WorldWideScience

Sample records for specific g-quadruplex structure

  1. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  2. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  3. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  4. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  5. Studies of G-quadruplex DNA structures at the single molecule level

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  6. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  8. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  9. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  11. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  12. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  13. DNA secondary structures: stability and function of G-quadruplex structures

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  14. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  15. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  16. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  18. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  19. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  2. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  4. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  6. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  7. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  8. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  9. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  10. Macrocyclic G-quadruplex ligands

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  11. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  12. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  13. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  14. Seven essential questions on G-quadruplexes.

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  15. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  16. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  17. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  18. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  19. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  20. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  1. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  2. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  3. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  4. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  5. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  6. Guanine base stacking in G-quadruplex nucleic acids

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  7. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  8. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Effect of Urea on G-Quadruplex Stability.

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  10. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  11. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  12. Local epigenetic reprogramming induced by G-quadruplex ligands

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  13. Multimerization rules for G-quadruplexes

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  14. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  15. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  16. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  17. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  19. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  20. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  1. Selectivity in ligand recognition of G-quadruplex loops.

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  2. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  3. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Simultaneous G-Quadruplex DNA Logic.

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  7. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  8. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  9. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  11. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  15. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  16. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  17. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  18. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  20. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  1. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  2. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  3. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  4. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  5. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  6. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  7. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  8. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  9. G-Quadruplexes influence pri-microRNA processing.

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  10. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  11. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  12. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  13. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  14. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  15. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  18. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  19. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  20. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  1. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  2. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  3. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  4. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  5. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  6. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  8. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  9. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  10. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  11. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  12. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  15. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  16. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  17. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  1. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  2. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  3. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  4. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  5. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  6. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  7. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  8. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  9. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  11. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  12. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  13. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  14. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  16. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  17. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  18. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  19. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  20. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  1. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  2. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  3. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  4. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  5. p53 binds human telomeric G-quadruplex in vitro

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  6. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  8. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  12. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  15. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  17. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  18. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  19. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  20. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  1. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  2. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  3. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  4. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  5. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  6. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  7. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  8. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  9. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  10. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  11. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  12. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  13. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  14. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  17. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  18. G-quadruplex recognition activities of E. Coli MutS

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  19. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  20. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  1. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  2. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  3. Long-range charge transport in single G-quadruplex DNA molecules

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  4. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  5. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  6. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. RPA prevents G-rich structure formation at lagging-strand telomeres to allow maintenance of chromosome ends.

    Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane

    2015-07-14

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.

  8. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  9. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  10. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  11. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  14. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...

  15. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  16. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  17. C9orf72 nucleotide repeat structures initiate molecular cascades of disease.

    Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou

    2014-03-13

    A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.

  18. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  19. Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

    Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

    2014-09-05

    The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Structural revisions of small molecules reported to cross-link G-quadruplex DNA in vivo reveal a repetitive assignment error in the literature

    Reyes Gutierrez, Paul Eduardo; Kapal, Tomáš; Klepetářová, Blanka; Šaman, David; Pohl, Radek; Zawada, Zbigniew; Kužmová, Erika; Hájek, Miroslav; Teplý, Filip

    2016-01-01

    Roč. 6, Mar 23 (2016), č. článku 23499. ISSN 2045-2322 R&D Projects: GA ČR GA13-19213S; GA MŠk LO1302 Grant - others:AV ČR(CZ) M200551208 Institutional support: RVO:61388963 Keywords : 1,2-disubstituted benzimidazoles * chemical synthesis * promoter region Subject RIV: CC - Organic Chemistry Impact factor: 4.259, year: 2016 http://www.nature.com/articles/srep23499

  1. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-01-01

    Roč. 12, č. 4 (2016), s. 2000-2016 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * quantum-chemical computations * continuum solvation models Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  2. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  3. [Structure and evolution of the eukaryotic FANCJ-like proteins].

    Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi

    2015-02-01

    The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.

  4. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  5. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  6. Transposable elements and G-quadruplexes

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  7. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  8. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  9. Structure of a Stable G-Hairpin

    Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

    2017-01-01

    Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

  10. Structural similarity and category-specificity

    Gerlach, Christian; Law, Ian; Paulson, Olaf B

    2004-01-01

    It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...

  11. Specificity of Structural Assessment of Knowledge

    Trumpower, David L.; Sharara, Harold; Goldsmith, Timothy E.

    2010-01-01

    This study examines the specificity of information provided by structural assessment of knowledge (SAK). SAK is a technique which uses the Pathfinder scaling algorithm to transform ratings of concept relatedness into network representations (PFnets) of individuals' knowledge. Inferences about individuals' overall domain knowledge based on the…

  12. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  13. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

    2015-01-01

    Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  14. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  15. Specific "scientific" data structures, and their processing

    Jerzy Karczmarczuk

    2011-09-01

    Full Text Available Programming physicists use, as all programmers, arrays, lists, tuples, records, etc., and this requires some change in their thought patterns while converting their formulae into some code, since the "data structures" operated upon, while elaborating some theory and its consequences, are rather: power series and Padé approximants, differential forms and other instances of differential algebras, functionals (for the variational calculus, trajectories (solutions of differential equations, Young diagrams and Feynman graphs, etc. Such data is often used in a [semi-]numerical setting, not necessarily "symbolic", appropriate for the computer algebra packages. Modules adapted to such data may be "just libraries", but often they become specific, embedded sub-languages, typically mapped into object-oriented frameworks, with overloaded mathematical operations. Here we present a functional approach to this philosophy. We show how the usage of Haskell datatypes and - fundamental for our tutorial - the application of lazy evaluation makes it possible to operate upon such data (in particular: the "infinite" sequences in a natural and comfortable manner.

  16. [Production, specificity and structure of immunoglobulins].

    Goujard, C; Delfraissy, J F

    1991-03-21

    Immunoglobulin is a key factor of the immune response resulting from B-cell activation and associated with T-cell stimulation. Because of its structure, this antibody has a dual function: it specifically recognizes the inducer antigen in the variable region and eliminates it by a constant portion which is responsible for effector properties. Surface immunoglobulin, therefore, is the B-cell antigen receptor; it differs from the T-cell receptor in that it recognizes the antigen unbound to the major istocompatibility complex; binding the antigen results in direct signal transduction first in the cytoplasm, then in the nucleus. This receptor can be secreted in the body: it is made up of circulating immunoglobulins. Human immunoglobulins are divided into 5 classes, each of them with its own response kinetics, distribution and functions. The variability of the antibody response accounts for a genetic organization involving numerous genes which may be associated with each other, or mutate, or recombine during maturation of the lymphocytes. Altogether, this system has a theoretical capacity of response to three hundred million different antigens.

  17. Structuring Formal Requirements Specifications for Reuse and Product Families

    Heimdahl, Mats P. E.

    2001-01-01

    In this project we have investigated how formal specifications should be structured to allow for requirements reuse, product family engineering, and ease of requirements change, The contributions of this work include (1) a requirements specification methodology specifically targeted for critical avionics applications, (2) guidelines for how to structure state-based specifications to facilitate ease of change and reuse, and (3) examples from the avionics domain demonstrating the proposed approach.

  18. Crystal Structure and Substrate Specificity of PTPN12

    Hui Li

    2016-05-01

    Full Text Available PTPN12 is an important tumor suppressor that plays critical roles in various physiological processes. However, the molecular basis underlying the substrate specificity of PTPN12 remains uncertain. Here, enzymological and crystallographic studies have enabled us to identify two distinct structural features that are crucial determinants of PTPN12 substrate specificity: the pY+1 site binding pocket and specific basic charged residues along its surface loops. Key structurally plastic regions and specific residues in PTPN12 enabled recognition of different HER2 phosphorylation sites and regulated specific PTPN12 functions. In addition, the structure of PTPN12 revealed a CDK2 phosphorylation site in a specific PTPN12 loop. Taken together, our results not only provide the working mechanisms of PTPN12 for desphosphorylation of its substrates but will also help in designing specific inhibitors of PTPN12.

  19. Far-red fluorescent probes for canonical and non-canonical nucleic acid structures: current progress and future implications.

    Suseela, Y V; Narayanaswamy, Nagarjun; Pratihar, Sumon; Govindaraju, Thimmaiah

    2018-02-05

    The structural diversity and functional relevance of nucleic acids (NAs), mainly deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are indispensable for almost all living organisms, with minute aberrations in their structure and function becoming causative factors in numerous human diseases. The standard structures of NAs, termed canonical structures, are supported by Watson-Crick hydrogen bonding. Under special physiological conditions, NAs adopt distinct spatial organisations, giving rise to non-canonical conformations supported by hydrogen bonding other than the Watson-Crick type; such non-canonical structures have a definite function in controlling gene expression and are considered as novel diagnostic and therapeutic targets. Development of molecular probes for these canonical and non-canonical DNA/RNA structures has been an active field of research. Among the numerous probes studied, probes with turn-on fluorescence in the far-red (600-750 nm) region are highly sought-after due to minimal autofluorescence and cellular damage. Far-red fluorescent probes are vital for real-time imaging of NAs in live cells as they provide good resolution and minimal perturbation of the cell under investigation. In this review, we present recent advances in the area of far-red fluorescent probes of DNA/RNA and non-canonical G-quadruplex structures. For the sake of continuity and completeness, we provide a brief overview of visible fluorescent probes. Utmost importance is given to design criteria, characteristic properties and biological applications, including in cellulo imaging, apart from critical discussion on limitations of the far-red fluorescent probes. Finally, we offer current and future prospects in targeting canonical and non-canonical NAs specific to cellular organelles, through sequence- and conformation-specific far-red fluorescent probes. We also cover their implications in chemical and molecular biology, with particular focus on decoding various disease

  20. Specific-structured lipids: nutritional perspectives and production potentials

    Xu, Xuebing; Høy, Carl-Erik; Balchen, Steen

    1997-01-01

    Structured lipids are referring to any triacylglycerols containing both long chain fatty acids (mostly essential fatty acids) and medium or short chain fatty acids. In case of specific-structured lipids (SSLs), each group of fatty acids locates specifically at sn-2 or -1.3 positions of the glycerol...... backbone. Recently the nutritional perspectives of this kind of lipids attract many interests. This causes an increasing interest in the production of them by lipase-catalyzed interesterification. One of the advantages of lipase method over chemical ones is that SSLs can be produced with particular fatty...

  1. Structural basis for substrate specificities of cellular deoxyribonucleoside kinases

    Johansson, K.; Ramaswamy, S.; Ljungcrantz, C.

    2001-01-01

    Deoxyribonucleoside kinases phosphorylate deoxyribonucleosides and activate a number of medically important nucleoside analogs. Here we report the structure of the Drosophila deoxyribonucleoside kinase with deoxycytidine bound at the nucleoside binding site and that of the human deoxyguanosine ki......; this is apparently due to the presence of Arg 118, which provides favorable hydrogen bonding interactions with the substrate. The two new structures provide an explanation for the substrate specificity of cellular deoxyribonucleoside kinases....

  2. Structural Determinants of Specific Lipid Binding to Potassium Channels

    Weingarth, M.H.|info:eu-repo/dai/nl/330985655; Prokofyev, A.; van der Cruijsen, E.A.W.|info:eu-repo/dai/nl/330826743; Nand, D.|info:eu-repo/dai/nl/337731403; Bonvin, A.M.J.J.|info:eu-repo/dai/nl/113691238; Pongs, O.; Baldus, M.|info:eu-repo/dai/nl/314410864

    2013-01-01

    We have investigated specific lipid binding to the pore domain of potassium channels KcsA and chimeric KcsAKv1.3 on the structural and functional level using extensive coarse-grained and atomistic molecular dynamics simulations, solid-state NMR, and single channel measurements. We show that, while

  3. Perceptual learning is specific to the trained structure of information.

    Cohen, Yamit; Daikhin, Luba; Ahissar, Merav

    2013-12-01

    What do we learn when we practice a simple perceptual task? Many studies have suggested that we learn to refine or better select the sensory representations of the task-relevant dimension. Here we show that learning is specific to the trained structural regularities. Specifically, when this structure is modified after training with a fixed temporal structure, performance regresses to pretraining levels, even when the trained stimuli and task are retained. This specificity raises key questions as to the importance of low-level sensory modifications in the learning process. We trained two groups of participants on a two-tone frequency discrimination task for several days. In one group, a fixed reference tone was consistently presented in the first interval (the second tone was higher or lower), and in the other group the same reference tone was consistently presented in the second interval. When following training, these temporal protocols were switched between groups, performance of both groups regressed to pretraining levels, and further training was needed to attain postlearning performance. ERP measures, taken before and after training, indicated that participants implicitly learned the temporal regularity of the protocol and formed an attentional template that matched the trained structure of information. These results are consistent with Reverse Hierarchy Theory, which posits that even the learning of simple perceptual tasks progresses in a top-down manner, hence can benefit from temporal regularities at the trial level, albeit at the potential cost that learning may be specific to these regularities.

  4. STRUCTURAL AND DESIGN SPECIFICS OF SPACE GRID SYSTEMS

    G. M. Gasii

    2017-01-01

    Full Text Available The aim of the study is to identify main trends in the development of space grid structures. In order to reach the purpose it is necessary to conduct a review of the known structural concepts, nodal connections and specifics of the space grid structures and to make conclusions on feasibility improvement of the considered structural concepts that make it possible to develop new solutions without disadvantages residing in the analogues. Analysis of papers written by foreign and national scientists and devoted to theoretical, numerical and experimental studies of stress-strain state, influence of different factors on it and geometrical optimization and designing of space grid structures has been conducted in order to achieve the objectives. Space grid structures and, in particular, flat double-layer grid and most frequent nodes have been studied in the paper. The paper contains a short review of the history on development of space grid structures. It has been found that a rapid development of structural designs was caused by scientific and technical progress and, in particular, improvement of physical and mechanical properties of materials, development of calculation methods, application of software systems for simulating behavior of the structure under load, which significantly increased the calculation accuracy and reduced complexity of design. It has been also established that main parameters that have influence on effectiveness of a structural design are geometric dimensions of its modular elements, ratio of its depth to the span. The world experience on development of connection components has been studied in the paper. The paper presents general classification of nodal connections. Main advantages and disadvantages of existing space grid structures are highlighted and it allows to determine possible methods for their improvement. Theoretical research has permitted to establish that the main direction of spatial grid structures improvement

  5. Phenotype- and genotype-specific structural alterations in spasmodic dysphonia.

    Bianchi, Serena; Battistella, Giovanni; Huddleston, Hailey; Scharf, Rebecca; Fleysher, Lazar; Rumbach, Anna F; Frucht, Steven J; Blitzer, Andrew; Ozelius, Laurie J; Simonyan, Kristina

    2017-04-01

    Spasmodic dysphonia is a focal dystonia characterized by involuntary spasms in the laryngeal muscles that occur selectively during speaking. Although hereditary trends have been reported in up to 16% of patients, the causative etiology of spasmodic dysphonia is unclear, and the influences of various phenotypes and genotypes on disorder pathophysiology are poorly understood. In this study, we examined structural alterations in cortical gray matter and white matter integrity in relationship to different phenotypes and putative genotypes of spasmodic dysphonia to elucidate the structural component of its complex pathophysiology. Eighty-nine patients with spasmodic dysphonia underwent high-resolution magnetic resonance imaging and diffusion-weighted imaging to examine cortical thickness and white matter fractional anisotropy in adductor versus abductor forms (distinct phenotypes) and in sporadic versus familial cases (distinct genotypes). Phenotype-specific abnormalities were localized in the left sensorimotor cortex and angular gyrus and the white matter bundle of the right superior corona radiata. Genotype-specific alterations were found in the left superior temporal gyrus, supplementary motor area, and the arcuate portion of the left superior longitudinal fasciculus. Our findings suggest that phenotypic differences in spasmodic dysphonia arise at the level of the primary and associative areas of motor control, whereas genotype-related pathophysiological mechanisms may be associated with dysfunction of regions regulating phonological and sensory processing. Identification of structural alterations specific to disorder phenotype and putative genotype provides an important step toward future delineation of imaging markers and potential targets for novel therapeutic interventions for spasmodic dysphonia. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  6. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  7. Mushroom Lectins: Specificity, Structure and Bioactivity Relevant to Human Disease

    Mohamed Ali Abol Hassan

    2015-04-01

    Full Text Available Lectins are non-immunoglobulin proteins that bind diverse sugar structures with a high degree of selectivity. Lectins play crucial role in various biological processes such as cellular signaling, scavenging of glycoproteins from the circulatory system, cell–cell interactions in the immune system, differentiation and protein targeting to cellular compartments, as well as in host defence mechanisms, inflammation, and cancer. Among all the sources of lectins, plants have been most extensively studied. However, more recently fungal lectins have attracted considerable attention due to their antitumor, antiproliferative and immunomodulatory activities. Given that only 10% of mushroom species are known and have been taxonomically classified, mushrooms represent an enormous unexplored source of potentially useful and novel lectins. In this review we provide an up-to-date summary on the biochemical, molecular and structural properties of mushroom lectins, as well as their versatile applications specifically focusing on mushroom lectin bioactivity.

  8. Potential-specific structure at the hematite-electrolyte interface

    McBriarty, Martin E.; Stubbs, Joanne; Eng, Peter; Rosso, Kevin M.

    2018-02-21

    The atomic-scale structure of interfaces between metal oxides and aqueous electrolytes controls their catalytic, geochemical, and corrosion behavior. Measurements that probe these interfaces in situ provide important details of ion and solvent arrangements, but atomically precise structural models do not exist for common oxide-electrolyte interfaces far from equilibrium. Using a novel cell, we measured the structure of the hematite (a-Fe2O3) (110$\\bar{2}$)-electrolyte interface under controlled electrochemical bias using synchrotron crystal truncation rod X ray scattering. At increasingly cathodic potentials, charge-compensating protonation of surface oxygen groups increases the coverage of specifically bound water while adjacent water layers displace outwardly and became disordered. Returning to open circuit potential leaves the surface in a persistent metastable protonation state. The flux of current and ions at applied potential is thus regulated by a unique interfacial electrolyte environment, suggesting that electrical double layer models should be adapted to the dynamically changing interfacial structure far from equilibrium.

  9. Combinatorial design of a nanobody that specifically targets structured RNAs.

    Cawez, F; Duray, E; Hu, Y; Vandenameele, J; Romão, E; Vincke, C; Dumoulin, M; Galleni, M; Muyldermans, S; Vandevenne, M

    2018-04-11

    Recent advances in transcriptome sequencing and analysis have revealed the complexity of the human genome. The majority (≈ 98%) of cellular transcripts is not translated into proteins and represents a vast, unchartered world of functional non-coding RNAs (ncRNAs). Most of them adopt a well-defined 3D structure to achieve their biological functions. However, only very few RNA structures are currently available which reflects the challenges associated with RNA crystallization. Nevertheless, these structures would represent a critical step in understanding functions of ncRNAs and their molecular mechanisms in the cell. The overall goal of this study is to develop an innovative and versatile tool to facilitate the functional study and crystallization of structured RNAs (stRNAs). In this work, we have engineered an antibody fragment from camelid heavy-chain antibody (nanobody) able to specifically bind with low nanomolar affinity to stRNA while no binding could be detected for single-stranded DNA/RNA, double-stranded DNA/RNA or a negatively charged protein. However, this nanobody recognizes different and non-related stRNAs, this observation suggests that it binds to an epitope shared by these stRNAs. Finally, our data also show that the binding of the nanobody doesn't alter the secondary structure content of the stRNA as well as its unfolding/refolding processes during heat treatment. This work constitutes a successful proof-of-concept demonstrating that nanobodies can be engineered to recognize RNA-related epitopes. Copyright © 2018. Published by Elsevier Ltd.

  10. Exposure to Hycanthone alters chromatin structure around specific gene functions and specific repeats in Schistosoma mansoni

    David eRoquis

    2014-07-01

    Full Text Available Schistosoma mansoni is a parasitic plathyhelminth responsible for intestinal schistosomiasis (or bilharziasis, a disease affecting 67 million people worldwide and causing an important economic burden. The schistosomicides hycanthone, and its later proxy oxamniquine, were widely used for treatments in endemic areas during the 20th century. Recently, the mechanism of action, as well as the genetic origin of a stably and Mendelian inherited resistance for both drugs was elucidated in two strains. However, several observations suggested early on that alternative mechanisms might exist, by which resistance could be induced for these two drugs in sensitive lines of schistosomes. This induced resistance appeared rapidly, within the first generation, but was metastable (not stably inherited. Epigenetic inheritance could explain such a phenomenon and we therefore re-analyzed the historical data with our current knowledge of epigenetics. In addition, we performed new experiments such as ChIP-seq on hycanthone treated worms. We found distinct chromatin structure changes between sensitive worms and induced resistant worms from the same strain. No specific pathway was discovered, but genes in which chromatin structure modification were observed are mostly associated with transport and catabolism, which makes sense in the context of the elimination of the drug. Specific differences were observed in the repetitive compartment of the genome. We finally describe what types of experiments are needed to understand the complexity of heritability that can be based on genetic and/or epigenetic mechanisms for drug resistance in schistosomes.

  11. Play in two societies: pervasiveness of process, specificity of structure.

    Bornstein, M H; Haynes, O M; Pascual, L; Painter, K M; Galperín, C

    1999-01-01

    The present study compared Argentine (N = 39) and U.S. (N = 43) children and their mothers on exploratory, symbolic, and social play and interaction when children were 20 months of age. Patterns of cultural similarity and difference emerged. In both cultures, boys engaged in more exploratory play than girls, and girls engaged in more symbolic play than boys; mothers of boys engaged in more exploratory play than mothers of girls, and mothers of girls engaged in more symbolic play than mothers of boys. Moreover, in both cultures, individual variation in children's exploratory and symbolic play was specifically associated with individual variation in mothers' exploratory and symbolic play, respectively. Between cultures, U.S. children and their mothers engaged in more exploratory play, whereas Argentine children and their mothers engaged in more symbolic play. Moreover, Argentine mothers exceeded U.S. mothers in social play and verbal praise of their children. During an early period of mental and social growth, general developmental processes in play may be pervasive, but dyadic and cultural structures are apparently specific. Overall, Argentine and U.S. dyads utilized different modes of exploration, representation, and interaction--emphasizing "other-directed" acts of pretense versus "functional" and "combinatorial" exploration, for example--and these individual and dyadic allocentric versus idiocentric stresses accord with larger cultural concerns of collectivism versus individualism in the two societies.

  12. On the specification of structural equation models for ecological systems

    Grace, J.B.; Michael, Anderson T.; Han, O.; Scheiner, S.M.

    2010-01-01

    The use of structural equation modeling (SEM) is often motivated by its utility for investigating complex networks of relationships, but also because of its promise as a means of representing theoretical concepts using latent variables. In this paper, we discuss characteristics of ecological theory and some of the challenges for proper specification of theoretical ideas in structural equation models (SE models). In our presentation, we describe some of the requirements for classical latent variable models in which observed variables (indicators) are interpreted as the effects of underlying causes. We also describe alternative model specifications in which indicators are interpreted as having causal influences on the theoretical concepts. We suggest that this latter nonclassical specification (which involves another variable type-the composite) will often be appropriate for ecological studies because of the multifaceted nature of our theoretical concepts. In this paper, we employ the use of meta-models to aid the translation of theory into SE models and also to facilitate our ability to relate results back to our theories. We demonstrate our approach by showing how a synthetic theory of grassland biodiversity can be evaluated using SEM and data from a coastal grassland. In this example, the theory focuses on the responses of species richness to abiotic stress and disturbance, both directly and through intervening effects on community biomass. Models examined include both those based on classical forms (where each concept is represented using a single latent variable) and also ones in which the concepts are recognized to be multifaceted and modeled as such. To address the challenge of matching SE models with the conceptual level of our theory, two approaches are illustrated, compositing and aggregation. Both approaches are shown to have merits, with the former being preferable for cases where the multiple facets of a concept have widely differing effects in the

  13. Guide Structures in CD-ROM Dictionaries, with Specific Reference ...

    Since the appearance of that article, various academics have written articles and read ... The access and mediostructures of the Microsoft Encarta World English ... structures, inner access structure, inner search path, internet, mediostructure, ...

  14. Production of specific-structured lipids by enzymatic interesterification in a pilot continuous enzyme bed reactor

    Xu, Xuebing; Balchen, Steen; Høy, Carl-Erik

    1998-01-01

    Production of specific-structured lipids (interesterified lipids with a specific structure) by enzymatic interesterification was carried out in a continuous enzyme bed pilot scale reactor. Commercial immobilized lipase (Lipozyme IM) was used and investigations of acyl migration, pressure drop...

  15. Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection.

    Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang

    2011-01-28

    In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).

  16. Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

    Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

    2011-01-01

    Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

  17. SPECIFIC PROFESSIONAL COMMUNICATION IN THE STRUCTURE OF THE PROFESSIONAL EDUCATOR

    Olga Abramova

    2012-01-01

    Full Text Available The article deals with the specific characteristics of professional communication teachers in the course of his career. Characterized by the basic communication skillsfor professional communication teachers, distinguished social and psychological characteristics of professional educator.

  18. On the specification of structural equation models for ecological systems

    Grace, James B.; Anderson, T. Michael; Olff, Han; Scheiner, Samuel M.

    The use of structural equation modeling (SEM) is often motivated by its utility for investigating complex networks of relationships, but also because of its promise as a means of representing theoretical Concepts using latent variables. In this paper, we discuss characteristics of ecological theory

  19. Imaging specific cellular glycan structures using glycosyltransferases via click chemistry.

    Wu, Zhengliang L; Person, Anthony D; Anderson, Matthew; Burroughs, Barbara; Tatge, Timothy; Khatri, Kshitij; Zou, Yonglong; Wang, Lianchun; Geders, Todd; Zaia, Joseph; Sackstein, Robert

    2018-02-01

    Heparan sulfate (HS) is a polysaccharide fundamentally important for biologically activities. T/Tn antigens are universal carbohydrate cancer markers. Here, we report the specific imaging of these carbohydrates using a mesenchymal stem cell line and human umbilical vein endothelial cells (HUVEC). The staining specificities were demonstrated by comparing imaging of different glycans and validated by either removal of target glycans, which results in loss of signal, or installation of target glycans, which results in gain of signal. As controls, representative key glycans including O-GlcNAc, lactosaminyl glycans and hyaluronan were also imaged. HS staining revealed novel architectural features of the extracellular matrix (ECM) of HUVEC cells. Results from T/Tn antigen staining suggest that O-GalNAcylation is a rate-limiting step for O-glycan synthesis. Overall, these highly specific approaches for HS and T/Tn antigen imaging should greatly facilitate the detection and functional characterization of these biologically important glycans. © The Author(s) 2017. Published by Oxford University Press.

  20. Actinide-specific complexing agents: their structural and solution chemistry

    Raymond, K.N.; Freeman, G.E.; Kappel, M.J.

    1983-07-01

    The synthesis of a series of tetracatecholate ligands designed to be specific for Pu(IV) and other actinide(IV) ions has been achieved. Although these compounds are very effective as in vivo plutonium removal agents, potentiometric and voltammetric data indicate that at neutral pH full complexation of the Pu(IV) ion by all four catecholate groups does not occur. Spectroscopic results indicate that the tetracatecholates, 3,4,3-LICAMS and 3,4,3-LICAMC, complex Am(III). The Am(IV)/(III)-catecholate couple (where catecholate = 3,4,3-LICAMS or 3,4,3-LICAMC) is not observed, but may not be observable due to the large currents associated with ligand oxidation. However, within the potential range where ligand oxidation does not occur, these experiments indicate that the reduction potential of free Am(IV)/(III) is probably greater than or equal to + 2.6 V vs NHE or higher. Proof of the complexation of americium in the trivalent oxidation state by 3,4,3-LICAMS and 3,4,3-LICAMC elimates the possibility of tetracatholates stabilizing Am(IV) in vivo

  1. The Okhansk Meteorite: Specifics of Composition, Structure, and Genesis

    A.I. Bakhtin

    2016-12-01

    Full Text Available The Okhansk meteorite fell on August 18, 1887 near the village of Tabor, about 15 km away from the town of Okhansk in Perm province and weighed 186.5 kg (the total weight of collected fragments, according to P.I. Krotov, was more than 245 kg. The shock wave from the meteorite entry knocked down animals and riders on horses. Despite the fact that it was significantly stronger than that caused by the Chelyabinsk meteorite of 2013, all information about this meteorite has completely erased from people's memory. It has been shown that the meteorite is an ordinary olivine-bronzite chondrite. Its main silicate minerals are olivine, bronzite, plagioclase, and diopside. The main ore minerals are kamacite and troilite. The meteorite contains silicate glass in large amounts. The analysis of the composition and structure of the Okhansk meteorite has demonstrated that it was formed at the early stages of accretion of the melted substance of the protosolar nebula without undergoing endogenous, temperature, or pressure changes.

  2. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  3. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  4. Selecting highly structure-specific antibodies using structured synthetic mimics of the cystine knot protein sclerostin

    Back, J.W.; Frisch, C.; Van Pee, K.; Boschert, V.; van Vught, R.; Puijk, W.; Mueller, T. D.; Knappik, A.; Timmerman, P.

    2012-01-01

    Antibodies directed against specific regions of a protein have traditionally been raised against full proteins, protein domains or simple unstructured peptides, containing contiguous stretches of primary sequence. We have used a new approach of selecting antibodies against restrained peptides

  5. Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands

    Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav

    2014-01-01

    Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry

  6. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  7. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.

    2016-01-01

    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  8. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  9. Wild-type p53 binds to MYC promoter G-quadruplex

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  10. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  11. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  12. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  13. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  14. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  15. Bloom’s syndrome protein unfolding G-quadruplexes in two pathways

    Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying

    2017-08-01

    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).

  16. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

    2017-11-29

    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  17. Does Gender-Specific Differential Item Functioning Affect the Structure in Vocational Interest Inventories?

    Beinicke, Andrea; Pässler, Katja; Hell, Benedikt

    2014-01-01

    The study investigates consequences of eliminating items showing gender-specific differential item functioning (DIF) on the psychometric structure of a standard RIASEC interest inventory. Holland's hexagonal model was tested for structural invariance using a confirmatory methodological approach (confirmatory factor analysis and randomization…

  18. Site-specific electronic structure analysis by channeling EELS and first-principles calculations.

    Tatsumi, Kazuyoshi; Muto, Shunsuke; Yamamoto, Yu; Ikeno, Hirokazu; Yoshioka, Satoru; Tanaka, Isao

    2006-01-01

    Site-specific electronic structures were investigated by electron energy loss spectroscopy (EELS) under electron channeling conditions. The Al-K and Mn-L(2,3) electron energy loss near-edge structure (ELNES) of, respectively, NiAl2O4 and Mn3O4 were measured. Deconvolution of the raw spectra with the instrumental resolution function restored the blunt and hidden fine features, which allowed us to interpret the experimental spectral features by comparing with theoretical spectra obtained by first-principles calculations. The present method successfully revealed the electronic structures specific to the differently coordinated cationic sites.

  19. Purification of specific structured lipids by distillation: Effects on acyl migration

    Xu, Xuebing; Skands, A.; Adler-Nissen, Jens

    2001-01-01

    The cause and effects of acyl migration during the purification of specific structured lipids by distillation were studied in a conventional batch deodorizer with stripping steam. The mixture of specific structured lipids produced by lipase-catalyzed acidolysis between rapeseed oil and capric acid...... influenced the rate of acyl migration, and their combinations made the effect more severe. However, diacylglycerols were found to be the main reason for acyl migration. In the distillation of the specific structured lipid product mixture, distillation temperature and time were the main factors to determine...... the degree of acyl migration and the extent of separation of free fatty acids. The results indicate that more efficient separation technology should be used to improve the quality of the purified structured lipids. in order to reduce the distillation temperature, vacuum should be made as low as possible...

  20. Medicinal Chemistry Projects Requiring Imaginative Structure-Based Drug Design Methods.

    Moitessier, Nicolas; Pottel, Joshua; Therrien, Eric; Englebienne, Pablo; Liu, Zhaomin; Tomberg, Anna; Corbeil, Christopher R

    2016-09-20

    cytochrome P450 enzymes (CYPs)-for toxicology studies-the program Impacts was derived from Fitted and helped us to reveal a complex metabolism with unforeseen stereocenter isomerizations. These efforts, combined with those of other docking software developers, have strengthened our understanding of the complex drug-protein binding process while providing the medicinal chemistry community with useful tools that have led to drug discoveries. In this Account, we describe our contributions over the past 15 years-within their historical context-to the design of drug candidates, including BACE-1 inhibitors, POP covalent inhibitors, G-quadruplex binders, and aminoglycosides binding to nucleic acids. We also remark the necessary developments of docking programs, specifically Fitted, that enabled structure-based design to flourish and yielded multiple fruitful, rational medicinal chemistry campaigns.

  1. Structural studies of Pseudomonas and Chromobacterium ω-aminotransferases provide insights into their differing substrate specificity

    Sayer, Christopher; Isupov, Michail N.; Westlake, Aaron; Littlechild, Jennifer A.

    2013-01-01

    The X-ray structures of two ω-aminotransferases from P. aeruginosa and C. violaceum in complex with an inhibitor offer the first detailed insight into the structural basis of the substrate specificity of these industrially important enzymes. The crystal structures and inhibitor complexes of two industrially important ω-aminotransferase enzymes from Pseudomonas aeruginosa and Chromobacterium violaceum have been determined in order to understand the differences in their substrate specificity. The two enzymes share 30% sequence identity and use the same amino acceptor, pyruvate; however, the Pseudomonas enzyme shows activity towards the amino donor β-alanine, whilst the Chromobacterium enzyme does not. Both enzymes show activity towards S-α-methylbenzylamine (MBA), with the Chromobacterium enzyme having a broader substrate range. The crystal structure of the P. aeruginosa enzyme has been solved in the holo form and with the inhibitor gabaculine bound. The C. violaceum enzyme has been solved in the apo and holo forms and with gabaculine bound. The structures of the holo forms of both enzymes are quite similar. There is little conformational difference observed between the inhibitor complex and the holoenzyme for the P. aeruginosa aminotransferase. In comparison, the crystal structure of the C. violaceum gabaculine complex shows significant structural rearrangements from the structures of both the apo and holo forms of the enzyme. It appears that the different rigidity of the protein scaffold contributes to the substrate specificity observed for the two ω-aminotransferases

  2. Crystal structure of inulosucrase from Lactobacillus: insights into the substrate specificity and product specificity of GH68 fructansucrases.

    Pijning, Tjaard; Anwar, Munir A; Böger, Markus; Dobruchowska, Justyna M; Leemhuis, Hans; Kralj, Slavko; Dijkhuizen, Lubbert; Dijkstra, Bauke W

    2011-09-09

    Fructansucrases (FSs) catalyze a transfructosylation reaction with sucrose as substrate to produce fructo-oligosaccharides and fructan polymers that contain either β-2,1 glycosidic linkages (inulin) or β-2,6 linkages (levan). Levan-synthesizing FSs (levansucrases) have been most extensively investigated, while detailed information on inulosucrases is limited. Importantly, the molecular basis of the different product specificities of levansucrases and inulosucrases is poorly understood. We have elucidated the three-dimensional structure of a truncated active bacterial GH68 inulosucrase, InuJ of Lactobacillus johnsonii NCC533 (residues 145-708), in its apo form, with a bound substrate (sucrose), and with a transfructosylation product. The sucrose binding pocket and the sucrose binding mode are virtually identical with those of GH68 levansucrases, confirming that both enzyme types use the same fully conserved structural framework for the binding and cleavage of the donor substrate sucrose in the active site. The binding mode of the first transfructosylation product 1-kestose (Fru-β(2-1)-Fru-α(2-1)-Glc, where Fru=fructose and Glc=glucose) in subsites -1 to +2 shows for the first time how inulin-type fructo-oligosaccharide bind in GH68 FS and how an inulin-type linkage can be formed. Surprisingly, observed interactions with the sugar in subsites +1 and +2 are provided by residues that are also present in levansucrases. The binding mode of 1-kestose and the presence of a more distant sucrose binding site suggest that residues beyond the +2 subsite, in particular residues from the nonconserved 1B-1C loop, determine product linkage type specificity in GH68 FSs. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Structure-specific selection of earthquake ground motions for the reliable design and assessment of structures

    Katsanos, E. I.; Sextos, A. G.

    2018-01-01

    A decision support process is presented to accommodate selecting and scaling of earthquake motions as required for the time domain analysis of structures. Code-compatible suites of seismic motions are provided being, at the same time, prequalified through a multi-criterion approach to induce...... was subjected to numerous suites of motions that were highly ranked according to both the proposed approach (δsv–sc) and the conventional one (δconv), that is commonly used for earthquake records selection and scaling. The findings from numerous linear response history analyses reveal the superiority...

  4. Structural Basis for Specific Inhibition of tRNA Synthetase by an ATP Competitive Inhibitor.

    Fang, Pengfei; Han, Hongyan; Wang, Jing; Chen, Kaige; Chen, Xin; Guo, Min

    2015-06-18

    Pharmaceutical inhibitors of aminoacyl-tRNA synthetases demand high species and family specificity. The antimalarial ATP-mimetic cladosporin selectively inhibits Plasmodium falciparum LysRS (PfLysRS). How the binding to a universal ATP site achieves the specificity is unknown. Here we report three crystal structures of cladosporin with human LysRS, PfLysRS, and a Pf-like human LysRS mutant. In all three structures, cladosporin occupies the class defining ATP-binding pocket, replacing the adenosine portion of ATP. Three residues holding the methyltetrahydropyran moiety of cladosporin are critical for the specificity of cladosporin against LysRS over other class II tRNA synthetase families. The species-exclusive inhibition of PfLysRS is linked to a structural divergence beyond the active site that mounts a lysine-specific stabilizing response to binding cladosporin. These analyses reveal that inherent divergence of tRNA synthetase structural assembly may allow for highly specific inhibition even through the otherwise universal substrate binding pocket and highlight the potential for structure-driven drug development. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  6. Functional and structural analysis of yeast trx system reveals structural elements of substrate specificity

    Oliveira, Marcos Antonio; Discola, Karen Fulan; Alves, Simone Vidigal; Netto, Luis Eduardo Soares; Amorim, Gisele Cardoso; Pinheiro, Anderson Sa; Valente, Ana Paula; Almeida, Fabio Ceneviva Lacerda; Medrano, Francisco Javier; Guimaraes, Beatriz Gomes

    2006-01-01

    Thioredoxin reductases (Trr) are members of the nucleotide pyridine disulfide oxide reductase family, which includes glutathione reductase (Gr), alkyl hydroperoxide reductase F (AhpF) and lipoamide dehydrogenase (Lpd). Constituents of this family are homodimeric flavoproteins containing one redoxactive disulfide and one tightly bound flavin adenine dinucleotide (FAD) per subunit. Trr catalyzes the disulfide reduction of oxidized Thioredoxin (Trx) using nicotinamide adenine dinucleotide phosphate (NADPH) via a FAD molecule and a redox-active cysteine motif. In this context, FAD transfers the reducing equivalents from NADPH molecule to the reactive cysteines and then to the Trx. Trx, Trr and NADPH comprise the Trx system. Trx are low molecular weight proteins (∼12 KDa) which are involved in several thiol-dependent cellular reactions such as synthesis of deoxyribonucleotides, sulphur metabolism, regulation of the gene expression and oxidative stress defenses. Remarkably, Trr - Trx interactions presents high species and organelle specificities. (author)

  7. Porous silicon structures with high surface area/specific pore size

    Northrup, M.A.; Yu, C.M.; Raley, N.F.

    1999-03-16

    Fabrication and use of porous silicon structures to increase surface area of heated reaction chambers, electrophoresis devices, and thermopneumatic sensor-actuators, chemical preconcentrates, and filtering or control flow devices. In particular, such high surface area or specific pore size porous silicon structures will be useful in significantly augmenting the adsorption, vaporization, desorption, condensation and flow of liquids and gases in applications that use such processes on a miniature scale. Examples that will benefit from a high surface area, porous silicon structure include sample preconcentrators that are designed to adsorb and subsequently desorb specific chemical species from a sample background; chemical reaction chambers with enhanced surface reaction rates; and sensor-actuator chamber devices with increased pressure for thermopneumatic actuation of integrated membranes. Examples that benefit from specific pore sized porous silicon are chemical/biological filters and thermally-activated flow devices with active or adjacent surfaces such as electrodes or heaters. 9 figs.

  8. Structural Basis for Specific Inhibition of tRNA Synthetase by an ATP Competitive Inhibitor

    Fang, Pengfei; Han, Hongyan; Wang, Jing; Chen, Kaige; Chen, Xin; Guo, Min

    2015-01-01

    Pharmaceutical inhibitors of aminoacyl-tRNA synthetases demand high species and family specificity. The antimalarial ATP-mimetic cladosporin selectively inhibits P. falciparum LysRS (PfLysRS). How the binding to a universal ATP site achieves the specificity is unknown. Here we report 3 crystal structures of cladosporin with human LysRS, PfLysRS, and a Pf-like human LysRS mutant. In all 3 structures, cladosporin occupies the class defining ATP-binding pocket, replacing the adenosine portion of...

  9. Electronic Health Record in Occupational Medicine: Specific Aspects and Requirements of Data Structuring and Standardization

    Dorin TRIFF

    2009-07-01

    Full Text Available The service of occupational medicine of a specific economic agent, as integrated part of the System of Labor Health and Safety, requires efficient, well-organized information management through standardized and computerized data processing and exploitation. Legal requirements and practical aspects of information management in occupational medicine trigger necessary operational modifications in the Electronic Health File. The goal of the paper is to present basic requirements of structuring the electronic health file and the necessary standards in recording specific data.

  10. Technical Specifications of Structural Health Monitoring for Highway Bridges: New Chinese Structural Health Monitoring Code

    Fernando Moreu

    2018-03-01

    Full Text Available Governments and professional groups related to civil engineering write and publish standards and codes to protect the safety of critical infrastructure. In recent decades, countries have developed codes and standards for structural health monitoring (SHM. During this same period, rapid growth in the Chinese economy has led to massive development of civil engineering infrastructure design and construction projects. In 2016, the Ministry of Transportation of the People’s Republic of China published a new design code for SHM systems for large highway bridges. This document is the first technical SHM code by a national government that enforces sensor installation on highway bridges. This paper summarizes the existing international technical SHM codes for various countries and compares them with the new SHM code required by the Chinese Ministry of Transportation. This paper outlines the contents of the new Chinese SHM code and explains its relevance for the safety and management of large bridges in China, introducing key definitions of the Chinese–United States SHM vocabulary and their technical significance. Finally, this paper discusses the implications for the design and implementation of a future SHM codes, with suggestions for similar efforts in United States and other countries.

  11. Structural Characterization of the Hemagglutinin Receptor Specificity from the 2009 H1N1 Influenza Pandemic

    Xu, Rui; McBride, Ryan; Nycholat, Corwin M.; Paulson, James C.; Wilson, Ian A. (Scripps)

    2012-02-13

    Influenza virus hemagglutinin (HA) is the viral envelope protein that mediates viral attachment to host cells and elicits membrane fusion. The HA receptor-binding specificity is a key determinant for the host range and transmissibility of influenza viruses. In human pandemics of the 20th century, the HA normally has acquired specificity for human-like receptors before widespread infection. Crystal structures of the H1 HA from the 2009 human pandemic (A/California/04/2009 [CA04]) in complex with human and avian receptor analogs reveal conserved recognition of the terminal sialic acid of the glycan ligands. However, favorable interactions beyond the sialic acid are found only for {alpha}2-6-linked glycans and are mediated by Asp190 and Asp225, which hydrogen bond with Gal-2 and GlcNAc-3. For {alpha}2-3-linked glycan receptors, no specific interactions beyond the terminal sialic acid are observed. Our structural and glycan microarray analyses, in the context of other high-resolution HA structures with {alpha}2-6- and {alpha}2-3-linked glycans, now elucidate the structural basis of receptor-binding specificity for H1 HAs in human and avian viruses and provide a structural explanation for the preference for {alpha}2-6 siaylated glycan receptors for the 2009 pandemic swine flu virus.

  12. The structural basis of Arf effector specificity: the crystal structure of ARF6 in a complex with JIP4.

    Isabet, Tatiana; Montagnac, Guillaume; Regazzoni, Karine; Raynal, Bertrand; El Khadali, Fatima; England, Patrick; Franco, Michel; Chavrier, Philippe; Houdusse, Anne; Ménétrey, Julie

    2009-09-16

    The JNK-interacting proteins, JIP3 and JIP4, are specific effectors of the small GTP-binding protein ARF6. The interaction of ARF6-GTP with the second leucine zipper (LZII) domains of JIP3/JIP4 regulates the binding of JIPs to kinesin-1 and dynactin. Here, we report the crystal structure of ARF6-GTP bound to the JIP4-LZII at 1.9 A resolution. The complex is a heterotetramer with dyad symmetry arranged in an ARF6-(JIP4)(2)-ARF6 configuration. Comparison of the ARF6-JIP4 interface with the equivalent region of ARF1 shows the structural basis of JIP4's specificity for ARF6. Using site-directed mutagenesis and surface plasmon resonance, we further show that non-conserved residues at the switch region borders are the key structural determinants of JIP4 specificity. A structure-derived model of the association of the ARF6-JIP3/JIP4 complex with membranes shows that the JIP4-LZII coiled-coil should lie along the membrane to prevent steric hindrances, resulting in only one ARF6 molecule bound. Such a heterotrimeric complex gives insights to better understand the ARF6-mediated motor switch regulatory function.

  13. DAFS study of site-specific local structure of Mn in manganese ferrite films

    Kravtsov, E.; Haskel, D.; Cady, A.; Yang, A.; Vittoria, C.; Zuo, X.; Harris, V.G.

    2006-01-01

    Manganese ferrite (MnFe 2 O 4 ) is a well-known magnetic material widely used in electronics for many years. It is well established that its magnetic behavior is strongly influenced by local structural properties of Mn ions, which are distributed between crystallographically inequivalent tetrahedral and octahedral sites in the unit cell. In order to understand and be able to tune properties of these structures, it is necessary to have detailed site-specific structural information on the system. Here we report on the application of diffraction-anomalous fine structure (DAFS) spectroscopy to resolve site-specific Mn local structures in manganese ferrite films. The DAFS measurements were done at undulator beamline 4-ID-D of the Advanced Photon Source at Argonne National Laboratory. The DAFS spectra (Fig. 1) were measured at several Bragg reflections in the vicinity of the Mn absorption K-edge, having probed separately contributions from tetrahedrally and octahedrally coordinated Mn sites. The DAFS data analysis done with an iterative Kramers-Kroenig algorithm made it possible to solve separately the local structure around different inequivalent Mn sites in the unit cell. The reliability of the data treatment was checked carefully, and it was showed that the site-specific structural parameters obtained with DAFS allow us to describe fluorescence EXAFS spectrum measured independently. Fig. 2 shows individual site contributions to the imaginary part of the resonant scattering amplitude obtained from the treatment of the data of Fig. 1. The analysis of the refined site-specific absorption spectra was done using EXAFS methods based on theoretical standards. We provided direct evidence for the tetrahedral Mn-O bond distance being increased relative to the corresponding Fe-O distance in bulk manganese ferrites. The first coordination shell number was found to be reduced significantly for Mn atoms at these sites. This finding is consistent with the well-known tendency of Mn

  14. First applications of structural pattern recognition methods to the investigation of specific physical phenomena at JET

    Ratta, G.A.; Vega, J.; Pereira, A.; Portas, A.; Luna, E. de la; Dormido-Canto, S.; Farias, G.; Dormido, R.; Sanchez, J.; Duro, N.; Vargas, H.; Santos, M.; Pajares, G.; Murari, A.

    2008-01-01

    Structural pattern recognition techniques allow the identification of plasma behaviours. Physical properties are encoded in the morphological structure of signals. Intelligent access methods have been applied to JET databases to retrieve data according to physical criteria. On the one hand, the structural form of signals has been used to develop general purpose data retrieval systems to search for both similar entire waveforms and similar structural shapes inside waveforms. On the other hand, domain dependent knowledge was added to the structural information of signals to create particular data retrieval methods for specific physical phenomena. The inclusion of explicit knowledge assists in data analysis. The latter has been applied in JET to look for first, cut-offs in ECE heterodyne radiometer signals and, second, L-H transitions

  15. First applications of structural pattern recognition methods to the investigation of specific physical phenomena at JET

    Ratta, G.A. [Asociacion EURATOM/CIEMAT para Fusion (Spain)], E-mail: giuseppe.ratta@ciemat.es; Vega, J.; Pereira, A.; Portas, A.; Luna, E. de la [Asociacion EURATOM/CIEMAT para Fusion (Spain); Dormido-Canto, S.; Farias, G.; Dormido, R.; Sanchez, J.; Duro, N.; Vargas, H. [Dpto. Informatica y Automatica-UNED, 28040 Madrid (Spain); Santos, M.; Pajares, G. [Dpto. Arquitectura de Computadores y Automatica-UCM, 28040 Madrid (Spain); Murari, A. [Consorzio RFX-Associazione EURATOM ENEA per la Fusione, Padua (Italy)

    2008-04-15

    Structural pattern recognition techniques allow the identification of plasma behaviours. Physical properties are encoded in the morphological structure of signals. Intelligent access methods have been applied to JET databases to retrieve data according to physical criteria. On the one hand, the structural form of signals has been used to develop general purpose data retrieval systems to search for both similar entire waveforms and similar structural shapes inside waveforms. On the other hand, domain dependent knowledge was added to the structural information of signals to create particular data retrieval methods for specific physical phenomena. The inclusion of explicit knowledge assists in data analysis. The latter has been applied in JET to look for first, cut-offs in ECE heterodyne radiometer signals and, second, L-H transitions.

  16. Universal and Language-Specific Patterns in the Acquisition of Verb Argument Structures in German

    Leischner, Franziska N.; Weissenborn, Jürgen; Naigles, Letitia R.

    2016-01-01

    The study investigated the influence of universal and language-specific morpho-syntactic properties (i.e., flexible word order, case) on the acquisition of verb argument structures in German compared with English. To this end, 65 three- to nine-year-old German learning children and adults were asked to act out grammatical ("The sheep…

  17. Co-Localisation of Abnormal Brain Structure and Function in Specific Language Impairment

    Badcock, Nicholas A.; Bishop, Dorothy V. M.; Hardiman, Mervyn J.; Barry, Johanna G.; Watkins, Kate E.

    2012-01-01

    We assessed the relationship between brain structure and function in 10 individuals with specific language impairment (SLI), compared to six unaffected siblings, and 16 unrelated control participants with typical language. Voxel-based morphometry indicated that grey matter in the SLI group, relative to controls, was increased in the left inferior…

  18. Production of specific structured lipids by enzymatic interesterification: optimization of the reaction by response surface design

    Xu, Xuebing; Skands, Anja Rebecca Havegaard; Adler-Nissen, Jens

    1998-01-01

    Rapeseed oil and capric acid were interesterified in solvent-free media catalyzed by Lipozyme IM (Rhizomucor miehei) to produce specific-structured lipids (SSLs). The process was optimized by response surface design concerning the effects of acyl migration and the by-products of diacylglycerols...

  19. Sensing site-specific structural characteristics and chirality using vibrational circular dichroism of isotope labeled peptides.

    Keiderling, Timothy A

    2017-12-01

    Isotope labeling has a long history in chemistry as a tool for probing structure, offering enhanced sensitivity, or enabling site selection with a wide range of spectroscopic tools. Chirality sensitive methods such as electronic circular dichroism are global structural tools and have intrinsically low resolution. Consequently, they are generally insensitive to modifications to enhance site selectivity. The use of isotope labeling to modify vibrational spectra with unique resolvable frequency shifts can provide useful site-specific sensitivity, and these methods have been recently more widely expanded in biopolymer studies. While the spectral shifts resulting from changes in isotopic mass can provide resolution of modes from specific parts of the molecule and can allow detection of local change in structure with perturbation, these shifts alone do not directly indicate structure or chirality. With vibrational circular dichroism (VCD), the shifted bands and their resultant sign patterns can be used to indicate local conformations in labeled biopolymers, particularly if multiple labels are used and if their coupling is theoretically modeled. This mini-review discusses selected examples of the use of labeling specific amides in peptides to develop local structural insight with VCD spectra. © 2017 Wiley Periodicals, Inc.

  20. Graded territories: Towards the design, specification and simulation of materially graded bending active structures

    Nicholas, Paul; Tamke, Martin; Ramsgaard Thomsen, Mette

    2012-01-01

    these structures, the property of bending is activated and varied through bespoke material means so as to match a desired form. Within the architectural design process, formal control depends upon design approaches for material specification and simulation that consider behavior at the level of the material...... element as well as the structure. We describe an evolving approach to material specification and simulation, and highlight the digital and material considerations that frame the process.......The ability to make materials with bespoke behavior affords new perspectives on incorporating material properties within the design process not available through natural materials. This paper reports the design and assembly of two bending-active, fibre-reinforced composite structures. Within...

  1. Structural evolution and tissue-specific expression of tetrapod-specific second isoform of secretory pathway Ca2+-ATPase

    Pestov, Nikolay B.; Dmitriev, Ruslan I.; Kostina, Maria B.; Korneenko, Tatyana V.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.

    2012-01-01

    Highlights: ► Full-length secretory pathway Ca-ATPase (SPCA2) cloned from rat duodenum. ► ATP2C2 gene (encoding SPCA2) exists only in genomes of Tetrapoda. ► Rat and pig SPCA2 are expressed in intestines, lung and some secretory glands. ► Subcellular localization of SPCA2 may depend on tissue type. ► In rat duodenum, SPCA2 is localized in plasma membrane-associated compartments. -- Abstract: Secretory pathway Ca-ATPases are less characterized mammalian calcium pumps than plasma membrane Ca-ATPases and sarco-endoplasmic reticulum Ca-ATPases. Here we report analysis of molecular evolution, alternative splicing, tissue-specific expression and subcellular localization of the second isoform of the secretory pathway Ca-ATPase (SPCA2), the product of the ATP2C2 gene. The primary structure of SPCA2 from rat duodenum deduced from full-length transcript contains 944 amino acid residues, and exhibits 65% sequence identity with known SPCA1. The rat SPCA2 sequence is also highly homologous to putative human protein KIAA0703, however, the latter seems to have an aberrant N-terminus originating from intron 2. The tissue-specificity of SPCA2 expression is different from ubiquitous SPCA1. Rat SPCA2 transcripts were detected predominantly in gastrointestinal tract, lung, trachea, lactating mammary gland, skin and preputial gland. In the newborn pig, the expression profile is very similar with one remarkable exception: porcine bulbourethral gland gave the strongest signal. Upon overexpression in cultured cells, SPCA2 shows an intracellular distribution with remarkable enrichment in Golgi. However, in vivo SPCA2 may be localized in compartments that differ among various tissues: it is intracellular in epidermis, but enriched in plasma membranes of the intestinal epithelium. Analysis of SPCA2 sequences from various vertebrate species argue that ATP2C2 gene radiated from ATP2C1 (encoding SPCA1) during adaptation of tetrapod ancestors to terrestrial habitats.

  2. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  3. Polyaniline nanofibers with a high specific surface area and an improved pore structure for supercapacitors

    Xu, Hailing; Li, Xingwei; Wang, Gengchao

    2015-10-01

    Polyaniline (PANI) with a high specific surface area and an improved pore structure (HSSA-PANI) has been prepared by using a facile method, treating PANI nanofibers with chloroform (CHCl3), and its structure, morphology and pore structure are investigated. The specific surface area and pore volume of HSSA-PANI are 817.3 m2 g-1 and 0.6 cm3 g-1, and those of PANI are 33.6 m2 g-1 and 0.2 cm3 g-1. As electrode materials, a large specific surface area and pore volume can provide high electroactive regions, accelerate the diffusion of ions, and mitigate the electrochemical degradation of active materials. Compared with PANI, the capacity retention rate of HSSA-PANI is 90% with a growth of current density from 5.0 to 30 A g-1, and that of PANI is 29%. At a current density of 30 A g-1, the specific capacitance of HSSA-PANI still reaches 278.3 F g-1, and that of PANI is 86.7 F g-1. At a current density of 5.0 A g-1, the capacitance retention of HSSA-PANI is 53.1% after 2000 cycles, and that of PANI electrode is only 28.1%.

  4. Crystal Structure of a UDP-glucose-specific Glycosyltransferase from a Mycobacterium Species

    Fulton, Zara; McAlister, Adrian; Wilce, Matthew C.J.; Brammananth, Rajini; Zaker-Tabrizi, Leyla; Perugini, Matthew A.; Bottomley, Stephen P.; Coppel, Ross L.; Crellin, Paul K.; Rossjohn, Jamie; Beddoe, Travis (Monash); (Melbourne)

    2008-10-24

    Glycosyltransferases (GTs) are a large and ubiquitous family of enzymes that specifically transfer sugar moieties to a range of substrates. Mycobacterium tuberculosis contains a large number of GTs, many of which are implicated in cell wall synthesis, yet the majority of these GTs remain poorly characterized. Here, we report the high resolution crystal structures of an essential GT (MAP2569c) from Mycobacterium avium subsp. paratuberculosis (a close homologue of Rv1208 from M. tuberculosis) in its apo- and ligand-bound forms. The structure adopted the GT-A fold and possessed the characteristic DXD motif that coordinated an Mn{sup 2+} ion. Atypical of most GTs characterized to date, MAP2569c exhibited specificity toward the donor substrate, UDP-glucose. The structure of this ligated complex revealed an induced fit binding mechanism and provided a basis for this unique specificity. Collectively, the structural features suggested that MAP2569c may adopt a 'retaining' enzymatic mechanism, which has implications for the classification of other GTs in this large superfamily.

  5. Magnetic susceptibility, specific heat and magnetic structure of CuNi2(PO4)2

    Escobal, Jaione; Pizarro, Jose L.; Mesa, Jose L.; Larranaga, Aitor; Fernandez, Jesus Rodriguez; Arriortua, Maria I.; Rojo, Teofilo

    2006-01-01

    The CuNi 2 (PO 4 ) 2 phosphate has been synthesized by the ceramic method at 800 deg. C in air. The crystal structure consists of a three-dimensional skeleton constructed from MO 4 (M II =Cu and Ni) planar squares and M 2 O 8 dimers with square pyramidal geometry, which are interconnected by (PO 4 ) 3- oxoanions with tetrahedral geometry. The magnetic behavior has been studied on powdered sample by using susceptibility, specific heat and neutron diffraction data. The bimetallic copper(II)-nickel(II) orthophosphate exhibits a three-dimensional magnetic ordering at, approximately, 29.8 K. However, its complex crystal structure hampers any parametrization of the J-exchange parameter. The specific heat measurements exhibit a three-dimensional magnetic ordering (λ-type) peak at 29.5 K. The magnetic structure of this phosphate shows ferromagnetic interactions inside the Ni 2 O 8 dimers, whereas the sublattice of Cu(II) ions presents antiferromagnetic couplings along the y-axis. The change of the sign in the magnetic unit-cell, due to the [1/2, 0, 1/2] propagation vector determines a purely antiferromagnetic structure. - Graphical abstract: Magnetic structure of CuNi2(PO4)2

  6. Understanding the mechanism of nanotube synthesis for controlled production of specific (n,m) structures

    Resasco, Daniel E.

    2010-02-11

    This report shows the extensive research on the mechanism responsible for the formation of single walled carbon nanotubes in order to get control over their structural parameters (diameter and chirality). Catalyst formulations, pre-treatment conditions, and reaction conditions are described in detail as well as mechanisms to produce nanotubes structures of specific arrays (vertical forest, nanotube pillars). Applications of SWNT in different fields are also described in this report. In relation to this project five students have graduated (3 PhD and 2 MS) and 35 papers have been published.

  7. Crystal structure analysis reveals functional flexibility in the selenocysteine-specific tRNA from mouse.

    Oleg M Ganichkin

    Full Text Available Selenocysteine tRNAs (tRNA(Sec exhibit a number of unique identity elements that are recognized specifically by proteins of the selenocysteine biosynthetic pathways and decoding machineries. Presently, these identity elements and the mechanisms by which they are interpreted by tRNA(Sec-interacting factors are incompletely understood.We applied rational mutagenesis to obtain well diffracting crystals of murine tRNA(Sec. tRNA(Sec lacking the single-stranded 3'-acceptor end ((ΔGCCARNA(Sec yielded a crystal structure at 2.0 Å resolution. The global structure of (ΔGCCARNA(Sec resembles the structure of human tRNA(Sec determined at 3.1 Å resolution. Structural comparisons revealed flexible regions in tRNA(Sec used for induced fit binding to selenophosphate synthetase. Water molecules located in the present structure were involved in the stabilization of two alternative conformations of the anticodon stem-loop. Modeling of a 2'-O-methylated ribose at position U34 of the anticodon loop as found in a sub-population of tRNA(Secin vivo showed how this modification favors an anticodon loop conformation that is functional during decoding on the ribosome. Soaking of crystals in Mn(2+-containing buffer revealed eight potential divalent metal ion binding sites but the located metal ions did not significantly stabilize specific structural features of tRNA(Sec.We provide the most highly resolved structure of a tRNA(Sec molecule to date and assessed the influence of water molecules and metal ions on the molecule's conformation and dynamics. Our results suggest how conformational changes of tRNA(Sec support its interaction with proteins.

  8. Structural basis for sequence-specific recognition of DNA by TAL effectors

    Deng, Dong

    2012-01-05

    TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13. Here, we report the crystal structures of an 11.5-repeat TAL effector in both DNA-free and DNA-bound states. Each TAL repeat comprises two helices connected by a short RVD-containing loop. The 11.5 repeats form a right-handed, superhelical structure that tracks along the sense strand of DNA duplex, with RVDs contacting the major groove. The 12th residue stabilizes the RVD loop, whereas the 13th residue makes a base-specific contact. Understanding DNA recognition by TAL effectors may facilitate rational design of DNA-binding proteins with biotechnological applications.

  9. Structural Changes of Lumbar Muscles in Non-specific Low Back Pain: A Systematic Review.

    Goubert, Dorien; Oosterwijck, Jessica Van; Meeus, Mira; Danneels, Lieven

    2016-01-01

    Lumbar muscle dysfunction due to pain might be related to altered lumbar muscle structure. Macroscopically, muscle degeneration in low back pain (LBP) is characterized by a decrease in cross-sectional area and an increase in fat infiltration in the lumbar paraspinal muscles. In addition microscopic changes, such as changes in fiber distribution, might occur. Inconsistencies in results from different studies make it difficult to draw firm conclusions on which structural changes are present in the different types of non-specific LBP. Insights regarding structural muscle alterations in LBP are, however, important for prevention and treatment of non-specific LBP. The goal of this article is to review which macro- and/or microscopic structural alterations of the lumbar muscles occur in case of non-specific chronic low back pain (CLBP), recurrent low back pain (RLBP), and acute low back pain (ALBP). Systematic review. All selected studies were case-control studies. A systematic literature search was conducted in the databases PubMed and Web of Science. Only full texts of original studies regarding structural alterations (atrophy, fat infiltration, and fiber type distribution) in lumbar muscles of patients with non-specific LBP compared to healthy controls were included. All included articles were scored on methodological quality. Fifteen studies were found eligible after screening title, abstract, and full text for inclusion and exclusion criteria. In CLBP, moderate evidence of atrophy was found in the multifidus; whereas, results in the paraspinal and the erector spinae muscle remain inconclusive. Also moderate evidence occurred in RLBP and ALBP, where no atrophy was shown in any lumbar muscle. Conflicting results were seen in undefined LBP groups. Results concerning fat infiltration were inconsistent in CLBP. On the other hand, there is moderate evidence in RLBP that fat infiltration does not occur, although a larger muscle fat index was found in the erector spinae

  10. Ordering effects on structure and specific heat of nonstoichiometric titanium carbide

    Lipatnikov, V.N.; Gusev, A.I.

    1999-01-01

    The experimental results on the change in the crystal structure and specific heat of the nonstoichiometric titanium carbide TiC y (0.5 2 C phases with cubic and trigonal symmetry and the rhombic ordered Ti 3 C 2 phase are formed in the titanium carbide at the temperature below 1000 K by the phase transitions mechanism. The temperatures and heats of the order-disorder phase transitions are determined [ru

  11. Structure elucidation of female-specific volatiles released by the parasitoid wasp Trichogramma turkestanica (Hymenoptera: Trichogrammatidae

    Armin Tröger

    2014-04-01

    Full Text Available Females of the parasitoid wasp Trichogramma turkestanica produce the putative polydeoxypropionates (2E,4E,6S,8S,10S-4,6,8,10-tetramethyltrideca-2,4-diene and (2E,4E,6S,8S,10S-4,6,8,10-tetramethyltrideca-2,4-dien-1-ol or their enantiomers as sex specific volatiles. The structures were assigned on the basis of GC–MS investigations using synthetic reference compounds.

  12. Subfamily-specific adaptations in the structures of two penicillin-binding proteins from Mycobacterium tuberculosis.

    Daniil M Prigozhin

    Full Text Available Beta-lactam antibiotics target penicillin-binding proteins including several enzyme classes essential for bacterial cell-wall homeostasis. To better understand the functional and inhibitor-binding specificities of penicillin-binding proteins from the pathogen, Mycobacterium tuberculosis, we carried out structural and phylogenetic analysis of two predicted D,D-carboxypeptidases, Rv2911 and Rv3330. Optimization of Rv2911 for crystallization using directed evolution and the GFP folding reporter method yielded a soluble quadruple mutant. Structures of optimized Rv2911 bound to phenylmethylsulfonyl fluoride and Rv3330 bound to meropenem show that, in contrast to the nonspecific inhibitor, meropenem forms an extended interaction with the enzyme along a conserved surface. Phylogenetic analysis shows that Rv2911 and Rv3330 belong to different clades that emerged in Actinobacteria and are not represented in model organisms such as Escherichia coli and Bacillus subtilis. Clade-specific adaptations allow these enzymes to fulfill distinct physiological roles despite strict conservation of core catalytic residues. The characteristic differences include potential protein-protein interaction surfaces and specificity-determining residues surrounding the catalytic site. Overall, these structural insights lay the groundwork to develop improved beta-lactam therapeutics for tuberculosis.

  13. Structure And Specificity of a Quorum-Quenching Lactonase (AiiB) From Agrobacterium Tumefaciens

    Liu, D.; Thomas, P.W.; Momb, J.; Hoang, Q.Q.; Petsko, G.A.; Ringe, D.; Fast, W.

    2009-06-03

    N-Acyl-l-homoserine lactone (AHL) mediated quorum-sensing regulates virulence factor production in a variety of Gram-negative bacteria. Proteins capable of degrading these autoinducers have been called 'quorum-quenching' enzymes, can block many quorum-sensing dependent phenotypes, and represent potentially useful reagents for clinical, agricultural, and industrial applications. The most characterized quorum-quenching enzymes to date are the AHL lactonases, which are metalloproteins that belong to the metallo-beta-lactamase superfamily. Here, we report the cloning, heterologous expression, purification, metal content, substrate specificity, and three-dimensional structure of AiiB, an AHL lactonase from Agrobacterium tumefaciens. Much like a homologous AHL lactonase from Bacillus thuringiensis, AiiB appears to be a metal-dependent AHL lactonase with broad specificity. A phosphate dianion is bound to the dinuclear zinc site and the active-site structure suggests specific mechanistic roles for an active site tyrosine and aspartate. To our knowledge, this is the second representative structure of an AHL lactonase and the first of an AHL lactonase from a microorganism that also produces AHL autoinducers. This work should help elucidate the hydrolytic ring-opening mechanism of this family of enzymes and also facilitate the design of more effective quorum-quenching catalysts.

  14. Capturing structured, pulmonary disease-specific data elements in electronic health records.

    Gronkiewicz, Cynthia; Diamond, Edward J; French, Kim D; Christodouleas, John; Gabriel, Peter E

    2015-04-01

    Electronic health records (EHRs) have the potential to improve health-care quality by allowing providers to make better decisions at the point of care based on electronically aggregated data and by facilitating clinical research. These goals are easier to achieve when key, disease-specific clinical information is documented as structured data elements (SDEs) that computers can understand and process, rather than as free-text/natural-language narrative. This article reviews the benefits of capturing disease-specific SDEs. It highlights several design and implementation considerations, including the impact on efficiency and expressivity of clinical documentation and the importance of adhering to data standards when available. Pulmonary disease-specific examples of collection instruments are provided from two commonly used commercial EHRs. Future developments that can leverage SDEs to improve clinical quality and research are discussed.

  15. Antidepressant Specificity of Serotonin Transporter Suggested by Three LeuT-SSRI Structures

    Zhou, Z.; Zhen, J; Karpowich, N; Law, C; Reith, M; Wang, D

    2009-01-01

    Sertraline and fluoxetine are selective serotonin re-uptake inhibitors (SSRIs) that are widely prescribed to treat depression. They exert their effects by inhibiting the presynaptic plasma membrane serotonin transporter (SERT). All SSRIs possess halogen atoms at specific positions, which are key determinants for the drugs' specificity for SERT. For the SERT protein, however, the structural basis of its specificity for SSRIs is poorly understood. Here we report the crystal structures of LeuT, a bacterial SERT homolog, in complex with sertraline, R-fluoxetine or S-fluoxetine. The SSRI halogens all bind to exactly the same pocket within LeuT. Mutation at this halogen-binding pocket (HBP) in SERT markedly reduces the transporter's affinity for SSRIs but not for tricyclic antidepressants. Conversely, when the only nonconserved HBP residue in both norepinephrine and dopamine transporters is mutated into that found in SERT, their affinities for all the three SSRIs increase uniformly. Thus, the specificity of SERT for SSRIs is dependent largely on interaction of the drug halogens with the protein's HBP.

  16. Structure based protein engineering of Bacillus stearothermophilus {alpha}-amylase: toward a new substrate specificity

    Rasera, Ana Claudia [Sao Paulo Univ., SP (Brazil). Inst. de Ciencias Biomedicas; Iulek, Jorge [Universidade Estadual de Ponta Grossa, PR (Brazil). Inst. de Quimica; Delboni, Luis Fernando; Barbosa, Valma Martins Barbosa [Parana Univ., Curitiba, PR (Brazil). Dept. de Bioquimica

    1997-12-31

    Full text. Structural similarity is observed in all members of {alpha}-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to {alpha}-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus {alpha}-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated {alpha}-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacillus stearothermophilus {alpha}-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to {alpha}-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus

  17. Structure based protein engineering of Bacillus stearothermophilus α-amylase: toward a new substrate specificity

    Rasera, Ana Claudia; Iulek, Jorge; Delboni, Luis Fernando; Barbosa, Valma Martins Barbosa

    1997-01-01

    Full text. Structural similarity is observed in all members of α-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to α-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus α-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated α-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacillus stearothermophilus α-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to α-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus α-amylase (using Bacillus

  18. Individual differences in personality traits reflect structural variance in specific brain regions.

    Gardini, Simona; Cloninger, C Robert; Venneri, Annalena

    2009-06-30

    Personality dimensions such as novelty seeking (NS), harm avoidance (HA), reward dependence (RD) and persistence (PER) are said to be heritable, stable across time and dependent on genetic and neurobiological factors. Recently a better understanding of the relationship between personality traits and brain structures/systems has become possible due to advances in neuroimaging techniques. This Magnetic Resonance Imaging (MRI) study investigated if individual differences in these personality traits reflected structural variance in specific brain regions. A large sample of eighty five young adult participants completed the Three-dimensional Personality Questionnaire (TPQ) and had their brain imaged with MRI. A voxel-based correlation analysis was carried out between individuals' personality trait scores and grey matter volume values extracted from 3D brain scans. NS correlated positively with grey matter volume in frontal and posterior cingulate regions. HA showed a negative correlation with grey matter volume in orbito-frontal, occipital and parietal structures. RD was negatively correlated with grey matter volume in the caudate nucleus and in the rectal frontal gyrus. PER showed a positive correlation with grey matter volume in the precuneus, paracentral lobule and parahippocampal gyrus. These results indicate that individual differences in the main personality dimensions of NS, HA, RD and PER, may reflect structural variance in specific brain areas.

  19. Lymphatic recovery of exogenous oleic acid in rats on long chain or specific structured triacylglycerol diets

    Vistisen, Bodil; Mu, Huiling; Høy, Carl-Erik

    2006-01-01

    Specific structured triacylglycerols, MLM (M = medium-chain fatty acid, L = long-chain fatty acid), rapidly deliver energy and long-chain fatty acids to the body and are used for longer periods in human enteral feeding. In the present study rats were fed diets of 10 wt% MLM or LLL (L = oleic acid......% and 45%, respectively). However, the recovery of exogenous 18:1 n-9 was higher after a single bolus of MLM compared with a bolus of LLL in rats on the MLM diet (40% and 24%, respectively, P = 0.009). The recovery of lymphatic 18:1 n-9 of the LLL bolus tended to depend on the diet triacylglycerol...... structure and composition (P = 0.07). This study demonstrated that with a diet containing specific structured triacylglycerol, the lymphatic recovery of 18:1 n-9 after a single bolus of fat was dependent on the triacylglycerol structure of the bolus. This indicates that the lymphatic recovery of long...

  20. Structural characterization of a D-isomer specific 2-hydroxyacid dehydrogenase from Lactobacillus delbrueckii ssp. bulgaricus.

    Holton, Simon J; Anandhakrishnan, Madhankumar; Geerlof, Arie; Wilmanns, Matthias

    2013-02-01

    Hydroxyacid dehydrogenases, responsible for the stereospecific conversion of 2-keto acids to 2-hydroxyacids in lactic acid producing bacteria, have a range of biotechnology applications including antibiotic synthesis, flavor development in dairy products and the production of valuable synthons. The genome of Lactobacillus delbrueckii ssp. bulgaricus, a member of the heterogeneous group of lactic acid bacteria, encodes multiple hydroxyacid dehydrogenases whose structural and functional properties remain poorly characterized. Here, we report the apo and coenzyme NAD⁺ complexed crystal structures of the L. bulgaricusD-isomer specific 2-hydroxyacid dehydrogenase, D2-HDH. Comparison with closely related members of the NAD-dependent dehydrogenase family reveals that whilst the D2-HDH core fold is structurally conserved, the substrate-binding site has a number of non-canonical features that may influence substrate selection and thus dictate the physiological function of the enzyme. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Site-specific local structure of Mn in artificial manganese ferrite films

    Kravtsov, E.; Haskel, D.; Cady, A.; Yang, A.; Vittoria, C.; Harris, V. G.; Zuo, X.

    2006-01-01

    Diffraction anomalous fine structure (DAFS) spectroscopy has been applied to resolve site-specific Mn local structure in manganese ferrite films grown under nonequilibrium conditions. The DAFS spectra were measured at a number of Bragg reflections in the vicinity of the Mn absorption K edge. The DAFS data analysis done with an iterative Kramers-Kroenig algorithm made it possible to solve separately the local structure around crystallographically inequivalent Mn sites in the unit cell with nominal octahedral and tetrahedral coordination. The strong preference for Mn to be tetrahedrally coordinated in this compound is not only manifested in the relative site occupancies but also in a strong reduction in coordination number for Mn ions at nominal octahedral sites

  2. Structure and genetics of the O-specific polysaccharide of Escherichia coli O27.

    Perepelov, Andrei V; Chen, Tingting; Senchenkova, Sofya N; Filatov, Andrei V; Song, Jingjie; Shashkov, Alexander S; Liu, Bin; Knirel, Yuriy A

    2018-02-01

    The O-specific polysaccharide (O-antigen) is a part of the lipopolysaccharide on the cell surface of Gram-negative bacteria. The O-polysaccharide was obtained by mild acid hydrolysis of the lipopolysaccharide of Escherichia coli O27 and studied by sugar analysis and Smith degradation along with 1 H and 13 C NMR spectroscopy. The following structure of the branched hexasaccharide repeating unit was established, which is unique among known structures of bacterial polysaccharides:where GlcA is non-stoichiometrically O-acetylated at position 3 (∼22%) or 4 (∼37%). Functions of genes in the O-antigen gene cluster of E. coli O27 were tentatively assigned by comparison with sequences in the available databases and found to be consistent with the O-polysaccharide structure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Templated Synthesis of Single-Walled Carbon Nanotubes with Specific Structure.

    Yang, Feng; Wang, Xiao; Li, Meihui; Liu, Xiyan; Zhao, Xiulan; Zhang, Daqi; Zhang, Yan; Yang, Juan; Li, Yan

    2016-04-19

    Single-walled carbon nanotubes (SWNTs) have shown great potential in various applications attributed to their unique structure-dependent properties. Therefore, the controlled preparation of chemically and structurally pristine SWNTs is a crucial issue for their advanced applications (e.g., nanoelectronics) and has been a great challenge for two decades. Epitaxial growth from well-defined seeds has been shown to be a promising strategy to control the structure of SWNTs. Segments of carbon nanotubes, including short pipes from cutting of preformed nanotubes and caps from opening of fullerenes or cyclodehydrogenation of polycyclic hydrocarbon precursors, have been used as the seeds to grow SWNTs. Single-chirality SWNTs were obtained with both presorted chirality-pure SWNT segments and end caps obtained from polycyclic hydrocarbon molecules with designed structure. The main challenges of nanocarbon-segment-seeded processes are the stability of the seeds, yield, and efficiency. Catalyst-mediated SWNT growth is believed to be more efficient. The composition and morphology of the catalyst nanoparticles have been widely reported to affect the chirality distribution of SWNTs. However, chirality-specific SWNT growth is hard to achieve by alternating catalysts. The specificity of enzyme-catalyzed reactions brings us an awareness of the essentiality of a unique catalyst structure for the chirality-selective growth of SWNTs. Only catalysts with the desired atomic arrangements in their crystal planes can act as structural templates for chirality-specific growth of SWNTs. We have developed a new family of catalysts, tungsten-based intermetallic compounds, which have high melting points and very special crystal structures, to facilitate the growth of SWNTs with designed chirality. By the use of W6Co7 catalysts, (12,6) SWNTs were directly grown with purity higher than 92%. Both high-resolution transmission electron microscopy measurements and density functional theory simulations

  4. Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity.

    Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A

    2017-04-28

    Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.

  5. Structural basis for the high specificity of a Trypanosoma congolense immunoassay targeting glycosomal aldolase.

    Joar Pinto

    2017-09-01

    Full Text Available Animal African trypanosomosis (AAT is a neglected tropical disease which imposes a heavy burden on the livestock industry in Sub-Saharan Africa. Its causative agents are Trypanosoma parasites, with T. congolense and T. vivax being responsible for the majority of the cases. Recently, we identified a Nanobody (Nb474 that was employed to develop a homologous sandwich ELISA targeting T. congolense fructose-1,6-bisphosphate aldolase (TcoALD. Despite the high sequence identity between trypanosomatid aldolases, the Nb474-based immunoassay is highly specific for T. congolense detection. The results presented in this paper yield insights into the molecular principles underlying the assay's high specificity.The structure of the Nb474-TcoALD complex was determined via X-ray crystallography. Together with analytical gel filtration, the structure reveals that a single TcoALD tetramer contains four binding sites for Nb474. Through a comparison with the crystal structures of two other trypanosomatid aldolases, TcoALD residues Ala77 and Leu106 were identified as hot spots for specificity. Via ELISA and surface plasmon resonance (SPR, we demonstrate that mutation of these residues does not abolish TcoALD recognition by Nb474, but does lead to a lack of detection in the Nb474-based homologous sandwich immunoassay.The results show that the high specificity of the Nb474-based immunoassay is not determined by the initial recognition event between Nb474 and TcoALD, but rather by its homologous sandwich design. This (i provides insights into the optimal set-up of the assay, (ii may be of great significance for field applications as it could explain the potential detection escape of certain T. congolense strains, and (iii may be of general interest to those developing similar assays.

  6. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    Dessanti, Paola [Cornell University, Ithaca, NY 14853-1301 (United States); Università di Sassari, (Italy); Zhang, Yang [Cornell University, Ithaca, NY 14853-1301 (United States); Allegrini, Simone [Università di Sassari, (Italy); Tozzi, Maria Grazia [Università di Pisa, (Italy); Sgarrella, Francesco [Università di Sassari, (Italy); Ealick, Steven E., E-mail: see3@cornell.edu [Cornell University, Ithaca, NY 14853-1301 (United States)

    2012-03-01

    Adenosine phosphorylase from B. cereus shows a strong preference for adenosine over other 6-oxopurine nucleosides. Mutation of Asp204 to asparagine reduces the efficiency of adenosine cleavage but does not affect inosine cleavage, effectively reversing the substrate specificity. The structures of D204N complexes explain these observations. Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2′-deoxy)nucleosides, generating the corresponding free base and (2′-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2–1.4 Å). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  7. Structured flowcharts for control logic specification in the Tritium Systems Test Assembly

    Nielson, C.W.; Claborn, G.W.

    1983-01-01

    The Tritium Systems Test Assembly (TSTA) contains several subsystems employing sophisticated chemical and physical processes to purify, transport, and capture the isotopes of hydrogen. The ultimate responsibility for the correct and safe operation of these subsystems lies with their designers. However, the logic is implemented in a computer system with program control. A means to insure unambiguous specification of the control logic in a form understandable to both the non-programming designers and the software staff was required. The computer programs are written in RATFOR, a language providing clear control structures and powerful symbol definition facilities. However, the actual code was considered unsatisfactory as a means of primary specification by the non-programming designers. On the other hand, simple English language descriptions of the desired behavior were not precise enough to insure correctness. Experimentation with traditional flowcharts proved that they were more difficult to follow than the RATFOR code. On the other hand, the use of structured flowcharts derived from those introduced by Nassi and Shneidermanl have proven to be very powerful. Using simple geometric forms for the basic control structures such as loops and conditional tests, and by using expansion rather than connection as the means of reducing any flowchart to a single page, a specification that is both understandable and precise has been obtained. A computer code automates the production and modification of these flowcharts. Combining these flowcharts with primitive subroutines which hide most of the details of control implementation has provided an effective medium for algorithm specification and validation. Examples of the flowcharts and the language used to specify them will be given

  8. Is recursion language-specific? Evidence of recursive mechanisms in the structure of intentional action.

    Vicari, Giuseppe; Adenzato, Mauro

    2014-05-01

    In their 2002 seminal paper Hauser, Chomsky and Fitch hypothesize that recursion is the only human-specific and language-specific mechanism of the faculty of language. While debate focused primarily on the meaning of recursion in the hypothesis and on the human-specific and syntax-specific character of recursion, the present work focuses on the claim that recursion is language-specific. We argue that there are recursive structures in the domain of motor intentionality by way of extending John R. Searle's analysis of intentional action. We then discuss evidence from cognitive science and neuroscience supporting the claim that motor-intentional recursion is language-independent and suggest some explanatory hypotheses: (1) linguistic recursion is embodied in sensory-motor processing; (2) linguistic and motor-intentional recursions are distinct and mutually independent mechanisms. Finally, we propose some reflections about the epistemic status of HCF as presenting an empirically falsifiable hypothesis, and on the possibility of testing recursion in different cognitive domains. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Comprehensive structural and substrate specificity classification of the Saccharomyces cerevisiae methyltransferome.

    Wlodarski, Tomasz; Kutner, Jan; Towpik, Joanna; Knizewski, Lukasz; Rychlewski, Leszek; Kudlicki, Andrzej; Rowicka, Maga; Dziembowski, Andrzej; Ginalski, Krzysztof

    2011-01-01

    Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity). Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.

  10. Comprehensive structural and substrate specificity classification of the Saccharomyces cerevisiae methyltransferome.

    Tomasz Wlodarski

    Full Text Available Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity. Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.

  11. Proximity-activated nanoparticles: in vitro performance of specific structural modification by enzymatic cleavage

    Adam Smith, R; Sewell, Sarah L; Giorgio, Todd D

    2008-01-01

    The development and in vitro performance of a modular nanoscale system capable of specific structural modification by enzymatic activity is described in this work. Due to its small physical size and adaptable characteristics, this system has the potential for utilization in targeted delivery systems and biosensing. Nanoparticle probes were synthesized containing two distinct fluorescent species including a quantum dot base particle and fluorescently labeled cleavable peptide substrate. Activity of these probes was monitored by gel electrophoresis with quantitative cleavage measurements made by fluorometric analysis. The model proximity-activated nanoparticles studied here exhibit significant susceptibility to cleavage by matrix metalloprotease-7 (MMP-7) at physiologically relevant concentrations, with nearly complete cleavage of available substrate molecules after 24 hours. This response is specific to MMP-7 enzyme activity, as cleavage is completely inhibited with the addition of EDTA. Utilization of enzyme-specific modification is a sensitive approach with broad applications for targeted therapeutics and biosensing. The versatility of this nanoparticle system is highlighted in its modular design, as it has the capability to integrate characteristics for detection, biosensing, targeting, and payload delivery into a single, multifunctional nanoparticle structure. PMID:18488420

  12. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E. (Cornell); (Sassari); (Pisa)

    2012-10-08

    Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2{prime}-deoxy)nucleosides, generating the corresponding free base and (2{prime}-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2-1.4 {angstrom}). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  13. Structure and Sequence Analyses of Clustered Protocadherins Reveal Antiparallel Interactions that Mediate Homophilic Specificity.

    Nicoludis, John M; Lau, Sze-Yi; Schärfe, Charlotta P I; Marks, Debora S; Weihofen, Wilhelm A; Gaudet, Rachelle

    2015-11-03

    Clustered protocadherin (Pcdh) proteins mediate dendritic self-avoidance in neurons via specific homophilic interactions in their extracellular cadherin (EC) domains. We determined crystal structures of EC1-EC3, containing the homophilic specificity-determining region, of two mouse clustered Pcdh isoforms (PcdhγA1 and PcdhγC3) to investigate the nature of the homophilic interaction. Within the crystal lattices, we observe antiparallel interfaces consistent with a role in trans cell-cell contact. Antiparallel dimerization is supported by evolutionary correlations. Two interfaces, located primarily on EC2-EC3, involve distinctive clustered Pcdh structure and sequence motifs, lack predicted glycosylation sites, and contain residues highly conserved in orthologs but not paralogs, pointing toward their biological significance as homophilic interaction interfaces. These two interfaces are similar yet distinct, reflecting a possible difference in interaction architecture between clustered Pcdh subfamilies. These structures initiate a molecular understanding of clustered Pcdh assemblies that are required to produce functional neuronal networks. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Specific β-turns precede PPIIL structures binding to allele-specific HLA-DRβ1* PBRs in fully-protective malaria vaccine components

    Bermudez, Adriana; Alba, Martha P.; Vanegas, Magnolia; Patarroyo, Manuel A.; Patarroyo, Manuel E.

    2018-04-01

    The 3D structural analysis of 62 peptides derived from highly pathogenic Plasmodium falciparum malaria parasite proteins involved in host cell invasion led to finding a striking association between particular β-turn types located in the N-terminal peripheral flanking residue region (preceding the polyproline II left-handed structures fitting into the HLA-DRβ* allele family) and modified immune protection-inducing protein structure induced long-lasting protective immunity. This is the first time association between two different secondary structures associated with a specific immunological function has been described: full, long-lasting protective immunity.

  15. Revealing the Structural Complexity of Component Interactions of Topic-Specific PCK when Planning to Teach

    Mavhunga, Elizabeth

    2018-04-01

    Teaching pedagogical content knowledge (PCK) at a topic-specific level requires clarity on the content-specific nature of the components employed, as well as the specific features that bring about the desirable depth in teacher explanations. Such understanding is often hazy; yet, it influences the nature of teacher tasks and learning opportunities afforded to pre-service teachers in a teaching program. The purpose of this study was twofold: firstly, to illuminate the emerging complexity when content-specific components of PCK interact when planning to teach a chemistry topic; and secondly, to identify the kinds of teacher tasks that promote the emergence of such complexity. Data collected were content representations (CoRes) in chemical equilibrium accompanied by expanded lesson outlines from 15 pre-service teachers in their final year of study towards a first degree in teaching (B Ed). The analysis involved extraction of episodes that exhibited component interaction by using a qualitative in-depth analysis method. The results revealed the structure in which the components of PCK in a topic interact among each other to be linear, interwoven, or a combination of the two. The interwoven interactions contained multiple components that connected explanations on different aspects of a concept, all working in a complementary manner. The most sophisticated component interactions emerged from teacher tasks on descriptions of a lesson sequence and a summary of a lesson. Recommendations in this study highlight core practices for making pedagogical transformation of topic content knowledge more accessible.

  16. Linker histones: novel insights into structure-specific recognition of the nucleosome.

    Cutter, Amber R; Hayes, Jeffrey J

    2017-04-01

    Linker histones (H1s) are a primary component of metazoan chromatin, fulfilling numerous functions, both in vitro and in vivo, including stabilizing the wrapping of DNA around the nucleosome, promoting folding and assembly of higher order chromatin structures, influencing nucleosome spacing on DNA, and regulating specific gene expression. However, many molecular details of how H1 binds to nucleosomes and recognizes unique structural features on the nucleosome surface remain undefined. Numerous, confounding studies are complicated not only by experimental limitations, but the use of different linker histone isoforms and nucleosome constructions. This review summarizes the decades of research that has resulted in several models of H1 association with nucleosomes, with a focus on recent advances that suggest multiple modes of H1 interaction in chromatin, while highlighting the remaining questions.

  17. Site specific incorporation of heavy atom-containing unnatural amino acids into proteins for structure determination

    Xie, Jianming [San Diego, CA; Wang, Lei [San Diego, CA; Wu, Ning [Boston, MA; Schultz, Peter G [La Jolla, CA

    2008-07-15

    Translation systems and other compositions including orthogonal aminoacyl tRNA-synthetases that preferentially charge an orthogonal tRNA with an iodinated or brominated amino acid are provided. Nucleic acids encoding such synthetases are also described, as are methods and kits for producing proteins including heavy atom-containing amino acids, e.g., brominated or iodinated amino acids. Methods of determining the structure of a protein, e.g., a protein into which a heavy atom has been site-specifically incorporated through use of an orthogonal tRNA/aminoacyl tRNA-synthetase pair, are also described.

  18. In vivo study about specific captation of 125 I-insulin by rat brain structures

    Sanvitto, G.L.

    1986-01-01

    The specific captation of 125 I-insulin was evaluated by brain structures, as olfactory bulbous, hypothalamus and cerebellum in rats, from in vivo experiences that including two different aspects: captation measure of 125 I-insulin after the intravenous injection of the labelled hormone, in fed rats and in rats with 48 h of fast or convulsion, procedure by the pentylene tetrazole; captation measure of 125 I-insulin after intra-cerebral-ventricular injection of the labelled hormone in fed rats. (C.G.C.)

  19. Mapping the MMPI-2-RF Specific Problems Scales Onto Extant Psychopathology Structures.

    Sellbom, Martin

    2017-01-01

    A main objective in developing the Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Ben-Porath & Tellegen, 2008 ) was to link the hierarchical structure of the instrument's scales to contemporary psychopathology and personality models for greater enhancement of construct validity. Initial evidence published with the Restructured Clinical scales has indicated promising results in that the higher order structure of these measures maps onto those reported in the extant psychopathology literature. This study focused on evaluating the internal structure of the Specific Problems and Interest scales, which have not yet been examined in this manner. Two large, mixed-gender outpatient and correctional samples were used. Exploratory factor analyses revealed consistent evidence for a 4-factor structure representing somatization, negative affect, externalizing, and social detachment. Convergent and discriminant validity analyses in the outpatient sample yielded a pattern of results consistent with expectations. These findings add further evidence to indicate that the MMPI-2-RF hierarchy of scales map onto extant psychopathology literature, and also add support to the notion that somatization and detachment should be considered important higher order domains in the psychopathology literature.

  20. Crystal Structure and Substrate Specificity Modification of Acetyl Xylan Esterase from Aspergillus luchuensis.

    Komiya, Dai; Hori, Akane; Ishida, Takuya; Igarashi, Kiyohiko; Samejima, Masahiro; Koseki, Takuya; Fushinobu, Shinya

    2017-10-15

    Acetyl xylan esterase (AXE) catalyzes the hydrolysis of the acetyl bonds present in plant cell wall polysaccharides. Here, we determined the crystal structure of AXE from Aspergillus luchuensis ( Al AXEA), providing the three-dimensional structure of an enzyme in the Esterase_phb family. Al AXEA shares its core α/β-hydrolase fold structure with esterases in other families, but it has an extended central β-sheet at both its ends and an extra loop. Structural comparison with a ferulic acid esterase (FAE) from Aspergillus niger indicated that Al AXEA has a conserved catalytic machinery: a catalytic triad (Ser119, His259, and Asp202) and an oxyanion hole (Cys40 and Ser120). Near the catalytic triad of A lAXEA, two aromatic residues (Tyr39 and Trp160) form small pockets at both sides. Homology models of fungal FAEs in the same Esterase_phb family have wide pockets at the corresponding sites because they have residues with smaller side chains (Pro, Ser, and Gly). Mutants with site-directed mutations at Tyr39 showed a substrate specificity similar to that of the wild-type enzyme, whereas those with mutations at Trp160 acquired an expanded substrate specificity. Interestingly, the Trp160 mutants acquired weak but significant type B-like FAE activity. Moreover, the engineered enzymes exhibited ferulic acid-releasing activity from wheat arabinoxylan. IMPORTANCE Hemicelluloses in the plant cell wall are often decorated by acetyl and ferulic acid groups. Therefore, complete and efficient degradation of plant polysaccharides requires the enzymes for cleaving the side chains of the polymer. Since the Esterase_phb family contains a wide array of fungal FAEs and AXEs from fungi and bacteria, our study will provide a structural basis for the molecular mechanism of these industrially relevant enzymes in biopolymer degradation. The structure of the Esterase_phb family also provides information for bacterial polyhydroxyalkanoate depolymerases that are involved in biodegradation of

  1. The Structural Model of Spirituality and Psychological Well-Being for Pregnancy-Specific Stress.

    Dolatian, Mahrokh; Mahmoodi, Zohreh; Dilgony, Taibeh; Shams, Jamal; Zaeri, Farid

    2017-12-01

    Women experience different types of stress in their lifetime. The present study was conducted to examine the structural model of spirituality and psychological well-being for pregnancy-specific stress. The present descriptive correlational study was conducted on 450 pregnant Iranian women (150 women from each trimester) in Dehdasht city in 2015. Data were collected using the personal-social questionnaire, the pregnancy-specific stress questionnaire, the spirituality questionnaire and the psychological well-being questionnaire and were then analyzed in SPSS-16 and Lisrel-8.8 for carrying out a path analysis. The fit indices of the model indicate the good fit and high compatibility of the model and rational relationships between the variables (GFI = 0.94, NFI = 0.85, CFI = 0.94 and RMSEA = 0.048). Of the variables that affected pregnancy-specific stress through both paths, spirituality had a positive effect (B = 0.11) and the personal-social variable a negative effect (B = -0.37). Psychological well-being affected pregnancy-specific stress negatively and directly and through one path only (B = -0.59). The results obtained through the model confirm the effect of spirituality and psychological well-being in reducing pregnancy-specific stress. Given that handling stress has a major role in the quality of daily life in pregnant women, stress management skills are recommended to be promoted among pregnant women so as to mitigate stress and its negative consequences.

  2. Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.

    Amy L Bauer

    2010-11-01

    Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

  3. Recoveries of rat lymph FA after administration of specific structured C-13-TAG

    Vistisen, Bodil; Mu, Huiling; Høy, Carl-Erik

    2003-01-01

    of intragastrically administered L*L*L*, M*M*M*, ML*M, and ML*L* (where * = C-13-labeled FA) in rats. Lymph lipids were separated into lipid classes and analyzed by GC combustion isotope ratio MS. The recoveries of lymph TAG 18:2n-6 8 h after administration of L*L*L*, ML*M, and ML*L* were 38.6, 48.4, and 49...... rapid recovery of exogenous long-chain FA following administration of specific structured TAG compared with long-chain TAG was probably due to fast hydrolysis. The lymphatic recovery of 8:0 was 2.2% 24 h after administration of M*M*M*. This minor lymphatic recovery of exogenous 8:0 was probably due...... to low stimulation of chylomicron formation. These results demonstrate tendencies toward faster lymphatic recovery of long-chain FA after administration of specific structured TAG compared with long-chain TAG....

  4. Inter-specific coral chimerism: Genetically distinct multicellular structures associated with tissue loss in Montipora capitata

    Work, Thierry M.; Forsman, Zac H.; Szabo, Zoltan; Lewis, Teresa D.; Aeby, Greta S.; Toonen, Robert J.

    2011-01-01

    Montipora white syndrome (MWS) results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS) that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR), while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata). Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  5. Interleukin-11 binds specific EF-hand proteins via their conserved structural motifs.

    Kazakov, Alexei S; Sokolov, Andrei S; Vologzhannikova, Alisa A; Permyakova, Maria E; Khorn, Polina A; Ismailov, Ramis G; Denessiouk, Konstantin A; Denesyuk, Alexander I; Rastrygina, Victoria A; Baksheeva, Viktoriia E; Zernii, Evgeni Yu; Zinchenko, Dmitry V; Glazatov, Vladimir V; Uversky, Vladimir N; Mirzabekov, Tajib A; Permyakov, Eugene A; Permyakov, Sergei E

    2017-01-01

    Interleukin-11 (IL-11) is a hematopoietic cytokine engaged in numerous biological processes and validated as a target for treatment of various cancers. IL-11 contains intrinsically disordered regions that might recognize multiple targets. Recently we found that aside from IL-11RA and gp130 receptors, IL-11 interacts with calcium sensor protein S100P. Strict calcium dependence of this interaction suggests a possibility of IL-11 interaction with other calcium sensor proteins. Here we probed specificity of IL-11 to calcium-binding proteins of various types: calcium sensors of the EF-hand family (calmodulin, S100B and neuronal calcium sensors: recoverin, NCS-1, GCAP-1, GCAP-2), calcium buffers of the EF-hand family (S100G, oncomodulin), and a non-EF-hand calcium buffer (α-lactalbumin). A specific subset of the calcium sensor proteins (calmodulin, S100B, NCS-1, GCAP-1/2) exhibits metal-dependent binding of IL-11 with dissociation constants of 1-19 μM. These proteins share several amino acid residues belonging to conservative structural motifs of the EF-hand proteins, 'black' and 'gray' clusters. Replacements of the respective S100P residues by alanine drastically decrease its affinity to IL-11, suggesting their involvement into the association process. Secondary structure and accessibility of the hinge region of the EF-hand proteins studied are predicted to control specificity and selectivity of their binding to IL-11. The IL-11 interaction with the EF-hand proteins is expected to occur under numerous pathological conditions, accompanied by disintegration of plasma membrane and efflux of cellular components into the extracellular milieu.

  6. Rapid discovery of peptide capture candidates with demonstrated specificity for structurally similar toxins

    Sarkes, Deborah A.; Hurley, Margaret M.; Coppock, Matthew B.; Farrell, Mikella E.; Pellegrino, Paul M.; Stratis-Cullum, Dimitra N.

    2016-05-01

    Peptides have emerged as viable alternatives to antibodies for molecular-based sensing due to their similarity in recognition ability despite their relative structural simplicity. Various methods for peptide capture reagent discovery exist, including phage display, yeast display, and bacterial display. One of the primary advantages of peptide discovery by bacterial display technology is the speed to candidate peptide capture agent, due to both rapid growth of bacteria and direct utilization of the sorted cells displaying each individual peptide for the subsequent round of biopanning. We have previously isolated peptide affinity reagents towards protective antigen of Bacillus anthracis using a commercially available automated magnetic sorting platform with improved enrichment as compared to manual magnetic sorting. In this work, we focus on adapting our automated biopanning method to a more challenging sort, to demonstrate the specificity possible with peptide capture agents. This was achieved using non-toxic, recombinant variants of ricin and abrin, RiVax and abrax, respectively, which are structurally similar Type II ribosomal inactivating proteins with significant sequence homology. After only two rounds of biopanning, enrichment of peptide capture candidates binding abrax but not RiVax was achieved as demonstrated by Fluorescence Activated Cell Sorting (FACS) studies. Further sorting optimization included negative sorting against RiVax, proper selection of autoMACS programs for specific sorting rounds, and using freshly made buffer and freshly thawed protein target for each round of biopanning for continued enrichment over all four rounds. Most of the resulting candidates from biopanning for abrax binding peptides were able to bind abrax but not RiVax, demonstrating that short peptide sequences can be highly specific even at this early discovery stage.

  7. The retinal specific CD147 Ig0 domain: from molecular structure to biological activity

    Redzic, Jasmina S.; Armstrong, Geoffrey S.; Isern, Nancy. G.; Jones, David N.M.; Kieft, Jeffrey S.; Eisenmesser, Elan Zohar

    2011-01-01

    CD147 is a type I transmembrane protein that is involved in inflammatory diseases, cancer progression, and multiple human pathogens utilize CD147 for efficient infection. In several cancers, CD147 expression is so high that it is now used as a prognostic marker. The two primary isoforms of CD147 that are related to cancer progression have been identified, differing in their number of immunoglobulin (Ig)-like domains. These include CD147 Ig1-Ig2 that is ubiquitously expressed in most tissues and CD147 Ig0-Ig1-Ig2 that is retinal specific and implicated in retinoblastoma. However, little is known in regard to the retinal specific CD147 Ig0 domain despite its potential role in retinoblastoma. We present the first crystal structure of the human CD147 Ig0 domain and show that the CD147 Ig0 domain is a crystallographic dimer with an I-type domain structure, which is maintained in solution. Furthermore, we have utilized our structural data together with mutagenesis to probe the biological activity of CD147-containing proteins both with and without the CD147 Ig0 domain within several model cell lines. Our findings reveal that the CD147 Ig0 domain is a potent stimulator of interleukin-6 and suggest that the CD147 Ig0 domain has its own receptor distinct from that of the other CD147 Ig-like domains, CD147 Ig1-Ig2. Finally, we show that the CD147 Ig0 dimer is the functional unit required for activity and can be disrupted by a single point mutation. PMID:21620857

  8. Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.

    Vacchi-Suzzi, Caterina; Hahne, Florian; Scheubel, Philippe; Marcellin, Magali; Dubost, Valerie; Westphal, Magdalena; Boeglen, Catherine; Büchmann-Møller, Stine; Cheung, Ming Sin; Cordier, André; De Benedetto, Christopher; Deurinck, Mark; Frei, Moritz; Moulin, Pierre; Oakeley, Edward; Grenet, Olivier; Grevot, Armelle; Stull, Robert; Theil, Diethilde; Moggs, Jonathan G; Marrer, Estelle; Couttet, Philippe

    2013-01-01

    MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves) in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*). The relative abundance of myocardium-enriched (miR-1) and valve-enriched (miR-125b-5p and miR-204) microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.

  9. Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.

    Caterina Vacchi-Suzzi

    Full Text Available MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744 and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*. The relative abundance of myocardium-enriched (miR-1 and valve-enriched (miR-125b-5p and miR-204 microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.

  10. Structure-guided mutational analysis reveals the functional requirements for product specificity of DOT1 enzymes.

    Dindar, Gülcin; Anger, Andreas M; Mehlhorn, Christine; Hake, Sandra B; Janzen, Christian J

    2014-11-12

    DOT1 enzymes are conserved methyltransferases that catalyse the methylation of lysine 79 on histone H3 (H3K79). Most eukaryotes contain one DOT1 enzyme, whereas African trypanosomes have two homologues, DOT1A and DOT1B, with different enzymatic activities. DOT1A mediates mono- and dimethylation of H3K76, the homologue of H3K79 in other organisms, whereas DOT1B additionally catalyses H3K76 trimethylation. However, it is unclear how these different enzymatic activities are achieved. Here we employ a trypanosomal nucleosome reconstitution system and structure-guided homology modelling to identify critical residues within and outside the catalytic centre that modulate product specificity. Exchange of these residues transfers the product specificity from one enzyme to the other, and reveals the existence of distinct regulatory domains adjacent to the catalytic centre. Our study provides the first evidence that a few crucial residues in DOT1 enzymes are sufficient to catalyse methyl-state-specific reactions. These results might also have far-reaching consequences for the functional understanding of homologous enzymes in higher eukaryotes.

  11. Structural modeling of age specific fertility curves in Peninsular Malaysia: An approach of Lee Carter method

    Hanafiah, Hazlenah; Jemain, Abdul Aziz

    2013-11-01

    In recent years, the study of fertility has been getting a lot of attention among research abroad following fear of deterioration of fertility led by the rapid economy development. Hence, this study examines the feasibility of developing fertility forecasts based on age structure. Lee Carter model (1992) is applied in this study as it is an established and widely used model in analysing demographic aspects. A singular value decomposition approach is incorporated with an ARIMA model to estimate age specific fertility rates in Peninsular Malaysia over the period 1958-2007. Residual plots is used to measure the goodness of fit of the model. Fertility index forecast using random walk drift is then utilised to predict the future age specific fertility. Results indicate that the proposed model provides a relatively good and reasonable data fitting. In addition, there is an apparent and continuous decline in age specific fertility curves in the next 10 years, particularly among mothers' in their early 20's and 40's. The study on the fertility is vital in order to maintain a balance between the population growth and the provision of facilities related resources.

  12. Crystal Structure and Substrate Specificity of Drosophila 3,4-Dihydroxyphenylalanine Decarboxylase

    Han, Q.; Ding, H; Robinson, H; Christensen, B; Li, J

    2010-01-01

    3,4-Dihydroxyphenylalanine decarboxylase (DDC), also known as aromatic L-amino acid decarboxylase, catalyzes the decarboxylation of a number of aromatic L-amino acids. Physiologically, DDC is responsible for the production of dopamine and serotonin through the decarboxylation of 3,4-dihydroxyphenylalanine and 5-hydroxytryptophan, respectively. In insects, both dopamine and serotonin serve as classical neurotransmitters, neuromodulators, or neurohormones, and dopamine is also involved in insect cuticle formation, eggshell hardening, and immune responses. In this study, we expressed a typical DDC enzyme from Drosophila melanogaster, critically analyzed its substrate specificity and biochemical properties, determined its crystal structure at 1.75 Angstrom resolution, and evaluated the roles residues T82 and H192 play in substrate binding and enzyme catalysis through site-directed mutagenesis of the enzyme. Our results establish that this DDC functions exclusively on the production of dopamine and serotonin, with no activity to tyrosine or tryptophan and catalyzes the formation of serotonin more efficiently than dopamine. The crystal structure of Drosophila DDC and the site-directed mutagenesis study of the enzyme demonstrate that T82 is involved in substrate binding and that H192 is used not only for substrate interaction, but for cofactor binding of drDDC as well. Through comparative analysis, the results also provide insight into the structure-function relationship of other insect DDC-like proteins.

  13. 45S5 bioglass: modifications in the structural arrangement to meet specific needs in bone regeneration

    Silva, A.C.; Braga, J.F.C.; Aparecida, A.H.

    2011-01-01

    After surgical implantation the osteoinductivity property, observed in bioactive materials, is mainly due to the formation of calcium phosphate on these materials surface when in body fluids contact. The dissolution and diffusion phenomena in bioglass are result of it's structural arrangement and govern the osteoinductivity property. In structural arrangement of bioglass, silica segments are linked by phosphate groups, defining the distance between the vitreous network segments and thereby influence of cations diffusion rate through the network and the dissolution rate. Thus, the induced changes in arrangement of phosphate groups can control the intensity of material osteoinductivity in order to fit bone regeneration requirements. In this study, P_2O_5 nanoclusters formation were induced in bioglass 45S5 network structure. The bioactive glasses were prepared by melting at 1500°C in platinum crucibles and annealed between 2 and 24 h at 500°C. The characterization was performed using the following techniques, X-ray diffraction (XRD), Infrared spectroscopy (FT-IR) and hydrolytic resistance. In bioglasses 24 hours heat-treated, there was evidence of nanocrystals formation, dissolution rate, significant increase and consequently the property of osteoinductive. The obtained results indicated the potential of development of biomaterials for specific applications in bone regeneration. (author)

  14. Preschool externalizing behavior predicts gender-specific variation in adolescent neural structure.

    Jessica Z K Caldwell

    Full Text Available Dysfunction in the prefrontal cortex, amygdala, and hippocampus is believed to underlie the development of much psychopathology. However, to date only limited longitudinal data relate early behavior with neural structure later in life. Our objective was to examine the relationship of early life externalizing behavior with adolescent brain structure. We report here the first longitudinal study linking externalizing behavior during preschool to brain structure during adolescence. We examined the relationship of preschool externalizing behavior with amygdala, hippocampus, and prefrontal cortex volumes at age 15 years in a community sample of 76 adolescents followed longitudinally since their mothers' pregnancy. A significant gender by externalizing behavior interaction revealed that males-but not females-with greater early childhood externalizing behavior had smaller amygdala volumes at adolescence (t = 2.33, p = .023. No significant results were found for the hippocampus or the prefrontal cortex. Greater early externalizing behavior also related to smaller volume of a cluster including the angular gyrus and tempoparietal junction across genders. Results were not attributable to the impact of preschool anxiety, preschool maternal stress, school-age internalizing or externalizing behaviors, or adolescent substance use. These findings demonstrate a novel, gender-specific relationship between early-childhood externalizing behavior and adolescent amygdala volume, as well as a cross-gender result for the angular gyrus and tempoparietal junction.

  15. Structural and functional plasticity specific to musical training with wind instruments

    Uk-Su eChoi

    2015-10-01

    Full Text Available Numerous neuroimaging studies have shown structural and functional changes resulting from musical training. Among these studies, changes in primary sensory areas are mostly related to motor functions. In this study, we looked for some similar functional and structural changes in other functional modalities, such as somatosensory function, by examining the effects of musical training with wind instruments. We found significant changes in two aspects of neuroplasticity, cortical thickness and resting-state neuronal networks. A group of subjects with several years of continuous musical training and who are currently playing in university wind ensembles showed differences in cortical thickness in lip- and tongue-related brain areas versus non-music playing subjects. Cortical thickness in lip-related brain areas was significantly thicker and that in tongue-related areas was significantly thinner in the music playing group compared with that in the non-music playing group. Association analysis of lip-related areas in the music playing group showed that the increase in cortical thickness was caused by musical training. In addition, seed-based correlation analysis showed differential activation in the precentral gyrus and supplementary motor areas between the music and non-music playing groups. These results suggest that high-intensity training with specific musical instruments could induce structural changes in related anatomical areas and could also generate a new functional neuronal network in the brain.

  16. Crystal structure and substrate specificity of Drosophila 3,4-dihydroxyphenylalanine decarboxylase.

    Qian Han

    2010-01-01

    Full Text Available 3,4-Dihydroxyphenylalanine decarboxylase (DDC, also known as aromatic L-amino acid decarboxylase, catalyzes the decarboxylation of a number of aromatic L-amino acids. Physiologically, DDC is responsible for the production of dopamine and serotonin through the decarboxylation of 3,4-dihydroxyphenylalanine and 5-hydroxytryptophan, respectively. In insects, both dopamine and serotonin serve as classical neurotransmitters, neuromodulators, or neurohormones, and dopamine is also involved in insect cuticle formation, eggshell hardening, and immune responses.In this study, we expressed a typical DDC enzyme from Drosophila melanogaster, critically analyzed its substrate specificity and biochemical properties, determined its crystal structure at 1.75 Angstrom resolution, and evaluated the roles residues T82 and H192 play in substrate binding and enzyme catalysis through site-directed mutagenesis of the enzyme. Our results establish that this DDC functions exclusively on the production of dopamine and serotonin, with no activity to tyrosine or tryptophan and catalyzes the formation of serotonin more efficiently than dopamine.The crystal structure of Drosophila DDC and the site-directed mutagenesis study of the enzyme demonstrate that T82 is involved in substrate binding and that H192 is used not only for substrate interaction, but for cofactor binding of drDDC as well. Through comparative analysis, the results also provide insight into the structure-function relationship of other insect DDC-like proteins.

  17. Structural basis for the site-specific incorporation of lysine derivatives into proteins.

    Veronika Flügel

    Full Text Available Posttranslational modifications (PTMs of proteins determine their structure-function relationships, interaction partners, as well as their fate in the cell and are crucial for many cellular key processes. For instance chromatin structure and hence gene expression is epigenetically regulated by acetylation or methylation of lysine residues in histones, a phenomenon known as the 'histone code'. Recently it was shown that these lysine residues can furthermore be malonylated, succinylated, butyrylated, propionylated and crotonylated, resulting in significant alteration of gene expression patterns. However the functional implications of these PTMs, which only differ marginally in their chemical structure, is not yet understood. Therefore generation of proteins containing these modified amino acids site specifically is an important tool. In the last decade methods for the translational incorporation of non-natural amino acids using orthogonal aminoacyl-tRNA synthetase (aaRS:tRNAaaCUA pairs were developed. A number of studies show that aaRS can be evolved to use non-natural amino acids and expand the genetic code. Nevertheless the wild type pyrrolysyl-tRNA synthetase (PylRS from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of non-natural amino acids. Here we present structural data on the wild type enzyme in complex with adenylated ε-N-alkynyl-, ε-N-butyryl-, ε-N-crotonyl- and ε-N-propionyl-lysine providing insights into the plasticity of the PylRS active site. This shows that given certain key features in the non-natural amino acid to be incorporated, directed evolution of this enzyme is not necessary for substrate tolerance.

  18. IgE to penicillins with different specificities can be identified by a multiepitope macromolecule: Bihaptenic penicillin structures and IgE specificities.

    Ariza, A; Barrionuevo, E; Mayorga, C; Montañez, M I; Perez-Inestrosa, E; Ruiz-Sánchez, A; Rodríguez-Guéant, R M; Fernández, T D; Guéant, J L; Torres, M J; Blanca, M

    2014-04-01

    Quantitation of specific IgE by immunoassay is a recommended in vitro test for the diagnosis of immediate hypersensitivity reactions to betalactams (BLs), particularly when skin test results are negative. IgE antibodies that recognize the common nuclear structure of all BLs or the specific side chain structure can be mainly distinguished by immunoassays. The aim of this study was to develop an immunoassay system to detect IgE antibodies with different specificities. Cellulose discs conjugated with benzylpenicillin (BP), amoxicillin (AX) or both drugs, with poly-l-lysine (PLL) as carrier molecule, were used as solid phases in the radioallergosorbent test (RAST). Direct and inhibition radioimmunoassay studies were made to verify the structures recognized by serum IgE antibodies from penicillin-allergic patients. Our results indicated that the addition of both haptens did not decrease the capacity to capture IgE when serum specific to either BP or AX was used, at least in terms of sensitivity. In addition, the inclusion of two haptens improved significantly the levels of IgE detection in patients who recognized both BP and AX. Therefore, the use of a solid phase with a carrier molecule conjugated with two determinants (AX and BP) is helpful to recognize IgE antibodies against either of these determinants and is useful for screening sera with different specificities. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Milk whey protein modification by coffee-specific phenolics: effect on structural and functional properties.

    Ali, Mostafa; Homann, Thomas; Khalil, Mahmoud; Kruse, Hans-Peter; Rawel, Harshadrai

    2013-07-17

    A suitable vehicle for integration of bioactive plant constituents is proposed. It involves modification of proteins using phenolics and applying these for protection of labile constituents. It dissects the noncovalent and covalent interactions of β-lactoglobulin with coffee-specific phenolics. Alkaline and polyphenol oxidase modulated covalent reactions were compared. Tryptic digestion combined with MALDI-TOF-MS provided tentative allocation of the modification type and site in the protein, and an in silico modeling of modified β-lactoglobulin is proposed. The modification delivers proteins with enhanced antioxidative properties. Changed structural properties and differences in solubility, surface hydrophobicity, and emulsification were observed. The polyphenol oxidase modulated reaction provides a modified β-lactoglobulin with a high antioxidative power, is thermally more stable, requires less energy to unfold, and, when emulsified with lutein esters, exhibits their higher stability against UV light. Thus, adaptation of this modification provides an innovative approach for functionalizing proteins and their uses in the food industry.

  20. The bats (Chiroptera; Mammalia of Mordovia: specific structure and features of distribution

    Oleg N. Artaev

    2016-05-01

    Full Text Available This article presents the specific structure and distribution of the bats made in the territory of the Republic of Mordovia (Central Russia from the first half of the 20th century to the present. Occurence, relative abundance and patterns of distribution are briefly assessed for rare species. On this base, recommendations for inclusion these bats in the regional Red Data Book are presented. .In Mordovia twelve species of bats have been observed. There are widespread and numerous species: Pipistrellus nathusii, Myotis daubentonii, M. dasycneme, Nyctalus noctula and Vespertilio murinus. Widespread but less numerous species are: Myotis brandtii and Plecotus auritus. Finally, rare species are: Myotis nattereri, Nyctalus lasiopterus, N. leisleri, Pipistrellus pygmaeus and P. kuhlii.

  1. Specificities of micro-structured reactors for hydrogen production and purification

    Dupont, N.; Germani, G.; Van Veen, A.C.; Schuurman, Y.; Mirodatos, C. [Institut de Recherches sur la Catalyse - CNRS, 2, Avenue Albert Einstein, 69626 Villeurbanne Cedex (France); Schaefer, G. [Atotech Deutschland GmbH, PO Box 210780, 10507 Berlin (Germany)

    2007-07-15

    This paper presents the specificities of micro-structured reactors as compared to conventional fixed-bed reactors through two case studies devoted to (i) hydrogen production by methanol steam reforming, (ii) hydrogen purification by water-gas shift (WGS). Key features like catalyst coating stability, temperature and pressure management, effects of operating conditions (residence time, pressure drops, etc.) are well identified as controlling the micro-reactor performances for methanol reforming. These devices are also shown to be excellent tools for fast access to reaction kinetics as exemplified for the WGS reaction, subject to operating conditions carefully chosen to ensure proper hydrodynamics, in order to use conventional plug flow reactor models for extracting rate constants. (author)

  2. Specific uptake of DHA by the brain from a structured phospholipid, AceDoPC®

    Bernoud-Hubac Nathalie

    2017-03-01

    Full Text Available Docosahexaenoic acid (DHA; 22:6 ω-3 is highly enriched in the brain and is required for proper brain development and function. Its deficiency has been shown to be linked with the emergence of neurological diseases. Dietary ω-3 fatty acid supplements including DHA have been suggested to improve neuronal development and enhance cognitive functions. Findings suggested that DHA is better incorporated into the brain when esterified at the sn-2 position of a lysophosphatidylcholine (LysoPC-DHA. AceDoPC® is a structured phospholipid or acetyl-LysoPC-DHA. As previously shown for LysoPC-DHA, AceDoPC® is a specific and preferred carrier of DHA to the brain. When AceDoPC® was injected to rats that were subjected to an ischemic stroke, it prevents the extension of brain lesions. Regarding the essential role of DHA for cerebral functions, targeting the brain with specific carriers of DHA might provide novel therapeutic approaches to neurodegenerative diseases.

  3. Structural Evidence for Regulation and Specificity of Flaviviral Proteases and Evolution of the Flaviviridae Fold

    Aleshin,A.; Shiryaev, S.; Strongin, A.; Liddington, R.

    2007-01-01

    Pathogenic members of the flavivirus family, including West Nile Virus (WNV) and Dengue Virus (DV), are growing global threats for which there are no specific treatments. The two-component flaviviral enzyme NS2B-NS3 cleaves the viral polyprotein precursor within the host cell, a process that is required for viral replication. Here, we report the crystal structure of WNV NS2B-NS3pro both in a substrate-free form and in complex with the trypsin inhibitor aprotinin/BPTI. We show that aprotinin binds in a substrate-mimetic fashion in which the productive conformation of the protease is fully formed, providing evidence for an 'induced fit' mechanism of catalysis and allowing us to rationalize the distinct substrate specificities of WNV and DV proteases. We also show that the NS2B cofactor of WNV can adopt two very distinct conformations and that this is likely to be a general feature of flaviviral proteases, providing further opportunities for regulation. Finally, by comparing the flaviviral proteases with the more distantly related Hepatitis C virus, we provide insights into the evolution of the Flaviviridae fold. Our work should expedite the design of protease inhibitors to treat a range of flaviviral infections.

  4. Sensory memory of structure-from-motion is shape-specific.

    Pastukhov, Alexander; Füllekrug, Jana; Braun, Jochen

    2013-08-01

    Perceptual priming can stabilize the phenomenal appearance of multistable visual displays (Leopold, Wilke, Maier, & Logothetis, Nature Neuroscience, 5, 605-609, 2002). Prior exposure to such displays induces a sensory memory of their appearance, which persists over long intervals and intervening stimulation, and which facilitates renewed perception of the same appearance. Here, we investigated perceptual priming for the apparent rotation in depth of ambiguous structure-from-motion (SFM) displays. Specifically, we generated SFM objects with different three-dimensional shapes and presented them in random order and with intervening blank periods. To assess perceptual priming, we established the probability that a perceived direction of rotation would persist between successive objects. In general, persistence was greatest between identical objects, intermediate between similar objects, and negligible between dissimilar objects. These results demonstrate unequivocally that sensory memory for apparent rotation is specific to three-dimensional shape, contrary to previous reports (e.g., Maier, Wilke, Logothetis, & Leopold, Current Biology, 13, 1076-1085, 2003). Because persistence did not depend on presentation order for any pair of objects, it provides a commutative measure for the similarity of object shapes. However, it is not clear exactly which features or aspects of object shape determine similarity. At least, we did not find simple, low-level features (such as volume overlap, heterogeneity, or rotational symmetry) that could have accounted for all observations. Accordingly, it seems that sensory memory of SFM (which underlies priming of ambiguous rotation) engages higher-level representations of object surface and shape.

  5. Development of a patient-specific anatomical foot model from structured light scan data.

    Lochner, Samuel J; Huissoon, Jan P; Bedi, Sanjeev S

    2014-01-01

    The use of anatomically accurate finite element (FE) models of the human foot in research studies has increased rapidly in recent years. Uses for FE foot models include advancing knowledge of orthotic design, shoe design, ankle-foot orthoses, pathomechanics, locomotion, plantar pressure, tissue mechanics, plantar fasciitis, joint stress and surgical interventions. Similar applications but for clinical use on a per-patient basis would also be on the rise if it were not for the high costs associated with developing patient-specific anatomical foot models. High costs arise primarily from the expense and challenges of acquiring anatomical data via magnetic resonance imaging (MRI) or computed tomography (CT) and reconstructing the three-dimensional models. The proposed solution morphs detailed anatomy from skin surface geometry and anatomical landmarks of a generic foot model (developed from CT or MRI) to surface geometry and anatomical landmarks acquired from an inexpensive structured light scan of a foot. The method yields a patient-specific anatomical foot model at a fraction of the cost of standard methods. Average error for bone surfaces was 2.53 mm for the six experiments completed. Highest accuracy occurred in the mid-foot and lowest in the forefoot due to the small, irregular bones of the toes. The method must be validated in the intended application to determine if the resulting errors are acceptable.

  6. Ultrafast hydrogen exchange reveals specific structural events during the initial stages of folding of cytochrome c.

    Fazelinia, Hossein; Xu, Ming; Cheng, Hong; Roder, Heinrich

    2014-01-15

    Many proteins undergo a sharp decrease in chain dimensions during early stages of folding, prior to the rate-limiting step in folding. However, it remains unclear whether compact states are the result of specific folding events or a general hydrophobic collapse of the poly peptide chain driven by the change in solvent conditions. To address this fundamental question, we extended the temporal resolution of NMR-detected H/D exchange labeling experiments into the microsecond regime by adopting a microfluidics approach. By observing the competition between H/D exchange and folding as a function of labeling pH, coupled with direct measurement of exchange rates in the unfolded state, we were able to monitor hydrogen-bond formation for over 50 individual backbone NH groups within the initial 140 microseconds of folding of horse cytochrome c. Clusters of solvent-shielded amide protons were observed in two α-helical segments in the C-terminal half of the protein, while the N-terminal helix remained largely unstructured, suggesting that proximity in the primary structure is a major factor in promoting helix formation and association at early stages of folding, while the entropically more costly long-range contacts between the N- and C-terminal helices are established only during later stages. Our findings clearly indicate that the initial chain condensation in cytochrome c is driven by specific interactions among a subset of α-helical segments rather than a general hydrophobic collapse.

  7. Structure-function relationship of substituted bromomethylcoumarins in nucleoside specificity of RNA alkylation.

    Kellner, Stefanie; Kollar, Laura Bettina; Ochel, Antonia; Ghate, Manjunath; Helm, Mark

    2013-01-01

    Selective alkylation of RNA nucleotides is an important field of RNA biochemistry, e.g. in applications of fluorescent labeling or in structural probing experiments, yet detailed structure-function studies of labeling agents are rare. Here, bromomethylcoumarins as reactive compounds for fluorescent labeling of RNA are developed as an attractive scaffold on which electronic properties can be modulated by varying the substituents. Six different 4-bromomethyl-coumarins of various substitution patterns were tested for nucleotide specificity of RNA alkylation using tRNA from Escherichia coli as substrate. Using semi-quantitative LC-MS/MS analysis, reactions at mildly acidic and slightly alkaline pH were compared. For all tested compounds, coumarin conjugates with 4-thiouridine, pseudouridine, guanosine, and uridine were identified, with the latter largely dominating. This data set shows that selectivity of ribonucleotide alkylation depends on the substitution pattern of the reactive dye, and even more strongly on the modulation of the reaction conditions. The latter should be therefore carefully optimized when striving to achieve selectivity. Interestingly, the highest selectivity for labeling of a modified nucleoside, namely of 4-thiouridine, was achieved with a compound whose selectivity was somewhat less dependent on reaction conditions than the other compounds. In summary, bromomethylcoumarin derivatives are a highly interesting class of compounds, since their selectivity for 4-thiouridine can be efficiently tuned by variation of substitution pattern and reaction conditions.

  8. Testing Fiscal Dominance Hypothesis in a Structural VAR Specification for Pakistan

    Shaheen Rozina

    2018-03-01

    Full Text Available This research aims to test the fiscal dominance hypothesis for Pakistan through a bivariate structural vector auto regression (SVAR specification, covering time period 1977 – 2016. This study employs real primary deficit (non interest government expenditures minus total revenues and real primary liabilities (sum of monetary base and domestic public debt as indicators of fiscal measures and monetary policy respectively. A structural VAR is retrieved both for entire sample period and four sub periods (1977 – 1986, 1987 – 1997, 1998 – 2008, and 2009 – 2016. This study identifies the presence of fiscal dominance for the entire sample period and the sub period from 1987 – 2008. The estimates reveal an interesting phenomenon that fiscal dominance is significant in the elected regimes and weaker in the presence of military regimes in Pakistan. From a policy perspective, this research suggests increased autonomy of central bank to achieve long term price stability and reduced administration costs to ensure efficient democratic regime in Pakistan.

  9. Structural insights into Rhino-Deadlock complex for germline piRNA cluster specification.

    Yu, Bowen; Lin, Yu An; Parhad, Swapnil S; Jin, Zhaohui; Ma, Jinbiao; Theurkauf, William E; Zhang, Zz Zhao; Huang, Ying

    2018-06-01

    PIWI-interacting RNAs (piRNAs) silence transposons in germ cells to maintain genome stability and animal fertility. Rhino, a rapidly evolving heterochromatin protein 1 (HP1) family protein, binds Deadlock in a species-specific manner and so defines the piRNA-producing loci in the Drosophila genome. Here, we determine the crystal structures of Rhino-Deadlock complex in Drosophila melanogaster and simulans In both species, one Rhino binds the N-terminal helix-hairpin-helix motif of one Deadlock protein through a novel interface formed by the beta-sheet in the Rhino chromoshadow domain. Disrupting the interface leads to infertility and transposon hyperactivation in flies. Our structural and functional experiments indicate that electrostatic repulsion at the interaction interface causes cross-species incompatibility between the sibling species. By determining the molecular architecture of this piRNA-producing machinery, we discover a novel HP1-partner interacting mode that is crucial to piRNA biogenesis and transposon silencing. We thus explain the cross-species incompatibility of two sibling species at the molecular level. © 2018 The Authors.

  10. Structural basis for subtype-specific inhibition of the P2X7 receptor

    Karasawa, Akira; Kawate, Toshimitsu (Cornell)

    2016-12-09

    The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of the drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases.

  11. Structural Basis for the Altered PAM Specificities of Engineered CRISPR-Cas9.

    Hirano, Seiichi; Nishimasu, Hiroshi; Ishitani, Ryuichiro; Nureki, Osamu

    2016-03-17

    The RNA-guided endonuclease Cas9 cleaves double-stranded DNA targets bearing a PAM (protospacer adjacent motif) and complementarity to the guide RNA. A recent study showed that, whereas wild-type Streptococcus pyogenes Cas9 (SpCas9) recognizes the 5'-NGG-3' PAM, the engineered VQR, EQR, and VRER SpCas9 variants recognize the 5'-NGA-3', 5'-NGAG-3', and 5'-NGCG-3' PAMs, respectively, thus expanding the targetable sequences in Cas9-mediated genome editing applications. Here, we present the high-resolution crystal structures of the three SpCas9 variants in complexes with a single-guide RNA and its altered PAM-containing, partially double-stranded DNA targets. A structural comparison of the three SpCas9 variants with wild-type SpCas9 revealed that the multiple mutations synergistically induce an unexpected displacement in the phosphodiester backbone of the PAM duplex, thereby allowing the SpCas9 variants to directly recognize the altered PAM nucleotides. Our findings explain the altered PAM specificities of the SpCas9 variants and establish a framework for further rational engineering of CRISPR-Cas9. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Structural and biochemical analysis of atypically low dephosphorylating activity of human dual-specificity phosphatase 28.

    Bonsu Ku

    Full Text Available Dual-specificity phosphatases (DUSPs constitute a subfamily of protein tyrosine phosphatases, and are intimately involved in the regulation of diverse parameters of cellular signaling and essential biological processes. DUSP28 is one of the DUSP subfamily members that is known to be implicated in the progression of hepatocellular and pancreatic cancers, and its biological functions and enzymatic characteristics are mostly unknown. Herein, we present the crystal structure of human DUSP28 determined to 2.1 Å resolution. DUSP28 adopts a typical DUSP fold, which is composed of a central β-sheet covered by α-helices on both sides and contains a well-ordered activation loop, as do other enzymatically active DUSP proteins. The catalytic pocket of DUSP28, however, appears hardly accessible to a substrate because of the presence of nonconserved bulky residues in the protein tyrosine phosphatase signature motif. Accordingly, DUSP28 showed an atypically low phosphatase activity in the biochemical assay, which was remarkably improved by mutations of two nonconserved residues in the activation loop. Overall, this work reports the structural and biochemical basis for understanding a putative oncological therapeutic target, DUSP28, and also provides a unique mechanism for the regulation of enzymatic activity in the DUSP subfamily proteins.

  13. Systematic determination of the mosaic structure of bacterial genomes: species backbone versus strain-specific loops

    Gendrault-Jacquemard A

    2005-07-01

    Full Text Available Abstract Background Public databases now contain multitude of complete bacterial genomes, including several genomes of the same species. The available data offers new opportunities to address questions about bacterial genome evolution, a task that requires reliable fine comparison data of closely related genomes. Recent analyses have shown, using pairwise whole genome alignments, that it is possible to segment bacterial genomes into a common conserved backbone and strain-specific sequences called loops. Results Here, we generalize this approach and propose a strategy that allows systematic and non-biased genome segmentation based on multiple genome alignments. Segmentation analyses, as applied to 13 different bacterial species, confirmed the feasibility of our approach to discern the 'mosaic' organization of bacterial genomes. Segmentation results are available through a Web interface permitting functional analysis, extraction and visualization of the backbone/loops structure of documented genomes. To illustrate the potential of this approach, we performed a precise analysis of the mosaic organization of three E. coli strains and functional characterization of the loops. Conclusion The segmentation results including the backbone/loops structure of 13 bacterial species genomes are new and available for use by the scientific community at the URL: http://genome.jouy.inra.fr/mosaic.

  14. Specific chemical and structural damage to proteins produced by synchrotron radiation.

    Weik, M; Ravelli, R B; Kryger, G; McSweeney, S; Raves, M L; Harel, M; Gros, P; Silman, I; Kroon, J; Sussman, J L

    2000-01-18

    Radiation damage is an inherent problem in x-ray crystallography. It usually is presumed to be nonspecific and manifested as a gradual decay in the overall quality of data obtained for a given crystal as data collection proceeds. Based on third-generation synchrotron x-ray data, collected at cryogenic temperatures, we show for the enzymes Torpedo californica acetylcholinesterase and hen egg white lysozyme that synchrotron radiation also can cause highly specific damage. Disulfide bridges break, and carboxyl groups of acidic residues lose their definition. Highly exposed carboxyls, and those in the active site of both enzymes, appear particularly susceptible. The catalytic triad residue, His-440, in acetylcholinesterase, also appears to be much more sensitive to radiation damage than other histidine residues. Our findings have direct practical implications for routine x-ray data collection at high-energy synchrotron sources. Furthermore, they provide a direct approach for studying the radiation chemistry of proteins and nucleic acids at a detailed, structural level and also may yield information concerning putative "weak links" in a given biological macromolecule, which may be of structural and functional significance.

  15. Non-verbal emotion communication training induces specific changes in brain function and structure.

    Kreifelts, Benjamin; Jacob, Heike; Brück, Carolin; Erb, Michael; Ethofer, Thomas; Wildgruber, Dirk

    2013-01-01

    The perception of emotional cues from voice and face is essential for social interaction. However, this process is altered in various psychiatric conditions along with impaired social functioning. Emotion communication trainings have been demonstrated to improve social interaction in healthy individuals and to reduce emotional communication deficits in psychiatric patients. Here, we investigated the impact of a non-verbal emotion communication training (NECT) on cerebral activation and brain structure in a controlled and combined functional magnetic resonance imaging (fMRI) and voxel-based morphometry study. NECT-specific reductions in brain activity occurred in a distributed set of brain regions including face and voice processing regions as well as emotion processing- and motor-related regions presumably reflecting training-induced familiarization with the evaluation of face/voice stimuli. Training-induced changes in non-verbal emotion sensitivity at the behavioral level and the respective cerebral activation patterns were correlated in the face-selective cortical areas in the posterior superior temporal sulcus and fusiform gyrus for valence ratings and in the temporal pole, lateral prefrontal cortex and midbrain/thalamus for the response times. A NECT-induced increase in gray matter (GM) volume was observed in the fusiform face area. Thus, NECT induces both functional and structural plasticity in the face processing system as well as functional plasticity in the emotion perception and evaluation system. We propose that functional alterations are presumably related to changes in sensory tuning in the decoding of emotional expressions. Taken together, these findings highlight that the present experimental design may serve as a valuable tool to investigate the altered behavioral and neuronal processing of emotional cues in psychiatric disorders as well as the impact of therapeutic interventions on brain function and structure.

  16. Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

    Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

    2017-10-18

    G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  17. Structure, stability and behaviour of nucleic acids in ionic liquids

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  18. The retinal specific CD147 Ig0 domain: from molecular structure to biological activity

    Redzic, Jasmina S.; Armstrong, Geoffrey S.; Isern, Nancy G.; Jones, David N.M.; Kieft, Jeffrey S.; Eisenmesser, Elan Z.

    2011-06-18

    CD147 is a type I transmembrane protein that is involved in inflammatory diseases, cancer progression, and multiple human pathogens utilize CD147 for efficient infection. In several cancers, CD147 expression is so high that it is now used as a prognostic marker. The two primary isoforms of CD147 that are related to cancer progression have been identified, differing in their number of immunoglobulin (Ig)-like domains. These include CD147 Ig1-Ig2 that is ubiquitously expressed in most tissues and CD147 Ig0-Ig1-Ig2 that is retinal specific and implicated in retinoblastoma. However, little is known in regard to the retinal specific CD147 Ig0 domain despite its potential role in retinoblastoma. Thus, here we have extensively characterized the CD147 Ig0 domain by elucidating its three-dimensional structure through crystallography and its solution behavior through several biophysical methods that include nuclear magnetic resonance. Furthermore, we have utilized this data together with mutagenesis to probe the biological activity of CD147-containing proteins both with and without the CD147 Ig0 domain within several model cell lines. Our findings reveal that the CD147 Ig0 domain is a potent stimulator of interleukin-6, which is a well-known contributor to retinoblastoma and suggest that the CD147 Ig0 domain has its own receptor distinct from that of the other CD147 Ig-like domains, CD147 Ig1-Ig2. Furthermore, we show that the CD147 Ig0 dimer is the functional unit required for activity and can be disrupted by a single point mutation.

  19. Adenovirus structural protein IIIa is involved in the serotype specificity of viral DNA packaging.

    Ma, Hsin-Chieh; Hearing, Patrick

    2011-08-01

    The packaging of the adenovirus (Ad) genome into a capsid displays serotype specificity. This specificity has been attributed to viral packaging proteins, the IVa2 protein and the L1-52/55K protein. We previously found that the Ad17 L1-52/55K protein was not able to complement the growth of an Ad5 L1-52/55K mutant virus, whereas two other Ad17 packaging proteins, IVa2 and L4-22K, could complement the growth of Ad5 viruses with mutations in the respective genes. In this report, we investigated why the Ad17 L1-52/55K protein was not able to complement the Ad5 L1-52/55K mutant virus. We demonstrate that the Ad17 L1-52/55K protein binds to the Ad5 IVa2 protein in vitro and the Ad5 packaging domain in vivo, activities previously associated with packaging function. The Ad17 L1-52/55K protein also associates with empty Ad5 capsids. Interestingly, we find that the Ad17 L1-52/55K protein is able to complement the growth of an Ad5 L1-52/55K mutant virus in conjunction with the Ad17 structural protein IIIa. The same result was found with the L1-52/55K and IIIa proteins of several other Ad serotypes, including Ad3 and Ad4. The Ad17 IIIa protein associates with empty Ad5 capsids. Consistent with the complementation results, we find that the IIIa protein interacts with the L1-52/55K protein in vitro and associates with the viral packaging domain in vivo. These results underscore the complex nature of virus assembly and genome encapsidation and provide a new model for how the viral genome may tether to the empty capsid during the encapsidation process.

  20. Structural basis of glycan specificity of P[19] VP8*: Implications for rotavirus zoonosis and evolution.

    Liu, Yang; Xu, Shenyuan; Woodruff, Andrew L; Xia, Ming; Tan, Ming; Kennedy, Michael A; Jiang, Xi

    2017-11-01

    Recognition of specific cell surface glycans, mediated by the VP8* domain of the spike protein VP4, is the essential first step in rotavirus (RV) infection. Due to lack of direct structural information of virus-ligand interactions, the molecular basis of ligand-controlled host ranges of the major human RVs (P[8] and P[4]) in P[II] genogroup remains unknown. Here, through characterization of a minor P[II] RV (P[19]) that can infect both animals (pigs) and humans, we made an important advance to fill this knowledge gap by solving the crystal structures of the P[19] VP8* in complex with its ligands. Our data showed that P[19] RVs use a novel binding site that differs from the known ones of other genotypes/genogroups. This binding site is capable of interacting with two types of glycans, the mucin core and type 1 histo-blood group antigens (HBGAs) with a common GlcNAc as the central binding saccharide. The binding site is apparently shared by other P[II] RVs and possibly two genotypes (P[10] and P[12]) in P[I] as shown by their highly conserved GlcNAc-interacting residues. These data provide strong evidence of evolutionary connections among these human and animal RVs, pointing to a common ancestor in P[I] with a possible animal host origin. While the binding properties to GlcNAc-containing saccharides are maintained, changes in binding to additional residues, such as those in the polymorphic type 1 HBGAs may occur in the course of RV evolution, explaining the complex P[II] genogroup that mainly causes diseases in humans but also in some animals.

  1. STRUCTURAL AND CONTENT-RELATED SPECIFICITY OF PROGRAMME LITERARY CRITICISM TEXTS IN THE JOURNAL

    Shilnikova Olga Gennadyevna

    2015-06-01

    Full Text Available The article specifies the notions of the structural, content-related, figurative, and functional characteristics of the texts which are traditionally referred to the group of informational genres of journalism. This lets us update the system of factors that influence the formation of the texts' genre specificity in the mass media. The analysis of programme literary criticism speeches published in the journals of N.M. Karamzin – Moskovsky Zhurnal, Vestnik Evropy – shows that not only rational and logical structures accomplish the constructive function in the text-formation mechanisms of such publications. The use of imaginative resources of journalistic and artistic discourses plays an important role in the implementation of the author's intentions. The supplementation of programme texts with the components non-typical of informational genres (lyrical and biographical fragments, expressive lexis, artistic and journalistic forms of the author's subjectivity expression is conditioned by organic interaction of several pragmatic goals in the texts, such as: informational, author's individual (Karamzin as a personality, and author's professional (Karamzin as an editor, writer, literary critic. These peculiarities together with a subtext contribute to the formation of new features of programme publications, which are not common for informational genres such as aesthetic function and multi-discursivity, reflected in semantic, expressive and vocabulary redundance. They also expand the range of possible effects on audience – cognitive, emotive, behavioral and communicative. As a result, a unique informational text of a programme type is formed. Therefore, a strict differentiation of genre forms of journal texts is only possible when taking into consideration all the possible text goals, as well as its role in the organization of common-journal discourse and publication policy.

  2. Site specific replacements of a single loop nucleoside with a dibenzyl linker may switch the activity of TBA from anticoagulant to antiproliferative.

    Scuotto, Maria; Rivieccio, Elisa; Varone, Alessia; Corda, Daniela; Bucci, Mariarosaria; Vellecco, Valentina; Cirino, Giuseppe; Virgilio, Antonella; Esposito, Veronica; Galeone, Aldo; Borbone, Nicola; Varra, Michela; Mayol, Luciano

    2015-09-18

    Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13. © Crown copyright 2015.

  3. Structural specificity of chloroquine-hematin binding related to inhibition of hematin polymerization and parasite growth.

    Vippagunta, S R; Dorn, A; Matile, H; Bhattacharjee, A K; Karle, J M; Ellis, W Y; Ridley, R G; Vennerstrom, J L

    1999-11-04

    Considerable data now support the hypothesis that chloroquine (CQ)-hematin binding in the parasite food vacuole leads to inhibition of hematin polymerization and parasite death by hematin poisoning. To better understand the structural specificity of CQ-hematin binding, 13 CQ analogues were chosen and their hematin binding affinity, inhibition of hematin polymerization, and inhibition of parasite growth were measured. As determined by isothermal titration calorimetry (ITC), the stoichiometry data and exothermic binding enthalpies indicated that, like CQ, these analogues bind to two or more hematin mu-oxo dimers in a cofacial pi-pi sandwich-type complex. Association constants (K(a)'s) ranged from 0.46 to 2.9 x 10(5) M(-1) compared to 4.0 x 10(5) M(-1) for CQ. Remarkably, we were not able to measure any significant interaction between hematin mu-oxo dimer and 11, the 6-chloro analogue of CQ. This result indicates that the 7-chloro substituent in CQ is a critical structural determinant in its binding affinity to hematin mu-oxo dimer. Molecular modeling experiments reinforce the view that the enthalpically favorable pi-pi interaction observed in the CQ-hematin mu-oxo dimer complex derives from a favorable alignment of the out-of-plane pi-electron density in CQ and hematin mu-oxo dimer at the points of intermolecular contact. For 4-aminoquinolines related to CQ, our data suggest that electron-withdrawing functional groups at the 7-position of the quinoline ring are required for activity against both hematin polymerization and parasite growth and that chlorine substitution at position 7 is optimal. Our results also confirm that the CQ diaminoalkyl side chain, especially the aliphatic tertiary nitrogen atom, is an important structural determinant in CQ drug resistance. For CQ analogues 1-13, the lack of correlation between K(a) and hematin polymerization IC(50) values suggests that other properties of the CQ-hematin mu-oxo dimer complex, rather than its association

  4. Fluid-Structure Simulations of a Ruptured Intracranial Aneurysm: Constant versus Patient-Specific Wall Thickness

    S. Voß

    2016-01-01

    Full Text Available Computational Fluid Dynamics is intensively used to deepen the understanding of aneurysm growth and rupture in order to support physicians during therapy planning. However, numerous studies considering only the hemodynamics within the vessel lumen found no satisfactory criteria for rupture risk assessment. To improve available simulation models, the rigid vessel wall assumption has been discarded in this work and patient-specific wall thickness is considered within the simulation. For this purpose, a ruptured intracranial aneurysm was prepared ex vivo, followed by the acquisition of local wall thickness using μCT. The segmented inner and outer vessel surfaces served as solid domain for the fluid-structure interaction (FSI simulation. To compare wall stress distributions within the aneurysm wall and at the rupture site, FSI computations are repeated in a virtual model using a constant wall thickness approach. Although the wall stresses obtained by the two approaches—when averaged over the complete aneurysm sac—are in very good agreement, strong differences occur in their distribution. Accounting for the real wall thickness distribution, the rupture site exhibits much higher stress values compared to the configuration with constant wall thickness. The study reveals the importance of geometry reconstruction and accurate description of wall thickness in FSI simulations.

  5. HTTR hydrogen production system. Structure and main specifications of mock-up test facility (Contract research)

    Kato, Michio; Aita, Hideki; Inagaki, Yoshiyuki; Hayashi, Koji; Ohashi, Hirofumi; Sato, Hiroyuki; Iwatsuki, Jin; Takada, Shoji; Inaba, Yoshitomo

    2007-03-01

    The mock-up test facility was fabricated to investigate performance of the steam generator for mitigation of the temperature fluctuation of helium gas and transient behavior of the hydrogen production system for HTTR and to obtain experimental data for verification of a dynamic analysis code. The test facility has an approximate hydrogen production capacity of 120Nm 3 /h and the steam reforming process of methane; CH 4 +H 2 O=3H 2 +CO, was used for hydrogen production of the test facility. An electric heater was used as a heat source instead of the reactor in order to heat helium gas up to 880degC (4MPa) at the chemical reactor inlet which is the same temperature as the HTTR hydrogen production system. Fabrication of the test facility was completed in February in 2002, and seven cycle operations were carried out from March in 2002 to December in 2004. This report describes the structure and main specifications of the test facility. (author)

  6. Determining the depth of certain gravity sources without a priori specification of their structural index

    Zhou, Shuai; Huang, Danian

    2015-11-01

    We have developed a new method for the interpretation of gravity tensor data based on the generalized Tilt-depth method. Cooper (2011, 2012) extended the magnetic Tilt-depth method to gravity data. We take the gradient-ratio method of Cooper (2011, 2012) and modify it so that the source type does not need to be specified a priori. We develop the new method by generalizing the Tilt-depth method for depth estimation for different types of source bodies. The new technique uses only the three vertical tensor components of the full gravity tensor data observed or calculated at different height plane to estimate the depth of the buried bodies without a priori specification of their structural index. For severely noise-corrupted data, our method utilizes different upward continuation height data, which can effectively reduce the influence of noise. Theoretical simulations of the gravity source model with and without noise illustrate the ability of the method to provide source depth information. Additionally, the simulations demonstrate that the new method is simple, computationally fast and accurate. Finally, we apply the method using the gravity data acquired over the Humble Salt Dome in the USA as an example. The results show a good correspondence to the previous drilling and seismic interpretation results.

  7. Structural analysis of the evolution of steroid specificity in the mineralocorticoid and glucocorticoid receptors

    Ollikainen Noah

    2007-02-01

    Full Text Available Abstract Background The glucocorticoid receptor (GR and mineralocorticoid receptor (MR evolved from a common ancestor. Still not completely understood is how specificity for glucocorticoids (e.g. cortisol and mineralocorticoids (e.g. aldosterone evolved in these receptors. Results Our analysis of several vertebrate GRs and MRs in the context of 3D structures of human GR and MR indicates that with the exception of skate GR, a cartilaginous fish, there is a deletion in all GRs, at the position corresponding to Ser-949 in human MR. This deletion occurs in a loop before helix 12, which contains the activation function 2 (AF2 domain, which binds coactivator proteins and influences transcriptional activity of steroids. Unexpectedly, we find that His-950 in human MR, which is conserved in the MR in chimpanzee, orangutan and macaque, is glutamine in all teleost and land vertebrate MRs, including New World monkeys and prosimians. Conclusion Evolution of differences in the responses of the GR and MR to corticosteroids involved deletion in the GR of a residue corresponding to Ser-949 in human MR. A mutation corresponding to His-950 in human MR may have been important in physiological changes associated with emergence of Old World monkeys from prosimians.

  8. The RecQ helicase-topoisomerase III-Rmi1 complex: a DNA structure-specific 'dissolvasome'?

    Mankouri, Hocine W; Hickson, Ian D

    2007-01-01

    structures, and we propose here that it functions in a coordinated fashion as a DNA structure-specific 'dissolvasome'. Little is known about how the RTR complex might be regulated or targeted to various DNA structures in vivo. Recent findings indicate that the components of the RTR complex might activate...... the cell cycle checkpoint machinery as well as be a target of checkpoint kinases, suggesting that these events are crucial to ensure faithful DNA replication and chromosome segregation....

  9. High-resolution AFM structure of DNA G-wires in aqueous solution.

    Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

    2018-05-17

    We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

  10. MNE SPECIFIC FACTORS OF CORPORATE CAPITAL STRUCTURE: COMPARATIVE ANALYSIS IN TERMS OF FINANCIAL RESOURCES DEMAND AND SUPPLY

    Sergiy Tsyganov

    2015-11-01

    Full Text Available This paper investigates corporate capital structure of multinational enterprises. Its core subject is focused on corporate capital structure defining factors that are specific for MNE rather than for domestic corporations. Substantial part of scientific literature concentrates on country specific and firm specific factors of corporate capital structure with most research devoted to domestic corporations. The main goal of our paper is to discover among plenty of corporate capital structure factors those that are specific for MNE and to develop a new approach for analyzing these factors in terms of financial resources demand and supply. There are some corporate capital structure factors that influence directly and some that have indirect influence while there is also another set of factors having both direct and indirect influence on indebtedness. Different theoretical and empirical research confirm different directions. Methodology of our study is based on analysis of two fundamental market driving forces that are demand and supply. Their influence on corporate capital structure is of a primary origin and that is why the suggested approach is to our mind theoretically significant and practically important. Demand factors imply that a corporation creates demand for financial resources and its capital structure is defined internally. Supply factors imply an external capital structure since it is created by external investors’ supply of financial resources. On empirical level, we use the primary data of corporate financial statements to analyze the leverage of MNE based in different countries and representing different industries. The key results of our study show that the main MNE specific factors of capital structure include such demand factors as multinationality level, assets tangibility and political risk. The first two are firm specific factors that can influence corporate capital structure either directly or indirectly according to

  11. Capital structure around the world: The roles of firm- and country-specific determinants

    de Jong, Abe; Kabir, Mohammed Rezaul; Nguyen, Thuy Thu

    2008-01-01

    We analyze the importance of firm-specific and country-specific factors in the leverage choice of firms from 42 countries around the world. Our analysis yields two new results. First, we find that firm-specific determinants of leverage differ across countries, while prior studies implicitly assume

  12. Capital Structure around the World: The Roles of Firm- and Country-Specific Determinants

    A. de Jong (Abe); R. Kabir (Rezaul); T.T. Nguyen (Thuy Thu)

    2007-01-01

    textabstractWe analyze the importance of firm-specific and country-specific factors in the leverage choice of firms from 42 countries around the world. Our analysis yields two new results. First, we find that firm-specific determinants of leverage differ across countries, while prior studies

  13. Disease-specific structural changes in thalamus and dentatorubrothalamic tract in progressive supranuclear palsy

    Surova, Yulia; Hall, Sara; Widner, Haakan [Lund University, Department of Clinical Sciences, Lund (Sweden); Skaane University Hospital, Department of Neurology, Lund (Sweden); Nilsson, Markus [Lund University, Lund University Bioimaging Center, Lund (Sweden); Laett, Jimmy [Skaane University Hospital, Center for Medical Imaging and Physiology, Lund (Sweden); Lampinen, Bjoern [Lund University, Department of Medical Radiation Physics, Lund (Sweden); Lindberg, Olof [Malmoe, Lund University, Department of Clinical Sciences, Malmoe (Sweden); Nilsson, Christer [Skaane University Hospital, Department of Neurology, Lund (Sweden); Malmoe, Lund University, Department of Clinical Sciences, Malmoe (Sweden); Westen, Danielle van [Lund University, Department of Clinical Sciences, Lund (Sweden); Skaane University Hospital, Center for Medical Imaging and Physiology, Lund (Sweden); Hansson, Oskar [Malmoe, Lund University, Department of Clinical Sciences, Malmoe (Sweden); Skaane University Hospital, Memory Clinic, Lund (Sweden)

    2015-11-15

    The aim of this study is to identify disease-specific changes of the thalamus, basal ganglia, pons, and midbrain in patients with progressive supranuclear palsy (PSP), Parkinson's disease (PD), and multiple system atrophy with predominant parkinsonism (MSA-P) using diffusion tensor imaging and volumetric analysis. MRI diffusion and volumetric data were acquired in a derivation of 30 controls and 8 patients with PSP and a validation cohort comprised of controls (n = 21) and patients with PSP (n = 27), PD (n = 10), and MSA-P (n = 11). Analysis was performed using regions of interest (ROI), tract-based spatial statistic (TBSS), and tractography and results compared between diagnostic groups. In the derivation cohort, we observed increased mean diffusivity (MD) in the thalamus, superior cerebellar peduncle, and the midbrain in PSP compared to controls. Furthermore, volumetric analysis showed reduced thalamic volumes in PSP. In the validation cohort, the observations of increased MD were replicated by ROI-based analysis and in the thalamus by TBSS-based analysis. Such differences were not found for patients with PD in any of the cohorts. Tractography of the dentatorubrothalamic tract (DRTT) showed increased MD in PSP patients from both cohorts compared to controls and in the validation cohort in PSP compared to PD and MSA patients. Increased MD in the thalamus and along the DRTT correlated with disease stage and motor function in PSP. Patients with PSP, but not PD or MSA-P, exhibit signs of structural abnormalities in the thalamus and in the DRTT. These changes are associated with disease stage and impaired motor function. (orig.)

  14. Disease-specific structural changes in thalamus and dentatorubrothalamic tract in progressive supranuclear palsy

    Surova, Yulia; Hall, Sara; Widner, Haakan; Nilsson, Markus; Laett, Jimmy; Lampinen, Bjoern; Lindberg, Olof; Nilsson, Christer; Westen, Danielle van; Hansson, Oskar

    2015-01-01

    The aim of this study is to identify disease-specific changes of the thalamus, basal ganglia, pons, and midbrain in patients with progressive supranuclear palsy (PSP), Parkinson's disease (PD), and multiple system atrophy with predominant parkinsonism (MSA-P) using diffusion tensor imaging and volumetric analysis. MRI diffusion and volumetric data were acquired in a derivation of 30 controls and 8 patients with PSP and a validation cohort comprised of controls (n = 21) and patients with PSP (n = 27), PD (n = 10), and MSA-P (n = 11). Analysis was performed using regions of interest (ROI), tract-based spatial statistic (TBSS), and tractography and results compared between diagnostic groups. In the derivation cohort, we observed increased mean diffusivity (MD) in the thalamus, superior cerebellar peduncle, and the midbrain in PSP compared to controls. Furthermore, volumetric analysis showed reduced thalamic volumes in PSP. In the validation cohort, the observations of increased MD were replicated by ROI-based analysis and in the thalamus by TBSS-based analysis. Such differences were not found for patients with PD in any of the cohorts. Tractography of the dentatorubrothalamic tract (DRTT) showed increased MD in PSP patients from both cohorts compared to controls and in the validation cohort in PSP compared to PD and MSA patients. Increased MD in the thalamus and along the DRTT correlated with disease stage and motor function in PSP. Patients with PSP, but not PD or MSA-P, exhibit signs of structural abnormalities in the thalamus and in the DRTT. These changes are associated with disease stage and impaired motor function. (orig.)

  15. Structure, specific surface area and thermal conductivity of the snowpack around Barrow, Alaska

    Domine, Florent; Gallet, Jean-Charles; Bock, Josué; Morin, Samuel

    2012-07-01

    The structure of the snowpack near Barrow was studied in March-April 2009. Vertical profiles of density, specific surface area (SSA) and thermal conductivity were measured on tundra, lakes and landfast ice. The average thickness was 41 cm on tundra and 21 cm on fast ice. Layers observed were diamond dust or recent wind drifts on top, overlaying wind slabs, occasional faceted crystals and melt-freeze crusts, and basal depth hoar layers. The top layer had a SSA between 45 and 224 m2 kg-1. All layers at Barrow had SSAs higher than at many other places because of the geographical and climatic characteristics of Barrow. In particular, a given snow layer was remobilized several times by frequent winds, which resulted in SSA increases each time. The average snow area index (SAI, the dimensionless vertically integrated SSA) on tundra was 3260, higher than in the Canadian High Arctic or in the Alaskan taiga. This high SAI, combined with low snow temperatures, imply that the Barrow snowpack efficiently traps persistent organic pollutants, as illustrated with simple calculations for PCB 28 and PCB 180. The average thermal conductivity was 0.21 Wm-1 K-1, and the average thermal resistance on tundra was 3.25 m2 K W-1. This low value partly explains why the snow-ground interface was cold, around -19°C. The high SAI and low thermal resistance values illustrate the interplay between climate, snow physical properties, and their potential impact on atmospheric chemistry, and the need to describe these relationships in models of polar climate and atmospheric chemistry, especially in a climate change context.

  16. Serotype-specific Differences in Dengue Virus Non-structural Protein 5 Nuclear Localization*

    Hannemann, Holger; Sung, Po-Yu; Chiu, Han-Chen; Yousuf, Amjad; Bird, Jim; Lim, Siew Pheng; Davidson, Andrew D.

    2013-01-01

    The four serotypes of dengue virus (DENV-1 to -4) cause the most important arthropod-borne viral disease of humans. DENV non-structural protein 5 (NS5) contains enzymatic activities required for capping and replication of the viral RNA genome that occurs in the host cytoplasm. However, previous studies have shown that DENV-2 NS5 accumulates in the nucleus during infection. In this study, we examined the nuclear localization of NS5 for all four DENV serotypes. We demonstrate for the first time that there are serotypic differences in NS5 nuclear localization. Whereas the DENV-2 and -3 proteins accumulate in the nucleus, DENV-1 and -4 NS5 are predominantly if not exclusively localized to the cytoplasm. Comparative studies on the DENV-2 and -4 NS5 proteins revealed that the difference in DENV-4 NS5 nuclear localization was not due to rapid nuclear export but rather the lack of a functional nuclear localization sequence. Interaction studies using DENV-2 and -4 NS5 and human importin-α isoforms failed to identify an interaction that supported the differential nuclear localization of NS5. siRNA knockdown of the human importin-α isoform KPNA2, corresponding to the murine importin-α isoform previously shown to bind to DENV-2 NS5, did not substantially affect DENV-2 NS5 nuclear localization, whereas knockdown of importin-β did. The serotypic differences in NS5 nuclear localization did not correlate with differences in IL-8 gene expression. The results show that NS5 nuclear localization is not strictly required for virus replication but is more likely to have an auxiliary function in the life cycle of specific DENV serotypes. PMID:23770669

  17. Serotype-specific differences in dengue virus non-structural protein 5 nuclear localization.

    Hannemann, Holger; Sung, Po-Yu; Chiu, Han-Chen; Yousuf, Amjad; Bird, Jim; Lim, Siew Pheng; Davidson, Andrew D

    2013-08-02

    The four serotypes of dengue virus (DENV-1 to -4) cause the most important arthropod-borne viral disease of humans. DENV non-structural protein 5 (NS5) contains enzymatic activities required for capping and replication of the viral RNA genome that occurs in the host cytoplasm. However, previous studies have shown that DENV-2 NS5 accumulates in the nucleus during infection. In this study, we examined the nuclear localization of NS5 for all four DENV serotypes. We demonstrate for the first time that there are serotypic differences in NS5 nuclear localization. Whereas the DENV-2 and -3 proteins accumulate in the nucleus, DENV-1 and -4 NS5 are predominantly if not exclusively localized to the cytoplasm. Comparative studies on the DENV-2 and -4 NS5 proteins revealed that the difference in DENV-4 NS5 nuclear localization was not due to rapid nuclear export but rather the lack of a functional nuclear localization sequence. Interaction studies using DENV-2 and -4 NS5 and human importin-α isoforms failed to identify an interaction that supported the differential nuclear localization of NS5. siRNA knockdown of the human importin-α isoform KPNA2, corresponding to the murine importin-α isoform previously shown to bind to DENV-2 NS5, did not substantially affect DENV-2 NS5 nuclear localization, whereas knockdown of importin-β did. The serotypic differences in NS5 nuclear localization did not correlate with differences in IL-8 gene expression. The results show that NS5 nuclear localization is not strictly required for virus replication but is more likely to have an auxiliary function in the life cycle of specific DENV serotypes.

  18. Single event upset test structures for digital CMOS application specific integrated circuits

    Baze, M.P.; Bartholet, W.G.; Braatz, J.C.; Dao, T.A.

    1993-01-01

    An approach has been developed for the design and utilization of SEU test structures for digital CMOS ASICs. This approach minimizes the number of test structures required by categorizing ASIC library cells according to their SEU response and designing a structure to characterize each response for each category. Critical SEU response parameters extracted from these structures are used to evaluate the SEU hardness of ASIC libraries and predict the hardness of ASIC chips

  19. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  20. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents

    Belmonte-Reche, E.; Martínez-García, M.; Guédin, A.; Zuffo, M.; Arevalo-Ruiz, M.; Doria, F.; Campos-Salinas, J.; Maynadier, M.; Lopez-Rubio, J.J.; Freccero, M.; Mergny, Jean-Louis; Maria Perez-Victoria, J.; Carlos Morales, J.

    2018-01-01

    Roč. 61, č. 3 (2018), s. 1231-1240 ISSN 0022-2623 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : terminal repeat promoter * plasmodium-falciparum Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 6.259, year: 2016

  1. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla

    2017-01-01

    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  2. Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs

    Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I

    2014-01-01

    Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...

  3. ReMixT: clone-specific genomic structure estimation in cancer.

    McPherson, Andrew W; Roth, Andrew; Ha, Gavin; Chauve, Cedric; Steif, Adi; de Souza, Camila P E; Eirew, Peter; Bouchard-Côté, Alexandre; Aparicio, Sam; Sahinalp, S Cenk; Shah, Sohrab P

    2017-07-27

    Somatic evolution of malignant cells produces tumors composed of multiple clonal populations, distinguished in part by rearrangements and copy number changes affecting chromosomal segments. Whole genome sequencing mixes the signals of sampled populations, diluting the signals of clone-specific aberrations, and complicating estimation of clone-specific genotypes. We introduce ReMixT, a method to unmix tumor and contaminating normal signals and jointly predict mixture proportions, clone-specific segment copy number, and clone specificity of breakpoints. ReMixT is free, open-source software and is available at http://bitbucket.org/dranew/remixt .

  4. Site-specific optimisation of the countermeasure structure on rehabilitation of radioactive contaminated territories

    Yatsalo, B.I.; Okhrimenko, D.V.; Lisyanski, B.G.; Okhrimenko, I.V.; Mirzeabassov, O.A.

    2000-01-01

    The use of 'soft' countermeasures (CMs) (agricultural CMs, some administrative ones, except for relocation/resettlement and some 'strong' measures on restriction of living conditions) allows considering the radiological and economic parameters for assessing their effectiveness. In this case cost-benefit analysis (CBA) or some its modification are used. However, the determination of various radiological and economic parameters (and their combination) is not enough for making final decisions on countermeasure implementation. All radiological, ecological and economic characteristics and other expert knowledge, corresponding standards and regulations should be taken into account, and many of them may not be used very often in analytical methods directly. The approaches to evaluating strong' CMs are based, as a rule, on expert judgements (MAUA, M-Crit). However, in practice they can lead to any result given in advance or to a choice of an weighted solution which does not comply with opinions by most experts due to considerable range of expert opinions and subjective weights for chosen attributes/criteria. Implementation of CMs on rehabilitation of contaminated territories should be based on the radiation protection principles. However, these principles are declared only when realising CMs on rehabilitation of contaminated territories after the Chernobyl accident. In practice some national or departmental standards are used and principles of justification'/'optimisation' are not examined. Taking into consideration a complex character of tasks on CM analysis and comparison of various alternatives it is quite necessary to use up-to-date computer decision support systems (DSSs). One of the systems which is directly intended for site-specific rehabilitation of territories subjected to radioactive contamination after the Chernobyl accident is the PRANA DSS. A key block of PRANA is 'analysis and optimisation of CMs structure'. It is intended for : -determination of territories

  5. Site-specific optimisation of the countermeasure structure on rehabilitation of radioactive contaminated territories

    Yatsalo, B.I.; Okhrimenko, D.V.; Lisyanski, B.G.; Okhrimenko, I.V.; Mirzeabassov, O.A. [Obninsk Institute of Nuclear Power Engineering, Obninsk, Kaluga (Russian Federation)

    2000-05-01

    The use of 'soft' countermeasures (CMs) (agricultural CMs, some administrative ones, except for relocation/resettlement and some 'strong' measures on restriction of living conditions) allows considering the radiological and economic parameters for assessing their effectiveness. In this case cost-benefit analysis (CBA) or some its modification are used. However, the determination of various radiological and economic parameters (and their combination) is not enough for making final decisions on countermeasure implementation. All radiological, ecological and economic characteristics and other expert knowledge, corresponding standards and regulations should be taken into account, and many of them may not be used very often in analytical methods directly. The approaches to evaluating strong' CMs are based, as a rule, on expert judgements (MAUA, M-Crit). However, in practice they can lead to any result given in advance or to a choice of an weighted solution which does not comply with opinions by most experts due to considerable range of expert opinions and subjective weights for chosen attributes/criteria. Implementation of CMs on rehabilitation of contaminated territories should be based on the radiation protection principles. However, these principles are declared only when realising CMs on rehabilitation of contaminated territories after the Chernobyl accident. In practice some national or departmental standards are used and principles of justification'/'optimisation' are not examined. Taking into consideration a complex character of tasks on CM analysis and comparison of various alternatives it is quite necessary to use up-to-date computer decision support systems (DSSs). One of the systems which is directly intended for site-specific rehabilitation of territories subjected to radioactive contamination after the Chernobyl accident is the PRANA DSS. A key block of PRANA is 'analysis and optimisation of CMs structure

  6. Professional masters in science education: structure, specificity, effectivity and teaching professional development

    Alberto Villani

    2017-04-01

    Full Text Available Historically teacher education constituted an important object of study and actions in the field of Science education. Between these actions, the professional masters (PM in Science education represent one of the most challenging and broader movements in teacher training up to this moment. However, the literature in the field is still rare and dispersed. Considering the complexity of this project and its singularity as a case of teacher training, due to its standard orientations, its large volume of people and institutions involved, it is important and necessary to produce a wider view of this initiative that has a history of 15 years and was characterized by many disagreements and changes. One of the possibilities to produce this wider view is through a state of art that organize and analyse the actual production in this field. In order to monitor these contributions we conducted a study such as “State of Art” based on the meta analysis guidance, thus, though a critical analysis we faced the challenge to discuss the scientific production on this theme. Therefore, we searched in all journals of education and science education, evaluated as A1 to B4 at Qualis/Capes published from 2000 to 2015, for articles published on this theme and selected 26 to analyse. Based on the empirical analysis of this corpus two categories were defined a-posteriori, representing the main themes whereupon the articles aimed to contribute: the wider nature of PM courses – structure, specificity and efectivity; and the Professional Master in Science Teaching (PMST and the professional development. The first category allowed us to identify the characteristics of the PM courses based on their curricular structure, faculty and educational projects. We highlight the fact that, since its creation, the PMST carry controversies about its singular characteristics. The opposition between its goals and the academic master in science teaching are constantly being used to find

  7. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  8. A Structure-Function Study of RecA: The Structural Basis for ATP Specificity in the Strand Exchange Reaction

    Gegner, Julie; Spruill, Natalie; Plesniak, Leigh A.

    1999-11-01

    The terms "structure" and "function" can assume a variety of meanings. In biochemistry, the "structure" of a protein can refer to its sequence of amino acids, the three-dimensional arrangement of atoms within a subunit, or the arrangement of subunits into a larger oligomeric or filamentous state. Likewise, the function of biological macromolecules can be examined at many levels. The function of a protein can be described by its role in an organism's survival or by a chemical reaction that it promotes. We have designed a three-part biochemical laboratory experiment that characterizes the structure and function of the Escherichia coli RecA protein. The first part examines the importance of RecA in the survival of bacteria that have been exposed to UV light. This is the broadest view of function of the enzyme. Second, the students use an in vitro assay of RecA whereby the protein promotes homologous recombination. Because RecA functions not catalytically, but rather stoichiometrically, in this recombination reaction, the oligomeric state of RecA in complex with DNA must also be discussed. Finally, through molecular modeling of X-ray crystallographic structures, students identify functionally important features of the ATP cofactor binding site of RecA.

  9. Finite Element Analysis and Die Design of Non-specific Engineering Structure of Aluminum Alloy during Extrusion

    Chen, D.-C.; Lu, Y.-Y.

    2010-01-01

    Aluminum extension applies to industrial structure, light load, framework rolls and conveyer system platform. Many factors must be controlled in processing the non-specific engineering structure (hollow shape) of the aluminum alloy during extrusion, to obtain the required plastic strain and desired tolerance values. The major factors include the forming angle of the die and temperature of billet and various materials. This paper employs rigid-plastic finite element (FE) DEFORM 3D software to investigate the plastic deformation behavior of an aluminum alloy (A6061, A5052, A3003) workpiece during extrusion for the engineering structure of the aluminum alloy. This work analyzes effective strain, effective stress, damage and die radius load distribution of the billet under various conditions. The analytical results confirm the suitability of the current finite element software for the non-specific engineering structure of aluminum alloy extrusion.

  10. Paralog-Specific Patterns of Structural Disorder and Phosphorylation in the Vertebrate SH3-SH2-Tyrosine Kinase Protein Family.

    Dos Santos, Helena G; Siltberg-Liberles, Jessica

    2016-09-19

    One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Pairwise structure alignment specifically tuned for surface pockets and interaction interfaces

    Cui, Xuefeng

    2015-09-09

    To detect and evaluate the similarities between the three-dimensional (3D) structures of two molecules, various kinds of methods have been proposed for the pairwise structure alignment problem [6, 9, 7, 11]. The problem plays important roles when studying the function and the evolution of biological molecules. Recently, pairwise structure alignment methods have been extended and applied on surface pocket structures [10, 3, 5] and interaction interface structures [8, 4]. The results show that, even when there are no global similarities discovered between the global sequences and the global structures, biological molecules or complexes could share similar functions because of well conserved pockets and interfaces. Thus, pairwise pocket and interface structure alignments are promising to unveil such shared functions that cannot be discovered by the well-studied global sequence and global structure alignments. State-of-the-art methods for pairwise pocket and interface structure alignments [4, 5] are direct extensions of the classic pairwise protein structure alignment methods, and thus such methods share a few limitations. First, the goal of the classic protein structure alignment methods is to align single-chain protein structures (i.e., a single fragment of residues connected by peptide bonds). However, we observed that pockets and interfaces tend to consist of tens of extremely short backbone fragments (i.e., three or fewer residues connected by peptide bonds). Thus, existing pocket and interface alignment methods based on the protein structure alignment methods still rely on the existence of long-enough backbone fragments, and the fragmentation issue of pockets and interfaces rises the risk of missing the optimal alignments. Moreover, existing interface structure alignment methods focus on protein-protein interfaces, and require a "blackbox preprocessing" before aligning protein-DNA and protein-RNA interfaces. Therefore, we introduce the PROtein STucture Alignment

  12. Industry-specificities and Size of Corporations: Determinants of Ownership Structures

    van der Elst, C.

    This paper analyses ownership concentration in six European countries and empirically studies the rent-seeking theory. This theory states that ownership concentration not only depends on the level of investor protection but also on company-specific and industry-specific parameters. This study

  13. Science Student Role: Evidence of Social Structural Norms Specific to School Science

    Shanahan, Marie-Claire; Nieswandt, Martina

    2011-01-01

    Sociocultural studies of science education have consistently recognized the dialectic nature of students' agency to create and author positions for themselves and the structural constraints that may influence them. This mixed-methods study explores one particular aspect of these potential constraints: the possibility of a social structure specific…

  14. Specification of indoor climate design parameters at the assessment of moisture protective properties of enclosing structures

    Kornienko Sergey Valer’evich

    2016-11-01

    Full Text Available Due to wide implementation of enveloping structures with increased heat-insulation properties in modern construction here appeared a necessity to assess their moisture conditions. Assessment of moisture conditions of enveloping structures is carried out according to maximum allowable moisture state basing on determining the surface of maximum damping. In relation to it the necessity of additional vapour barrier is checked using moisture balance equation. Though the change of indoor climate parameters in premises is not taken into account in moisture balance equations defined for different seasons. The author improves the method of calculating moisture protective parameters of enclosing structures according to the maximum allowable damping state for a year and a period of moisture accumulation. It is shown in this article that accounting of temperature and relative humidity change of inside air allows specifying calculated parameters of indoor climate in residential and office rooms in assessment of moisture protective properties of enclosing structures for the case of an effective enclosing structure with a façade heat-insulation composite system. Coordinates of the maximum moistened surface of the envelope depends on indoor climate design parameters. It is concluded that the increase of requirements for moisture protection of enclosing structures when using design values of temperature and relative humidity of internal air according to the Russian regulation (SP 50.13330.2012 is not always reasonable. Accounting of changes of indoor climate parameters allows more precise assessment of moisture protective properties of enclosing structures during their design.

  15. Changes in cell surface structure by viral transformation studied by binding of lectins differing in sugar specificity.

    Tsuda, M; Kurokawa, T; Takeuchi, M; Sugino, Y

    1975-10-01

    Changes in cell surface structure by viral transformation were studied by examining changes in the binding of various lectins differing in carbohydrate specificities. Binding of lectins was assayed directly using cells grown in coverslips. The following 125I-lectins were used: Concanavalin-A (specific for glucose and mannose), wheat germ agglutinin (specific for N-acetylglucosamine), castor bean agglutinin (specific for galactose), Wistaria floribunda agglutinin (specific for N-acetylgalactosamine), and soybean agglutinin (specific for N-acetyl-galactosamine). Cells for a clone, SS7, transformed by bovine adenovirus type-3, were found to bind 5 to 6 times more Wistaria floribunda agglutinin than the normal counterpart cells (clone C31, from C3H mouse kidney). In contrast, the binding of soybean agglutinin, which has a sugar specificity similar to Wistaria floribunda agglutinin, to normal and transformed cells was similar. The binding of wheat germ agglutinin and castor bean agglutinin, respectively, to normal and transformed cells was also similar. However, normal cells bound twice as much concanavalin-A as transformed cells. Only half as much Wistaria floribunda agglutinin was bound to transformed cells when they had been dispersed with EDTA. These changes in the number of lectin binding sites on transformation are thought to reflect alteration of the cell surface structure. The amount of lectins bound per cell decreased with increase in cell density, especially in the case of binding of Wistaria floribunda agglutinin to normal cells.

  16. The Structural Basis of Cryptosporidium-Specific IMP Dehydrogenase Inhibitor Selectivity

    MacPherson, Iain S.; Kirubakaran, Sivapriya; Gorla, Suresh Kumar; Riera, Thomas V.; D’Aquino, J. Alejandro; Zhang, Minjia; Cuny, Gregory D.; Hedstrom, Lizbeth (BWH); (Brandeis)

    2010-03-29

    Cryptosporidium parvum is a potential biowarfare agent, an important AIDS pathogen, and a major cause of diarrhea and malnutrition. No vaccines or effective drug treatment exist to combat Cryptosporidium infection. This parasite relies on inosine 5{prime}-monophosphate dehydrogenase (IMPDH) to obtain guanine nucleotides, and inhibition of this enzyme blocks parasite proliferation. Here, we report the first crystal structures of CpIMPDH. These structures reveal the structural basis of inhibitor selectivity and suggest a strategy for further optimization. Using this information, we have synthesized low-nanomolar inhibitors that display 10{sup 3} selectivity for the parasite enzyme over human IMPDH2.

  17. Structural basis for sequence-specific recognition of DNA by TAL effectors

    Deng, Dong; Yan, Chuangye; Pan, Xiaojing; Mahfouz, Magdy M.; Wang, Jiawei; Zhu, Jiankang; Shi, Yi Gong; Yan, Nieng

    2012-01-01

    TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair

  18. Pairwise structure alignment specifically tuned for surface pockets and interaction interfaces

    Cui, Xuefeng; Naveed, Hammad; Gao, Xin

    2015-01-01

    that are not limited to backbone fragments, and by employing a maximum weighted bipartite matching solver from the beginning of the alignment process. In addition, our methods incorporate similarities of sequentially and structurally remote residues that potentially

  19. Structure of Sphingolipids From Sea Cucumber Cucumaria frondosa and Structure-Specific Cytotoxicity Against Human HepG2 Cells.

    Jia, Zicai; Song, Yu; Tao, Suyuan; Cong, Peixu; Wang, Xiaoxu; Xue, Changhu; Xu, Jie

    2016-03-01

    To investigate the relationship between structure and activity, three glucocerebroside series (CFC-1, CFC-2 and CFC-3), ceramides (CF-Cer) and long-chain bases (CF-LCB) of sea cucumber Cucumaria frondosa (C. frondosa) were isolated and evaluated in HepG2 cells. The molecular species of CFC-1, CFC-2 and CFC-3 and CF-Cer were identified using reversed-phase liquid chromatography with heated electrospray ionization coupled to high-resolution mass spectrometry (RPLC-HESI-HRMS), and determined on the basis of chemical and spectroscopic evidence: For the three glucocerebroside series, fatty acids (FA) were mainly saturated (18:0 and 22:0), monounsaturated (22:1, 23:1 and 24:1) and 2-hydroxyl FA (2-HFA) (23:1 h and 24:1 h), the structure of long-chain bases (LCB) were dihydroxy (d17:1, d18:1 and d18:2) and trihydroxy (t16:0 and t17:0), and the glycosylation was glucose; For CF-Cer, FA were primarily saturated (17:0) and monounsaturated (16:1 and 19:1), the structure of LCB were dihydroxy (d17:1 and d18:1), and trihydroxy (t16:0). The results of cell experiment indicated that all of three glucocerebroside series, CF-Cer and CF-LCB exhibited an inhibitory effects on cell proliferation. Moreover, CFC-3 was most effective in three glucocerebrosides to HepG-2 cell viability. The inhibition effect of CF-LCB was the strongest, and the inhibition effect of CF-Cer was much stronger than glucocerebrosides.

  20. The structure-specific endonuclease Ercc1-Xpf is required for targeted gene replacement in embryonic stem cells

    L.J. Niedernhofer (Laura); J. Essers (Jeroen); G. Weeda (Geert); H.B. Beverloo (Berna); J. de Wit (Jan); M. Muijtjens (Manja); H. Odijk (Hanny); J.H.J. Hoeijmakers (Jan); R. Kanaar (Roland)

    2001-01-01

    textabstractThe Ercc1-Xpf heterodimer, a highly conserved structure-specific endonuclease, functions in multiple DNA repair pathways that are pivotal for maintaining genome stability, including nucleotide excision repair, interstrand crosslink repair and homologous recombination. Erccl-Xpf incises

  1. 2.4. Kinetics of voids structure change according to the specific properties of the concrete mix

    Saidov, D.Kh.

    2011-01-01

    This work is devoted to kinetics of voids structure changes according to the specific properties of concrete mix. The influence of concrete mix mobility on durability and watertightness of concrete was studied. The influence of cement expenditure on concrete durability was examined.

  2. Production of specific-structured lipids by enzymatic interesterification: elucidation of acyl migration by response surface design

    Xu, Xuebing; Skands, Anja; Høy, Carl-Erik

    1998-01-01

    Production of specific-structured lipids (SSL) by lipase-catalyzed interesterification has been attracting more and more attention recently. However, it was found that acyl migration occurs during the reaction and causes the production of by-products. In this paper, the elucidation of acyl...

  3. Mitochondrial DNA paradox: sex-specific genetic structure in a marine mussel – despite maternal inheritance and passive dispersal

    Teske Peter R

    2012-06-01

    Full Text Available Abstract Background When genetic structure is identified using mitochondrial DNA (mtDNA, but no structure is identified using biparentally-inherited nuclear DNA, the discordance is often attributed to differences in dispersal potential between the sexes. Results We sampled the intertidal rocky shore mussel Perna perna in a South African bay and along the nearby open coast, and sequenced maternally-inherited mtDNA (there is no evidence for paternally-inherited mtDNA in this species and a biparentally-inherited marker. By treating males and females as different populations, we identified significant genetic structure on the basis of mtDNA data in the females only. Conclusions This is the first study to report sex-specific differences in genetic structure based on matrilineally-inherited mtDNA in a passively dispersing species that lacks social structure or sexual dimorphism. The observed pattern most likely stems from females being more vulnerable to selection in habitats from which they did not originate, which also manifests itself in a male-biased sex ratio. Our results have three important implications for the interpretation of population genetic data. First, even when mtDNA is inherited exclusively in the female line, it also contains information about males. For that reason, using it to identify sex-specific differences in genetic structure by contrasting it with biparentally-inherited markers is problematic. Second, the fact that sex-specific differences were found in a passively dispersing species in which sex-biased dispersal is unlikely highlights the fact that significant genetic structure is not necessarily a function of low dispersal potential or physical barriers. Third, even though mtDNA is typically used to study historical demographic processes, it also contains information about contemporary processes. Higher survival rates of males in non-native habitats can erase the genetic structure present in their mothers within a single

  4. O'nyong nyong virus molecular determinants of unique vector specificity reside in non-structural protein 3.

    Kali D Saxton-Shaw

    Full Text Available O'nyong nyong virus (ONNV and Chikungunya virus (CHIKV are two closely related alphaviruses with very different infection patterns in the mosquito, Anopheles gambiae. ONNV is the only alphavirus transmitted by anopheline mosquitoes, but specific molecular determinants of infection of this unique vector specificity remain unidentified. Fifteen distinct chimeric viruses were constructed to evaluate both structural and non-structural regions of the genome and infection patterns were determined through artificial infectious feeds in An. gambiae with each of these chimeras. Only one region, non-structural protein 3 (nsP3, was sufficient to up-regulate infection to rates similar to those seen with parental ONNV. When ONNV non-structural protein 3 (nsP3 replaced nsP3 from CHIKV virus in one of the chimeric viruses, infection rates in An. gambiae went from 0% to 63.5%. No other single gene or viral region addition was able to restore infection rates. Thus, we have shown that a non-structural genome element involved in viral replication is a major element involved in ONNV's unique vector specificity.

  5. Function-specific and Enhanced Brain Structural Connectivity Mapping via Joint Modeling of Diffusion and Functional MRI.

    Chu, Shu-Hsien; Parhi, Keshab K; Lenglet, Christophe

    2018-03-16

    A joint structural-functional brain network model is presented, which enables the discovery of function-specific brain circuits, and recovers structural connections that are under-estimated by diffusion MRI (dMRI). Incorporating information from functional MRI (fMRI) into diffusion MRI to estimate brain circuits is a challenging task. Usually, seed regions for tractography are selected from fMRI activation maps to extract the white matter pathways of interest. The proposed method jointly analyzes whole brain dMRI and fMRI data, allowing the estimation of complete function-specific structural networks instead of interactively investigating the connectivity of individual cortical/sub-cortical areas. Additionally, tractography techniques are prone to limitations, which can result in erroneous pathways. The proposed framework explicitly models the interactions between structural and functional connectivity measures thereby improving anatomical circuit estimation. Results on Human Connectome Project (HCP) data demonstrate the benefits of the approach by successfully identifying function-specific anatomical circuits, such as the language and resting-state networks. In contrast to correlation-based or independent component analysis (ICA) functional connectivity mapping, detailed anatomical connectivity patterns are revealed for each functional module. Results on a phantom (Fibercup) also indicate improvements in structural connectivity mapping by rejecting false-positive connections with insufficient support from fMRI, and enhancing under-estimated connectivity with strong functional correlation.

  6. Guide Structures in CD-ROM Dictionaries, with Specific Reference to the EWED and the ELHAT

    Philip Louw

    2011-10-01

    Full Text Available

    macro- and microstructural information. In order to evaluate the methods which lexicographers employ to improve dictionary accessibility, the concept of guide structures was introduced by Hausmann and Wiegand (1989. Since the appearance of that article, various academics have written articles and read papers on guide structures in print dictionaries, but few studies have focussed on the tremendous potential of guide structures in electronic dictionaries. In this article it will be shown that electronic dictionaries add dimensions to the implementation of guide structures not possible in print versions. The role of two of the guide structures in the transfer of infonnation in CD-ROM dictionaries will be discussed. The access and mediostructures of the Microsoft Encarta World English Dictionary and the Elektroniese Handwoordeboek van die Afrikaanse Taal will be analysed and critically evaluated to illustrate the advantages of electronic dictionaries over print dictionaries and the urgent need for metalexicographical discussion of this publication medium.

    Keywords: ACCESS STRUCTURE; ACTIVE CROSS-REFERENCES; CD-ROM DICTIONARY; DICTIONARY ACCESSIBILITY; ENCYCLOPAEDIC DICTIONARY; GUIDE STRUCTURES; INNER ACCESS STRUCTURE; INNER SEARCH PATH; INTERNET; MEDIOSTRUCTURE; MULTIMEDIA; OUTER ACCESS STRUCTURE; OUTER SEARCH PATH; PASSIVE CROSSREFERENCING; USER-FRIENDLINESS

    Opsomming: Gidsstrukture in CD-ROM-woordeboeke, met spesifieke verwysingna EWED en ELHA T. Die sukses van modeme woordeboeke hang grootliles af vandie toeganklikheid van hulle makro- en mikrostrukturele inligting. Hausmann en Wiegand (1989het die konsep van gidsstrukture ingevoer om die metodes te evalueer wat leksikograwe gebruikom woordeboektoeganklikheid Ie verbeter. Sedert hierdie artikel verskyn het, het verskeie akademic:i artikels gepubliseer en referate gelewer oor gidsstrukture in gedrukte woordeboeke, maarmin studies het gefokus op die geweldige potensiaal van

  7. Role of tryptophan 95 in substrate specificity and structural stability of Sulfolobus solfataricus alcohol dehydrogenase.

    Pennacchio, Angela; Esposito, Luciana; Zagari, Adriana; Rossi, Mosè; Raia, Carlo A

    2009-09-01

    A mutant of the thermostable NAD(+)-dependent (S)-stereospecific alcohol dehydrogenase from Sulfolobus solfataricus (SsADH) which has a single substitution, Trp95Leu, located at the substrate binding pocket, was fully characterized to ascertain the role of Trp95 in discriminating between chiral secondary alcohols suggested by the wild-type SsADH crystallographic structure. The Trp95Leu mutant displays no apparent activity with short-chain primary and secondary alcohols and poor activity with aromatic substrates and coenzyme. Moreover, the Trp --> Leu substitution affects the structural stability of the archaeal ADH, decreasing its thermal stability without relevant changes in secondary structure. The double mutant Trp95Leu/Asn249Tyr was also purified to assist in crystallographic analysis. This mutant exhibits higher activity but decreased affinity toward aliphatic alcohols, aldehydes as well as NAD(+) and NADH compared to the wild-type enzyme. The crystal structure of the Trp95Leu/Asn249Tyr mutant apo form, determined at 2.0 A resolution, reveals a large local rearrangement of the substrate site with dramatic consequences. The Leu95 side-chain conformation points away from the catalytic metal center and the widening of the substrate site is partially counteracted by a concomitant change of Trp117 side chain conformation. Structural changes at the active site are consistent with the reduced activity on substrates and decreased coenzyme binding.

  8. Crystal structure of the Epithiospecifier Protein, ESP from Arabidopsis thaliana provides insights into its product specificity.

    Zhang, Weiwei; Wang, Wenhe; Liu, Zihe; Xie, Yongchao; Wang, Hao; Mu, Yajuan; Huang, Yao; Feng, Yue

    2016-09-16

    Specifier proteins are important components of the glucosinolate-myrosinase system, which mediate plant defense against herbivory and pathogen attacks. Upon tissue disruption, glucosinolates are hydrolyzed to instable aglucones by myrosinases, and then aglucones will rearrange to form defensive isothiocyanates. Specifier proteins can redirect this reaction to form other products, such as simple nitriles, epithionitriles and organic thiocyanates instead of isothiocyanates based on the side chain structure of glucosinolate and the type of the specifier proteins. Nevertheless, the molecular mechanism underlying the different product spectrums of various specifier proteins was not fully understood. Here in this study, we solved the crystal structure of the Epithiospecifier Protein, ESP from Arabidopsis thaliana (AtESP) at 2.3 Å resolution. Structural comparisons with the previously solved structure of thiocyanate forming protein, TFP from Thlaspi arvense (TaTFP) reveal that AtESP shows a dimerization pattern different from TaTFP. Moreover, AtESP harbors a slightly larger active site pocket than TaTFP and several residues around the active site are different between the two proteins, which might account for the different product spectrums of the two proteins. Together, our structural study provides important insights into the molecular mechanisms of specifier proteins and shed light on the basis of their different product spectrums. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Is a matrix exponential specification suitable for the modeling of spatial correlation structures?

    Strauß, Magdalena E; Mezzetti, Maura; Leorato, Samantha

    2017-05-01

    This paper investigates the adequacy of the matrix exponential spatial specifications (MESS) as an alternative to the widely used spatial autoregressive models (SAR). To provide as complete a picture as possible, we extend the analysis to all the main spatial models governed by matrix exponentials comparing them with their spatial autoregressive counterparts. We propose a new implementation of Bayesian parameter estimation for the MESS model with vague prior distributions, which is shown to be precise and computationally efficient. Our implementations also account for spatially lagged regressors. We further allow for location-specific heterogeneity, which we model by including spatial splines. We conclude by comparing the performances of the different model specifications in applications to a real data set and by running simulations. Both the applications and the simulations suggest that the spatial splines are a flexible and efficient way to account for spatial heterogeneities governed by unknown mechanisms.

  10. Structural Basis for Specificity of Propeptide-Enzyme Interaction in Barley C1A Cysteine Peptidases

    Cambra, Inés; Hernández, David; Diaz, Isabel; Martinez, Manuel

    2012-01-01

    C1A cysteine peptidases are synthesized as inactive proenzymes. Activation takes place by proteolysis cleaving off the inhibitory propeptide. The inhibitory capacity of propeptides from barley cathepsin L and B-like peptidases towards commercial and barley cathepsins has been characterized. Differences in selectivity have been found for propeptides from L-cathepsins against their cognate and non cognate enzymes. Besides, the propeptide from barley cathepsin B was not able to inhibit bovine cathepsin B. Modelling of their three-dimensional structures suggests that most propeptide inhibitory properties can be explained from the interaction between the propeptide and the mature cathepsin structures. Their potential use as biotechnological tools is discussed. PMID:22615948

  11. Structural and functional studies on the pituitary-specific transcription factor Pit-1

    Augustijn, K.D.

    2002-01-01

    Pit-1 is a pituitary specific transcription factor that plays a central role in the development and maintenance of a number of cell lineages in the anterior pituitary gland. In these cell lineages, Pit-1 is required for the selective expression of the growth hormone (GH), prolactin (PRL) and the

  12. Dynamic Recruitment of Cdc2 to Specific Microtubule Structures during Mitosis

    Weingartner, M.; Binarová, Pavla; Dryková, Denisa; Achweighofer, A.; David, P.; Heberle, E.; Doonan, J.; Bogre, L.

    2001-01-01

    Roč. 13, - (2001), s. 1929-1943 ISSN 1040-4651 R&D Projects: GA AV ČR IAA5020803 Grant - others:XE(XC) GA QLRT-00454 Keywords : dynamic * recruitment * specific Subject RIV: EE - Microbiology, Virology Impact factor: 11.081, year: 2001

  13. Specific experiments carried out in Germany in order to demonstrate the safety of existing structures

    Krutzik, Norbert

    2002-01-01

    Specific experiments are carried out in Germany in order to demonstrate the safety of existing NPPs. HDR research program includes operational loads testing (pressure test, pressure and temperature test, thermal shock, fatigue); extreme loads (earthquake, aircraft crash, external explosion); internal emergency loads (blowdown, hydrogen combustion, fire, thermal shock, water hammer, condensation loads)

  14. Significance of sterol structural specificity : desmosterol cannot replace cholesterol in lipid rafts

    Vainio, S.; Jansen, Maurice; Koivusalo, M.; Róg, T.; Karttunen, M.E.J.; Vattulainen, I.; Ikonen, E.

    2006-01-01

    Desmosterol is an immediate precursor of cholesterol in the Bloch pathway of sterol synthesis and an abundant membrane lipid in specific cell types. The significance of the difference between the two sterols, an additional double bond at position C24 in the tail of desmosterol, is not known. Here,

  15. Structure and organ specificity of an anionic peroxidase from Arabidopsis thaliana cell suspension culture

    Ostergaard, L; Abelskov, A K; Mattsson, O

    1996-01-01

    The predominant peroxidase (pI 3.5) (E.C. 1.11.1.7) of an Arabidopsis thaliana cell suspension culture was purified and partially sequenced. Oligonucleotides were designed and a specific probe was obtained. A cDNA clone was isolated from an Arabidopsis cell suspension cDNA library and completely ...

  16. Structural Basis of Histone Demethylase KDM6B Histone 3 Lysine 27 Specificity

    Jones, Sarah E; Olsen, Lars; Gajhede, Michael

    2018-01-01

    KDM subfamily 6 enzymes KDM6A and KDM6B specifically catalyze demethylation of di- and trimethylated lysine on histone 3 lysine 27 (H3K27me3/2) and play an important role in repression of developmental genes. Despite identical amino acid sequence in the immediate surroundings of H3K9me3/2 (ARKS...

  17. Structural Alterations of the Language Connectome in Children with Specific Language Impairment

    Vydrová, R.; Komárek, V.; Šanda, J.; Štěrbová, K.; Jahodová, A.; Maulisová, A.; Žáčková, J.; Reissigová, Jindra; Kršek, P.; Kyncl, M.

    2015-01-01

    Roč. 151, December (2015), s. 35-41 ISSN 0093-934X Institutional support: RVO:67985807 Keywords : Specific language disorder * DTI * Arcuate fascicle * IFOF * Ventral stream Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 3.038, year: 2015

  18. Structure, specificity, and evolution of insect guilds related to cones of conifers in Western Europe

    Alain Roques

    1991-01-01

    Patchy and ephemeral resources, such as the cones of conifers, can be very useful in the study of plant-insect relationships. Studies of such relationships in forest entomology are typically complicated by the spatial and temporal characteristics of the host plants, which occur over vast areas and have lifespans of decades or even centuries. The reproductive structures...

  19. GirlPOWER! Strengthening Mentoring Relationships through a Structured, Gender-Specific Program

    Pryce, Julia M.; Silverthorn, Naida; Sanchez, Bernadette; DuBois, David L.

    2010-01-01

    The authors examine GirlPOWER! an innovative program that uses structure and group-based activities to enhance one-to-one mentoring relationships for young adolescent girls from the perspective of the focus, purpose, and authorship dimensions of mentoring relationships that Karcher and Nakkula described. The discussion draws on several sources of…

  20. Family Structure and Home-Leaving: A Further Specification of the Relationship.

    Aquilino, William S.

    1991-01-01

    Investigated impact of childhood family structure on timing of home-leaving. Data from 1988 National Survey of Families and Households suggest that exposure to nonintact family living during childhood raises likelihood of home-leaving prior to age 19. Adopted children and children who lived in nonparental situations were most likely to leave…

  1. Pose Estimation using Local Structure-Specific Shape and Appearance Context

    Buch, Anders Glent; Kraft, Dirk; Kämäräinen, Joni-Kristian

    2013-01-01

    information for both edge and texture structures. This is achieved by defining feature space relations which describe the neighborhood of a descriptor. By quantitative evaluations, we show that our descriptors provide high discriminative power compared to state of the art approaches. In addition, we show how...

  2. Determination of the structure of thiol-specific antioxidant (Tsa 2) of Saccharomyces cerevisiae

    Breyer, C.A.; Oliveira, M.A.

    2012-01-01

    Full text: The peroxiredoxin (Prx), is a group of antioxidant proteins that have been widely studied for its role in the decomposition of several species of peroxides such as hydrogen peroxide, peroxynitrite and organic hydroperoxides using two highly reactive cysteines, named cysteine peroxidatic (Cys P ) and resolve cysteine (Cys R ), present in the active site. In Saccharomyces cerevisiae were identified five Prx isoforms, three cytosolic (Tsa1, Tsa2 and Ahp1), a mitochondrial (mTPx) and a nu- clear one (nTPx). Tsa1 and Tsa2 are homodimers that in heat shock or oxidative stress form complex structures of high molecular-weight with chaperone function. These proteins are very similar (86% identity and 96% similarity) but despite this structural similarity it has been shown that they present different functions: Tsa1 is mainly involved in the response to oxidative stress while Tsa2 is involved in signal transduction. Tsa1 was already crystallized and a structural model was generated, but Tsa2 structural studies were not performed. The research goal is the determination of the structure of Tsa2. The initial screening experiments of crystallization using the kits CS1 and CS2 (Hampton Research) showed favorable results when the conditions were 0,1M sodium acetate trihydrate pH 4.6 and 8% polyethylene glycol 4000. To improve our results the crystallization condition is been refined using variations of pH and concentration of polyethylene glycol 4000. We believe that the results of this study may contribute significantly to the understanding of the formation of over oxidized forms and cellular functions of Tsa2. (author)

  3. Hidden Markov model-derived structural alphabet for proteins: the learning of protein local shapes captures sequence specificity.

    Camproux, A C; Tufféry, P

    2005-08-05

    Understanding and predicting protein structures depend on the complexity and the accuracy of the models used to represent them. We have recently set up a Hidden Markov Model to optimally compress protein three-dimensional conformations into a one-dimensional series of letters of a structural alphabet. Such a model learns simultaneously the shape of representative structural letters describing the local conformation and the logic of their connections, i.e. the transition matrix between the letters. Here, we move one step further and report some evidence that such a model of protein local architecture also captures some accurate amino acid features. All the letters have specific and distinct amino acid distributions. Moreover, we show that words of amino acids can have significant propensities for some letters. Perspectives point towards the prediction of the series of letters describing the structure of a protein from its amino acid sequence.

  4. High affinity antigen recognition of the dual specific variants of herceptin is entropy-driven in spite of structural plasticity.

    Jenny Bostrom

    Full Text Available The antigen-binding site of Herceptin, an anti-human Epidermal Growth Factor Receptor 2 (HER2 antibody, was engineered to add a second specificity toward Vascular Endothelial Growth Factor (VEGF to create a high affinity two-in-one antibody bH1. Crystal structures of bH1 in complex with either antigen showed that, in comparison to Herceptin, this antibody exhibited greater conformational variability, also called "structural plasticity". Here, we analyzed the biophysical and thermodynamic properties of the dual specific variants of Herceptin to understand how a single antibody binds two unrelated protein antigens. We showed that while bH1 and the affinity-improved bH1-44, in particular, maintained many properties of Herceptin including binding affinity, kinetics and the use of residues for antigen recognition, they differed in the binding thermodynamics. The interactions of bH1 and its variants with both antigens were characterized by large favorable entropy changes whereas the Herceptin/HER2 interaction involved a large favorable enthalpy change. By dissecting the total entropy change and the energy barrier for dual interaction, we determined that the significant structural plasticity of the bH1 antibodies demanded by the dual specificity did not translate into the expected increase of entropic penalty relative to Herceptin. Clearly, dual antigen recognition of the Herceptin variants involves divergent antibody conformations of nearly equivalent energetic states. Hence, increasing the structural plasticity of an antigen-binding site without increasing the entropic cost may play a role for antibodies to evolve multi-specificity. Our report represents the first comprehensive biophysical analysis of a high affinity dual specific antibody binding two unrelated protein antigens, furthering our understanding of the thermodynamics that drive the vast antigen recognition capacity of the antibody repertoire.

  5. Site-Specific Pre-Swelling-Directed Morphing Structures of Patterned Hydrogels.

    Wang, Zhi Jian; Hong, Wei; Wu, Zi Liang; Zheng, Qiang

    2017-12-11

    Morphing materials have promising applications in various fields, yet how to program the self-shaping process for specific configurations remains a challenge. Herein we show a versatile approach to control the buckling of individual domains and thus the outcome configurations of planar-patterned hydrogels. By photolithography, high-swelling disc gels were positioned in a non-swelling gel sheet; the swelling mismatch resulted in out-of-plain buckling of the disc gels. To locally control the buckling direction, masks with holes were used to guide site-specific swelling of the high-swelling gel under the holes, which built a transient through-thickness gradient and thus directed the buckling during the subsequent unmasked swelling process. Therefore, various configurations of an identical patterned hydrogel can be programmed by the pre-swelling step with different masks to encode the buckling directions of separate domains. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Specific features of the motion of neutrons in a medium with a helical magnetic structure

    Fraerman, A. A.; Udalov, O. G.

    2007-01-01

    The specific features of the motion of neutrons in a noncoplanar magnetic field are considered by an example of the magnetization distribution in the form of a conical helix. The reflection coefficients of neutrons from holmium crystals are calculated. It is shown that, for a noncoplanar distribution of a magnetic field in a crystal, the reflection coefficient of neutrons with spin flip exhibits an additional feature

  7. Structural and enzymatic characterization of a host-specificity determinant from Salmonella

    Kohler, Amanda C. [Rockefeller University, New York, NY 10065 (United States); Spanò, Stefania; Galán, Jorge E. [Yale University School of Medicine, New Haven, CT 06536 (United States); Stebbins, C. Erec, E-mail: stebbins@rockefeller.edu [Rockefeller University, New York, NY 10065 (United States)

    2014-02-01

    The Salmonella effector protein GtgE functions as a cysteine protease to cleave a subset of the Rab-family GTPases and to prevent delivery of antimicrobial agents to the Salmonella-containing vacuole. GtgE is an effector protein from Salmonella Typhimurium that modulates trafficking of the Salmonella-containing vacuole. It exerts its function by cleaving the Rab-family GTPases Rab29, Rab32 and Rab38, thereby preventing the delivery of antimicrobial factors to the bacteria-containing vacuole. Here, the crystal structure of GtgE at 1.65 Å resolution is presented, and structure-based mutagenesis and in vivo infection assays are used to identify its catalytic triad. A panel of cysteine protease inhibitors were examined and it was determined that N-ethylmaleimide, antipain and chymostatin inhibit GtgE activity in vitro. These findings provide the basis for the development of novel therapeutic strategies to combat Salmonella infections.

  8. Structural-Functional Analysis Reveals a Specific Domain Organization in Family GH20 Hexosaminidases.

    Val-Cid, Cristina; Biarnés, Xevi; Faijes, Magda; Planas, Antoni

    2015-01-01

    Hexosaminidases are involved in important biological processes catalyzing the hydrolysis of N-acetyl-hexosaminyl residues in glycosaminoglycans and glycoconjugates. The GH20 enzymes present diverse domain organizations for which we propose two minimal model architectures: Model A containing at least a non-catalytic GH20b domain and the catalytic one (GH20) always accompanied with an extra α-helix (GH20b-GH20-α), and Model B with only the catalytic GH20 domain. The large Bifidobacterium bifidum lacto-N-biosidase was used as a model protein to evaluate the minimal functional unit due to its interest and structural complexity. By expressing different truncated forms of this enzyme, we show that Model A architectures cannot be reduced to Model B. In particular, there are two structural requirements general to GH20 enzymes with Model A architecture. First, the non-catalytic domain GH20b at the N-terminus of the catalytic GH20 domain is required for expression and seems to stabilize it. Second, the substrate-binding cavity at the GH20 domain always involves a remote element provided by a long loop from the catalytic domain itself or, when this loop is short, by an element from another domain of the multidomain structure or from the dimeric partner. Particularly, the lacto-N-biosidase requires GH20b and the lectin-like domain at the N- and C-termini of the catalytic GH20 domain to be fully soluble and functional. The lectin domain provides this remote element to the active site. We demonstrate restoration of activity of the inactive GH20b-GH20-α construct (model A architecture) by a complementation assay with the lectin-like domain. The engineering of minimal functional units of multidomain GH20 enzymes must consider these structural requirements.

  9. Substrate binding and specificity of rhomboid intramembrane protease revealed by substrate-peptide complex structures

    Zoll, Sebastian; Stanchev, Stancho; Began, Jakub; Škerle, Jan; Lepšík, Martin; Peclinovská, Lucie; Majer, Pavel; Stříšovský, Kvido

    2014-01-01

    Roč. 33, č. 20 (2014), s. 2408-2421 ISSN 0261-4189 R&D Projects: GA ČR GAP305/11/1886; GA MŠk(CZ) LK11206; GA MŠk LO1302; GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : intramembrane protease * rhomboid family * rhomboid protease * structure * substrate recognition Subject RIV: CE - Biochemistry Impact factor: 10.434, year: 2014

  10. Structure and DNA-binding of meiosis-specific protein Hop2

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  11. Structure-guided functional characterization of DUF1460 reveals a highly specific NlpC/P60 amidase family.

    Xu, Qingping; Mengin-Lecreulx, Dominique; Patin, Delphine; Grant, Joanna C; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Knuth, Mark W; Godzik, Adam; Lesley, Scott A; Elsliger, Marc-André; Deacon, Ashley M; Wilson, Ian A

    2014-12-02

    GlcNAc-1,6-anhydro-MurNAc-tetrapeptide is a major peptidoglycan degradation intermediate and a cytotoxin. It is generated by lytic transglycosylases and further degraded and recycled by various enzymes. We have identified and characterized a highly specific N-acetylmuramoyl-L-alanine amidase (AmiA) from Bacteroides uniformis, a member of the DUF1460 protein family, that hydrolyzes GlcNAc-1,6-anhydro-MurNAc-peptide into disaccharide and stem peptide. The high-resolution apo structure at 1.15 Å resolution shows that AmiA is related to NlpC/P60 γ-D-Glu-meso-diaminopimelic acid amidases and shares a common catalytic core and cysteine peptidase-like active site. AmiA has evolved structural adaptations that reconfigure the substrate recognition site. The preferred substrates for AmiA were predicted in silico based on structural and bioinformatics data, and subsequently were characterized experimentally. Further crystal structures of AmiA in complexes with GlcNAc-1,6-anhydro-MurNAc and GlcNAc have enabled us to elucidate substrate recognition and specificity. DUF1460 is highly conserved in structure and defines another amidase family. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Production of specifically structured lipids by enzymatic interesterification in a pilot enzyme bed reactor: process optimization by response surface methodology

    Xu, Xuebing; Mu, Huiling; Høy, Carl-Erik

    1999-01-01

    Pilot production of specifically structured lipids by Lipozyme IM-catalyzed interesterification was carried out in a continuous enzyme bed reactor without the use of solvent. Medium chain triacylglycerols and oleic acid were used as model substrates. Response surface methodology was applied...... and the production of mono-incorporated and di-incorporated structured lipids with multiple regression and backward elimination. The coefficient of determination (R2) for the incorporation was 0.93, and that for the di-incorporated products was 0.94. The optimal conditions were flow rate, 2 ml/min; temperature, 65...

  13. Specific character of bacterial biodegradation of polyhydroxyalkanoates with different chemical structure in soil.

    Prudnikova, S V; Vinogradova, O N; Trusova, M Y

    2017-03-01

    The study addresses the influence of the physicochemical properties of the reserve cellular macromolecules (polyhydroxyalkanoates, PHA) with different chemical composition on their biodegradation in the agro-transformed field soil of the Siberian region (Krasnoyarsk Territory, Russia). It was shown that the degradation of the PHA samples depends on the degree of polymer crystallinity (C x ). For the first time, it was shown that the range of PHA-degrading microorganisms differs for each of PHA types. The study defines the primary degraders specific to each PHA type and common to all types of examined polymers.

  14. Thermodynamic and structural investigation of the specific SDS binding of humicola insolens cutinase

    Kold, David; Dauter, Zbigniew; Laustsen, Anne K

    2014-01-01

    The interaction of lipolytic enzymes with anionic surfactants is of great interest with respect to industrially produced detergents. Here, we report the interaction of cutinase from the thermophilic fungus Humicola insolens with the anionic surfactant SDS, and show the enzyme specifically binds...... of the enzyme has been solved by X-ray crystallography in its apo form and after cocrystallization with diethyl p-nitrophenyl phosphate (DNPP) leading to a complex with monoethylphosphate (MEP) esterified to the catalytically active serine. The enzyme has the same fold as reported for other cutinases but...

  15. Anomalous Schottky specific heat and structural distortion in ferromagnetic PrAl2.

    Pathak, Arjun K; Paudyal, D; Mudryk, Y; Gschneidner, K A; Pecharsky, V K

    2013-05-03

    Unique from other rare earth dialuminides, PrAl(2) undergoes a cubic to tetragonal distortion below T = 30 K in a zero magnetic field, but the system recovers its cubic symmetry upon the application of an external magnetic field of 10 kOe via a lifting of the 4f crystal field splitting. The nuclear Schottky specific heat in PrAl(2) is anomalously high compared to that of pure Pr metal. First principles calculations reveal that the 4f crystal field splitting in the tetragonally distorted phase of PrAl(2) underpins the observed unusual low temperature phenomena.

  16. 3D active shape models of human brain structures: application to patient-specific mesh generation

    Ravikumar, Nishant; Castro-Mateos, Isaac; Pozo, Jose M.; Frangi, Alejandro F.; Taylor, Zeike A.

    2015-03-01

    The use of biomechanics-based numerical simulations has attracted growing interest in recent years for computer-aided diagnosis and treatment planning. With this in mind, a method for automatic mesh generation of brain structures of interest, using statistical models of shape (SSM) and appearance (SAM), for personalised computational modelling is presented. SSMs are constructed as point distribution models (PDMs) while SAMs are trained using intensity profiles sampled from a training set of T1-weighted magnetic resonance images. The brain structures of interest are, the cortical surface (cerebrum, cerebellum & brainstem), lateral ventricles and falx-cerebri membrane. Two methods for establishing correspondences across the training set of shapes are investigated and compared (based on SSM quality): the Coherent Point Drift (CPD) point-set registration method and B-spline mesh-to-mesh registration method. The MNI-305 (Montreal Neurological Institute) average brain atlas is used to generate the template mesh, which is deformed and registered to each training case, to establish correspondence over the training set of shapes. 18 healthy patients' T1-weightedMRimages form the training set used to generate the SSM and SAM. Both model-training and model-fitting are performed over multiple brain structures simultaneously. Compactness and generalisation errors of the BSpline-SSM and CPD-SSM are evaluated and used to quantitatively compare the SSMs. Leave-one-out cross validation is used to evaluate SSM quality in terms of these measures. The mesh-based SSM is found to generalise better and is more compact, relative to the CPD-based SSM. Quality of the best-fit model instance from the trained SSMs, to test cases are evaluated using the Hausdorff distance (HD) and mean absolute surface distance (MASD) metrics.

  17. Structural Basis for a Ribofuranosyl Binding Protein: Insights into the Furanose Specific Transport

    Bagaria, A.; Swaminathan, S.; Kumaran, D.; Burley, S. K.

    2011-04-01

    The ATP-binding cassette transporters (ABC-transporters) are members of one of the largest protein superfamilies, with representatives in all extant phyla. These integral membrane proteins utilize the energy of ATP hydrolysis to carry out certain biological processes, including translocation of various substrates across membranes and non-transport related processes such as translation of RNA and DNA repair. Typically, such transport systems in bacteria consist of an ATP binding component, a transmembrane permease, and a periplasmic receptor or binding protein. Soluble proteins found in the periplasm of gram-negative bacteria serve as the primary receptors for transport of many compounds, such as sugars, small peptides, and some ions. Ligand binding activates these periplasmic components, permitting recognition by the membrane spanning domain, which supports for transport and, in some cases, chemotaxis. Transport and chemotaxis processes appear to be independent of one another, and a few mutants of bifunctional periplasmic components reveal the absence of one or the other function. Previously published high-resolution X-ray structures of various periplasmic ligand binding proteins include Arabinose binding protein (ABP), Allose binding protein (ALBP), Glucose-galactose binding protein (GBP) and Ribose binding protein (RBP). Each of these proteins consists of two structurally similar domains connected by a three-stranded hinge region, with ligand buried between the domains. Upon ligand binding and release, various conformational changes have been observed. For RBP, open (apo) and closed (ligand bound) conformations have been reported and so for MBP. The closed/active form of the protein interacts with the integral membrane component of the system in both transport and chemotaxis. Herein, we report 1.9{angstrom} resolution X-ray structure of the R{sub f}BP periplasmic component of an ABC-type sugar transport system from Hahella chejuensis (UniProt Id Q2S7D2) bound to

  18. Crystal Structure and Substrate Specificity of D-Galactose-6-Phosphate Isomerase Complexed with Substrates

    Lee, Jung-Kul; Pan, Cheol-Ho

    2013-01-01

    D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26), which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD), catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi). Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays. PMID:24015281

  19. Structure and pathogenicity of antibodies specific for citrullinated collagen type II in experimental arthritis

    Uysal, Hüseyin; Bockermann, Robert; Nandakumar, Kutty S

    2009-01-01

    Antibodies to citrulline-modified proteins have a high diagnostic value in rheumatoid arthritis (RA). However, their biological role in disease development is still unclear. To obtain insight into this question, a panel of mouse monoclonal antibodies was generated against a major triple helical...... is indeed citrullinated in vivo. The structure determination of a Fab fragment of one of these antibodies in complex with a citrullinated peptide showed a surprising beta-turn conformation of the peptide and provided information on citrulline recognition. Based on these findings, we propose...

  20. Crystal structure and substrate specificity of D-galactose-6-phosphate isomerase complexed with substrates.

    Woo-Suk Jung

    Full Text Available D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26, which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD, catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi. Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays.

  1. Probing ion-specific effects on aqueous acetate solutions: Ion pairing versus water structure modifications.

    Petit, Tristan; Lange, Kathrin M; Conrad, Gerrit; Yamamoto, Kenji; Schwanke, Christoph; Hodeck, Kai F; Dantz, Marcus; Brandenburg, Tim; Suljoti, Edlira; Aziz, Emad F

    2014-05-01

    The effect of monovalent cations (Li(+), K(+), NH4 (+), Na(+)) on the water structure in aqueous chloride and acetate solutions was characterized by oxygen K-edge X-ray absorption spectroscopy (XAS), X-ray emission spectroscopy, and resonant inelastic X-ray scattering (RIXS) of a liquid microjet. We show ion- and counterion dependent effects on the emission spectra of the oxygen K-edge, which we attribute to modifications of the hydrogen bond network of water. For acetates, ion pairing with carboxylates was also probed selectively by XAS and RIXS. We correlate our experimental results to speciation data and to the salting-out properties of the cations.

  2. Human reinforcement learning subdivides structured action spaces by learning effector-specific values.

    Gershman, Samuel J; Pesaran, Bijan; Daw, Nathaniel D

    2009-10-28

    Humans and animals are endowed with a large number of effectors. Although this enables great behavioral flexibility, it presents an equally formidable reinforcement learning problem of discovering which actions are most valuable because of the high dimensionality of the action space. An unresolved question is how neural systems for reinforcement learning-such as prediction error signals for action valuation associated with dopamine and the striatum-can cope with this "curse of dimensionality." We propose a reinforcement learning framework that allows for learned action valuations to be decomposed into effector-specific components when appropriate to a task, and test it by studying to what extent human behavior and blood oxygen level-dependent (BOLD) activity can exploit such a decomposition in a multieffector choice task. Subjects made simultaneous decisions with their left and right hands and received separate reward feedback for each hand movement. We found that choice behavior was better described by a learning model that decomposed the values of bimanual movements into separate values for each effector, rather than a traditional model that treated the bimanual actions as unitary with a single value. A decomposition of value into effector-specific components was also observed in value-related BOLD signaling, in the form of lateralized biases in striatal correlates of prediction error and anticipatory value correlates in the intraparietal sulcus. These results suggest that the human brain can use decomposed value representations to "divide and conquer" reinforcement learning over high-dimensional action spaces.

  3. Fluid Structure Interaction simulation of heart prosthesis in patient-specific left-ventricle/aorta anatomies

    Le, Trung; Borazjani, Iman; Sotiropoulos, Fotis

    2009-11-01

    In order to test and optimize heart valve prosthesis and enable virtual implantation of other biomedical devices it is essential to develop and validate high-resolution FSI-CFD codes for carrying out simulations in patient-specific geometries. We have developed a powerful numerical methodology for carrying out FSI simulations of cardiovascular flows based on the CURVIB approach (Borazjani, L. Ge, and F. Sotiropoulos, Journal of Computational physics, vol. 227, pp. 7587-7620 2008). We have extended our FSI method to overset grids to handle efficiently more complicated geometries e.g. simulating an MHV implanted in an anatomically realistic aorta and left-ventricle. A compliant, anatomic left-ventricle is modeled using prescribed motion in one domain. The mechanical heart valve is placed inside the second domain i.e. the body-fitted curvilinear mesh of the anatomic aorta. The simulations of an MHV with a left-ventricle model underscore the importance of inflow conditions and ventricular compliance for such simulations and demonstrate the potential of our method as a powerful tool for patient-specific simulations.

  4. A fine structural localization of the non-specific cholinesterase activity in glomerular nerve formations (endings).

    Dubový, P

    1990-01-01

    Snout glabrous skin (rhinarium) of the cat is innervated not only by typical simple lamellar corpuscles but also glomerular formations. In contrast to simple lamellar corpuscles, glomerular nerve formations are located away the dermal papillae. In cross sections, glomerular nerve formation consists of several axonal profiles enveloped by 1-2 cytoplasmic lamellae of Schwann cells. The space among them is filled by collagenous microfibrils and the basal lamina-like material. Capsule was composed from fibroblast-like cells without definite basal lamina. An electron-dense reaction product due to non-specific cholinesterase activity was associated with Schwann cells and their processes surrounding unmyelinated terminal portion of the sensory axons. Abundant reaction product was bound to the collagenous microfibrils and was deposited in extracellular matrix between Schwann cell processes. These results are further evidence for the presence of the non-specific cholinesterase molecules as integral component of the extracellular matrix in sensory corpuscles. On the basis of histochemical study two possible explanation are considered for functional involving of this enzyme in sensory nerve formations.

  5. Interplay of host specificity and biogeography in the population structure of a cosmopolitan endoparasite: microsatellite study of Ligula intestinalis (Cestoda)

    Štefka, Jan; Hypša, Václav; Scholz, Tomáš

    2009-01-01

    Roč. 18, č. 6 (2009), s. 1187-1206 ISSN 0962-1083 R&D Projects: GA MŠk LC06073; GA ČR GA524/08/0885; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : cryptic speciation * geographical isolation * host specificity * microsatellites * parasite * population structure Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 5.960, year: 2009

  6. Jazz drummers recruit language-specific areas for the processing of rhythmic structure.

    Herdener, Marcus; Humbel, Thierry; Esposito, Fabrizio; Habermeyer, Benedikt; Cattapan-Ludewig, Katja; Seifritz, Erich

    2014-03-01

    Rhythm is a central characteristic of music and speech, the most important domains of human communication using acoustic signals. Here, we investigated how rhythmical patterns in music are processed in the human brain, and, in addition, evaluated the impact of musical training on rhythm processing. Using fMRI, we found that deviations from a rule-based regular rhythmic structure activated the left planum temporale together with Broca's area and its right-hemispheric homolog across subjects, that is, a network also crucially involved in the processing of harmonic structure in music and the syntactic analysis of language. Comparing the BOLD responses to rhythmic variations between professional jazz drummers and musical laypersons, we found that only highly trained rhythmic experts show additional activity in left-hemispheric supramarginal gyrus, a higher-order region involved in processing of linguistic syntax. This suggests an additional functional recruitment of brain areas usually dedicated to complex linguistic syntax processing for the analysis of rhythmical patterns only in professional jazz drummers, who are especially trained to use rhythmical cues for communication.

  7. Contact networks structured by sex underpin sex-specific epidemiology of infection.

    Silk, Matthew J; Weber, Nicola L; Steward, Lucy C; Hodgson, David J; Boots, Mike; Croft, Darren P; Delahay, Richard J; McDonald, Robbie A

    2018-02-01

    Contact networks are fundamental to the transmission of infection and host sex often affects the acquisition and progression of infection. However, the epidemiological impacts of sex-related variation in animal contact networks have rarely been investigated. We test the hypothesis that sex-biases in infection are related to variation in multilayer contact networks structured by sex in a population of European badgers Meles meles naturally infected with Mycobacterium bovis. Our key results are that male-male and between-sex networks are structured at broader spatial scales than female-female networks and that in male-male and between-sex contact networks, but not female-female networks, there is a significant relationship between infection and contacts with individuals in other groups. These sex differences in social behaviour may underpin male-biased acquisition of infection and may result in males being responsible for more between-group transmission. This highlights the importance of sex-related variation in host behaviour when managing animal diseases. © 2017 The Authors. Ecology Letters published by CNRS and John Wiley & Sons Ltd.

  8. Relationship of binding specificity and structural property of the technetium-99m complexes for tumor hypoxia and tumor angiogenesis imaging

    Su, Z.F.

    2005-01-01

    The growth of tumor requires nutrition and oxygen. Tumor cells will become hypoxic when the supply of oxygen is insufficient. Hypoxic tumor cells will not only resist radiation therapy and chemotherapy, but also induce angiogenesis for oxygen supply and for metastasis. Therefore, detection of tumor hypoxia and tumor angiogenesis with high sensitive radio labeled imaging agents is important. Hypoxic tumor cells may display some molecules as tumor markers for the specific binding with radiopharmaceuticals. Radiopharmaceuticals, unlike the non-radioactive drugs, are trace compounds in a given dosage. Due to the extreme low concentration, the non-specific accumulation of the radiotracers by blood cells and proteins, tissues, and organs can be even more serious compared to the non-radioactive drugs. The non-specific accumulation of the radiotracers can make the ratios of tumor/tissue (in terms of i.d.%/g) falling to the range of 2∼7 [1-2]. Non-specific binding of radiopharmaceuticals is common, but detailed studies on it are poor documented. This presentation reports the study of the relationship of non-specific accumulation and the structural property of two type of 99m TC labeled compounds: (a) 99m Tc-(amine o xime) containing either 2-nitroimidazole (2-NI, as hypoxia tumor cells specific agents), or 4-nitro- imidazole (4-NI, as control), or aniline (as reference) groups; (b) 99m Tc-(arginine-glycine- aspartic acid, RGD, as tumor angiogenesis specific agents) and 99m Tc-(arginine-glycine- glutarmic acid, RGE, as control). The 99m Tc-(amine-oxime) complexes, in addition to the 2-NI, 4-NI, and aniline groups, contain methyl-, ethyl-, propyl-, iso-butyl-, t-butyl-, phenyl-, and Benzyl- groups as well to make the radiotracers differing in structure and in lipophilicity , while the lipophilicity of a radiotracer plays an important role in non-specific cellular accumulation and protein binding, The results demonstrated that (1) the complex containing 2-NI showed specific

  9. Human lactoferricin derived di-peptides deploying loop structures induce apoptosis specifically in cancer cells through targeting membranous phosphatidylserine.

    Riedl, Sabrina; Leber, Regina; Rinner, Beate; Schaider, Helmut; Lohner, Karl; Zweytick, Dagmar

    2015-11-01

    Host defense-derived peptides have emerged as a novel strategy for the development of alternative anticancer therapies. In this study we report on characteristic features of human lactoferricin (hLFcin) derivatives which facilitate specific killing of cancer cells of melanoma, glioblastoma and rhabdomyosarcoma compared with non-specific derivatives and the synthetic peptide RW-AH. Changes in amino acid sequence of hLFcin providing 9-11 amino acids stretched derivatives LF11-316, -318 and -322 only yielded low antitumor activity. However, the addition of the repeat (di-peptide) and the retro-repeat (di-retro-peptide) sequences highly improved cancer cell toxicity up to 100% at 20 μM peptide concentration. Compared to the complete parent sequence hLFcin the derivatives showed toxicity on the melanoma cell line A375 increased by 10-fold and on the glioblastoma cell line U-87mg by 2-3-fold. Reduced killing velocity, apoptotic blebbing, activation of caspase 3/7 and formation of apoptotic DNA fragments proved that the active and cancer selective peptides, e.g. R-DIM-P-LF11-322, trigger apoptosis, whereas highly active, though non-selective peptides, such as DIM-LF11-318 and RW-AH seem to kill rapidly via necrosis inducing membrane lyses. Structural studies revealed specific toxicity on cancer cells by peptide derivatives with loop structures, whereas non-specific peptides comprised α-helical structures without loop. Model studies with the cancer membrane mimic phosphatidylserine (PS) gave strong evidence that PS only exposed by cancer cells is an important target for specific hLFcin derivatives. Other negatively charged membrane exposed molecules as sialic acid, heparan and chondroitin sulfate were shown to have minor impact on peptide activity. Copyright © 2015. Published by Elsevier B.V.

  10. Specific features of the flow structure in a reactive type turbine stage

    Chernikov, V. A.; Semakina, E. Yu.

    2017-04-01

    The results of experimental studies of the gas dynamics for a reactive type turbine stage are presented. The objective of the studies is the measurement of the 3D flow fields in reference cross sections, experimental determination of the stage characteristics, and analysis of the flow structure for detecting the sources of kinetic energy losses. The integral characteristics of the studied stage are obtained by averaging the results of traversing the 3D flow over the area of the reference cross sections before and behind the stage. The averaging is performed using the conservation equations for mass, total energy flux, angular momentum with respect to the axis z of the turbine, entropy flow, and the radial projection of the momentum flux equation. The flow parameter distributions along the channel height behind the stage are obtained in the same way. More thorough analysis of the flow structure is performed after interpolation of the experimentally measured point parameter values and 3D flow velocities behind the stage. The obtained continuous velocity distributions in the absolute and relative coordinate systems are presented in the form of vector fields. The coordinates of the centers and the vectors of secondary vortices are determined using the results of point measurements of velocity vectors in the cross section behind the turbine stage and their subsequent interpolation. The approach to analysis of experimental data on aerodynamics of the turbine stage applied in this study allows one to find the detailed space structure of the working medium flow, including secondary coherent vortices at the root and peripheral regions of the air-gas part of the stage. The measured 3D flow parameter fields and their interpolation, on the one hand, point to possible sources of increased power losses, and, on the other hand, may serve as the basis for detailed testing of CFD models of the flow using both integral and local characteristics. The comparison of the numerical and

  11. High-affinity monoclonal antibodies specific for deoxynucleosides structurally modified by alkylating agents: Applications for immunoanalysis

    Adamkiewicz, J.; Ahrens, O.; Rajewsky, M.F.

    1984-01-01

    So far the results of attempts to use monoclonal antibodies for the demonstration of carcinogen-DNA adducts in cells by immunostaining have been promising. Thus the authors have established a standardized procedure for the quantitation of specific alkyl-deoxynucleosides in the nuclear DNA of individual cells by direct immunofluorescence, using tetramethylrhodamine isothiocyanate-labeled monoclonal antibodies and a computer-based image analysis of electronically intensified fluorescence signals. With a fluorescent anti-(O/sup 6/-EtdGuo) monoclonal antibody, the present detection limit for O/sup 6/-Etd-Guo in the nuclei of individual cells previously exposed to an ethylating N-nitroso compound (e.g., N-ethyl-N-nitrosourea) is -- 700 O/sup 6/-EtdGuo molecules per diploid genome, i.e., similar to the detection limit for the same ethylation product in a hydrolysate of (O/sup 6/-EtdGuo)-containing DNA analyzed by competitive RIA

  12. A specific alpha laboratory dedicated to structural and thermodynamic studies on actinide complexes

    Charbonnel, M-C.; Berthon, C.; Berthon, L.; Boubals, N.; Couston, L.; Auwer, C. den; Meyer, D.; Guillaneux, D

    2004-07-01

    The main scope of the LN1 laboratory in ATALANTE facility is the chemical and physico-chemical study of transuranic samples to understand the behavior of compounds of actinide with selective ligands at a molecular scale. The main techniques implemented in this laboratory are the following ones: Nuclear Magnetic Resonance spectrometer (400 MHz shielded magnetic field), a four circle X-ray diffractometer for single crystals, a microcalorimeter to the measurement of low heats of reactions, a Time Resolved Laser-induced spectro-fluorimeter, vibrational spectrometers: FTIR and Raman, an Electro-spray Ionisation Mass spectrometer. Specific glove boxes have been built for each technique to work on radio elements with safety conditions and allow the analysis of samples in different states (aqueous and organic liquids, gels, solids). (authors)

  13. Crystal structure of the N domain of human somatic angiotensin I-converting enzyme provides a structural basis for domain-specific inhibitor design.

    Corradi, Hazel R; Schwager, Sylva L U; Nchinda, Aloysius T; Sturrock, Edward D; Acharya, K Ravi

    2006-03-31

    Human somatic angiotensin I-converting enzyme (sACE) is a key regulator of blood pressure and an important drug target for combating cardiovascular and renal disease. sACE comprises two homologous metallopeptidase domains, N and C, joined by an inter-domain linker. Both domains are capable of cleaving the two hemoregulatory peptides angiotensin I and bradykinin, but differ in their affinities for a range of other substrates and inhibitors. Previously we determined the structure of testis ACE (C domain); here we present the crystal structure of the N domain of sACE (both in the presence and absence of the antihypertensive drug lisinopril) in order to aid the understanding of how these two domains differ in specificity and function. In addition, the structure of most of the inter-domain linker allows us to propose relative domain positions for sACE that may contribute to the domain cooperativity. The structure now provides a platform for the design of "domain-specific" second-generation ACE inhibitors.

  14. Germ cell specification and ovary structure in the rotifer Brachionus plicatilis.

    Smith, James M; Cridge, Andrew G; Dearden, Peter K

    2010-08-02

    The segregation of the germline from somatic tissues is an essential process in the development of all animals. Specification of the primordial germ cells (PGCs) takes place via different strategies across animal phyla; either specified early in embryogenesis by the inheritance of maternal determinants in the cytoplasm of the oocyte ('preformation') or selected later in embryonic development from undifferentiated precursors by a localized inductive signal ('epigenesis'). Here we investigate the specification and development of the germ cells in the rotifer Brachionus plicatilis, a member of the poorly-characterized superphyla Lophotrochozoa, by isolating the Brachionus homologues of the conserved germ cell markers vasa and nanos, and examining their expression using in situ hybridization. Bpvasa and Bpnos RNA expression have very similar distributions in the Brachionus ovary, showing ubiquitous expression in the vitellarium, with higher levels in the putative germ cell cluster. Bpvas RNA expression is present in freshly laid eggs, remaining ubiquitous in embryos until at least the 96 cell stage after which expression narrows to a small cluster of cells at the putative posterior of the embryo, consistent with the developing ovary. Bpnos RNA expression is also present in just-laid eggs but expression is much reduced by the four-cell stage and absent by the 16-cell stage. Shortly before hatching of the juvenile rotifer from the egg, Bpnos RNA expression is re-activated, located in a subset of posterior cells similar to those expressing Bpvas at the same stage. The observed expression of vasa and nanos in the developing B. plicatilis embryo implies an epigenetic origin of primordial germ cells in Rotifer.

  15. Germ cell specification and ovary structure in the rotifer Brachionus plicatilis

    Smith James M

    2010-08-01

    Full Text Available Abstract Background The segregation of the germline from somatic tissues is an essential process in the development of all animals. Specification of the primordial germ cells (PGCs takes place via different strategies across animal phyla; either specified early in embryogenesis by the inheritance of maternal determinants in the cytoplasm of the oocyte ('preformation' or selected later in embryonic development from undifferentiated precursors by a localized inductive signal ('epigenesis'. Here we investigate the specification and development of the germ cells in the rotifer Brachionus plicatilis, a member of the poorly-characterized superphyla Lophotrochozoa, by isolating the Brachionus homologues of the conserved germ cell markers vasa and nanos, and examining their expression using in situ hybridization. Results Bpvasa and Bpnos RNA expression have very similar distributions in the Brachionus ovary, showing ubiquitous expression in the vitellarium, with higher levels in the putative germ cell cluster. Bpvas RNA expression is present in freshly laid eggs, remaining ubiquitous in embryos until at least the 96 cell stage after which expression narrows to a small cluster of cells at the putative posterior of the embryo, consistent with the developing ovary. Bpnos RNA expression is also present in just-laid eggs but expression is much reduced by the four-cell stage and absent by the 16-cell stage. Shortly before hatching of the juvenile rotifer from the egg, Bpnos RNA expression is re-activated, located in a subset of posterior cells similar to those expressing Bpvas at the same stage. Conclusions The observed expression of vasa and nanos in the developing B. plicatilis embryo implies an epigenetic origin of primordial germ cells in Rotifer.

  16. Direct methods and residue type specific isotope labeling in NMR structure determination and model-driven sequential assignment

    Schedlbauer, Andreas; Auer, Renate; Ledolter, Karin; Tollinger, Martin; Kloiber, Karin; Lichtenecker, Roman; Ruedisser, Simon; Hommel, Ulrich; Schmid, Walther; Konrat, Robert; Kontaxis, Georg

    2008-01-01

    Direct methods in NMR based structure determination start from an unassigned ensemble of unconnected gaseous hydrogen atoms. Under favorable conditions they can produce low resolution structures of proteins. Usually a prohibitively large number of NOEs is required, to solve a protein structure ab-initio, but even with a much smaller set of distance restraints low resolution models can be obtained which resemble a protein fold. One problem is that at such low resolution and in the absence of a force field it is impossible to distinguish the correct protein fold from its mirror image. In a hybrid approach these ambiguous models have the potential to aid in the process of sequential backbone chemical shift assignment when 13 C β and 13 C' shifts are not available for sensitivity reasons. Regardless of the overall fold they enhance the information content of the NOE spectra. These, combined with residue specific labeling and minimal triple-resonance data using 13 C α connectivity can provide almost complete sequential assignment. Strategies for residue type specific labeling with customized isotope labeling patterns are of great advantage in this context. Furthermore, this approach is to some extent error-tolerant with respect to data incompleteness, limited precision of the peak picking, and structural errors caused by misassignment of NOEs

  17. Common genetic variation near MC4R has a sex-specific impact on human brain structure and eating behavior.

    Annette Horstmann

    Full Text Available Obesity is associated with genetic and environmental factors but the underlying mechanisms remain poorly understood. Recent genome-wide association studies (GWAS identified obesity- and type 2 diabetes-associated genetic variants located within or near genes that modulate brain activity and development. Among the top hits is rs17782313 near MC4R, encoding for the melanocortin-4-receptor, which is expressed in brain regions that regulate eating. Here, we hypothesized rs17782313-associated changes in human brain regions that regulate eating behavior. Therefore, we examined effects of common variants at rs17782313 near MC4R on brain structure and eating behavior. Only in female homozygous carriers of the risk allele we found significant increases of gray matter volume (GMV in the right amygdala, a region known to influence eating behavior, and the right hippocampus, a structure crucial for memory formation and learning. Further, we found bilateral increases in medial orbitofrontal cortex, a multimodal brain structure encoding the subjective value of reinforcers, and bilateral prefrontal cortex, a higher order regulation area. There was no association between rs17782313 and brain structure in men. Moreover, among female subjects only, we observed a significant increase of 'disinhibition', and, more specifically, on 'emotional eating' scores of the Three Factor Eating Questionnaire in carriers of the variant rs17782313's risk allele. These findings suggest that rs17782313's effect on eating behavior is mediated by central mechanisms and that these effects are sex-specific.

  18. THE STRUCTURAL SPECIFICITIES OF THE US CONGRESS’ WHICH INFLUENCE THE POLICY DECISION-MAKING PROCESS

    O A. Frolova

    2014-04-01

    Full Text Available The U.S. Congress plays an important role in the decision-making process at the system of American political management. First of all, it applies to formulation and coordination of different interests through the law passing process. The article examines the Congress’ structure and the different aspects of its functioning. Those aspects often play a key role in lawmaking process and later affect the forming of the US political vector. The author comes to conclusion that the existing system of subcommittees doesn’t allow the U.S. Legislature to consider many bills completely and that fact negatively impacts on political decision-making process.Purchase on Elibrary.ru > Buy now

  19. Specific features of waveguide recombination in laser structures with asymmetric barrier layers

    Polubavkina, Yu. S., E-mail: polubavkina@mail.ru; Zubov, F. I.; Moiseev, E. I.; Kryzhanovskaya, N. V.; Maximov, M. V. [Russian Academy of Sciences, St. Petersburg National Research Academic University (Russian Federation); Semenova, E. S.; Yvind, K. [Technical University of Denmark, DTU Fotonik (Denmark); Asryan, L. V. [Virginia Polytechnic Institute and State University (United States); Zhukov, A. E. [Russian Academy of Sciences, St. Petersburg National Research Academic University (Russian Federation)

    2017-02-15

    The spatial distribution of the intensity of the emission caused by recombination appearing at a high injection level (up to 30 kA/cm{sup 2}) in the waveguide layer of a GaAs/AlGaAs laser structure with GaInP and AlGaInAs asymmetric barrier layers is studied by means of near-field scanning optical microscopy. It is found that the waveguide luminescence in such a laser, which is on the whole less intense as compared to that observed in a similar laser without asymmetric barriers, is non-uniformly distributed in the waveguide, so that the distribution maximum is shifted closer to the p-type cladding layer. This can be attributed to the ability of the GaInP barrier adjoining the quantum well on the side of the n-type cladding layer to suppress the hole transport.

  20. Specific features of waveguide recombination in laser structures with asymmetric barrier layers

    Polubavkina, Yu; Zubov, F. I.; Moiseev, E.

    2017-01-01

    microscopy. It is found that the waveguide luminescence in such a laser, which is on the whole less intense as compared to that observed in a similar laser without asymmetric barriers, is non-uniformly distributed in the waveguide, so that the distribution maximum is shifted closer to the p-type cladding......The spatial distribution of the intensity of the emission caused by recombination appearing at a high injection level (up to 30 kA/cm2) in the waveguide layer of a GaAs/AlGaAs laser structure with GaInP and AlGaInAs asymmetric barrier layers is studied by means of near-field scanning optical...... layer. This can be attributed to the ability of the GaInP barrier adjoining the quantum well on the side of the n-type cladding layer to suppress the hole transport....

  1. Probing ion-specific effects on aqueous acetate solutions: Ion pairing versus water structure modifications

    Tristan Petit

    2014-05-01

    Full Text Available The effect of monovalent cations (Li+, K+, NH4+, Na+ on the water structure in aqueous chloride and acetate solutions was characterized by oxygen K-edge X-ray absorption spectroscopy (XAS, X-ray emission spectroscopy, and resonant inelastic X-ray scattering (RIXS of a liquid microjet. We show ion- and counterion dependent effects on the emission spectra of the oxygen K-edge, which we attribute to modifications of the hydrogen bond network of water. For acetates, ion pairing with carboxylates was also probed selectively by XAS and RIXS. We correlate our experimental results to speciation data and to the salting-out properties of the cations.

  2. Diatom-Specific Oligosaccharide and Polysaccharide Structures Help to Unravel Biosynthetic Capabilities in Diatoms

    Bruno Gügi

    2015-09-01

    Full Text Available Diatoms are marine organisms that represent one of the most important sources of biomass in the ocean, accounting for about 40% of marine primary production, and in the biosphere, contributing up to 20% of global CO2 fixation. There has been a recent surge in developing the use of diatoms as a source of bioactive compounds in the food and cosmetic industries. In addition, the potential of diatoms such as Phaeodactylum tricornutum as cell factories for the production of biopharmaceuticals is currently under evaluation. These biotechnological applications require a comprehensive understanding of the sugar biosynthesis pathways that operate in diatoms. Here, we review diatom glycan and polysaccharide structures, thus revealing their sugar biosynthesis capabilities.

  3. Resistance exercise induces region-specific adaptations in anterior pituitary gland structure and function in rats.

    Kraemer, William J; Flanagan, Shawn D; Volek, Jeff S; Nindl, Bradley C; Vingren, Jakob L; Dunn-Lewis, Courtenay; Comstock, Brett A; Hooper, David R; Szivak, Tunde K; Looney, David P; Maresh, Carl M; Hymer, Wesley C

    2013-12-01

    The anterior pituitary gland (AP) increases growth hormone (GH) secretion in response to resistance exercise (RE), but the nature of AP adaptations to RE is unknown. To that end, we examined the effects of RE on regional AP somatotroph GH release, structure, and relative quantity. Thirty-six Sprague-Dawley rats were assigned to one of four groups: 1) no training or acute exercise (NT-NEX); 2) no training with acute exercise (NT-EX); 3) resistance training without acute exercise (RT-NEX); 4) resistance training with acute exercise (RT-EX). RE incorporated 10, 1 m-weighted ladder climbs at an 85° angle. RT groups trained 3 days/wk for 7 wk, progressively. After death, trunk blood was collected, and each AP was divided into quadrants (ventral-dorsal and left-right). We measured: 1) trunk plasma GH; 2) somatotroph GH release; 3) somatotroph size; 4) somatotroph secretory content; and 5) percent of AP cells identified as somatotrophs. Trunk GH differed by group (NT-NEX, 8.9 ± 2.4 μg/l; RT-NEX, 9.2 ± 3.5 μg/l; NT-EX, 15.6 ± 3.4 μg/l; RT-EX, 23.4 ± 4.6 μg/l). RT-EX demonstrated greater somatotroph GH release than all other groups, predominantly in ventral regions (P pituitary gland. RE training appears to induce dynamic adaptations in somatotroph structure and function.

  4. Quantitative MR imaging of intra-orbital structures: Tissue-specific measurements and age dependency compared to extra-orbital structures using multispectral quantitative MR imaging.

    Watanabe, Memi; Buch, Karen; Fujita, Akifumi; Jara, Hernán; Qureshi, Muhammad Mustafa; Sakai, Osamu

    2017-08-01

    The orbit can be affected by unique pathologic conditions and often requires MRI evaluation. The purpose of this study was to investigate the age-related changes in multiple intra-orbital structures using quantitative MRI (qMRI). Thirty-eight subjects (20 males, 18 females; ages 0.5-87 years) underwent MRI with a mixed turbo spin echo sequence. T1 and T2 measurements were obtained within ROI in 6 intra-orbital structures (medial and lateral rectus muscles, medial and lateral retrobulbar fat, lacrimal gland, and optic nerve), and compared with those of corresponding extra-orbital structures (masseter muscle, subcutaneous cheek fat, buccal fat, parotid gland, and frontal white matter). Statistical analyses were performed using Pearson's correlation coefficients. T1 and T2 values of the extra-ocular muscles increased with age, with higher T1 and T2 values compared to the masseter muscles. Retrobulbar fat showed significant age-associated increases in T1 values in the lateral side and in T2 values in both sides. T1 and T2 values in the lacrimal gland increased with age, while the parotid gland showed an age-associated increase in T2 values and decrease in T1 values. Optic nerves demonstrated age-related changes, similar to that of frontal white matter; rapid decreases with age in T1 and T2 times in early stages of life, and slight increases in T1 and T2 times later in life. Intra-orbital structures demonstrated specific qMRI measurements and aging patterns, which were different from extra-orbital structures. Location-specific age-related changes of intra-orbital structures should be considered in the qMRI assessment of the orbital pathology.

  5. Structural Differences between the Streptococcus agalactiae Housekeeping and Pilus-Specific Sortases: SrtA and SrtC1

    Khare, B.; Krishnan, V.; Rajashankar, K.R.; I-Hsiu, H.; Xin, M.; Ton-That, H.; Narayana, S.V. (Texas-HSC); (Cornell); (UAB)

    2011-10-21

    The assembly of pili on the cell wall of Gram-positive bacteria requires transpeptidase enzymes called sortases. In Streptococcus agalactiae, the PI-1 pilus island of strain 2603V/R encodes two pilus-specific sortases (SrtC1 and SrtC2) and three pilins (GBS80, GBS52 and GBS104). Although either pilus-specific sortase is sufficient for the polymerization of the major pilin, GBS80, incorporation of the minor pilins GBS52 and GBS104 into the pilus structure requires SrtC1 and SrtC2, respectively. The S. agalactiae housekeeping sortase, SrtA, whose gene is present at a different location and does not catalyze pilus polymerization, was shown to be involved in cell wall anchoring of pilus polymers. To understand the structural basis of sortases involved in such diverse functions, we determined the crystal structures of S. agalactiae SrtC1 and SrtA. Both enzymes are made of an eight-stranded beta-barrel core with variations in their active site architecture. SrtA exhibits a catalytic triad arrangement similar to that in Streptococcus pyogenes SrtA but different from that in Staphylococcus aureus SrtA. In contrast, the SrtC1 enzyme contains an N-terminal helical domain and a 'lid' in its putative active site, which is similar to that seen in Streptococcus pneumoniae pilus-specific sortases, although with subtle differences in positioning and composition. To understand the effect of such differences on substrate recognition, we have also determined the crystal structure of a SrtC1 mutant, in which the conserved DP(W/F/Y) motif was replaced with the sorting signal motif of GBS80, IPNTG. By comparing the structures of WT wild type SrtA and SrtC1 and the 'lid' mutant of SrtC1, we propose that structural elements within the active site and the lid may be important for defining the role of specific sortase in pili biogenesis.

  6. Structural differences between the Streptococcus agalactiae housekeeping and pilus-specific sortases: SrtA and SrtC1.

    B Khare

    Full Text Available The assembly of pili on the cell wall of Gram-positive bacteria requires transpeptidase enzymes called sortases. In Streptococcus agalactiae, the PI-1 pilus island of strain 2603V/R encodes two pilus-specific sortases (SrtC1 and SrtC2 and three pilins (GBS80, GBS52 and GBS104. Although either pilus-specific sortase is sufficient for the polymerization of the major pilin, GBS80, incorporation of the minor pilins GBS52 and GBS104 into the pilus structure requires SrtC1 and SrtC2, respectively. The S. agalactiae housekeeping sortase, SrtA, whose gene is present at a different location and does not catalyze pilus polymerization, was shown to be involved in cell wall anchoring of pilus polymers. To understand the structural basis of sortases involved in such diverse functions, we determined the crystal structures of S. agalactiae SrtC1 and SrtA. Both enzymes are made of an eight-stranded beta-barrel core with variations in their active site architecture. SrtA exhibits a catalytic triad arrangement similar to that in Streptococcus pyogenes SrtA but different from that in Staphylococcus aureus SrtA. In contrast, the SrtC1 enzyme contains an N-terminal helical domain and a 'lid' in its putative active site, which is similar to that seen in Streptococcus pneumoniae pilus-specific sortases, although with subtle differences in positioning and composition. To understand the effect of such differences on substrate recognition, we have also determined the crystal structure of a SrtC1 mutant, in which the conserved DP(W/F/Y motif was replaced with the sorting signal motif of GBS80, IPNTG. By comparing the structures of WT wild type SrtA and SrtC1 and the 'lid' mutant of SrtC1, we propose that structural elements within the active site and the lid may be important for defining the role of specific sortase in pili biogenesis.

  7. A novel multiple super junction power device structure with low specific on-resistance

    Zhu Hui; Li Haiou; Li Qi; Huang Yuanhao; Xu Xiaoning; Zhao Hailiang

    2014-01-01

    A novel multiple super junction (MSJ) LDMOS power device is proposed to decrease R on due to lateral and vertical interactions between the N-pillar and P-pillar. In the studied device: multiple layers of SJ are introduced oppositely under surface SJ; when compared with 2D-depleting of the conventional super junction (CSJ), a 3D-depleted effect is formed in the MSJ thanks to vertical electric field modulation; and, current distribution is improved by deep drain, which increases the drift doping concentration and results in a lower on-resistance. The high electric field around the drain region by substrate-assisted depleted effect is reduced due to the charge balance result from the electric field shielding effect of the bottom SJ, which causes the uniform electric field in the drift region and the high breakdown voltage. The numerical simulation results indicate that the specific on-resistance of the MSJ device is reduced by 42% compared with that of CSJ device, while maintaining a high breakdown voltage; the cell pitch of the device is 12 μm. (semiconductor devices)

  8. Improving specific activity and thermostability of Escherichia coli phytase by structure-based rational design.

    Wu, Tzu-Hui; Chen, Chun-Chi; Cheng, Ya-Shan; Ko, Tzu-Ping; Lin, Cheng-Yen; Lai, Hui-Lin; Huang, Ting-Yung; Liu, Je-Ruei; Guo, Rey-Ting

    2014-04-10

    Escherichia coli phytase (EcAppA) which hydrolyzes phytate has been widely applied in the feed industry, but the need to improve the enzyme activity and thermostability remains. Here, we conduct rational design with two strategies to enhance the EcAppA performance. First, residues near the substrate binding pocket of EcAppA were modified according to the consensus sequence of two highly active Citrobacter phytases. One out of the eleven mutants, V89T, exhibited 17.5% increase in catalytic activity, which might be a result of stabilized protein folding. Second, the EcAppA glycosylation pattern was modified in accordance with the Citrobacter phytases. An N-glycosylation motif near the substrate binding site was disrupted to remove spatial hindrance for phytate entry and product departure. The de-glycosylated mutants showed 9.6% increase in specific activity. On the other hand, the EcAppA mutants that adopt N-glycosylation motifs from CbAppA showed improved thermostability that three mutants carrying single N-glycosylation motif exhibited 5.6-9.5% residual activity after treatment at 80°C (1.8% for wild type). Furthermore, the mutant carrying all three glycosylation motifs exhibited 27% residual activity. In conclusion, a successful rational design was performed to obtain several useful EcAppA mutants with better properties for further applications. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. CMS tier structure and operation of the experiment-specific tasks in Germany

    Nowack, A

    2008-01-01

    In Germany, several university institutes and research centres take part in the CMS experiment. Concerning the data analysis, a couple of computing centres at different Tier levels, ranging from Tier 1 to Tier 3, exists at these places. The German Tier 1 centre GridKa at the research centre at Karlsruhe serves all four LHC experiments as well as four non-LHC experiments. With respect to the CMS experiment, GridKa is mainly involved in central tasks. The Tier 2 centre in Germany consists of two sites, one at the research centre DESY at Hamburg and one at RWTH Aachen University, forming a federated Tier 2 centre. Both parts cover different aspects of a Tier 2 centre. The German Tier 3 centres are located at the research centre DESY at Hamburg, at RWTH Aachen University, and at the University of Karlsruhe. Furthermore the building of a German user analysis facility is planned. Since the CMS community in German is rather small, a good cooperation between the different sites is essential. This cooperation includes physical topics as well as technical and operational issues. All available communication channels such as email, phone, monthly video conferences, and regular personal meetings are used. For example, the distribution of data sets is coordinated globally within Germany. Also the CMS-specific services such as the data transfer tool PhEDEx or the Monte Carlo production are operated by people from different sites in order to spread the knowledge widely and increase the redundancy in terms of operators

  10. Evidence of Ash Tree (Fraxinus spp. Specific Associations with Soil Bacterial Community Structure and Functional Capacity

    Michael P. Ricketts

    2018-04-01

    Full Text Available The spread of the invasive emerald ash borer (EAB across North America has had enormous impacts on temperate forest ecosystems. The selective removal of ash trees (Fraxinus spp. has resulted in abnormally large inputs of coarse woody debris and altered forest tree community composition, ultimately affecting a variety of ecosystem processes. The goal of this study was to determine if the presence of ash trees influences soil bacterial communities and/or functions to better understand the impacts of EAB on forest successional dynamics and biogeochemical cycling. Using 16S rRNA amplicon sequencing of soil DNA collected from ash and non-ash plots in central Ohio during the early stages of EAB infestation, we found that bacterial communities in plots with ash differed from those without ash. These differences were largely driven by Acidobacteria, which had a greater relative abundance in non-ash plots. Functional genes required for sulfur cycling, phosphorus cycling, and carbohydrate metabolism (specifically those which breakdown complex sugars to glucose were estimated to be more abundant in non-ash plots, while nitrogen cycling gene abundance did not differ. This ash-soil microbiome association implies that EAB-induced ash decline may promote belowground successional shifts, altering carbon and nutrient cycling and changing soil properties beyond the effects of litter additions caused by ash mortality.

  11. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  12. Sleep Benefits Memory for Semantic Category Structure While Preserving Exemplar-Specific Information.

    Schapiro, Anna C; McDevitt, Elizabeth A; Chen, Lang; Norman, Kenneth A; Mednick, Sara C; Rogers, Timothy T

    2017-11-01

    Semantic memory encompasses knowledge about both the properties that typify concepts (e.g. robins, like all birds, have wings) as well as the properties that individuate conceptually related items (e.g. robins, in particular, have red breasts). We investigate the impact of sleep on new semantic learning using a property inference task in which both kinds of information are initially acquired equally well. Participants learned about three categories of novel objects possessing some properties that were shared among category exemplars and others that were unique to an exemplar, with exposure frequency varying across categories. In Experiment 1, memory for shared properties improved and memory for unique properties was preserved across a night of sleep, while memory for both feature types declined over a day awake. In Experiment 2, memory for shared properties improved across a nap, but only for the lower-frequency category, suggesting a prioritization of weakly learned information early in a sleep period. The increase was significantly correlated with amount of REM, but was also observed in participants who did not enter REM, suggesting involvement of both REM and NREM sleep. The results provide the first evidence that sleep improves memory for the shared structure of object categories, while simultaneously preserving object-unique information.

  13. The specifics of the aplication of social and structural approach to electoral processes analysis

    V F Kovrov

    2009-06-01

    Full Text Available The analysis of a number of problems of the investigation of the electoral process viewed as a social phenomenon contributes to the overcoming of a number of theoretical and methodological obstacles in the process of its sociological cognition. The complexity and delicacy of the electoral process entails the application of a set of distinct approaches, research and description techniques. The article provides the rationale for the most complete insight into the social component of the electoral process via social and structural approach application. The given approach enables one to give concrete expression to the subject matter of electoral sociology at strategic, operational and tactical levels, define the elements of the electoral process, the outcome of the electoral practice, to reveal the invariability of the electoral conscience, psychological attitudes and values of different groups of voters as well as to analyze the evolution of the objective-transforming practice, the electoral activity of the population and to provide the extensive analysis of the results of the material and cultural assimilation of the electoral practice.

  14. Specificity of cognitive structure in depression and social phobia: a comparison of interpersonal and achievement content.

    Dozois, David J A; Frewen, Paul A

    2006-02-01

    The comorbidity between the mood and anxiety is extensive and it is probable that individuals with these disorders share a number of cognitive characteristics. However, comorbidity rates with depression are not uniform among the various anxiety disorders. This study examined the common and distinguishing features of self-schematic structure in major depressive disorder and social anxiety compared to other anxiety disorders in general and to no psychiatric disturbance. Participants completed the Psychological Distance Scaling Task, which provided an index of the cognitive organization of positively and negatively valenced interpersonal and achievement self-referent content. The depression and social phobia groups were statistically equivalent on all indices of cognitive organization, and showed greater interconnectedness among interpersonal negative content than both control groups, and less interconnectedness among both positive interpersonal and achievement content than did nonpsychiatric controls. Psychiatric groups were equivalent on negative achievement content but showed greater interconnectedness than controls. This study had a modest sample size and the findings are constrained to females. Negative interpersonal content is more densely interconnected in individuals with social phobia and depression compared with both other anxiety disorder and nonpsychiatric controls. In addition, both social phobia and depression were associated with less interconnected positive content. These findings are indicative of similarities in the way self-schematic content may be organized in individuals with depression and social phobia. Theoretical explanations of these results and future research directions are discussed.

  15. Structure and anticoagulant activity of a sulfated galactan from the red alga, Gelidium crinale. Is there a specific structural requirement for the anticoagulant action?

    Pereira, Maria G; Benevides, Norma M B; Melo, Marcia R S; Valente, Ana Paula; Melo, Fábio R; Mourão, Paulo A S

    2005-09-05

    Marine red algae are an abundant source of sulfated galactans with potent anticoagulant activity. However, the specific structural motifs that confer biological activity remain to be elucidated. We have now isolated and purified a sulfated galactan from the marine red alga, Gellidium crinale. The structure of this polysaccharide was determined using NMR spectroscopy. It is composed of the repeating structure -4-alpha-Galp-(1-->3)-beta-Galp1--> but with a variable sulfation pattern. Clearly 15% of the total alpha-units are 2,3-di-sulfated and another 55% are 2-sulfated. No evidence for the occurrence of 3,6-anhydro alpha-galactose units was observed in the NMR spectra. We also compared the anticoagulant activity of this sulfated galactan with a polysaccharide from the species, Botryocladia occidentalis, with a similar saccharide chain but with higher amounts of 2,3-di-sulfated alpha-units. The sulfated galactan from G. crinale has a lower anticoagulant activity on a clotting assay when compared with the polysaccharide from B. occidentalis. When tested in assays using specific proteases and coagulation inhibitors, these two galactans showed significant differences in their activity. They do not differ in thrombin inhibition mediated by antithrombin, but in assays where heparin cofactor II replaces antithrombin, the sulfated galactan from G. crinale requires a significantly higher concentration to achieve the same inhibitory effect as the polysaccharide from B. occidentalis. In contrast, when factor Xa instead of thrombin is used as the target protease, the sulfated galactan from G. crinale is a more potent anticoagulant. These observations suggest that the proportion and/or the distribution of 2,3-di-sulfated alpha-units along the galactan chain may be a critical structural motif to promote the interaction of the protease with specific protease and coagulation inhibitors.

  16. Light-stimulated cargo release from a core–shell structured nanocomposite for site-specific delivery

    Cai, Yun; Ling, Li; Li, Xiaofang; Chen, Meng; Su, Likai

    2015-01-01

    This paper reported a core–shell structured site-specific delivery system with a light switch triggered by low energy light (λ=510 nm). Its core was composed of supermagnetic Fe 3 O 4 nanoparticles for magnetic guiding and targeting. Its outer shell consisted of mesoporous silica molecular sieve MCM-41 which offered highly ordered hexagonal tunnels for cargo capacity. A light switch N1-(4aH-cyclopenta[1,2-b:5,4-b′]dipyridin-5(5aH)-ylidene)benzene-1, 4-diamine (CBD) was covalently grafted into these hexagonal tunnels, serving as light stimuli acceptor with loading content of 1.1 μM/g. This composite was fully characterized and confirmed by SEM, TEM, XRD patterns, N 2 adsorption/desorption, thermogravimetric analysis, IR, UV–vis absorption and emission spectra. Experimental data suggested that this composite had a core as wide as 150 nm and could be magnetically guided to specific sites. Its hexagonal tunnels were as long as 180 nm. Upon light stimuli of “on” and “off” states, controllable release was observed with short release time of ~900 s (90% capacity). - Graphical abstract: A core–shell structured site-specific delivery system with a light switch triggered by yellow light was constructed. Controllable release was observed with short release time of ~900 s (90% capacity). - Highlights: • A core–shell structured site-specific delivery system was constructed. • It consisted of Fe 3 O 4 core and MCM-41 shell grafted with light switch. • This delivery system was triggered by low energy light. • Controllable release was observed with short release time of ~900 s

  17. Structural and biochemical studies of a fluoroacetyl-CoA-specific thioesterase reveal a molecular basis for fluorine selectivity.

    Weeks, Amy M; Coyle, Scott M; Jinek, Martin; Doudna, Jennifer A; Chang, Michelle C Y

    2010-11-02

    We have initiated a broad-based program aimed at understanding the molecular basis of fluorine specificity in enzymatic systems, and in this context, we report crystallographic and biochemical studies on a fluoroacetyl-coenzyme A (CoA) specific thioesterase (FlK) from Streptomyces cattleya. Our data establish that FlK is competent to protect its host from fluoroacetate toxicity in vivo and demonstrate a 10(6)-fold discrimination between fluoroacetyl-CoA (k(cat)/K(M) = 5 × 10⁷ M⁻¹ s⁻¹) and acetyl-CoA (k(cat)/K(M) = 30 M⁻¹ s⁻¹) based on a single fluorine substitution that originates from differences in both substrate reactivity and binding. We show that Thr 42, Glu 50, and His 76 are key catalytic residues and identify several factors that influence substrate selectivity. We propose that FlK minimizes interaction with the thioester carbonyl, leading to selection against acetyl-CoA binding that can be recovered in part by new C═O interactions in the T42S and T42C mutants. We hypothesize that the loss of these interactions is compensated by the entropic driving force for fluorinated substrate binding in a hydrophobic binding pocket created by a lid structure, containing Val 23, Leu 26, Phe 33, and Phe 36, that is not found in other structurally characterized members of this superfamily. We further suggest that water plays a critical role in fluorine specificity based on biochemical and structural studies focused on the unique Phe 36 "gate" residue, which functions to exclude water from the active site. Taken together, the findings from these studies offer molecular insights into organofluorine recognition and design of fluorine-specific enzymes.

  18. Light-stimulated cargo release from a core–shell structured nanocomposite for site-specific delivery

    Cai, Yun; Ling, Li; Li, Xiaofang [Department of Neurology, Affiliated Hospital of Hebei University, Baoding 071000 (China); Chen, Meng [Department of Rheumatology, Affiliated Hospital of Hebei University, Baoding 071000 (China); Su, Likai, E-mail: zhangdong19992003@163.com [Department of Neurology, Affiliated Hospital of Hebei University, Baoding 071000 (China)

    2015-03-15

    This paper reported a core–shell structured site-specific delivery system with a light switch triggered by low energy light (λ=510 nm). Its core was composed of supermagnetic Fe{sub 3}O{sub 4} nanoparticles for magnetic guiding and targeting. Its outer shell consisted of mesoporous silica molecular sieve MCM-41 which offered highly ordered hexagonal tunnels for cargo capacity. A light switch N1-(4aH-cyclopenta[1,2-b:5,4-b′]dipyridin-5(5aH)-ylidene)benzene-1, 4-diamine (CBD) was covalently grafted into these hexagonal tunnels, serving as light stimuli acceptor with loading content of 1.1 μM/g. This composite was fully characterized and confirmed by SEM, TEM, XRD patterns, N{sub 2} adsorption/desorption, thermogravimetric analysis, IR, UV–vis absorption and emission spectra. Experimental data suggested that this composite had a core as wide as 150 nm and could be magnetically guided to specific sites. Its hexagonal tunnels were as long as 180 nm. Upon light stimuli of “on” and “off” states, controllable release was observed with short release time of ~900 s (90% capacity). - Graphical abstract: A core–shell structured site-specific delivery system with a light switch triggered by yellow light was constructed. Controllable release was observed with short release time of ~900 s (90% capacity). - Highlights: • A core–shell structured site-specific delivery system was constructed. • It consisted of Fe{sub 3}O{sub 4} core and MCM-41 shell grafted with light switch. • This delivery system was triggered by low energy light. • Controllable release was observed with short release time of ~900 s.

  19. A protected area influences genotype-specific survival and the structure of a Canis hybrid zone.

    Benson, John F; Patterson, Brent R; Mahoney, Peter J

    2014-02-01

    It is widely recognized that protected areas can strongly influence ecological systems and that hybridization is an important conservation issue. However, previous studies have not explicitly considered the influence of protected areas on hybridization dynamics. Eastern wolves are a species of special concern and their distribution is largely restricted to a protected population in Algonquin Provincial Park (APP), Ontario, Canada, where they are the numerically dominant canid. We studied intrinsic and extrinsic factors influencing survival and cause-specific mortality of hybrid and parental canids in the three-species hybrid zone between eastern wolves, eastern coyotes, and gray wolves in and adjacent to APP. Mortality risk for eastern wolves in areas adjacent to APP was significantly higher than for other sympatric Canis types outside of APP, and for eastern wolves and other canids within APP. Outside of APP, the annual mortality rate of all canids by harvest (24%) was higher than for other causes of death (4-7%). Furthermore, eastern wolves (hazard ratio = 3.5) and nonresidents (transients and dispersing animals, hazard ratio = 2.7) were more likely to die from harvest relative to other Canis types and residents, respectively. Thus, eastern wolves dispersing from APP were especially vulnerable to harvest mortality. For residents, eastern wolf survival was more negatively influenced by increased road density than for other Canis types, further highlighting the sensitivity of eastern wolves to human disturbance. A cycle of dispersal from APP followed by high rates of mortality and hybridization appears to maintain eastern wolves at low density adjacent to APP, limiting the potential for expansion beyond the protected area. However, high survival and numerical dominance of eastern wolves within APP suggest that protected areas can allow rare hybridizing species to persist even if their demographic performance is compromised and barriers to hybridization are largely

  20. Fat emulsions based on structured lipids (1,3-specific triglycerides): an investigation of the in vivo fate.

    Hedeman, H; Brøndsted, H; Müllertz, A; Frokjaer, S

    1996-05-01

    Structured lipids (1,3-specific triglycerides) are new chemical entities made by enzymatic transesterification of the fatty acids in the 1,3 positions of the triglyceride. The purpose of this study is to characterize structured lipids with either short chain fatty acids or medium chain fatty acids in the 1,3 positions with regard to their hydrophobicity, and investigate the in vivo fate in order to evaluate the potential of structured lipids as core material in fat emulsions used as parenteral drug delivery system. The lipids were characterized by employing reversed phase high performance liquid chromatography. The biodistribution of radioactively labeled emulsions was studied in rats. By employing high performance liquid chromatography a rank order of the hydrophobicities of the lipids could be given, with the triglycerides containing long chain fatty acids being the most hydrophobic and the structured lipid with short chain fatty acids in the 1,3 positions the least. When formulated as fat emulsions, the emulsion based on structured lipids with short fatty acids in the 1,3 positions was removed slower from the general blood circulation compared to emulsions based on lipids with long chain fatty acids in the 1,3 positions. The type of core material influences the in vivo circulation time of fat emulsions.

  1. The structure of bradyzoite-specific enolase from Toxoplasma gondii reveals insights into its dual cytoplasmic and nuclear functions

    Ruan, Jiapeng [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Mouveaux, Thomas [Université Lille Nord de France, (France); Light, Samuel H.; Minasov, George; Anderson, Wayne F. [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Tomavo, Stanislas [Université Lille Nord de France, (France); Ngô, Huân M., E-mail: h-ngo@northwestern.edu [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); BrainMicro LLC, 21 Pendleton Street, New Haven, CT 06511 (United States)

    2015-03-01

    The second crystal structure of a parasite protein preferentially enriched in the brain cyst of T. gondii has been solved at 2.75 Å resolution. Bradyzoite enolase 1 is reported to have differential functions as a glycolytic enzyme and a transcriptional regulator in bradyzoites. In addition to catalyzing a central step in glycolysis, enolase assumes a remarkably diverse set of secondary functions in different organisms, including transcription regulation as documented for the oncogene c-Myc promoter-binding protein 1. The apicomplexan parasite Toxoplasma gondii differentially expresses two nuclear-localized, plant-like enolases: enolase 1 (TgENO1) in the latent bradyzoite cyst stage and enolase 2 (TgENO2) in the rapidly replicative tachyzoite stage. A 2.75 Å resolution crystal structure of bradyzoite enolase 1, the second structure to be reported of a bradyzoite-specific protein in Toxoplasma, captures an open conformational state and reveals that distinctive plant-like insertions are located on surface loops. The enolase 1 structure reveals that a unique residue, Glu164, in catalytic loop 2 may account for the lower activity of this cyst-stage isozyme. Recombinant TgENO1 specifically binds to a TTTTCT DNA motif present in the cyst matrix antigen 1 (TgMAG1) gene promoter as demonstrated by gel retardation. Furthermore, direct physical interactions of both nuclear TgENO1 and TgENO2 with the TgMAG1 gene promoter are demonstrated in vivo using chromatin immunoprecipitation (ChIP) assays. Structural and biochemical studies reveal that T. gondii enolase functions are multifaceted, including the coordination of gene regulation in parasitic stage development. Enolase 1 provides a potential lead in the design of drugs against Toxoplasma brain cysts.

  2. Structural basis for type VI secreted peptidoglycan dl-endopeptidase function, specificity and neutralization in Serratia marcescens

    Srikannathasan, Velupillai; English, Grant [University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Bui, Nhat Khai [Newcastle University, Newcastle upon Tyne NE2 4HH (United Kingdom); Trunk, Katharina; O’Rourke, Patrick E. F.; Rao, Vincenzo A. [University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Vollmer, Waldemar [Newcastle University, Newcastle upon Tyne NE2 4HH (United Kingdom); Coulthurst, Sarah J., E-mail: s.j.coulthurst@dundee.ac.uk; Hunter, William N., E-mail: s.j.coulthurst@dundee.ac.uk [University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom)

    2013-12-01

    Crystal structures of type VI secretion system-associated immunity proteins, a peptidoglycan endopeptidase and a complex of the endopeptidase and its cognate immunity protein are reported together with assays of endopeptidase activity and functional assessment. Some Gram-negative bacteria target their competitors by exploiting the type VI secretion system to extrude toxic effector proteins. To prevent self-harm, these bacteria also produce highly specific immunity proteins that neutralize these antagonistic effectors. Here, the peptidoglycan endopeptidase specificity of two type VI secretion-system-associated effectors from Serratia marcescens is characterized. These small secreted proteins, Ssp1 and Ssp2, cleave between γ-d-glutamic acid and l-meso-diaminopimelic acid with different specificities. Ssp2 degrades the acceptor part of cross-linked tetratetrapeptides. Ssp1 displays greater promiscuity and cleaves monomeric tripeptides, tetrapeptides and pentapeptides and dimeric tetratetra and tetrapenta muropeptides on both the acceptor and donor strands. Functional assays confirm the identity of a catalytic cysteine in these endopeptidases and crystal structures provide information on the structure–activity relationships of Ssp1 and, by comparison, of related effectors. Functional assays also reveal that neutralization of these effectors by their cognate immunity proteins, which are called resistance-associated proteins (Raps), contributes an essential role to cell fitness. The structures of two immunity proteins, Rap1a and Rap2a, responsible for the neutralization of Ssp1 and Ssp2-like endopeptidases, respectively, revealed two distinct folds, with that of Rap1a not having previously been observed. The structure of the Ssp1–Rap1a complex revealed a tightly bound heteromeric assembly with two effector molecules flanking a Rap1a dimer. A highly effective steric block of the Ssp1 active site forms the basis of effector neutralization. Comparisons with Ssp2–Rap2

  3. Structural basis for type VI secreted peptidoglycan dl-endopeptidase function, specificity and neutralization in Serratia marcescens

    Srikannathasan, Velupillai; English, Grant; Bui, Nhat Khai; Trunk, Katharina; O’Rourke, Patrick E. F.; Rao, Vincenzo A.; Vollmer, Waldemar; Coulthurst, Sarah J.; Hunter, William N.

    2013-01-01

    Crystal structures of type VI secretion system-associated immunity proteins, a peptidoglycan endopeptidase and a complex of the endopeptidase and its cognate immunity protein are reported together with assays of endopeptidase activity and functional assessment. Some Gram-negative bacteria target their competitors by exploiting the type VI secretion system to extrude toxic effector proteins. To prevent self-harm, these bacteria also produce highly specific immunity proteins that neutralize these antagonistic effectors. Here, the peptidoglycan endopeptidase specificity of two type VI secretion-system-associated effectors from Serratia marcescens is characterized. These small secreted proteins, Ssp1 and Ssp2, cleave between γ-d-glutamic acid and l-meso-diaminopimelic acid with different specificities. Ssp2 degrades the acceptor part of cross-linked tetratetrapeptides. Ssp1 displays greater promiscuity and cleaves monomeric tripeptides, tetrapeptides and pentapeptides and dimeric tetratetra and tetrapenta muropeptides on both the acceptor and donor strands. Functional assays confirm the identity of a catalytic cysteine in these endopeptidases and crystal structures provide information on the structure–activity relationships of Ssp1 and, by comparison, of related effectors. Functional assays also reveal that neutralization of these effectors by their cognate immunity proteins, which are called resistance-associated proteins (Raps), contributes an essential role to cell fitness. The structures of two immunity proteins, Rap1a and Rap2a, responsible for the neutralization of Ssp1 and Ssp2-like endopeptidases, respectively, revealed two distinct folds, with that of Rap1a not having previously been observed. The structure of the Ssp1–Rap1a complex revealed a tightly bound heteromeric assembly with two effector molecules flanking a Rap1a dimer. A highly effective steric block of the Ssp1 active site forms the basis of effector neutralization. Comparisons with Ssp2–Rap2

  4. Structural evolution and tissue-specific expression of tetrapod-specific second isoform of secretory pathway Ca{sup 2+}-ATPase

    Pestov, Nikolay B., E-mail: korn@mail.ibch.ru [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Dmitriev, Ruslan I.; Kostina, Maria B. [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Korneenko, Tatyana V. [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Shakhparonov, Mikhail I. [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Modyanov, Nikolai N., E-mail: nikolai.modyanov@utoledo.edu [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States)

    2012-01-27

    Highlights: Black-Right-Pointing-Pointer Full-length secretory pathway Ca-ATPase (SPCA2) cloned from rat duodenum. Black-Right-Pointing-Pointer ATP2C2 gene (encoding SPCA2) exists only in genomes of Tetrapoda. Black-Right-Pointing-Pointer Rat and pig SPCA2 are expressed in intestines, lung and some secretory glands. Black-Right-Pointing-Pointer Subcellular localization of SPCA2 may depend on tissue type. Black-Right-Pointing-Pointer In rat duodenum, SPCA2 is localized in plasma membrane-associated compartments. -- Abstract: Secretory pathway Ca-ATPases are less characterized mammalian calcium pumps than plasma membrane Ca-ATPases and sarco-endoplasmic reticulum Ca-ATPases. Here we report analysis of molecular evolution, alternative splicing, tissue-specific expression and subcellular localization of the second isoform of the secretory pathway Ca-ATPase (SPCA2), the product of the ATP2C2 gene. The primary structure of SPCA2 from rat duodenum deduced from full-length transcript contains 944 amino acid residues, and exhibits 65% sequence identity with known SPCA1. The rat SPCA2 sequence is also highly homologous to putative human protein KIAA0703, however, the latter seems to have an aberrant N-terminus originating from intron 2. The tissue-specificity of SPCA2 expression is different from ubiquitous SPCA1. Rat SPCA2 transcripts were detected predominantly in gastrointestinal tract, lung, trachea, lactating mammary gland, skin and preputial gland. In the newborn pig, the expression profile is very similar with one remarkable exception: porcine bulbourethral gland gave the strongest signal. Upon overexpression in cultured cells, SPCA2 shows an intracellular distribution with remarkable enrichment in Golgi. However, in vivo SPCA2 may be localized in compartments that differ among various tissues: it is intracellular in epidermis, but enriched in plasma membranes of the intestinal epithelium. Analysis of SPCA2 sequences from various vertebrate species argue that ATP2C2

  5. Motor Skill Development in Italian Pre-School Children Induced by Structured Activities in a Specific Playground.

    Patrizia Tortella

    Full Text Available This study examined the effects and specificity of structured and unstructured activities played at the playground Primo Sport 0246 in Northern Italy on motor skill competence in five years old children. The playground was specifically designed to promote gross motor skills in preschool children; in this study 71 children from local kindergartens came to the park once a week for ten consecutive weeks and were exposed to 30 minutes of free play and 30 minutes of structured activities. Before and after the ten visits, each child completed nine tests to assess levels of motor skills, three for fine-motor skills and six for gross-motor skills. As control, motor skills were also assessed on 39 children from different kindergartens who did not come to the park. The results show that the experimental group who practiced gross-motor activities in the playground for 1 hour a week for 10 weeks improved significantly in 4 out of the 6 gross motor tasks and in none of the fine motor tasks. The data indicate that limited transfer occurred between tasks referring to different domains of motor competences while suggesting cross feeding for improvement of gross-motor skills between different exercises when domains related to physical fitness and strength of specific muscle groups are involved. These results are relevant to the issue of condition(s appropriate for maintaining and developing motor skills in this age group as well as for the planning, organization and implementation of play and physical activities in kindergartens.

  6. Motor Skill Development in Italian Pre-School Children Induced by Structured Activities in a Specific Playground.

    Tortella, Patrizia; Haga, Monika; Loras, Håvard; Sigmundsson, Hermundur; Fumagalli, Guido

    2016-01-01

    This study examined the effects and specificity of structured and unstructured activities played at the playground Primo Sport 0246 in Northern Italy on motor skill competence in five years old children. The playground was specifically designed to promote gross motor skills in preschool children; in this study 71 children from local kindergartens came to the park once a week for ten consecutive weeks and were exposed to 30 minutes of free play and 30 minutes of structured activities. Before and after the ten visits, each child completed nine tests to assess levels of motor skills, three for fine-motor skills and six for gross-motor skills. As control, motor skills were also assessed on 39 children from different kindergartens who did not come to the park. The results show that the experimental group who practiced gross-motor activities in the playground for 1 hour a week for 10 weeks improved significantly in 4 out of the 6 gross motor tasks and in none of the fine motor tasks. The data indicate that limited transfer occurred between tasks referring to different domains of motor competences while suggesting cross feeding for improvement of gross-motor skills between different exercises when domains related to physical fitness and strength of specific muscle groups are involved. These results are relevant to the issue of condition(s) appropriate for maintaining and developing motor skills in this age group as well as for the planning, organization and implementation of play and physical activities in kindergartens.

  7. High resolution bone material property assignment yields robust subject specific finite element models of complex thin bone structures.

    Pakdel, Amirreza; Fialkov, Jeffrey; Whyne, Cari M

    2016-06-14

    Accurate finite element (FE) modeling of complex skeletal anatomy requires high resolution in both meshing and the heterogeneous mapping of material properties onto the generated mesh. This study introduces Node-based elastic Modulus Assignment with Partial-volume correction (NMAP) as a new approach for FE material property assignment to thin bone structures. The NMAP approach incorporates point spread function based deblurring of CT images, partial-volume correction of CT image voxel intensities and anisotropic interpolation and mapping of CT intensity assignment to FE mesh nodes. The NMAP procedure combined with a derived craniomaxillo-facial skeleton (CMFS) specific density-isotropic elastic modulus relationship was applied to produce specimen-specific FE models of 6 cadaveric heads. The NMAP procedure successfully generated models of the complex thin bone structures with surface elastic moduli reflective of cortical bone material properties. The specimen-specific CMFS FE models were able to accurately predict experimental strains measured under in vitro temporalis and masseter muscle loading (r=0.93, slope=1.01, n=5). The strength of this correlation represents a robust validation for CMFS FE modeling that can be used to better understand load transfer in this complex musculoskeletal system. The developed methodology offers a systematic process-flow able to address the complexity of the CMFS that can be further applied to create high-fidelity models of any musculoskeletal anatomy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Motor Skill Development in Italian Pre-School Children Induced by Structured Activities in a Specific Playground

    Tortella, Patrizia; Haga, Monika; Loras, Håvard

    2016-01-01

    This study examined the effects and specificity of structured and unstructured activities played at the playground Primo Sport 0246 in Northern Italy on motor skill competence in five years old children. The playground was specifically designed to promote gross motor skills in preschool children; in this study 71 children from local kindergartens came to the park once a week for ten consecutive weeks and were exposed to 30 minutes of free play and 30 minutes of structured activities. Before and after the ten visits, each child completed nine tests to assess levels of motor skills, three for fine-motor skills and six for gross-motor skills. As control, motor skills were also assessed on 39 children from different kindergartens who did not come to the park. The results show that the experimental group who practiced gross-motor activities in the playground for 1 hour a week for 10 weeks improved significantly in 4 out of the 6 gross motor tasks and in none of the fine motor tasks. The data indicate that limited transfer occurred between tasks referring to different domains of motor competences while suggesting cross feeding for improvement of gross-motor skills between different exercises when domains related to physical fitness and strength of specific muscle groups are involved. These results are relevant to the issue of condition(s) appropriate for maintaining and developing motor skills in this age group as well as for the planning, organization and implementation of play and physical activities in kindergartens. PMID:27462985

  9. 1H NMR studies of plastocyanin from Scenedesmus obliquus: Complete sequence-specific assignment, secondary structure analysis, and global fold

    Moore, J.M.; Chazin, W.J.; Wright, P.E.; Powls, R.

    1988-01-01

    Two-dimensional 1 H NMR methods have been used to make sequence-specific resonance assignments for the 97 amino acid residues of the plastocyanin from the green alga Scenedesmus obliquus. Assignments were obtained for all backbone protons and the majority of the side-chain protons. Spin system identification relied heavily on the observation of relayed connectivities to the backbone amide proton. Sequence-specific assignments were made by using the sequential assignment procedure. During this process, an extra valine residue was identified that had not been detected in the original amino acid sequence. Elements of regular secondary structure were identified from characteristic NOE connectivities between backbone protons, coupling constant values, and the observation of slowly exchanging amide protons. The protein in solution contains eight β-strands, one short segment of helix, five reverse turns, and five loops. The β-strands may be arranged into two βsheets on the basis of extensive cross-strand NOE connectivities. The chain-folding topology determined from the NMR experiments is that of a Greek key β-barrel and is similar to that observed for French bean plastocyanin in solution and poplar plastocyanin in the crystalline state. While the overall structures are similar, several differences in local structure between the S. obliquus and higher plant plastocyanins have been identified

  10. Dynamic changes in the secondary structure of ECE-1 and XCE account for their different substrate specificities

    Ul-Haq Zaheer

    2012-11-01

    Full Text Available Abstract Background X-converting enzyme (XCE involved in nervous control of respiration, is a member of the M13 family of zinc peptidases, for which no natural substrate has been identified yet. In contrast, it’s well characterized homologue endothelin-converting enzyme-1 (ECE-1 showed broad substrate specificity and acts as endopeptidase as well as dipeptidase. To explore the structural differences between XCE and ECE-1, homology model of XCE was built using the complex structure of ECE-1 with phosphoramidon (pdb-id: 3DWB as template. Phosphoramidon was docked into the binding site of XCE whereas phosphate oxygen of the inhibitor was used as water molecule to design the apo forms of both enzymes. Molecular dynamics simulation of both enzymes was performed to analyze the dynamic nature of their active site residues in the absence and presence of the inhibitor. Results Homology model of XCE explained the role of non-conserved residues of its S2’ subsite. Molecular dynamics (MD simulations identified the flexible transitions of F149/I150, N566/N571, W714/W719, and R145/R723 residues of ECE-1/XCE for the strong binding of the inhibitor. Secondary structure calculations using DSSP method reveals the folding of R145/R723 residue of ECE-1/XCE into β-sheet structure while unfolding of the S2’ subsite residues in aECE-1 and sustained compact folding of that of aXCE. The results evaluated are in good agreement with available experimental data, thus providing detailed molecular models which can explain the structural and specificities differences between both zinc peptidases. Conclusions Secondary structure changes of both enzymes during the simulation time revealed the importance of β-sheet structure of R145/R723 for its binding with the terminal carboxylate group of the inhibitor. Unfolding of the α-helix comprising the S2’ subsite residues in aECE-1 correlate well with its endopeptidase activity while their compact folding in aXCE may

  11. Structural Basis for the Specific Neutralization of Stx2a with a Camelid Single Domain Antibody Fragment

    Robert Alvin Bernedo-Navarro

    2018-03-01

    Full Text Available Background: Shiga toxin-producing Escherichia coli (STEC are a subset of pathogens leading to illnesses such as diarrhea, hemolytic uremic syndrome and even death. The Shiga toxins are the main virulence factors and divided in two groups: Stx1 and Stx2, of which the latter is more frequently associated with severe pathologies in humans. Results: An immune library of nanobodies (Nbs was constructed after immunizing an alpaca with recombinant Shiga toxin-2a B subunit (rStx2aB, to retrieve multiple rStx2aB-specific Nbs. The specificity of five Nbs towards rStx2aB was confirmed in ELISA and Western blot. Nb113 had the highest affinity (9.6 nM and its bivalent construct exhibited a 100-fold higher functional affinity. The structure of the Nb113 in complex with rStx2aB was determined via X-ray crystallography. The crystal structure of the Nb113–rStx2aB complex revealed that five copies of Nb113 bind to the rStx2aB pentamer and that the Nb113 epitope overlaps with the Gb3 binding site, thereby providing a structural basis for the neutralization of Stx2a by Nb113 that was observed on Vero cells. Finally, the tandem-repeated, bivalent Nb1132 exhibits a higher toxin neutralization capacity compared to monovalent Nb113. Conclusions: The Nb of highest affinity for rStx2aB is also the best Stx2a and Stx2c toxin neutralizing Nb, especially in a bivalent format. This lead Nb neutralizes Stx2a by competing for the Gb3 receptor. The fusion of the bivalent Nb1132 with a serum albumin specific Nb is expected to combine high toxin neutralization potential with prolonged blood circulation.

  12. Site-specific issues related to structural/seismic design of an underground independent spent fuel storage installation (ISFSI)

    Tripathi, B.P.

    2005-01-01

    Utilities owning and operating commercial nuclear power plants (NPP) in USA may choose to build an underground Independent Spent Fuel Storage Installation (ISFSI) to store the spent nuclear fuels. The regulatory requirements and other guidance are based on 10 CFR Part 72, Regulatory Guide RG 3.73, Standard Review Plans NUREG-1536 and NUREG-1567, and Interim staff Guidance (ISG) documents as applicable. Structures, Systems, and Components (SSCs) classified as important to safety are designed to withstand the effects of site-specific environmental conditions and natural phenomena such as earthquake, tornado, flood, etc. An underground ISFSI for storage of spent nuclear fuel, presents some unique analysis and design challenges. This paper will briefly address some of these challenges and discuss site-specific loads, including seismic for the ISFSI design. (authors)

  13. The human otubain2-ubiquitin structure provides insights into the cleavage specificity of poly-ubiquitin-linkages.

    Mikael Altun

    Full Text Available Ovarian tumor domain containing proteases cleave ubiquitin (Ub and ubiquitin-like polypeptides from proteins. Here we report the crystal structure of human otubain 2 (OTUB2 in complex with a ubiquitin-based covalent inhibitor, Ub-Br2. The ubiquitin binding mode is oriented differently to how viral otubains (vOTUs bind ubiquitin/ISG15, and more similar to yeast and mammalian OTUs. In contrast to OTUB1 which has exclusive specificity towards Lys48 poly-ubiquitin chains, OTUB2 cleaves different poly-Ub linked chains. N-terminal tail swapping experiments between OTUB1 and OTUB2 revealed how the N-terminal structural motifs in OTUB1 contribute to modulating enzyme activity and Ub-chain selectivity, a trait not observed in OTUB2, supporting the notion that OTUB2 may affect a different spectrum of substrates in Ub-dependent pathways.

  14. Structural correlation method for model reduction and practical estimation of patient specific parameters illustrated on heart rate regulation

    Ottesen, Johnny T.; Mehlsen, Jesper; Olufsen, Mette

    2014-01-01

    We consider the inverse and patient specific problem of short term (seconds to minutes) heart rate regulation specified by a system of nonlinear ODEs and corresponding data. We show how a recent method termed the structural correlation method (SCM) can be used for model reduction and for obtaining...... a set of practically identifiable parameters. The structural correlation method includes two steps: sensitivity and correlation analysis. When combined with an optimization step, it is possible to estimate model parameters, enabling the model to fit dynamics observed in data. This method is illustrated...... in detail on a model predicting baroreflex regulation of heart rate and applied to analysis of data from a rat and healthy humans. Numerous mathematical models have been proposed for prediction of baroreflex regulation of heart rate, yet most of these have been designed to provide qualitative predictions...

  15. Crystal structures of the human G3BP1 NTF2-like domain visualize FxFG Nup Repeat Specificity

    Vognsen, Tina Reinholdt; Möller, Ingvar Rúnar; Kristensen, Ole

    2013-01-01

    Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat...... peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded...

  16. Pilot batch production of specific-structured lipids by lipase-catalyzed interesterification: preliminary study on incorporation and acyl migration

    Xu, Xuebing; Balchen, Steen; Høy, Carl-Erik

    1998-01-01

    Effects of water content, reaction time and their relationships in the production of two types of specific-structured lipids (sn-MLM- and sn-LML-types: L-long chain fatty acids; M-medium chain fatty acids) by lipase-catalyzed interesterification in a solvent-free system were studied...... of two totally position-opposed lipids can be observed. Presumably these are caused by the different chain length of the fatty acids. The relationships between reaction time and water content are inverse and give a quantitative prediction of incorporation and acyl migration in selected reaction...

  17. Bayesian population structure analysis reveals presence of phylogeographically specific sublineages within previously ill-defined T group of Mycobacterium tuberculosis.

    Yann Reynaud

    Full Text Available Mycobacterium tuberculosis genetic structure, and evolutionary history have been studied for years by several genotyping approaches, but delineation of a few sublineages remains controversial and needs better characterization. This is particularly the case of T group within lineage 4 (L4 which was first described using spoligotyping to pool together a number of strains with ill-defined signatures. Although T strains were not traditionally considered as a real phylogenetic group, they did contain a few phylogenetically meaningful sublineages as shown using SNPs. We therefore decided to investigate if this observation could be corroborated using other robust genetic markers. We consequently made a first assessment of genetic structure using 24-loci MIRU-VNTRs data extracted from the SITVIT2 database (n = 607 clinical isolates collected in Russia, Albania, Turkey, Iraq, Brazil and China. Combining Minimum Spanning Trees and Bayesian population structure analyses (using STRUCTURE and TESS softwares, we distinctly identified eight tentative phylogenetic groups (T1-T8 with a remarkable correlation with geographical origin. We further compared the present structure observed with other L4 sublineages (n = 416 clinical isolates belonging to LAM, Haarlem, X, S sublineages, and showed that 5 out of 8 T groups seemed phylogeographically well-defined as opposed to the remaining 3 groups that partially mixed with other L4 isolates. These results provide with novel evidence about phylogeographically specificity of a proportion of ill-defined T group of M. tuberculosis. The genetic structure observed will now be further validated on an enlarged worldwide dataset using Whole Genome Sequencing (WGS.

  18. Structural basis for drug and substrate specificity exhibited by FIV encoding a chimeric FIV/HIV protease

    Lin, Ying-Chuan; Perryman, Alexander L.; Olson, Arthur J.; Torbett, Bruce E.; Elder, John H.; Stout, C. David

    2011-01-01

    Crystal structures of the 6s-98S FIV protease chimera with darunavir and lopinavir bound have been determined at 1.7 and 1.8 Å resolution, respectively. A chimeric feline immunodeficiency virus (FIV) protease (PR) has been engineered that supports infectivity but confers sensitivity to the human immunodeficiency virus (HIV) PR inhibitors darunavir (DRV) and lopinavir (LPV). The 6s-98S PR has five replacements mimicking homologous residues in HIV PR and a sixth which mutated from Pro to Ser during selection. Crystal structures of the 6s-98S FIV PR chimera with DRV and LPV bound have been determined at 1.7 and 1.8 Å resolution, respectively. The structures reveal the role of a flexible 90s loop and residue 98 in supporting Gag processing and infectivity and the roles of residue 37 in the active site and residues 55, 57 and 59 in the flap in conferring the ability to specifically recognize HIV PR drugs. Specifically, Ile37Val preserves tertiary structure but prevents steric clashes with DRV and LPV. Asn55Met and Val59Ile induce a distinct kink in the flap and a new hydrogen bond to DRV. Ile98Pro→Ser and Pro100Asn increase 90s loop flexibility, Gln99Val contributes hydrophobic contacts to DRV and LPV, and Pro100Asn forms compensatory hydrogen bonds. The chimeric PR exhibits a comparable number of hydrogen bonds, electrostatic interactions and hydrophobic contacts with DRV and LPV as in the corresponding HIV PR complexes, consistent with IC 50 values in the nanomolar range

  19. Structural basis for drug and substrate specificity exhibited by FIV encoding a chimeric FIV/HIV protease

    Lin, Ying-Chuan; Perryman, Alexander L.; Olson, Arthur J.; Torbett, Bruce E.; Elder, John H.; Stout, C. David, E-mail: dave@scripps.edu [The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037 (United States)

    2011-06-01

    Crystal structures of the 6s-98S FIV protease chimera with darunavir and lopinavir bound have been determined at 1.7 and 1.8 Å resolution, respectively. A chimeric feline immunodeficiency virus (FIV) protease (PR) has been engineered that supports infectivity but confers sensitivity to the human immunodeficiency virus (HIV) PR inhibitors darunavir (DRV) and lopinavir (LPV). The 6s-98S PR has five replacements mimicking homologous residues in HIV PR and a sixth which mutated from Pro to Ser during selection. Crystal structures of the 6s-98S FIV PR chimera with DRV and LPV bound have been determined at 1.7 and 1.8 Å resolution, respectively. The structures reveal the role of a flexible 90s loop and residue 98 in supporting Gag processing and infectivity and the roles of residue 37 in the active site and residues 55, 57 and 59 in the flap in conferring the ability to specifically recognize HIV PR drugs. Specifically, Ile37Val preserves tertiary structure but prevents steric clashes with DRV and LPV. Asn55Met and Val59Ile induce a distinct kink in the flap and a new hydrogen bond to DRV. Ile98Pro→Ser and Pro100Asn increase 90s loop flexibility, Gln99Val contributes hydrophobic contacts to DRV and LPV, and Pro100Asn forms compensatory hydrogen bonds. The chimeric PR exhibits a comparable number of hydrogen bonds, electrostatic interactions and hydrophobic contacts with DRV and LPV as in the corresponding HIV PR complexes, consistent with IC{sub 50} values in the nanomolar range.

  20. Towards Patient-Tailored Perimetry: Automated Perimetry Can Be Improved by Seeding Procedures With Patient-Specific Structural Information

    Denniss, Jonathan; McKendrick, Allison M.; Turpin, Andrew

    2013-01-01

    Purpose: To explore the performance of patient-specific prior information, for example, from structural imaging, in improving perimetric procedures. Methods: Computer simulation was used to determine the error distribution and presentation count for Structure–Zippy Estimation by Sequential Testing (ZEST), a Bayesian procedure with prior distribution centered on a threshold prediction from structure. Structure-ZEST (SZEST) was trialled for single locations with combinations of true and predicted thresholds between 1 to 35 dB, and compared with a standard procedure with variability similar to Swedish Interactive Thresholding Algorithm (SITA) (Full-Threshold, FT). Clinical tests of glaucomatous visual fields (n = 163, median mean deviation −1.8 dB, 90% range +2.1 to −22.6 dB) were also compared between techniques. Results: For single locations, SZEST typically outperformed FT when structural predictions were within ± 9 dB of true sensitivity, depending on response errors. In damaged locations, mean absolute error was 0.5 to 1.8 dB lower, SD of threshold estimates was 1.2 to 1.5 dB lower, and 2 to 4 (29%–41%) fewer presentations were made for SZEST. Gains were smaller across whole visual fields (SZEST, mean absolute error: 0.5 to 1.2 dB lower, threshold estimate SD: 0.3 to 0.8 dB lower, 1 [17%] fewer presentation). The 90% retest limits of SZEST were median 1 to 3 dB narrower and more consistent (interquartile range 2–8 dB narrower) across the dynamic range than those for FT. Conclusion: Seeding Bayesian perimetric procedures with structural measurements can reduce test variability of perimetry in glaucoma, despite imprecise structural predictions of threshold. Translational Relevance: Structural data can reduce the variability of current perimetric techniques. A strong structure–function relationship is not necessary, however, structure must predict function within ±9 dB for gains to be realized. PMID:24049720