Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.
Armas, Pablo; David, Aldana; Calcaterra, Nora B
2017-01-01
G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.
Experimental approaches to identify cellular G-quadruplex structures and functions.
Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar
2012-05-01
Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.
Altered biochemical specificity of G-quadruplexes with mutated tetrads
Czech Academy of Sciences Publication Activity Database
Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.
2016-01-01
Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes
A multi-functional guanine derivative for studying the DNA G-quadruplex structure.
Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan
2017-10-23
In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân
2014-01-01
G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274
Guanine base stacking in G-quadruplex nucleic acids
Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2013-01-01
G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444
Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications
2018-01-01
Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699
Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands
Directory of Open Access Journals (Sweden)
Alessandro Altieri
2013-10-01
Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.
Seven essential questions on G-quadruplexes.
König, Sebastian L B; Evans, Amanda C; Huppert, Julian L
2010-08-01
The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.
Sun, Daekyu; Hurley, Laurence H
2010-01-01
The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.
Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao
2018-06-01
G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.
Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A
2018-06-01
Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.
McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L
2017-07-25
G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.
Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.
Directory of Open Access Journals (Sweden)
Li-Ping Bai
Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.
Takahashi, Shuntaro; Sugimoto, Naoki
2017-12-01
DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.
Mms1 is an assistant for regulating G-quadruplex DNA structures.
Schwindt, Eike; Paeschke, Katrin
2017-11-02
The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.
Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.
Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo
2014-03-21
In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Effect of Urea on G-Quadruplex Stability.
Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V
2017-07-13
G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the
Directory of Open Access Journals (Sweden)
Li-Na Zhu
Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki
2011-01-01
Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901
G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.
Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela
2015-09-22
Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S
2017-09-12
The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.
Directory of Open Access Journals (Sweden)
Emmanuel O Ariyo
Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.
Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu
2017-03-15
This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.
Macrocyclic G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, M C; Ulven, Trond
2010-01-01
are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...
Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents
Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David
2013-01-01
Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518
Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi
2013-01-01
Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846
GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.
Directory of Open Access Journals (Sweden)
Kohal Das
Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.
Selectivity in ligand recognition of G-quadruplex loops.
Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen
2009-03-03
A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.
Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2016-01-04
G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.
Directory of Open Access Journals (Sweden)
Dmitry Kaluzhny
Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.
Directory of Open Access Journals (Sweden)
Stefano Alcaro
2013-09-01
Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.
DNA secondary structures: stability and function of G-quadruplex structures
Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.
2013-01-01
In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257
Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu
2013-10-01
G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.
UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA
International Nuclear Information System (INIS)
Das, Anubrata; Misra, H.S.
2015-01-01
Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan
2015-05-01
Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.
Multimerization rules for G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.
2017-01-01
Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes
G-quadruplexes as novel cis-elements controlling transcription during embryonic development.
David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B
2016-05-19
G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis
2017-07-15
Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the
Local epigenetic reprogramming induced by G-quadruplex ligands
Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar
2017-11-01
DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.
Directory of Open Access Journals (Sweden)
Rosalba Perrone
Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.
Directory of Open Access Journals (Sweden)
Giovanna Sattin
Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.
Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân
2017-09-20
Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.
Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.
Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân
2015-12-02
G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
A mRNA-Responsive G-Quadruplex-Based Drug Release System
Directory of Open Access Journals (Sweden)
Hidenobu Yaku
2015-04-01
Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.
Efficient Long-Range Hole Transport Through G-Quadruplexes.
Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei
2017-10-09
DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng
2017-10-20
Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui
2018-10-05
G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.
Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano
2013-10-01
Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond
2009-01-01
the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....
Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate
Ranjan, Nihar; Davis, Erik; Xue, Liang
2013-01-01
The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
Directory of Open Access Journals (Sweden)
Juan Hu
2013-01-01
Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.
Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey
2016-10-01
Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.
Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-12-02
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes
Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-01-01
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...
G-Quadruplexes in DNA Replication: A Problem or a Necessity?
Valton, Anne-Laure; Prioleau, Marie-Noëlle
2016-11-01
DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Andrzej S Kudlicki
Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.
RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.
Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola
2018-05-25
DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.
Studies of G-quadruplexes formed within self-assembled DNA mini-circles.
Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon
2016-10-13
We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu
2018-03-01
A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.
Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.
2014-01-01
O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506
Directory of Open Access Journals (Sweden)
Gajjela Raju
Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.
Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana
2012-01-01
Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271
Directory of Open Access Journals (Sweden)
Deanna N Edwards
Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.
DEFF Research Database (Denmark)
Porru, Manuela; Artuso, Simona; Salvati, Erica
2015-01-01
We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...
RPA-mediated unfolding of systematically varying G-quadruplex structures.
Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza
2013-05-21
G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal
2018-06-01
Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2017-01-01
Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....
Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.
2018-05-01
Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.
Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân
2009-11-25
Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.
A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO
Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo
2018-02-01
As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.
Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro
Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.
2015-01-01
The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241
Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.
Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang
2017-12-01
Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.
Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.
Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro
2009-09-16
We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.
Simultaneous G-Quadruplex DNA Logic.
Bader, Antoine; Cockroft, Scott L
2018-04-03
A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David
2014-09-03
Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.
Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja
2017-01-01
G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance
Directory of Open Access Journals (Sweden)
Vikas Yadav
2017-07-01
Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore
Energy Technology Data Exchange (ETDEWEB)
Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC
2014-08-21
Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N
2018-06-01
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C
2018-02-15
Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.
Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua
2017-08-01
Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.
Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar
2012-06-05
The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.
Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
Directory of Open Access Journals (Sweden)
Aishwarya Prakash
2011-01-01
Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.
Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates
International Nuclear Information System (INIS)
Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.
1991-01-01
Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures
Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee
2016-03-02
The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte
2011-01-01
G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...
Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng
2013-05-01
G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.
A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.
Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia
2015-01-01
A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.
Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.
Directory of Open Access Journals (Sweden)
Yunqiang Bian
2014-04-01
Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.
Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole
2018-03-01
Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Directory of Open Access Journals (Sweden)
Natalia Rizeq
2017-12-01
Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.
Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo
2009-01-01
Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.
Directory of Open Access Journals (Sweden)
John A Capra
2010-07-01
Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.
Energy Technology Data Exchange (ETDEWEB)
Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)
2017-02-15
In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.
Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar
2014-07-23
L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
G-Quadruplexes influence pri-microRNA processing.
Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre
2018-02-01
RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.
Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.
Directory of Open Access Journals (Sweden)
Khondaker M Rahman
Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.
Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik
2013-03-05
Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Directory of Open Access Journals (Sweden)
David Monchaud
2010-01-01
Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.
Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2015-02-15
Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.
Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can
2015-03-02
Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein
2014-01-01
G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...
Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis
2017-01-01
Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016
De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela
2013-11-20
A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.
G-quadruplex recognition activities of E. Coli MutS
Directory of Open Access Journals (Sweden)
Ehrat Edward A
2012-07-01
Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.
Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V
2012-09-19
Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.
Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří
2017-01-01
Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016
Thermal stability of DNA quadruplex-duplex hybrids.
Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân
2014-01-14
DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.
Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung
2013-01-01
We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.
Directory of Open Access Journals (Sweden)
Ka-Ho Leung
Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.
2014-01-01
Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669
Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong
2017-12-21
An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.
Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E
2014-02-21
Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.
Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.
Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek
2015-06-22
A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands
DEFF Research Database (Denmark)
Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond
2012-01-01
Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....
RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP
Czech Academy of Sciences Publication Activity Database
Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.
2014-01-01
Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.
Directory of Open Access Journals (Sweden)
Ezekiel Crenshaw
Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.
Czech Academy of Sciences Publication Activity Database
Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk
2015-01-01
Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015
Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane
2015-07-14
Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.
Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun
2016-06-15
The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.
Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina
2018-03-01
Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Lech, Christopher Jacques; Phan, Anh Tuân
2017-06-20
Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression
Directory of Open Access Journals (Sweden)
Charikleia Papadopoulou
2015-12-01
Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.
Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin
2017-07-21
G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
Directory of Open Access Journals (Sweden)
Felipe Opazo
2015-01-01
Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.
Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun
2014-09-01
A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh
2014-09-05
The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate
2016-09-21
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.
Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka
2018-03-01
The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.
Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.
Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P
2010-01-15
A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen
2010-08-21
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G
2018-06-01
APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.
Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela
2016-03-18
The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping
2014-07-15
For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.
Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae
2018-06-01
The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.
Structure of a Stable G-Hairpin
Czech Academy of Sciences Publication Activity Database
Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.
2017-01-01
Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Czech Academy of Sciences Publication Activity Database
Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.
2017-01-01
Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016
Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.
Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole
2014-08-01
Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun
2017-06-02
G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao
2017-12-01
A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
DNA and RNA Quadruplex-Binding Proteins
Czech Academy of Sciences Publication Activity Database
Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav
2014-01-01
Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014
DEFF Research Database (Denmark)
Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus
2011-01-01
Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...
Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin
2017-09-05
The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.
2017-10-01
We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.
Directory of Open Access Journals (Sweden)
Julia H Chariker
Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.
Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng
2018-02-07
Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.
Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos
2018-02-08
G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.
Directory of Open Access Journals (Sweden)
Jinzhi Tan
2009-05-01
Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins
Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.
Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng
2014-01-29
We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.
DEFF Research Database (Denmark)
Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels
2017-01-01
The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.
2017-01-01
Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016
Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena
2018-02-01
Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.
2007-01-01
Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...
G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding
Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza
2014-01-01
Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170
Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua
2018-05-01
Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.
Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao
2018-03-09
Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel
2018-05-01
An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.
Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.
Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio
2017-03-14
G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.
Extended molecular dynamics of a c-kit promoter quadruplex
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří
2015-01-01
Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015
Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu
2018-04-21
An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.
DEFF Research Database (Denmark)
Foulk, M. S.; Urban, J. M.; Casella, Cinzia
2015-01-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...
Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo
2015-08-04
Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.
Charge splitters and charge transport junctions based on guanine quadruplexes
Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.
2018-04-01
Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.
DEFF Research Database (Denmark)
Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong
2016-01-01
DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...
Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia
2011-05-17
Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.
Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong
2017-11-29
G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.
Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions
Kocman, Vojč; Plavec, Janez
2017-05-01
Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.
Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.
Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V
2015-03-28
Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.
Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei
2016-01-15
Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Marathias, V M; Sawicki, M J; Bolton, P H
1999-07-15
The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.
Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization
Directory of Open Access Journals (Sweden)
Victor Constantin Diculescu
2010-01-01
Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.
Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A
2015-05-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.
Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang
2015-01-01
This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.
Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen
2015-11-23
A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.
2017-01-01
Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav
2009-01-01
A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao
2015-08-05
Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.
Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.
Directory of Open Access Journals (Sweden)
Bidisha Sengupta
Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.
Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach
Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.
2013-01-01
Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423
High-resolution AFM structure of DNA G-wires in aqueous solution.
Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân
2018-05-17
We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.
Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage
Czech Academy of Sciences Publication Activity Database
Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel
2017-01-01
Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J
2015-08-26
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.
G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela
2017-01-01
Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016
Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo
2015-01-28
In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).
Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.
Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh
2017-10-18
G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Directory of Open Access Journals (Sweden)
Yanhua Chen
2016-05-01
Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.
QuadBase2: web server for multiplexed guanine quadruplex mining and visualization
Dhapola, Parashar; Chowdhury, Shantanu
2016-01-01
DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890
Isolation of deletion alleles by G4 DNA-induced mutagenesis
Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel
Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature
C9orf72 nucleotide repeat structures initiate molecular cascades of disease.
Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou
2014-03-13
A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.
FANCJ couples replication past natural fork barriers with maintenance of chromatin structure.
Schwab, Rebekka A; Nieminuszczy, Jadwiga; Shin-ya, Kazuo; Niedzwiedz, Wojciech
2013-04-01
Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer-predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.
DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes
Czech Academy of Sciences Publication Activity Database
Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor
2009-01-01
Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.
2011-01-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589
Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.
Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo
2017-06-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.
Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki
2014-01-01
The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.
2015-01-01
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692
Mostafavi, Najmeh; Ebrahimi, Ali
2018-06-01
In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.
Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence
Tawani, Arpita; Kumar, Amit
2015-01-01
Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.
Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V
2011-12-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.
Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří
2016-04-12
Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.
Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.
Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro
2012-04-14
The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Directory of Open Access Journals (Sweden)
Charlotte Rehm
Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S
2015-01-01
In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Energy Technology Data Exchange (ETDEWEB)
Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)
2017-10-09
IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.
Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie
2018-06-01
An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Alexandro Membrino
Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří
105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014
Directory of Open Access Journals (Sweden)
Oyoshi Takanori
2012-01-01
Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří
2016-01-01
Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016
Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.
2010-01-01
Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468
Hirashima, Kyotaro; Seimiya, Hiroyuki
2015-02-27
Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S
2016-01-15
The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small
Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai
2013-02-01
Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA
DEFF Research Database (Denmark)
Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch
2016-01-01
of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...
New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.
Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni
2018-02-10
The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50 = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.
Zaccaria, F; Paragi, G; Fonseca Guerra, C
2016-08-21
The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.
DEFF Research Database (Denmark)
Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich
2012-01-01
Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří
2010-01-01
Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010
Stability of Human Telomere Quadruplexes at High DNA Concentrations
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.
2014-01-01
Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014
Czech Academy of Sciences Publication Activity Database
Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří
2014-01-01
Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014
Scuotto, Maria; Rivieccio, Elisa; Varone, Alessia; Corda, Daniela; Bucci, Mariarosaria; Vellecco, Valentina; Cirino, Giuseppe; Virgilio, Antonella; Esposito, Veronica; Galeone, Aldo; Borbone, Nicola; Varra, Michela; Mayol, Luciano
2015-09-18
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13. © Crown copyright 2015.
Crystal structures of the human G3BP1 NTF2-like domain visualize FxFG Nup Repeat Specificity
DEFF Research Database (Denmark)
Vognsen, Tina Reinholdt; Möller, Ingvar Rúnar; Kristensen, Ole
2013-01-01
Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat...... peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded...
Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar
2015-01-01
Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.
A bouquet of DNA structures: Emerging diversity
Directory of Open Access Journals (Sweden)
Mahima Kaushik
2016-03-01
Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.
A bouquet of DNA structures: Emerging diversity.
Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant
2016-03-01
Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.
Czech Academy of Sciences Publication Activity Database
Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.
2015-01-01
Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015
Energy Technology Data Exchange (ETDEWEB)
Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV
2008-01-01
This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.
Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.
Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar
2010-06-01
The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.
DEFF Research Database (Denmark)
Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.
2011-01-01
Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...
Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei
2017-01-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564
[Structure and evolution of the eukaryotic FANCJ-like proteins].
Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi
2015-02-01
The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.
RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.
Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J
2012-05-11
T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.
Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela
2009-01-01
Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009
Structural characterization of the Man5 glycoform of human IgG3 Fc
Energy Technology Data Exchange (ETDEWEB)
Shah, Ishan S.; Lovell, Scott; Mehzabeen, Nurjahan; Battaile, Kevin P.; Tolbert, Thomas J. (Kansas); (HWMRI)
2017-12-01
Immunoglobulin G (IgG) consists of four subclasses in humans: IgG1, IgG2, IgG3 and IgG4, which are highly conserved but have unique differences that result in subclass-specific effector functions. Though IgG1 is the most extensively studied IgG subclass, study of other subclasses is important to understand overall immune function and for development of new therapeutics. When compared to IgG1, IgG3 exhibits a similar binding profile to Fcγ receptors and stronger activation of complement. All IgG subclasses are glycosylated at N297, which is required for Fcγ receptor and C1q complement binding as well as maintaining optimal Fc conformation. We have determined the crystal structure of homogenously glycosylated human IgG3 Fc with a GlcNAc2Man5 (Man5) high mannose glycoform at 1.8 Å resolution and compared its structural features with published structures from the other IgG subclasses. Although the overall structure of IgG3 Fc is similar to that of other subclasses, some structural perturbations based on sequence differences were revealed. For instance, the presence of R435 in IgG3 (and H435 in the other IgG subclasses) has been implicated to result in IgG3-specific properties related to binding to protein A, protein G and the neonatal Fc receptor (FcRn). The IgG3 Fc structure helps to explain some of these differences. Additionally, protein-glycan contacts observed in the crystal structure appear to correlate with IgG3 affinity for Fcγ receptors as shown by binding studies with IgG3 Fc glycoforms. Finally, this IgG3 Fc structure provides a template for further studies aimed at engineering the Fc for specific gain of function.
Spinello, A; Barone, G; Grunenberg, J
2016-01-28
In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.
Ingemarsdotter, Carin K; Zeng, Jingwei; Long, Ziqi; Lever, Andrew M L; Kenyon, Julia C
2018-03-14
NSC260594, a quinolinium derivative from the NCI diversity set II compound library, was previously identified in a target-based assay as an inhibitor of the interaction between the HIV-1 (ψ) stem-loop 3 (SL3) RNA and Gag. This compound was shown to exhibit potent antiviral activity. Here, the effects of this compound on individual stages of the viral lifecycle were examined by qRT-PCR, ELISA and Western blot, to see if its actions were specific to the viral packaging stage. The structural effects of NSC260594 binding to the HIV-1 gRNA were also examined by SHAPE and dimerization assays. Treatment of cells with NSC260594 did not reduce the number of integration events of incoming virus, and treatment of virus producing cells did not affect the level of intracellular Gag protein or viral particle release as determined by immunoblot. However, NSC260594 reduced the incorporation of gRNA into virions by up to 82%, without affecting levels of gRNA inside the cell. This reduction in packaging correlated closely with the reduction in infectivity of the released viral particles. To establish the structural effects of NSC260594 on the HIV-1 gRNA, we performed SHAPE analyses to pinpoint RNA structural changes. NSC260594 had a stabilizing effect on the wild type RNA that was not confined to SL3, but that was propagated across the structure. A packaging mutant lacking SL3 did not show this effect. NSC260594 acts as a specific inhibitor of HIV-1 RNA packaging. No other viral functions are affected. Its action involves preventing the interaction of Gag with SL3 by stabilizing this small RNA stem-loop which then leads to stabilization of the global packaging signal region (psi or ψ). This confirms data, previously only shown in analyses of isolated SL3 oligonucleotides, that SL3 is structurally labile in the presence of Gag and that this is critical for the complete psi region to be able to adopt different conformations. Since replication is otherwise unaffected by NSC260594
Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations
Czech Academy of Sciences Publication Activity Database
Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří
2004-01-01
Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004
Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang
2011-01-28
In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).
Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu
2015-04-15
Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.
Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons
Czech Academy of Sciences Publication Activity Database
Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris
2014-01-01
Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
Mas, Caroline; Norwood, Suzanne J; Bugarcic, Andrea; Kinna, Genevieve; Leneva, Natalya; Kovtun, Oleksiy; Ghai, Rajesh; Ona Yanez, Lorena E; Davis, Jasmine L; Teasdale, Rohan D; Collins, Brett M
2014-10-10
Sorting nexins (SNXs) or phox homology (PX) domain containing proteins are central regulators of cell trafficking and signaling. A subfamily of PX domain proteins possesses two unique PX-associated domains, as well as a regulator of G protein-coupled receptor signaling (RGS) domain that attenuates Gαs-coupled G protein-coupled receptor signaling. Here we delineate the structural organization of these RGS-PX proteins, revealing a protein family with a modular architecture that is conserved in all eukaryotes. The one exception to this is mammalian SNX19, which lacks the typical RGS structure but preserves all other domains. The PX domain is a sensor of membrane phosphoinositide lipids and we find that specific sequence alterations in the PX domains of the mammalian RGS-PX proteins, SNX13, SNX14, SNX19, and SNX25, confer differential phosphoinositide binding preferences. Although SNX13 and SNX19 PX domains bind the early endosomal lipid phosphatidylinositol 3-phosphate, SNX14 shows no membrane binding at all. Crystal structures of the SNX19 and SNX14 PX domains reveal key differences, with alterations in SNX14 leading to closure of the binding pocket to prevent phosphoinositide association. Our findings suggest a role for alternative membrane interactions in spatial control of RGS-PX proteins in cell signaling and trafficking. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Structure of human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7)
International Nuclear Information System (INIS)
Arai, Ryoichi; Yoshikawa, Seiko; Murayama, Kazutaka; Imai, Yuzuru; Takahashi, Ryosuke; Shirouzu, Mikako; Yokoyama, Shigeyuki
2006-01-01
The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way as UbcH7. The human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7) is involved in protein degradation, including a process known as endoplasmic reticulum-associated degradation (ERAD). The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The UBE2G2 structure comprises a single domain consisting of an antiparallel β-sheet with four strands, five α-helices and two 3 10 -helices. Structural comparison of human UBE2G2 with yeast Ubc7 indicated that the overall structures are similar except for the long loop region and the C-terminal helix. Superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way to UbcH7. In addition, the extra loop region of UBE2G2 may interact with the RING domain or its neighbouring region and may be involved in the binding specificity and stability
Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding
Czech Academy of Sciences Publication Activity Database
Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela
2014-01-01
Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong
2016-04-05
Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří
2016-01-01
Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016
Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang
2015-01-01
Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju
2017-12-15
Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.
In-depth analysis of subclass-specific conformational preferences of IgG antibodies
Directory of Open Access Journals (Sweden)
Xinsheng Tian
2015-01-01
Full Text Available IgG subclass-specific differences in biological function and in vitro stability are often referred to variations in the conformational flexibility, while this flexibility has rarely been characterized. Here, small-angle X-ray scattering data from IgG1, IgG2 and IgG4 antibodies, which were designed with identical variable regions, were thoroughly analysed by the ensemble optimization method. The extended analysis of the optimized ensembles through shape clustering reveals distinct subclass-specific conformational preferences, which provide new insights for understanding the variations in physical/chemical stability and biological function of therapeutic antibodies. Importantly, the way that specific differences in the linker region correlate with the solution structure of intact antibodies is revealed, thereby visualizing future potential for the rational design of antibodies with designated physicochemical properties and tailored effector functions. In addition, this advanced computational approach is applicable to other flexible multi-domain systems and extends the potential for investigating flexibility in solutions of macromolecules by small-angle X-ray scattering.
Backbone modified TBA analogues endowed with antiproliferative activity.
Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo
2017-05-01
The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.
Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.
Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu
2018-08-01
In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.
Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A
2016-11-01
Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.
Directory of Open Access Journals (Sweden)
Minglei Yang
Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.
2011-01-01
Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011
DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure
International Nuclear Information System (INIS)
Revaud, D.
2009-06-01
Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)
Determination of specific IgG antibody by crossed radioimmunoelectrophoresis
International Nuclear Information System (INIS)
Nordvall, S.L.; Uhlin, T.; Einarsson, R.
1983-01-01
A crossed radioimmunoelectrophoretic method was developed for detection of honey bee venom specific IgG antibodies in patient sera. At the serum concentration 1/200 the contrast between specific binding and backgroud was the most favourable. The detection limit was fairly low, approximately 30 kU/l(IgG RAST units). A reference system based on the reference kits in Phadebas IgG-RAST was elaborated. (author)
Determination of specific IgG antibody by crossed radioimmunoelectrophoresis
Energy Technology Data Exchange (ETDEWEB)
Nordvall, S.L. (Dept. of Paediatrics, University Hospital, Uppsala, Sweden); Uhlin, T.; Einarsson, R. (Allergy Research, Pharmacia Diagnostics AB, Uppsala, Sweden)
1983-01-01
A crossed radioimmunoelectrophoretic method was developed for detection of honey bee venom specific IgG antibodies in patient sera. At the serum concentration 1/200 the contrast between specific binding and backgroud was the most favourable. The detection limit was fairly low, approximately 30 kU/l(IgG RAST units). A reference system based on the reference kits in Phadebas IgG-RAST was elaborated.
Jia, Zicai; Song, Yu; Tao, Suyuan; Cong, Peixu; Wang, Xiaoxu; Xue, Changhu; Xu, Jie
2016-03-01
To investigate the relationship between structure and activity, three glucocerebroside series (CFC-1, CFC-2 and CFC-3), ceramides (CF-Cer) and long-chain bases (CF-LCB) of sea cucumber Cucumaria frondosa (C. frondosa) were isolated and evaluated in HepG2 cells. The molecular species of CFC-1, CFC-2 and CFC-3 and CF-Cer were identified using reversed-phase liquid chromatography with heated electrospray ionization coupled to high-resolution mass spectrometry (RPLC-HESI-HRMS), and determined on the basis of chemical and spectroscopic evidence: For the three glucocerebroside series, fatty acids (FA) were mainly saturated (18:0 and 22:0), monounsaturated (22:1, 23:1 and 24:1) and 2-hydroxyl FA (2-HFA) (23:1 h and 24:1 h), the structure of long-chain bases (LCB) were dihydroxy (d17:1, d18:1 and d18:2) and trihydroxy (t16:0 and t17:0), and the glycosylation was glucose; For CF-Cer, FA were primarily saturated (17:0) and monounsaturated (16:1 and 19:1), the structure of LCB were dihydroxy (d17:1 and d18:1), and trihydroxy (t16:0). The results of cell experiment indicated that all of three glucocerebroside series, CF-Cer and CF-LCB exhibited an inhibitory effects on cell proliferation. Moreover, CFC-3 was most effective in three glucocerebrosides to HepG-2 cell viability. The inhibition effect of CF-LCB was the strongest, and the inhibition effect of CF-Cer was much stronger than glucocerebrosides.
Haka, Jaana; Niemi, Merja H; Iljin, Kristiina; Reddy, Vanga Siva; Takkinen, Kristiina; Laukkanen, Marja-Leena
2015-05-27
Around 3-5% of the population suffer from IgE-mediated food allergies in Western countries and the number of food-allergenic people is increasing. Individuals with certain pollen allergies may also suffer from a sensitisation to proteins in the food products. As an example a person sensitised to the major birch pollen allergen, Bet v 1, is often sensitised to its homologues, such as the major allergens of apple, Mal d 1, and celery, Api g 1, as well. Development of tools for the reliable, sensitive and quick detection of allergens present in various food products is essential for allergic persons to prevent the consumption of substances causing mild and even life-threatening immune responses. The use of monoclonal antibodies would ensure the specific detection of the harmful food content for a sensitised person. Mouse IgG antibody libraries were constructed from immunised mice and specific recombinant antibodies for Mal d 1 and Api g 1 were isolated from the libraries by phage display. More detailed characterisation of the resulting antibodies was carried out using ELISA, SPR experiments and immunoprecipitation assays. The allergen-specific Fab fragments exhibited high affinity towards the target recombinant allergens. Furthermore, the Fab fragments also recognised native allergens from natural sources. Interestingly, isolated Mal d 1-specific antibody bound also to Bet v 1, the main allergen eliciting the cross-reactivity syndrome between the birch pollen and apple. Despite the similarities in Api g 1 and Bet v 1 tertiary structures, the isolated Api g 1-specific antibodies showed no cross-reactivity to Bet v 1. Here, high-affinity allergen-specific recombinant antibodies were isolated with interesting binding properties. With further development, these antibodies can be utilised as tools for the specific and reliable detection of allergens from different consumable products. This study gives new preliminary insights to elucidate the mechanism behind the pollen
Xu, Hailing; Li, Xingwei; Wang, Gengchao
2015-10-01
Polyaniline (PANI) with a high specific surface area and an improved pore structure (HSSA-PANI) has been prepared by using a facile method, treating PANI nanofibers with chloroform (CHCl3), and its structure, morphology and pore structure are investigated. The specific surface area and pore volume of HSSA-PANI are 817.3 m2 g-1 and 0.6 cm3 g-1, and those of PANI are 33.6 m2 g-1 and 0.2 cm3 g-1. As electrode materials, a large specific surface area and pore volume can provide high electroactive regions, accelerate the diffusion of ions, and mitigate the electrochemical degradation of active materials. Compared with PANI, the capacity retention rate of HSSA-PANI is 90% with a growth of current density from 5.0 to 30 A g-1, and that of PANI is 29%. At a current density of 30 A g-1, the specific capacitance of HSSA-PANI still reaches 278.3 F g-1, and that of PANI is 86.7 F g-1. At a current density of 5.0 A g-1, the capacitance retention of HSSA-PANI is 53.1% after 2000 cycles, and that of PANI electrode is only 28.1%.
Energy Technology Data Exchange (ETDEWEB)
Revaud, D.
2009-06-15
Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)
Human IgG4: a structural perspective.
Davies, Anna M; Sutton, Brian J
2015-11-01
IgG4, the least represented human IgG subclass in serum, is an intriguing antibody with unique biological properties, such as the ability to undergo Fab-arm exchange and limit immune complex formation. The lack of effector functions, such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity, is desirable for therapeutic purposes. IgG4 plays a protective role in allergy by acting as a blocking antibody, and inhibiting mast cell degranulation, but a deleterious role in malignant melanoma, by impeding IgG1-mediated anti-tumor immunity. These findings highlight the importance of understanding the interaction between IgG4 and Fcγ receptors. Despite a wealth of structural information for the IgG1 subclass, including complexes with Fcγ receptors, and structures for intact antibodies, high-resolution crystal structures were not reported for IgG4-Fc until recently. Here, we highlight some of the biological properties of human IgG4, and review the recent crystal structures of IgG4-Fc. We discuss the unexpected conformations adopted by functionally important Cγ2 domain loops, and speculate about potential implications for the interaction between IgG4 and FcγRs. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.
p53 binds human telomeric G-quadruplex in vitro
Czech Academy of Sciences Publication Activity Database
Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie
2016-01-01
Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016
Lanzillotta, Marco; Campochiaro, Corrado; Trimarchi, Matteo; Arrigoni, Gianluigi; Gerevini, Simonetta; Milani, Raffaella; Bozzolo, Enrica; Biafora, Matteo; Venturini, Elena; Cicalese, Maria Pia; Stone, John H; Sabbadini, Maria Grazia; Della-Torre, Emanuel
2017-07-01
A series of destructive and tumefactive lesions of the midline structures have been recently added to the spectrum of IgG4-related disease (IgG4-RD). We examined the clinical, serological, endoscopic, radiological, and histological features that might be of utility in distinguishing IgG4-RD from other forms of inflammatory conditions with the potential to involve the sinonasal area and the oral cavity. We studied 11 consecutive patients with erosive and/or tumefactive lesions of the midline structures referred to our tertiary care center. All patients underwent serum IgG4 measurement, flow cytometry for circulating plasmablast counts, nasal endoscopy, radiological studies, and histological evaluation of tissue specimens. The histological studies included immunostaining studies to assess the number of IgG4 + plasma cells/HPF for calculation of the IgG4+/IgG + plasma cell ratio. Five patients with granulomatosis with polyangiitis (GPA), three with cocaine-induced midline destructive lesions (CIMDL), and three with IgG4-RD were studied. We found no clinical, endoscopic, or radiological findings specific for IgG4-RD. Increased serum IgG4 and plasmablasts levels were not specific for IgG4-RD. Rather, all 11 patients had elevated blood plasmablast concentrations, and several patients with GPA and CIMDL had elevated serum IgG4 levels. Storiform fibrosis and an IgG4+/IgG + plasma cell ratio >20% on histological examination, however, were observed only in patients with IgG4-RD. Histological examination of bioptic samples from the sinonasal area and oral cavity represents the mainstay for the diagnosis of IgG4-RD involvement of the midline structures.
Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei
2017-08-01
DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.
Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong
2016-10-21
Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Timothy-specific IgG antibody levels vary with the pollen seasons.
Nordvall, S L; Larsson, P H; Johansson, S G
1986-11-01
Serum samples were collected from eight grass pollen hypersensitive children during a 4-year period. The sera were assayed for contents of timothy-specific IgE antibodies by RAST. Timothy-specific IgG and IgA antibodies were quantified by a refined ELISA in which covalent binding of the antigen to the polystyrene solid phase had been performed. IgG antibodies were also assayed by a Sepharose-protein-A technique with radiolabelled timothy allergens as the antigen. It was possible to register clearcut seasonal variations with postseasonally boosted antibody levels not only of timothy-specific IgE but also of IgG antibody. Both IgG1 and IgG4 antibodies specific for timothy showed seasonal variations of a similar degree. It was not possible to register seasonal variations of the same magnitude of timothy-specific IgA antibodies.
Strong preference of BRCA1 protein to topologically constrained non-B DNA structures
Czech Academy of Sciences Publication Activity Database
Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva
2016-01-01
Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016
Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor
Energy Technology Data Exchange (ETDEWEB)
Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.; Liu, Corey W.; Nygaard, Rie; Rosenbaum, Daniel M.; Fung, Juan José; Choi, Hee-Jung; Thian, Foon Sun; Kobilka, Tong Sun; Puglisi, Joseph D.; Weis, William I.; Pardo, Leonardo; Prosser, R. Scott; Mueller, Luciano; Kobilka, Brian K. (Stanford-MED); (Toronto); (BMS); (UAB, Spain)
2010-01-14
G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.
Structural basis for G9a-like protein lysine methyltransferase inhibition by BIX-01294
Energy Technology Data Exchange (ETDEWEB)
Chang, Yanqi; Zhang, Xing; Horton, John R.; Upadhyay, Anup K.; Spannhoff, Astrid; Liu, Jin; Synder, James P.; Bedford, Mark T.; Cheng, Xiaodong; (Emory-MED); (Emory); (Texas)
2009-03-26
Histone lysine methylation is an important epigenetic mark that regulates gene expression and chromatin organization. G9a and G9a-like protein (GLP) are euchromatin-associated methyltransferases that repress transcription by methylating histone H3 Lys9. BIX-01294 was originally identified as a G9a inhibitor during a chemical library screen of small molecules and has previously been used in the generation of induced pluripotent stem cells. Here we present the crystal structure of the catalytic SET domain of GLP in complex with BIX-01294 and S-adenosyl-L-homocysteine. The inhibitor is bound in the substrate peptide groove at the location where the histone H3 residues N-terminal to the target lysine lie in the previously solved structure of the complex with histone peptide. The inhibitor resembles the bound conformation of histone H3 Lys4 to Arg8, and is positioned in place by residues specific for G9a and GLP through specific interactions.
Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis
International Nuclear Information System (INIS)
Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.
2004-01-01
Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)
Novel molecular targets for kRAS downregulation: promoter G-quadruplexes
2016-11-01
proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with
Measurement of the Proton and Deuteron Spin Structure Functions G1 and G2
Energy Technology Data Exchange (ETDEWEB)
Tobias, Al
2003-04-02
The SLAC experiment E155 was a deep-inelastic scattering experiment that scattered polarized electrons off polarized proton and deuteron targets in the effort to measure precisely the proton and deuteron spin structure functions. The nucleon structure functions g{sub 1} and g{sub 2} are important quantities that help test our present models of nucleon structure. Such information can help quantify the constituent contributions to the nucleon spin. The structure functions g{sub 1}{sup p} and G{sub 1}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.9 and 1 {le} Q{sup 2} {le} 40 GeV{sup 2} by scattering 48.4 GeV longitudinally polarized electrons off longitudinally polarized protons and deuterons. In addition, the structure functions g{sub 2}{sup p} and g{sub 2}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.7 and 1 {le} Q{sup 2} {le} 17 GeV{sup 2} by scattering 38.8 GeV longitudinally polarized electrons off transversely polarized protons and deuterons. The measurements of g{sub 1} confirm the Bjorken sum rule and find the net quark polarization to be {Delta}{Sigma} = 0.23 {+-} 0.04 {+-} 0.6 while g{sub 2} is found to be consistent with the g{sub 2}{sup WW} model.
Directory of Open Access Journals (Sweden)
Lisandra Akemi Suzuki
Full Text Available In the present study, an enzyme-linked immunosorbent assay (ELISA standardized with vesicular fluid of Taenia solium cysticerci was used to screen for IgG (total and subclasses and IgE antibodies in cerebrospinal fluid (CSF samples from patients with neurocysticercosis showing intrathecal production of specific IgG antibodies and patients with other neurological disorders. The following results were obtained: IgG-ELISA: 100% sensitivity (median of the ELISA absorbances (MEA=1.17 and 100% specificity; IgG1-ELISA: 72.7% sensitivity (MEA=0.49 and 100% specificity; IgG2-ELISA: 81.8% sensitivity (MEA=0.46 and 100% specificity; IgG3-ELISA: 63.6% sensitivity (MEA=0.12 and 100% specificity; IgG4-ELISA: 90.9% sensitivity (MEA=0.85 and 100% specificity; IgE-ELISA 93.8% sensitivity (MEA=0.60 and 100% specificity. There were no significant differences between the sensitivities and specificities in the detection of IgG-ELISA and IgE-ELISA, although in CSF samples from patients with neurocysticercosis the MEA of the IgG-ELISA was significantly higher than that of the IgE-ELISA. The sensitivity and MEA values of the IgG4-ELISA were higher than the corresponding values for the other IgG subclasses. Future studies should address the contribution of IgG4 and IgE antibodies to the physiopathology of neurocysticercosis.
21 CFR 866.5520 - Immunoglobulin G (Fab fragment specific) immunological test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fab fragment specific... Test Systems § 866.5520 Immunoglobulin G (Fab fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fab fragment specific) immunological test system is a device that consists...
21 CFR 866.5540 - Immunoglobulin G (Fd fragment specific) immunological test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fd fragment specific... Test Systems § 866.5540 Immunoglobulin G (Fd fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fd fragment specific) immunological test system is a device that consists of...
21 CFR 866.5530 - Immunoglobulin G (Fc fragment specific) immunological test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fc fragment specific... Test Systems § 866.5530 Immunoglobulin G (Fc fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fc fragment specific) immunological test system is a device that consists of...
Remarks on Hamiltonian structures in G2-geometry
International Nuclear Information System (INIS)
Cho, Hyunjoo; Salur, Sema; Todd, A. J.
2013-01-01
In this article, we treat G 2 -geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G 2 -structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G 2 -structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry
Transposable elements and G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kejnovský, Eduard; Tokan, Viktor; Lexa, M.
2015-01-01
Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015
Immunoradiometric assay for cytomegalovirus-specific IgG antibodies
International Nuclear Information System (INIS)
Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J.
1990-01-01
An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 [human cytomegalovirus (CMV)] has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab
HCMV gB shares structural and functional properties with gB proteins from other herpesviruses
Energy Technology Data Exchange (ETDEWEB)
Sharma, Sapna [Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 (United States); Wisner, Todd W.; Johnson, David C. [Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, OR 97239 (United States); Heldwein, Ekaterina E., E-mail: katya.heldwein@tufts.edu [Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 (United States)
2013-01-20
Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yan, E-mail: zhang_yan@ecust.edu.cn [The Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Zhang, Yi [The Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Chen, Min; Zhou, Yan [The State Key Laboratory of Bioreactor Engineering, School of Bioengineering, East China University of Science and Technology, Shanghai, 200237 (China); Lang, Meidong, E-mail: mdlang@ecust.edu.cn [The Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China)
2014-08-01
The lack of pendant functional groups on the PCL backbone has been a great challenge for surface bioactivation of poly(ε-caprolactone) (PCL). In the present study, covalently galactosylated PCL (GPCL) was developed through coupling between the amino-functionalized PCL (NPCL) and the lactobionic acid (LA) and its potential application in maintenance of physiological functions of HepG2 cells was further evaluated. The structure and properties of GPCL were explored by {sup 1}H NMR, FT-IR, GPC and DSC. Moreover, the incorporation of galactose ligands onto GPCL membranes not only promoted higher wettability, but also radically changed surface morphology in comparison with PCL and NPCL according to the contact angle measurement and atomic force microscopy. When HepG2 cells were seeded onto these membranes, the cells on GPCL membranes showed more pronounced cell adhesion and tended to form aggregates during the initial adhesion stage and then progressively grew into multi-layer structures compared to those without galactose ligands by the observation with fluorescence microscope and scanning electron microscopy. Furthermore, live–dead assay and functional tests demonstrated that HepG2 cells on GPCL membranes had superior viability and maintained better liver-specific functions. Collectively, GPCL has great potential for hepatic tissue engineering scaffolds. - Graphical abstract: The specific recognition between the galactose ligands on the galactosylated poly(ε-caprolactone) membrane and the ASGPR on the HepG2 cell surface. The galactosylated poly(ε-caprolactone) membranes improved the cell-matrix interaction. The galactosylated functionalized PCL scaffold is a potential candidate for liver tissue engineering. - Highlights: • The specific recognition between the galactose ligands on the galactosylated poly(ε-caprolactone) membrane and the ASGPR on the HepG2 cell surface. • The galactosylated poly(ε-caprolactone) membranes improved the cell-matrix interaction.
2017-01-01
We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322
Application of Food-specific IgG Antibody Detection in Allergy Dermatosis
Directory of Open Access Journals (Sweden)
Yine Hu
2015-01-01
Full Text Available The application of food-specific IgG antibody detection in allergy dermatoses was explored. 181 patients with allergy dermatoses were diagnosed from January to September 2014 and 20 healthy subjects were selected. Fourteen kinds of food-specific IgG antibodies were detected by ELISA method among all the subjects. The positive rates of IgG antibody of the patient group and the healthy group were respectively 65.2% and 5.0%. The positive rates of IgG antibody of egg, milk, shrimp and crab took a large proportion in three groups of patients with three kinds of allergy dermatoses of urticaria, eczema and allergic dermatitis, the proportion of which was respectively 70.2%, 77.8% and 71.7%. Among urticaria and allergic dermatitis patients with positive antibody, the positive rate of children was significantly higher than that of adults (p0.05. Allergy dermatoses are closely related to food-specific IgG antibodies, and the allergy dermatoses patients have a high incidence rate of food intolerance; detecting IgG antibody in the serum of patients is of great significance for the diagnosis and treatment of allergy dermatoses.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Mouse allergen-specific immunoglobulin G4 and risk of mouse skin test sensitivity
Matsui, E. C.; Diette, G. B.; Krop, E. J. M.; Aalberse, R. C.; Smith, A. L.; Eggleston, P. A.
2006-01-01
High serum levels of cat-specific IgG and IgG4 are associated with protection against allergic sensitization to cat, but whether this association applies to other animal allergens remains unclear. To determine if high levels of mouse-specific IgG and IgG4 are associated with a decreased risk of
Matsui, Elizabeth C.; Krop, Esmeralda J. M.; Diette, Gregory B.; Aalberse, Rob C.; Smith, Abigail L.; Eggleston, Peyton A.
2004-01-01
Although there is evidence that contact with mice is associated with IgE-mediated mouse sensitization and mouse specific antibody responses, the exposure-response relationships remain unclear. To determine whether IgE-mediated mouse sensitization and mouse specific IgG (mIgG) and mIgG4 levels
Groh, N; von Loetzen, C S; Subbarayal, B; Möbs, C; Vogel, L; Hoffmann, A; Fötisch, K; Koutsouridou, A; Randow, S; Völker, E; Seutter von Loetzen, A; Rösch, P; Vieths, S; Pfützner, W; Bohle, B; Schiller, D
2017-05-01
Allergen-specific immunotherapy (AIT) with birch pollen generates Bet v 1-specific immunoglobulin (Ig)G 4 which blocks IgE-mediated hypersensitivity mechanisms. Whether IgG 4 specific for Bet v 1a competes with IgE for identical epitopes or whether novel epitope specificities of IgG 4 antibodies are developed is under debate. We sought to analyze the epitope specificities of IgE and IgG 4 antibodies from sera of patients who received AIT. 15 sera of patients (13/15 received AIT) with Bet v 1a-specific IgE and IgG 4 were analyzed. The structural arrangements of recombinant (r)Bet v 1a and rBet v 1a _11x , modified in five potential epitopes, were analyzed by circular dichroism and nuclear magnetic resonance spectroscopy. IgE binding to Bet v 1 was assessed by ELISA and mediator release assays. Competitive binding of monoclonal antibodies specific for Bet v 1a and serum IgE/IgG 4 to rBet v 1a and serum antibody binding to a non-allergenic Bet v 1-type model protein presenting an individual epitope for IgE was analyzed in ELISA and western blot. rBet v 1a _11x had a Bet v 1a - similar secondary and tertiary structure. Monomeric dispersion of rBet v 1a _11x was concentration and buffer-dependent. Up to 1500-fold increase in the EC 50 for IgE-mediated mediator release induced by rBet v 1a _11x was determined. The reduction of IgE and IgG 4 binding to rBet v 1a _11x was comparable in 67% (10/15) of sera. Bet v 1a-specific monoclonal antibodies inhibited binding of serum IgE and IgG 4 to 66.1% and 64.9%, respectively. Serum IgE and IgG 4 bound specifically to an individual epitope presented by our model protein in 33% (5/15) of sera. Patients receiving AIT develop Bet v 1a-specific IgG 4 which competes with IgE for partly identical or largely overlapping epitopes. The similarities of epitopes for IgE and IgG 4 might stimulate the development of epitope-specific diagnostics and therapeutics. © 2016 John Wiley & Sons Ltd.
Koneczny, Inga; Stevens, Jo A A; De Rosa, Anna; Huda, Saif; Huijbers, Maartje G; Saxena, Abhishek; Maestri, Michelangelo; Lazaridis, Konstantinos; Zisimopoulou, Paraskevi; Tzartos, Socrates; Verschuuren, Jan; van der Maarel, Silvère M; van Damme, Philip; De Baets, Marc H; Molenaar, Peter C; Vincent, Angela; Ricciardi, Roberta; Martinez-Martinez, Pilar; Losen, Mario
2017-02-01
Autoimmunity mediated by IgG4 subclass autoantibodies is an expanding field of research. Due to their structural characteristics a key feature of IgG4 antibodies is the ability to exchange Fab-arms with other, unrelated, IgG4 molecules, making the IgG4 molecule potentially monovalent for the specific antigen. However, whether those disease-associated antigen-specific IgG4 are mono- or divalent for their antigens is unknown. Myasthenia gravis (MG) with antibodies to muscle specific kinase (MuSK-MG) is a well-recognized disease in which the predominant pathogenic IgG4 antibody binds to extracellular epitopes on MuSK at the neuromuscular junction; this inhibits a pathway that clusters the acetylcholine (neurotransmitter) receptors and leads to failure of neuromuscular transmission. In vitro Fab-arm exchange-inducing conditions were applied to MuSK antibodies in sera, purified IgG4 and IgG1-3 sub-fractions. Solid-phase cross-linking assays were established to determine the extent of pre-existing and inducible Fab-arm exchange. Functional effects of the resulting populations of IgG4 antibodies were determined by measuring inhibition of agrin-induced AChR clustering in C2C12 cells. To confirm the results, κ/κ, λ/λ and hybrid κ/λ IgG4s were isolated and tested for MuSK antibodies. At least fifty percent of patients had IgG4, but not IgG1-3, MuSK antibodies that could undergo Fab-arm exchange in vitro under reducing conditions. Also MuSK antibodies were found in vivo that were divalent (monospecific for MuSK). Fab-arm exchange with normal human IgG4 did not prevent the inhibitory effect of serum derived MuSK antibodies on AChR clustering in C2C12 mouse myotubes. The results suggest that a considerable proportion of MuSK IgG4 could already be Fab-arm exchanged in vivo. This was confirmed by isolating endogenous IgG4 MuSK antibodies containing both κ and λ light chains, i.e. hybrid IgG4 molecules. These new findings demonstrate that Fab-arm exchanged antibodies
Complex DNA structures and structures of DNA complexes
International Nuclear Information System (INIS)
Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.
1994-01-01
Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful
Complex DNA structures and structures of DNA complexes
Energy Technology Data Exchange (ETDEWEB)
Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)
1994-12-01
Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.
Crystal structure of the conserved herpesvirus fusion regulator complex gH—gL
Energy Technology Data Exchange (ETDEWEB)
Chowdary, Tirumala K.; Cairns, Tina M.; Atanasiu, Doina; Cohen, Gary H.; Eisenberg, Roselyn J.; Heldwein, Ekaterina E. [UPENN; (Tufts-MED)
2015-02-09
Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH–gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH–gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH–gL activates gB for fusion, possibly through direct binding. Formation of a gB–gH–gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB–gH–gL interface a promising antiviral target.
Non-"g" Residuals of the SAT and ACT Predict Specific Abilities
Coyle, Thomas R.; Purcell, Jason M.; Snyder, Anissa C.; Kochunov, Peter
2013-01-01
This research examined whether non-"g" residuals of the SAT and ACT subtests, obtained after removing g, predicted specific abilities. Non-"g" residuals of the verbal and math subtests of the SAT and ACT were correlated with academic (verbal and math) and non-academic abilities (speed and shop), both based on the Armed Services…
Comparative studies on the structure and adhesion of setae in G. gecko and G. swinhonis
Institute of Scientific and Technical Information of China (English)
GUO; Ce; WANG; WenBo; YU; Min; DAI; ZhenDong
2007-01-01
Scanning electron microscopy (SEM) and histological techniques were used to observe and study the setae structures of two gecko species (G. gecko and G. swinhonis) and the relationships between these structures and the adhesive forces. The SEM results showed that the setae of these two species were densely distributed in an orderly fashion, and branched with curved tips. The setae of G. gecko had cluster structures, each cluster containing 4-6 setae whose terminal branches curved towards the center of the toes at ~ 10(°-), the tips of the branches like spatulae and densely arrayed at an interval of less than 0.2-0.3 μm. On the contrary, the branch tips in the setae of G. swinhonis were curled, and the terminal parts of setae curved towards the center of the toes at various angles. Usually the setae of these gecko species branch twice at the top at intervals greater than that of G. gecko. The histological observation found that inside the setae of these two species there were plenty of unevenly distributed contents, such as epithelia, fat cells, pigmental cells and muscle tissue, but no gland cells existed. The results of functional experiments suggested that modifying the structure of gecko's setae could reduce its adhesive ability dramatically, demonstrating the positive correlation between the structure of the gecko's setae and its adhesive ability. The above results provide important information in designing bio-mimic setae and bio-gecko robots.
Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne
2017-08-01
Activation of G protein-coupled estrogen receptor (GPER) by its agonist, G1, protects the heart from stressors such as pressure-overload, ischemia, a high-salt diet, estrogen loss, and aging, in various male and female animal models. Due to nonspecific effects of G1, the exact functions of cardiac GPER cannot be concluded from studies using systemic G1 administration. Moreover, global knockdown of GPER affects glucose homeostasis, blood pressure, and many other cardiovascular-related systems, thereby confounding interpretation of its direct cardiac actions. We generated a cardiomyocyte-specific GPER knockout (KO) mouse model to specifically investigate the functions of GPER in cardiomyocytes. Compared to wild type mice, cardiomyocyte-specific GPER KO mice exhibited adverse alterations in cardiac structure and impaired systolic and diastolic function, as measured by echocardiography. Gene deletion effects on left ventricular dimensions were more profound in male KO mice compared to female KO mice. Analysis of DNA microarray data from isolated cardiomyocytes of wild type and KO mice revealed sex-based differences in gene expression profiles affecting multiple transcriptional networks. Gene Set Enrichment Analysis (GSEA) revealed that mitochondrial genes are enriched in GPER KO females, whereas inflammatory response genes are enriched in GPER KO males, compared to their wild type counterparts of the same sex. The cardiomyocyte-specific GPER KO mouse model provides us with a powerful tool to study the functions of GPER in cardiomyocytes. The gene expression profiles of the GPER KO mice provide foundational information for further study of the mechanisms underlying sex-specific cardioprotection by GPER. Copyright © 2016 Elsevier B.V. All rights reserved.
Suseela, Y V; Narayanaswamy, Nagarjun; Pratihar, Sumon; Govindaraju, Thimmaiah
2018-02-05
The structural diversity and functional relevance of nucleic acids (NAs), mainly deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are indispensable for almost all living organisms, with minute aberrations in their structure and function becoming causative factors in numerous human diseases. The standard structures of NAs, termed canonical structures, are supported by Watson-Crick hydrogen bonding. Under special physiological conditions, NAs adopt distinct spatial organisations, giving rise to non-canonical conformations supported by hydrogen bonding other than the Watson-Crick type; such non-canonical structures have a definite function in controlling gene expression and are considered as novel diagnostic and therapeutic targets. Development of molecular probes for these canonical and non-canonical DNA/RNA structures has been an active field of research. Among the numerous probes studied, probes with turn-on fluorescence in the far-red (600-750 nm) region are highly sought-after due to minimal autofluorescence and cellular damage. Far-red fluorescent probes are vital for real-time imaging of NAs in live cells as they provide good resolution and minimal perturbation of the cell under investigation. In this review, we present recent advances in the area of far-red fluorescent probes of DNA/RNA and non-canonical G-quadruplex structures. For the sake of continuity and completeness, we provide a brief overview of visible fluorescent probes. Utmost importance is given to design criteria, characteristic properties and biological applications, including in cellulo imaging, apart from critical discussion on limitations of the far-red fluorescent probes. Finally, we offer current and future prospects in targeting canonical and non-canonical NAs specific to cellular organelles, through sequence- and conformation-specific far-red fluorescent probes. We also cover their implications in chemical and molecular biology, with particular focus on decoding various disease
How-Kit, Alexandre; Daunay, Antoine; Mazaleyrat, Nicolas; Busato, Florence; Daviaud, Christian; Teyssier, Emeline; Deleuze, Jean-François; Gallusci, Philippe; Tost, Jörg
2015-07-01
Pyrosequencing permits accurate quantification of DNA methylation of specific regions where the proportions of the C/T polymorphism induced by sodium bisulfite treatment of DNA reflects the DNA methylation level. The commercially available high-throughput locus-specific pyrosequencing instruments allow for the simultaneous analysis of 96 samples, but restrict the DNA methylation analysis to CpG dinucleotide sites, which can be limiting in many biological systems. In contrast to mammals where DNA methylation occurs nearly exclusively on CpG dinucleotides, plants genomes harbor DNA methylation also in other sequence contexts including CHG and CHH motives, which cannot be evaluated by these pyrosequencing instruments due to software limitations. Here, we present a complete pipeline for accurate CpG and non-CpG cytosine methylation analysis at single base-resolution using high-throughput locus-specific pyrosequencing. The devised approach includes the design and validation of PCR amplification on bisulfite-treated DNA and pyrosequencing assays as well as the quantification of the methylation level at every cytosine from the raw peak intensities of the Pyrograms by two newly developed Visual Basic Applications. Our method presents accurate and reproducible results as exemplified by the cytosine methylation analysis of the promoter regions of two Tomato genes (NOR and CNR) encoding transcription regulators of fruit ripening during different stages of fruit development. Our results confirmed a significant and temporally coordinated loss of DNA methylation on specific cytosines during the early stages of fruit development in both promoters as previously shown by WGBS. The manuscript describes thus the first high-throughput locus-specific DNA methylation analysis in plants using pyrosequencing.
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
Zhang, Z.; Birkedal, V.; Gothelf, K. V.
2016-05-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
DEFF Research Database (Denmark)
Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager
2016-01-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...
"SP-G", a putative new surfactant protein--tissue localization and 3D structure.
Directory of Open Access Journals (Sweden)
Felix Rausch
Full Text Available Surfactant proteins (SP are well known from human lung. These proteins assist the formation of a monolayer of surface-active phospholipids at the liquid-air interface of the alveolar lining, play a major role in lowering the surface tension of interfaces, and have functions in innate and adaptive immune defense. During recent years it became obvious that SPs are also part of other tissues and fluids such as tear fluid, gingiva, saliva, the nasolacrimal system, and kidney. Recently, a putative new surfactant protein (SFTA2 or SP-G was identified, which has no sequence or structural identity to the already know surfactant proteins. In this work, computational chemistry and molecular-biological methods were combined to localize and characterize SP-G. With the help of a protein structure model, specific antibodies were obtained which allowed the detection of SP-G not only on mRNA but also on protein level. The localization of this protein in different human tissues, sequence based prediction tools for posttranslational modifications and molecular dynamic simulations reveal that SP-G has physicochemical properties similar to the already known surfactant proteins B and C. This includes also the possibility of interactions with lipid systems and with that, a potential surface-regulatory feature of SP-G. In conclusion, the results indicate SP-G as a new surfactant protein which represents an until now unknown surfactant protein class.
Presence of specific IgG antibody to grain dust does not go with respiratory symptoms.
Park, H S; Suh, C H; Nahm, D H; Kim, H Y
1999-02-01
A high prevalence of work-related symptoms in relation to grain dust exposure has been reported in grain dust workers, but the role of the specific IgG antibody is unknown. To study the possible role of specific IgG (sIgG) and specific IgG4 (sIgG4) in the development of work-related symptoms, sIgG and sIgG4 subclass antibodies against grain dust antigens were determined by ELISA in sera from 43 workers and 27 non-exposed controls. They were compared with results of specific IgE antibodies, exposure intensity and the presence of respiratory symptoms. SIgG and sIgG4 antibodies were detectable in almost all sera of exposed workers, and the prevalence were significantly higher than those of controls (pgrain dust exposure and may unlikely play a role in the etiology of respiratory symptoms.
Crystal Structure of the Conserved Herpes Virus Fusion Regulator Complex gH–gL
Energy Technology Data Exchange (ETDEWEB)
Chowdary, T.; Cairns, T; Atanasiu, D; Cohen, G; Eisenberg, R; Heldwein, E
2010-01-01
Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.
Crystal structure of the conserved herpes virus fusion regulator complex gH-gL
Energy Technology Data Exchange (ETDEWEB)
Chowdary, Tirumala K; Cairns, Tina M; Atanasiu, Doina; Cohen, Gary H; Eisenberg, Roselyn J; Heldwein, Ekaterina E [UPENN; (Tufts-MED)
2010-09-13
Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.
Directory of Open Access Journals (Sweden)
Weronika Kotkowiak
2018-03-01
Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.
Autism-specific covariation in perceptual performances: "g" or "p" factor?
Meilleur, Andrée-Anne S; Berthiaume, Claude; Bertone, Armando; Mottron, Laurent
2014-01-01
Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination) and mid-level (e.g., pattern matching) tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals. We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ) and Raven Progressive Matrices (RPM). We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence. In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism. Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor). Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor), which may drive perceptual abilities differently in autistic and
Autism-specific covariation in perceptual performances: "g" or "p" factor?
Directory of Open Access Journals (Sweden)
Andrée-Anne S Meilleur
Full Text Available Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination and mid-level (e.g., pattern matching tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals.We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ and Raven Progressive Matrices (RPM. We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence.In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism.Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor. Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor, which may drive perceptual abilities differently in
International Nuclear Information System (INIS)
Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.
2009-01-01
The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III 1 region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III 1 region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III 1 and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III 1 in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg 88 to Ala 88 (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III 1 region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.
Human Leukocyte Antigen-G and Regulatory T Cells during Specific Immunotherapy for Pollen Allergy
DEFF Research Database (Denmark)
Sørensen, Anja Elaine; Johnsen, Claus R; Dalgaard, Louise Torp
2013-01-01
of the cytokine profile towards a TH1-polarized immune response. We investigated the effects of SIT on T cells, on immunomodulation of human leukocyte antigen (HLA)-G, which has been associated with allergy, on regulatory cytokine expression, and on serum allergen-specific antibody subclasses (IgE and IgG4......). Methods: Eleven birch and/or grass pollen-allergic patients and 10 healthy nonatopic controls were studied before and during SIT. Tregs, chemokine receptors, soluble HLA-G (sHLA-G), Ig-like transcript (ILT) 2, specific IgE, and IgG4 were studied. Peripheral blood mononuclear cells (PBMCs) were stimulated...... with pollen extract in vitro and immune factors were evaluated. Results: During SIT, the main changes in the peripheral blood were an increase in CXCR3+CD4+CD25+CD127low/- Tregs and a decrease in CCR4+CD4+CD25+CD127low/- Tregs, an increase in allergen-specific IgG4, and a decrease in sHLA-G during the first...
Bao, Ting; Shu, Huawei; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu
2015-03-03
A target-induced structure-switching electrochemical aptasensor for sensitive detection of ATP was successfully constructed which was based on exonuclease III-catalyzed target recycling for signal amplification. With the existence of ATP, methylene blue (MB) labeled hairpin DNA formed G-quadruplex with ATP, which led to conformational changes of the hairpin DNA and created catalytic cleavage sites for exonuclease III (Exo III). Then the structure-switching DNA hybridized with capture DNA which made MB close to electrode surface. Meanwhile, Exo III selectively digested aptamer from its 3'-end, thus G-quadruplex structure was destroyed and ATP was released for target recycling. The Exo III-assisted target recycling amplified electrochemical signal significantly. Fluorescence experiment was performed to confirm the structure-switching process of the hairpin DNA. In fluorescence experiment, AuNPs-aptamer conjugates were synthesized, AuNPs quenched fluorescence of MB, the target-induced structure-switching made Exo III digested aptamer, which restored fluorescence. Under optimized conditions, the proposed aptasensor showed a linear range of 0.1-20 nM with a detection limit of 34 pM. In addition, the proposed aptasensor had good stability and selectivity, offered promising choice for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gao, Baojiao; Fang, Li; Men, Jiying; Zhang, Yanyan
2013-01-01
Sodium 4-styrene sulfonate (SSS) was graft-polymerized on the surfaces of crosslinked polyvinyl alcohol (CPVA) microspheres in a manner of surface-initiated graft-polymerization by using cerium salt-hydroxyl group redox initiation system, obtaining the grafted microspheres CPVA-g-PSSS. The chemical structure and physicochemical characters of CPVA-g-PSSS microspheres were fully characterized with infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and zeta potential determination. The aim of this work is to constitute a novel colon-specific drug delivery system via molecular design by using CPVA-g-PSSS microspheres as the drug-carrying material and by taking metronidazole (MTZ) as the model drug. The drug-carrying ability and mechanism of the grafted microspheres CPVA-g-PSSS for MTZ were investigated. Finally, in-vitro release tests for the drug-carrying microspheres were conducted. The experimental results show that in an acidic medium, the grafted microspheres CPVA-g-PSSS exhibit strong adsorption ability for MTZ by driving of electrostatic interaction, and have an adsorption capacity of 112 mg/g, displaying the high efficiency of drug-carrying. The in-vitro release behavior of the drug-carried microspheres is highly pH-sensitive. In the medium of pH = 1, the drug-carrying microspheres do not release the drug, whereas in the medium of pH = 7.4, a sudden delivery phenomenon of the drug will occur, displaying an excellent colon-specific drug delivery behavior. Highlights: ► A metronidazole colon-specific drug delivery was constituted using grafted polymeric microspheres. ► Grafted polymeric microspheres CPVA-g-PSSS were prepared via surface-initiated graft-polymerization. ► The release of the drug-carrying microspheres is highly pH-sensitive. ► The drug-carrying microspheres display an excellent colon-specific drug delivery behavior
Energy Technology Data Exchange (ETDEWEB)
Gao, Baojiao, E-mail: gaobaojiao@126.com [Department of Chemical Engineering, North University of China, Taiyuan 030051, People' s Republic of China (China); Fang, Li [School of Chemistry and Chemical engineering, Shanxi University, Taiyuan 030006 (China); Men, Jiying; Zhang, Yanyan [Department of Chemical Engineering, North University of China, Taiyuan 030051, People' s Republic of China (China)
2013-04-01
Sodium 4-styrene sulfonate (SSS) was graft-polymerized on the surfaces of crosslinked polyvinyl alcohol (CPVA) microspheres in a manner of surface-initiated graft-polymerization by using cerium salt-hydroxyl group redox initiation system, obtaining the grafted microspheres CPVA-g-PSSS. The chemical structure and physicochemical characters of CPVA-g-PSSS microspheres were fully characterized with infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and zeta potential determination. The aim of this work is to constitute a novel colon-specific drug delivery system via molecular design by using CPVA-g-PSSS microspheres as the drug-carrying material and by taking metronidazole (MTZ) as the model drug. The drug-carrying ability and mechanism of the grafted microspheres CPVA-g-PSSS for MTZ were investigated. Finally, in-vitro release tests for the drug-carrying microspheres were conducted. The experimental results show that in an acidic medium, the grafted microspheres CPVA-g-PSSS exhibit strong adsorption ability for MTZ by driving of electrostatic interaction, and have an adsorption capacity of 112 mg/g, displaying the high efficiency of drug-carrying. The in-vitro release behavior of the drug-carried microspheres is highly pH-sensitive. In the medium of pH = 1, the drug-carrying microspheres do not release the drug, whereas in the medium of pH = 7.4, a sudden delivery phenomenon of the drug will occur, displaying an excellent colon-specific drug delivery behavior. Highlights: ► A metronidazole colon-specific drug delivery was constituted using grafted polymeric microspheres. ► Grafted polymeric microspheres CPVA-g-PSSS were prepared via surface-initiated graft-polymerization. ► The release of the drug-carrying microspheres is highly pH-sensitive. ► The drug-carrying microspheres display an excellent colon-specific drug delivery behavior.
Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua
2017-11-01
In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.
G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.
Lee, Hui Sun; Im, Wonpil
2017-01-01
Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.
Internal circle uplifts, transversality and stratified G-structures
Energy Technology Data Exchange (ETDEWEB)
Babalic, Elena Mirela [Department of Theoretical Physics, National Institute of Physics and Nuclear Engineering,Str. Reactorului no.30, P.O.BOX MG-6, Postcode 077125, Bucharest-Magurele (Romania); Department of Physics, University of Craiova,13 Al. I. Cuza Str., Craiova 200585 (Romania); Lazaroiu, Calin Iuliu [Center for Geometry and Physics, Institute for Basic Science,Pohang 790-784 (Korea, Republic of)
2015-11-24
We study stratified G-structures in N=2 compactifications of M-theory on eight-manifolds M using the uplift to the auxiliary nine-manifold M̂=M×S{sup 1}. We show that the cosmooth generalized distribution D̂ on M̂ which arises in this formalism may have pointwise transverse or non-transverse intersection with the pull-back of the tangent bundle of M, a fact which is responsible for the subtle relation between the spinor stabilizers arising on M and M̂ and for the complicated stratified G-structure on M which we uncovered in previous work. We give a direct explanation of the latter in terms of the former and relate explicitly the defining forms of the SU(2) structure which exists on the generic locus U of M to the defining forms of the SU(3) structure which exists on an open subset Û of M̂, thus providing a dictionary between the eight- and nine-dimensional formalisms.
Ren, Wang; Zhang, Ying; Huang, Wei Tao; Li, Nian Bing; Luo, Hong Qun
2015-06-15
This work reported a label-free colorimetric assay for sensitive detection of Hg(2+) based on Hg(2+)-triggered hairpin DNA probe (H-DNA) termini-binding and exonuclease Ш (Exo Ш)-assisted target recycling, as well as hemin/G-quadruplex (DNAzyme) signal amplification. The specific binding of free Hg(2+) with the thymine-thymine (T-T) mismatches termini of H-DNA could immediately trigger the Exo Ш digestion, and then set free G-quadruplex segments and Hg(2+). The Exo Ш impellent recycling of ultratrace Hg(2+) produced numerous G-quadruplexes. The corresponding DNAzymes catalyzed efficiently the H2O2-mediated oxidation of the ABTS(2-) to the colored product in the presence of hemin. Using the color change as the output signal, and the Exo Ш-aided Hg(2+) recycling and DNAzyme as the signal amplifier, the ultrasensitive assay system successfully achieved visual detection of Hg(2+) as low as 1.0 nM by the naked eye, and was suitable for field monitoring. The calibration curve was linear in the range of 50.0 pM to 20.0 nM for Hg(2+) (R=0.9962) with a detection limit of 10.0 pM. Moreover, this proposed strategy showed excellent selectivity, portability and low-cost, and was successfully applied to colorimetric detection of Hg(2+) in laboratory tap water and Jialing river water samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Rayner, Lucy E.; Hui, Gar Kay; Gor, Jayesh; Heenan, Richard K.; Dalby, Paul A.; Perkins, Stephen J.
2014-01-01
Human IgG4 antibody shows therapeutically useful properties compared with the IgG1, IgG2, and IgG3 subclasses. Thus IgG4 does not activate complement and shows conformational variability. These properties are attributable to its hinge region, which is the shortest of the four IgG subclasses. Using high throughput scattering methods, we studied the solution structure of wild-type IgG4(Ser222) and a hinge mutant IgG4(Pro222) in different buffers and temperatures where the proline substitution suppresses the formation of half-antibody. Analytical ultracentrifugation showed that both IgG4 forms were principally monomeric with sedimentation coefficients s20,w0 of 6.6–6.8 S. A monomer-dimer equilibrium was observed in heavy water buffer at low temperature. Scattering showed that the x-ray radius of gyration Rg was unchanged with concentration in 50–250 mm NaCl buffers, whereas the neutron Rg values showed a concentration-dependent increase as the temperature decreased in heavy water buffers. The distance distribution curves (P(r)) revealed two peaks, M1 and M2, that shifted below 2 mg/ml to indicate concentration-dependent IgG4 structures in addition to IgG4 dimer formation at high concentration in heavy water. Constrained x-ray and neutron scattering modeling revealed asymmetric solution structures for IgG4(Ser222) with extended hinge structures. The IgG4(Pro222) structure was similar. Both IgG4 structures showed that their Fab regions were positioned close enough to the Fc region to restrict C1q binding. Our new molecular models for IgG4 explain its inability to activate complement and clarify aspects of its stability and function for therapeutic applications. PMID:24876381
In-depth analysis of subclass-specific conformational preferences of IgG antibodies
DEFF Research Database (Denmark)
Tian, Xinsheng; Vestergaard, Bente; Thorolfsson, Matthias
2015-01-01
IgG subclass-specific differences in biological function and in vitro stability are often referred to variations in the conformational flexibility, while this flexibility has rarely been characterized. Here, small-angle X-ray scattering data from IgG1, IgG2 and IgG4 antibodies, which were designe...... properties and tailored effector functions. In addition, this advanced computational approach is applicable to other flexible multi-domain systems and extends the potential for investigating flexibility in solutions of macromolecules by small-angle X-ray scattering....
Characterizing the strand-specific distribution of non-CpG methylation in human pluripotent cells.
Guo, Weilong; Chung, Wen-Yu; Qian, Minping; Pellegrini, Matteo; Zhang, Michael Q
2014-03-01
DNA methylation is an important defense and regulatory mechanism. In mammals, most DNA methylation occurs at CpG sites, and asymmetric non-CpG methylation has only been detected at appreciable levels in a few cell types. We are the first to systematically study the strand-specific distribution of non-CpG methylation. With the divide-and-compare strategy, we show that CHG and CHH methylation are not intrinsically different in human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). We also find that non-CpG methylation is skewed between the two strands in introns, especially at intron boundaries and in highly expressed genes. Controlling for the proximal sequences of non-CpG sites, we show that the skew of non-CpG methylation in introns is mainly guided by sequence skew. By studying subgroups of transposable elements, we also found that non-CpG methylation is distributed in a strand-specific manner in both short interspersed nuclear elements (SINE) and long interspersed nuclear elements (LINE), but not in long terminal repeats (LTR). Finally, we show that on the antisense strand of Alus, a non-CpG site just downstream of the A-box is highly methylated. Together, the divide-and-compare strategy leads us to identify regions with strand-specific distributions of non-CpG methylation in humans.
DEFF Research Database (Denmark)
Bodtger, U; Ejrnaes, A M; Hummelshoj, L
2005-01-01
The role of IgG4 during allergen-specific immunotherapy (SIT) is still controversial. The available studies present paramount differences in in vitro techniques, allergens, and clinical outcome parameters. By implementing a sensitive method, and pivotal clinical outcome parameters, we wanted to a...
Specific IgG and its subclass antibodies after immunotherapy with gynandropsis gynandra
Directory of Open Access Journals (Sweden)
Latha G
2005-01-01
Full Text Available Background : About 10 to 15 % of the Indian population is known to suffer from major allergic disorders such as Asthma, Rhinitis, Atopic Dermatitis and Urticaria. Aeroallergens play a major role in the pathogenesis of respiratory allergic diseases. Among the aeroallergens, pollens are major causative agents. The predominance of pollen allergens necessitate the need to assess the specific immunotherapy (SIT in allergic patients. Objective : To evaluate the effect of immunotherapy based on the presence of IgG and its subclass antibodies towards whole pollen antigen of Gynandropsis gynandra (G.gynandra and its fractions. Material and Methods : A study was conducted in 30 bronchial asthma patients on immunotherapy, by assessing the levels of IgG and its subclasses specific to G. gynandra pollen. Results : There was a significant increase in IgG and its subclass antibodies to whole pollen antigen and its fractions i.e.> 90kD, 46-37kD and 36-32kD after the course of IT. Conclusion : The use of peptide fractions may be more appropriate instead of the whole pollen antigen to test the effect of immunotherapy.
Aktar, Suriya J; Vivet-Boudou, Valérie; Ali, Lizna M; Jabeen, Ayesha; Kalloush, Rawan M; Richer, Delphine; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A
2014-11-14
One of the hallmarks of retroviral life cycle is the efficient and specific packaging of two copies of retroviral gRNA in the form of a non-covalent RNA dimer by the assembling virions. It is becoming increasingly clear that the process of dimerization is closely linked with gRNA packaging, and in some retroviruses, the latter depends on the former. Earlier mutational analysis of the 5' end of the MMTV genome indicated that MMTV gRNA packaging determinants comprise sequences both within the 5' untranslated region (5' UTR) and the beginning of gag. The RNA secondary structure of MMTV gRNA packaging sequences was elucidated employing selective 2'hydroxyl acylation analyzed by primer extension (SHAPE). SHAPE analyses revealed the presence of a U5/Gag long-range interaction (U5/Gag LRI), not predicted by minimum free-energy structure predictions that potentially stabilizes the global structure of this region. Structure conservation along with base-pair covariations between different strains of MMTV further supported the SHAPE-validated model. The 5' region of the MMTV gRNA contains multiple palindromic (pal) sequences that could initiate intermolecular interaction during RNA dimerization. In vitro RNA dimerization, SHAPE analysis, and structure prediction approaches on a series of pal mutants revealed that MMTV RNA utilizes a palindromic point of contact to initiate intermolecular interactions between two gRNAs, leading to dimerization. This contact point resides within pal II (5' CGGCCG 3') at the 5' UTR and contains a canonical "GC" dyad and therefore likely constitutes the MMTV RNA dimerization initiation site (DIS). Further analyses of these pal mutants employing in vivo genetic approaches indicate that pal II, as well as pal sequences located in the primer binding site (PBS) are both required for efficient MMTV gRNA packaging. Employing structural prediction, biochemical, and genetic approaches, we show that pal II functions as a primary point of contact between
Thrombin–aptamer recognition: a revealed ambiguity
Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena
2011-01-01
Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the a...
NMO-IgG: A Specific Biomarker for Neuromyelitis Optica
Directory of Open Access Journals (Sweden)
Brian G. Weinshenker
2006-01-01
Full Text Available Neuromyelitis optica (NMO is an inflammatory demyelinating disease that principally targets the optic nerves and spinal cord and often leads to severe disability and occasionally life threatening respiratory failure. Although its clinical manifestations overlap with those of multiple sclerosis (MS, in established cases these two conditions can be distinguished on the basis of clinical, radiological, and routine spinal fluid studies. The diagnosis in early cases or limited forms of NMO is difficult. We recently discovered a unique IgG autoantibody (NMO-IgG that is highly specific to patients with NMO and thus a valuable diagnostic aid. Its antigen, aquaporin-4 (AQP4, is the central nervous system’s predominant water channel protein. This antibody has not yet been proven to be pathogenic, but several facts suggest that it might be, including the similarity of the immunohistochemical pattern of NMO-(AQP4 IgG binding to mouse CNS tissues to the pattern of immune complex deposition in autopsied patients’ spinal cord tissue. The spectrum of diseases identified by NMO-IgG is broader than has previously been recognized clinically and includes incomplete forms of NMO, such as recurrent transverse myelitis without optic neuritis and recurrent optic neuritis without myelitis.
Evolution of Positioning Techniques in Cellular Networks, from 2G to 4G
Directory of Open Access Journals (Sweden)
Rafael Saraiva Campos
2017-01-01
Full Text Available This review paper presents within a common framework the mobile station positioning methods applied in 2G, 3G, and 4G cellular networks, as well as the structure of the related 3GPP technical specifications. The evolution path through the generations is explored in three steps at each level: first, the new network elements supporting localization features are introduced; then, the standard localization methods are described; finally, the protocols providing specific support to mobile station positioning are studied. To allow a better understanding, this paper also brings a brief review of the cellular networks evolution paths.
Crystal Structure and Substrate Specificity of PTPN12
Directory of Open Access Journals (Sweden)
Hui Li
2016-05-01
Full Text Available PTPN12 is an important tumor suppressor that plays critical roles in various physiological processes. However, the molecular basis underlying the substrate specificity of PTPN12 remains uncertain. Here, enzymological and crystallographic studies have enabled us to identify two distinct structural features that are crucial determinants of PTPN12 substrate specificity: the pY+1 site binding pocket and specific basic charged residues along its surface loops. Key structurally plastic regions and specific residues in PTPN12 enabled recognition of different HER2 phosphorylation sites and regulated specific PTPN12 functions. In addition, the structure of PTPN12 revealed a CDK2 phosphorylation site in a specific PTPN12 loop. Taken together, our results not only provide the working mechanisms of PTPN12 for desphosphorylation of its substrates but will also help in designing specific inhibitors of PTPN12.
Structure-based drug design for G protein-coupled receptors.
Congreve, Miles; Dias, João M; Marshall, Fiona H
2014-01-01
Our understanding of the structural biology of G protein-coupled receptors has undergone a transformation over the past 5 years. New protein-ligand complexes are described almost monthly in high profile journals. Appreciation of how small molecules and natural ligands bind to their receptors has the potential to impact enormously how medicinal chemists approach this major class of receptor targets. An outline of the key topics in this field and some recent examples of structure- and fragment-based drug design are described. A table is presented with example views of each G protein-coupled receptor for which there is a published X-ray structure, including interactions with small molecule antagonists, partial and full agonists. The possible implications of these new data for drug design are discussed. © 2014 Elsevier B.V. All rights reserved.
An Immunoglobulin G1 Monoclonal Antibody Highly Specific to the Wall of Cryptosporidium Oocysts
Weir, C.; Vesey, G.; Slade, M.; Ferrari, B.; Veal, D. A.; Williams, K.
2000-01-01
The detection of Cryptosporidium oocysts in drinking water is critically dependent on the quality of immunofluorescent reagents. Experiments were performed to develop a method for producing highly specific antibodies to Cryptosporidium oocysts that can be used for water testing. BALB/c mice were immunized with six different antigen preparations and monitored for immunoglobulin G (IgG) and IgM responses to the surface of Cryptosporidium oocysts. One group of mice received purified oocyst walls, a second group received a soluble protein preparation extracted from the outside of the oocyst wall, and the third group received whole inactivated oocysts. Three additional groups were immunized with sequentially prepared oocyst extracts to provide for a comparison of the immune response. Mice injected with the soluble protein extract demonstrated an IgG response to oocysts surface that was not seen in the whole-oocyst group. Mice injected with whole oocysts showed an IgM response only, while mice injected with purified oocyst walls showed little increase in IgM or IgG levels. Of the additional reported preparations only one, BME (2-mercaptoethanol treated), produced a weak IgM response to the oocyst wall. A mouse from the soluble oocyst extract group yielding a high IgG response was utilized to produce a highly specific IgG1 monoclonal antibody (Cry104) specific to the oocyst surface. Comparative flow cytometric analysis indicated that Cry104 has a higher avidity and specificity to oocysts in water concentrates than other commercially available antibodies. PMID:10973448
Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor
DEFF Research Database (Denmark)
Bokoch, Michael P; Zou, Yaozhong; Rasmussen, Søren Gøgsig Faarup
2010-01-01
extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known...... conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive...... about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the beta(2) adrenergic...
Decoding Finger Flexion From Band-specific ECoG Signals in Humans
Directory of Open Access Journals (Sweden)
Nanying eLiang
2012-06-01
Full Text Available This article presents the method that won the BCI competition IV addressed to the pre- diction of the finger flexion from ECoG signals. ECoG-based BCIs have recently drawn the attention from the community. Indeed, ECoG can provide a higher spatial resolution, a higher signal quality and is more suitable for long-term use than classical EEG recordings. These characteristics allow to decode precise brain activities and to realize efficient ECoG-based neu- roprostheses. Signal processing is a very important task in BCIs research for translating brain signals into commands. Here, we present a linear regression method based on the amplitude modulation of band-specific ECoG including a short term memory for individual finger flexion prediction. The effectiveness of the method was proven by achieving the highest value of corre- lation coefficient between the predicted and recorded finger flexion values on data set 4 during the BCI competition IV.
Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M
2017-12-01
Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Structural Properties of G,T-Parallel Duplexes
Directory of Open Access Journals (Sweden)
Anna Aviñó
2010-01-01
Full Text Available The structure of G,T-parallel-stranded duplexes of DNA carrying similar amounts of adenine and guanine residues is studied by means of molecular dynamics (MD simulations and UV- and CD spectroscopies. In addition the impact of the substitution of adenine by 8-aminoadenine and guanine by 8-aminoguanine is analyzed. The presence of 8-aminoadenine and 8-aminoguanine stabilizes the parallel duplex structure. Binding of these oligonucleotides to their target polypyrimidine sequences to form the corresponding G,T-parallel triplex was not observed. Instead, when unmodified parallel-stranded duplexes were mixed with their polypyrimidine target, an interstrand Watson-Crick duplex was formed. As predicted by theoretical calculations parallel-stranded duplexes carrying 8-aminopurines did not bind to their target. The preference for the parallel-duplex over the Watson-Crick antiparallel duplex is attributed to the strong stabilization of the parallel duplex produced by the 8-aminopurines. Theoretical studies show that the isomorphism of the triads is crucial for the stability of the parallel triplex.
R-loops and initiation of DNA replication in human cells: a missing link?
Directory of Open Access Journals (Sweden)
Rodrigo eLombraña
2015-04-01
Full Text Available The unanticipated widespread occurrence of stable hybrid DNA/RNA structures (R-loops in human cells and the increasing evidence of their involvement in several human malignancies have invigorated the research on R-loop biology in recent years. Here we propose that physiological R-loop formation at CpG island promoters can contribute to DNA replication origin specification at these regions, the most efficient replication initiation sites in mammalian cells. Quite likely, this occurs by the strand-displacement reaction activating the formation of G-quadruplex structures that target the Origin Recognition Complex (ORC in the single-stranded conformation. In agreement with this, we found that R-loops co-localize with the ORC within the same CpG island region in a significant fraction of these efficient replication origins, precisely at the position displaying the highest density of G4 motifs. This scenario builds on the connection between transcription and replication in human cells and suggests that R-loop dysregulation at CpG island promoter-origins might contribute to the phenotype of DNA replication abnormalities and loss of genome integrity detected in cancer cells.
Directory of Open Access Journals (Sweden)
Xia Li
2016-10-01
Full Text Available Bisphenol A (BPA detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA/Exonuclease III (Exo III-combined cascade amplification strategy. First, the duplex DNA probe (RP with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of “G-quadruplex” in lantern-like structures. Finally, the continuously enriched “G-quadruplex lanterns” were lightened by zinc(II-protoporphyrin IX (ZnPPIX generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10−17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Templated Synthesis of Single-Walled Carbon Nanotubes with Specific Structure.
Yang, Feng; Wang, Xiao; Li, Meihui; Liu, Xiyan; Zhao, Xiulan; Zhang, Daqi; Zhang, Yan; Yang, Juan; Li, Yan
2016-04-19
Single-walled carbon nanotubes (SWNTs) have shown great potential in various applications attributed to their unique structure-dependent properties. Therefore, the controlled preparation of chemically and structurally pristine SWNTs is a crucial issue for their advanced applications (e.g., nanoelectronics) and has been a great challenge for two decades. Epitaxial growth from well-defined seeds has been shown to be a promising strategy to control the structure of SWNTs. Segments of carbon nanotubes, including short pipes from cutting of preformed nanotubes and caps from opening of fullerenes or cyclodehydrogenation of polycyclic hydrocarbon precursors, have been used as the seeds to grow SWNTs. Single-chirality SWNTs were obtained with both presorted chirality-pure SWNT segments and end caps obtained from polycyclic hydrocarbon molecules with designed structure. The main challenges of nanocarbon-segment-seeded processes are the stability of the seeds, yield, and efficiency. Catalyst-mediated SWNT growth is believed to be more efficient. The composition and morphology of the catalyst nanoparticles have been widely reported to affect the chirality distribution of SWNTs. However, chirality-specific SWNT growth is hard to achieve by alternating catalysts. The specificity of enzyme-catalyzed reactions brings us an awareness of the essentiality of a unique catalyst structure for the chirality-selective growth of SWNTs. Only catalysts with the desired atomic arrangements in their crystal planes can act as structural templates for chirality-specific growth of SWNTs. We have developed a new family of catalysts, tungsten-based intermetallic compounds, which have high melting points and very special crystal structures, to facilitate the growth of SWNTs with designed chirality. By the use of W6Co7 catalysts, (12,6) SWNTs were directly grown with purity higher than 92%. Both high-resolution transmission electron microscopy measurements and density functional theory simulations
Structural Analysis of Botulinum Neurotoxin Type G Receptor Binding
Energy Technology Data Exchange (ETDEWEB)
Schmitt, John; Karalewitz, Andrew; Benefield, Desire A.; Mushrush, Darren J.; Pruitt, Rory N.; Spiller, Benjamin W.; Barbieri, Joseph T.; Lacy, D. Borden (Vanderbilt); (MCW)
2010-10-19
Botulinum neurotoxin (BoNT) binds peripheral neurons at the neuromuscular junction through a dual-receptor mechanism that includes interactions with ganglioside and protein receptors. The receptor identities vary depending on BoNT serotype (A-G). BoNT/B and BoNT/G bind the luminal domains of synaptotagmin I and II, homologous synaptic vesicle proteins. We observe conditions under which BoNT/B binds both Syt isoforms, but BoNT/G binds only SytI. Both serotypes bind ganglioside G{sub T1b}. The BoNT/G receptor-binding domain crystal structure provides a context for examining these binding interactions and a platform for understanding the physiological relevance of different Syt receptor isoforms in vivo.
Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu
2018-02-01
In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.
Coppola, Teresa; Varra, Michela; Oliviero, Giorgia; Galeone, Aldo; D'Isa, Giuliana; Mayol, Luciano; Morelli, Elena; Bucci, Maria-Rosaria; Vellecco, Valentina; Cirino, Giuseppe; Borbone, Nicola
2008-09-01
A new modified acyclic nucleoside, namely N(1)-(3-hydroxy-2-hydroxymethyl-2-methylpropyl)-thymidine, was synthesized and transformed into a building block useful for oligonucleotide (ON) automated synthesis. A series of modified thrombin binding aptamers (TBAs) in which the new acyclic nucleoside replaces, one at the time, the thymidine residues were then synthesized and characterized by UV, CD, MS, and (1)H NMR. The biological activity of the resulting TBAs was tested by Prothrombin Time assay (PT assay) and by purified fibrinogen clotting assay. From a structural point of view, nearly all the new TBA analogues show a similar behavior as the unmodified counterpart, being able to fold into a bimolecular or monomolecular quadruplex structure depending on the nature of monovalent cations (sodium or potassium) coordinated in the quadruplex core. From the comparison of structural and biological data, some important structure-activity relationships emerged, particularly when the modification involved the TT loops. In agreement with previous studies we found that the folding ability of TBA analogues is more affected by modifications involving positions 4 and 13, rather than positions 3 and 12. On the other hand, the highest anti-thrombin activities were detected for aptamers containing the modification at T13 or T12 positions, thus indicating that the effects produced by the introduction of the acyclic nucleoside on the biological activity are not tightly connected with structure stabilities. It is noteworthy that the modification at T7 produces an ON being more stable and active than the natural TBA.
Directory of Open Access Journals (Sweden)
Catherine L Worth
Full Text Available BACKGROUND: Up until recently the only available experimental (high resolution structure of a G-protein-coupled receptor (GPCR was that of bovine rhodopsin. In the past few years the determination of GPCR structures has accelerated with three new receptors, as well as squid rhodopsin, being successfully crystallized. All share a common molecular architecture of seven transmembrane helices and can therefore serve as templates for building molecular models of homologous GPCRs. However, despite the common general architecture of these structures key differences do exist between them. The choice of which experimental GPCR structure(s to use for building a comparative model of a particular GPCR is unclear and without detailed structural and sequence analyses, could be arbitrary. The aim of this study is therefore to perform a systematic and detailed analysis of sequence-structure relationships of known GPCR structures. METHODOLOGY: We analyzed in detail conserved and unique sequence motifs and structural features in experimentally-determined GPCR structures. Deeper insight into specific and important structural features of GPCRs as well as valuable information for template selection has been gained. Using key features a workflow has been formulated for identifying the most appropriate template(s for building homology models of GPCRs of unknown structure. This workflow was applied to a set of 14 human family A GPCRs suggesting for each the most appropriate template(s for building a comparative molecular model. CONCLUSIONS: The available crystal structures represent only a subset of all possible structural variation in family A GPCRs. Some GPCRs have structural features that are distributed over different crystal structures or which are not present in the templates suggesting that homology models should be built using multiple templates. This study provides a systematic analysis of GPCR crystal structures and a consistent method for identifying
Worth, Catherine L; Kleinau, Gunnar; Krause, Gerd
2009-09-16
Up until recently the only available experimental (high resolution) structure of a G-protein-coupled receptor (GPCR) was that of bovine rhodopsin. In the past few years the determination of GPCR structures has accelerated with three new receptors, as well as squid rhodopsin, being successfully crystallized. All share a common molecular architecture of seven transmembrane helices and can therefore serve as templates for building molecular models of homologous GPCRs. However, despite the common general architecture of these structures key differences do exist between them. The choice of which experimental GPCR structure(s) to use for building a comparative model of a particular GPCR is unclear and without detailed structural and sequence analyses, could be arbitrary. The aim of this study is therefore to perform a systematic and detailed analysis of sequence-structure relationships of known GPCR structures. We analyzed in detail conserved and unique sequence motifs and structural features in experimentally-determined GPCR structures. Deeper insight into specific and important structural features of GPCRs as well as valuable information for template selection has been gained. Using key features a workflow has been formulated for identifying the most appropriate template(s) for building homology models of GPCRs of unknown structure. This workflow was applied to a set of 14 human family A GPCRs suggesting for each the most appropriate template(s) for building a comparative molecular model. The available crystal structures represent only a subset of all possible structural variation in family A GPCRs. Some GPCRs have structural features that are distributed over different crystal structures or which are not present in the templates suggesting that homology models should be built using multiple templates. This study provides a systematic analysis of GPCR crystal structures and a consistent method for identifying suitable templates for GPCR homology modelling that will
Structure models of G72, the product of a susceptibility gene to schizophrenia.
Kato, Yusuke; Fukui, Kiyoshi
2017-02-01
The G72 gene is one of the most susceptible genes to schizophrenia and is contained exclusively in the genomes of primates. The product of the G72 gene modulates the activity of D-amino acid oxidase (DAO) and is a small protein prone to aggregate, which hampers its structural studies. In addition, lack of a known structure of a homologue makes it difficult to use the homology modelling method for the prediction of the structure. Thus, we first developed a hybrid ab initio approach for small proteins prior to the prediction of the structure of G72. The approach uses three known ab initio algorithms. To evaluate the hybrid approach, we tested our prediction of the structure of the amino acid sequences whose structures were already solved and compared the predicted structures with the experimentally solved structures. Based on these comparisons, the average accuracy of our approach was calculated to be ∼5 Å. We then applied the approach to the sequence of G72 and successfully predicted the structures of the N- and C-terminal domains (ND and CD, respectively) of G72. The predicted structures of ND and CD were similar to membrane-bound proteins and adaptor proteins, respectively. © The Authors 2016. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Pereira, Maria G; Benevides, Norma M B; Melo, Marcia R S; Valente, Ana Paula; Melo, Fábio R; Mourão, Paulo A S
2005-09-05
Marine red algae are an abundant source of sulfated galactans with potent anticoagulant activity. However, the specific structural motifs that confer biological activity remain to be elucidated. We have now isolated and purified a sulfated galactan from the marine red alga, Gellidium crinale. The structure of this polysaccharide was determined using NMR spectroscopy. It is composed of the repeating structure -4-alpha-Galp-(1-->3)-beta-Galp1--> but with a variable sulfation pattern. Clearly 15% of the total alpha-units are 2,3-di-sulfated and another 55% are 2-sulfated. No evidence for the occurrence of 3,6-anhydro alpha-galactose units was observed in the NMR spectra. We also compared the anticoagulant activity of this sulfated galactan with a polysaccharide from the species, Botryocladia occidentalis, with a similar saccharide chain but with higher amounts of 2,3-di-sulfated alpha-units. The sulfated galactan from G. crinale has a lower anticoagulant activity on a clotting assay when compared with the polysaccharide from B. occidentalis. When tested in assays using specific proteases and coagulation inhibitors, these two galactans showed significant differences in their activity. They do not differ in thrombin inhibition mediated by antithrombin, but in assays where heparin cofactor II replaces antithrombin, the sulfated galactan from G. crinale requires a significantly higher concentration to achieve the same inhibitory effect as the polysaccharide from B. occidentalis. In contrast, when factor Xa instead of thrombin is used as the target protease, the sulfated galactan from G. crinale is a more potent anticoagulant. These observations suggest that the proportion and/or the distribution of 2,3-di-sulfated alpha-units along the galactan chain may be a critical structural motif to promote the interaction of the protease with specific protease and coagulation inhibitors.
DEFF Research Database (Denmark)
Cogoi, Susanna; Zorzet, Sonia; Rapozzi, Valentina
2013-01-01
and stability, two polycyclic aromatic hydrocarbon units (TINA or AMANY) were inserted internally, to cap the quadruplex. The most active G4-decoy (2998), which had two para-TINAs, strongly suppressed KRAS expression in Panc-1 cells. It also repressed their metabolic activity (IC50 = 520 nM), and it inhibited...... cell growth and colony formation by activating apoptosis. We finally injected 2998 and control oligonucleotides 5153, 5154 (2 nmol/mouse) intratumorally in SCID mice bearing a Panc-1 xenograft. After three treatments, 2998 reduced tumor xenograft growth by 64% compared with control and increased...
Manas, Nor Hasmaliana Abdul; Bakar, Farah Diba Abu; Illias, Rosli Md
2016-06-01
Maltogenic amylase (MAG1) from Bacillus lehensis G1 displayed the highest hydrolysis activity on β-cyclodextrin (β-CD) to produce maltose as a main product and exhibited high transglycosylation activity on malto-oligosaccharides with polymerization degree of three and above. These substrate and product specificities of MAG1 were elucidated from structural point of view in this study. A three-dimensional structure of MAG1 was constructed using homology modeling. Docking of β-CD and malto-oligosaccharides was then performed in the MAG1 active site. An aromatic platform in the active site was identified which is responsible in substrate recognition especially in determining the enzyme's preference toward β-CD. Molecular dynamics (MD) simulation showed MAG1 structure is most stable when docked with β-CD and least stable when docked with maltose. The docking analysis and MD simulation showed that the main subsites for substrate stabilization in the active site are -2, -1, +1 and +2. A bulky residue, Trp359 at the +2 subsite was identified to cause steric interference to the bound linear malto-oligosaccharides thus prevented it to occupy subsite +3, which can only be reached by a highly bent glucose molecule such as β-CD. The resulted modes of binding from docking simulation show a good correlation with the experimentally determined hydrolysis pattern. The subsite structure generated from this study led to a possible mode of action that revealed how maltose was mainly produced during hydrolysis. Furthermore, maltose only occupies subsite +1 and +2, therefore could not be hydrolyzed or transglycosylated by the enzyme. This important knowledge has paved the way for a novel structure-based molecular design for modulation of its catalytic activities. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Weissbrich Benedikt
2007-05-01
Full Text Available Abstract Background The determination of virus-specific immunoglobulin G (IgG antibodies in cerebrospinal fluid (CSF is useful for the diagnosis of virus associated diseases of the central nervous system (CNS and for the detection of a polyspecific intrathecal immune response in patients with multiple sclerosis. Quantification of virus-specific IgG in the CSF is frequently performed by calculation of a virus-specific antibody index (AI. Determination of the AI is a demanding and labour-intensive technique and therefore automation is desirable. We evaluated the precision and the diagnostic value of a fully automated enzyme immunoassay for the detection of virus-specific IgG in serum and CSF using the analyser BEP2000 (Dade Behring. Methods The AI for measles, rubella, varicella-zoster, and herpes simplex virus IgG was determined from pairs of serum and CSF samples of patients with viral CNS infections, multiple sclerosis and of control patients. CSF and serum samples were tested simultaneously with reference to a standard curve. Starting dilutions were 1:6 and 1:36 for CSF and 1:1386 and 1:8316 for serum samples. Results The interassay coefficient of variation was below 10% for all parameters tested. There was good agreement between AIs obtained with the BEP2000 and AIs derived from the semi-automated reference method. Conclusion Determination of virus-specific IgG in serum-CSF-pairs for calculation of AI has been successfully automated on the BEP2000. Current limitations of the assay layout imposed by the analyser software should be solved in future versions to offer more convenience in comparison to manual or semi-automated methods.
International Nuclear Information System (INIS)
Hibma, M.; Griffin, J.F.T.
1992-01-01
Monoclonal antibodies (mAb) which react with cervine immunoglobulin (Ig) light chain, IgM and IgG were produced using conventional cell fusion technology. Hybridoma supernatants were initially screened for specificity against cervine Ig using an enzyme-linked immunosorbent assay (ELISA). The specificity of supernatants against size-fractionated cervine Ig was further determined. Supernatants were characterised using western blotting and autoradiographic techniques. The mAb OU1G, OU2G and OU3G were specific for cervine gamma-chain of IgG, whereas OU1L was specific for light chain of Ig. A further mAb (OU1M) bound IgM and not IgG. These mAb were found to have varying cross-reactivity against Ig from other species
The spin-dependent structure function g1 of the deuteron
International Nuclear Information System (INIS)
Bueltmann, S.
1996-01-01
Results on the spin-dependent structure function g 1 d of the deuteron measured by the Spin Muon Collaboration at CERN are presented. They are based on deep-inelastic scattering of 190 GeV polarized muons off a polarized deuteron target in the kinematic range of 0.003 ≤ x Bj ≤ 0.7 and 1 GeV 2 ≤ Q 2 ≤ 60 GeV 2 . The structure function is found to be negative for small values of x Bj , while the proton structure function g 1 p measured earlier by the SMC is positive over the whole x Bj -range. The Bjorken sum rule is in good agreement with the first moments of the structure functions, while the Ellis-Jaffe sum rule is violated by more than three standard deviations for the deuteron measurement. (author)
Wei, Yin; Zhang, Ji; Wang, Xu; Duan, Yixiang
2015-03-15
This paper describes a novel approach utilizing nano-graphite-aptamer hybrid and DNase I for the amplified detection of ochratoxin A (OTA) for the first time. Nano-graphite can effectively quench the fluorescence of carboxyfluorescein (FAM) labeled OTA specific aptamer due to their strong π-π; stacking interactions; while upon OTA addition, it will bind with aptamer to fold into an OTA-aptamerG-quadruplex structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the G-quadruplex structure can be cleaved by DNase I, and in such case OTA is delivered from the complex. The released OTA then binds other FAM-labeled aptamers on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled aptamers from the nano-graphite, which leads to significant amplification of the signal. Under the optimized conditions, the present amplified sensing system exhibits high sensitivity toward OTA with a limit of detection of 20nM (practical measurement), which is about 100-fold higher than that of traditional unamplified homogeneous assay. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples. The proposed assay is simple, cost-effective, and might open a door for the development of new assays for other biomolecules. This aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer. Copyright © 2014 Elsevier B.V. All rights reserved.
Thyrocyte-specific Gq/G11 deficiency impairs thyroid function and prevents goiter development.
Kero, Jukka; Ahmed, Kashan; Wettschureck, Nina; Tunaru, Sorin; Wintermantel, Tim; Greiner, Erich; Schütz, Günther; Offermanns, Stefan
2007-09-01
The function of the adult thyroid is regulated by thyroid-stimulating hormone (TSH), which acts through a G protein-coupled receptor. Overactivation of the TSH receptor results in hyperthyroidism and goiter. The Gs-mediated stimulation of adenylyl cyclase-dependent cAMP formation has been regarded as the principal intracellular signaling mechanism mediating the action of TSH. Here we show that the Gq/G11-mediated signaling pathway plays an unexpected and essential role in the regulation of thyroid function. Mice lacking the alpha subunits of Gq and G11 specifically in thyroid epithelial cells showed severely reduced iodine organification and thyroid hormone secretion in response to TSH, and many developed hypothyroidism within months after birth. In addition, thyrocyte-specific Galphaq/Galpha11-deficient mice lacked the normal proliferative thyroid response to TSH or goitrogenic diet, indicating an essential role of this pathway in the adaptive growth of the thyroid gland. Our data suggest that Gq/G11 and their downstream effectors are promising targets to interfere with increased thyroid function and growth.
Structural similarity and category-specificity
DEFF Research Database (Denmark)
Gerlach, Christian; Law, Ian; Paulson, Olaf B
2004-01-01
It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...
Xie, Jianming [San Diego, CA; Wang, Lei [San Diego, CA; Wu, Ning [Boston, MA; Schultz, Peter G [La Jolla, CA
2008-07-15
Translation systems and other compositions including orthogonal aminoacyl tRNA-synthetases that preferentially charge an orthogonal tRNA with an iodinated or brominated amino acid are provided. Nucleic acids encoding such synthetases are also described, as are methods and kits for producing proteins including heavy atom-containing amino acids, e.g., brominated or iodinated amino acids. Methods of determining the structure of a protein, e.g., a protein into which a heavy atom has been site-specifically incorporated through use of an orthogonal tRNA/aminoacyl tRNA-synthetase pair, are also described.
Prevalence of rubella-specific IgG antibodies in unimmunized young female population
Directory of Open Access Journals (Sweden)
Jayakrishnan Thayyil
2016-01-01
Full Text Available Context: Rubella is a mild self-limiting disease all over the world; nevertheless, it is of significant public health importance due to its teratogenic effect of congenital rubella syndrome. Rubella vaccine is currently not included in the national immunization program in India. Rubella-specific IgG in the unvaccinated population is a marker of previous rubella infection. Rubella IgG estimation in children will provide data for initiation and necessary modification to the immunization strategy. Aims: In this background, this study was conducted with an aim to know the age-specific susceptibility of acquiring rubella infections and future risk of congenital rubella syndrome (CRS among girls. Settings and Design: This was a community-based, observational study. Participants and Methods: The study was conducted at a randomly selected rural area Mavoor Panchayath of Kozhikode District, Kerala, among adolescent girls. The estimation of rubella-specific IgG antibody was done by quantitative enzyme-linked immunosorbent assay method. IgG titer value of >15 IU was taken positive, 8-15 IU as equivocal, and <8 IU as negative. Statistical Analysis Used: Statistical analysis was performed using Statistical program for Social science version 16 for Windows. Chi-square test was applied to find out significant difference and Fisher′s exact test wherever applicable. Results: The data and blood sample collection was done from 250 girls. The mean IgG titer was 151.93 ± 128.78 IU, and as per the criteria, 68.3% were positive, 28.5% were negative, and 3.2% were equivocal. At this age, majority (68.3% of the girls get protection by natural infection without any vaccine. Some girls (32% may remain susceptible to infection during adulthood and pregnancy. Conclusions: Natural rubella infection was widely prevalent among child population and at this age. An immunization policy recommending rubella-containing vaccine is highly desirable to prevent rubella and CRS.
Beloki, Lorea; Ciaurriz, Miriam; Mansilla, Cristina; Zabalza, Amaya; Perez-Valderrama, Estela; Samuel, Edward R; Lowdell, Mark W; Ramirez, Natalia; Olavarria, Eduardo
2014-11-19
Cytomegalovirus (CMV)-specific T cell infusion to immunocompromised patients following allogeneic Hematopoietic Stem Cell Transplantation (allo-HSCT) is able to induce a successful anti-viral response. These cells have classically been manufactured from steady-state apheresis samples collected from the donor in an additional harvest prior to G-CSF mobilization, treatment that induces hematopoietic stem cell (HSC) mobilization to the periphery. However, two closely-timed cellular collections are not usually available in the unrelated donor setting, which limits the accessibility of anti-viral cells for adoptive immunotherapy. CMV-specific cytotoxic T cell (CTL) manufacture from the same G-CSF mobilized donor stem cell harvest offers great regulatory advantages, but the isolation using MHC-multimers is hampered by the high non-specific binding to myeloid progenitors, which reduces the purity of the cellular product. In the present study we describe an easy and fast method based on plastic adherence to remove myeloid cell subsets from 11 G-CSF mobilized donor samples. CMV-specific CTLs were isolated from the non-adherent fraction using pentamers and purity and yield of the process were compared to products obtained from unmanipulated samples. After the elimination of unwanted cell subtypes, non-specific binding of pentamers was notably reduced. Accordingly, following the isolation process the purity of the obtained cellular product was significantly improved. G-CSF mobilized leukapheresis samples can successfully be used to isolate antigen-specific T cells with MHC-multimers to be adoptively transferred following allo-HSCT, widening the accessibility of this therapy in the unrelated donor setting. The combination of the clinically translatable plastic adherence process to the antigen-specific cell isolation using MHC-multimers improves the quality of the therapeutic cellular product, thereby reducing the clinical negative effects associated with undesired
Elevated Serum IgG4 Defines Specific Clinical Phenotype of Rheumatoid Arthritis
Directory of Open Access Journals (Sweden)
Le-Feng Chen
2014-01-01
Full Text Available Objectives. To explore the correlation of serum IgG4 (sIgG4 with clinical manifestations or therapeutic response in rheumatoid arthritis (RA. Methods. Consecutive 136 RA patients were recruited and followed up at regular interval. SIgG4 was detected by immunonephelometry. Serial synovial tissue sections from 46 RA patients were stained immunohistochemically for IgG4. Results. Forty-six percent of 136 RA patients had elevated sIgG4. Patients with elevated sIgG4 had higher sIgG4/sIgG ratio, C-reactive protein, erythrocyte sedimentation rate, rheumatoid factor, and anticyclic citrullinated peptide antibodies than those with normal sIgG4 (all P<0.05. Among 45 patients who received methotrexate and leflunomide therapy, 50% (9/18 of patients with elevated sIgG4 and 85% (23/27 of patients with normal sIgG4 reached therapeutic target (disease activity score of 28 joints < 3.2 at 6-month visit (χ2=6.508, P=0.011. IgG4-positive plasma cell count correlated positively with sIgG4, total synovitis score, and CD3-, CD20-, and CD38-positive cell counts (all P<0.05. Conclusions. Our results showed that elevated sIgG4 in RA is common and disproportional to total IgG and RA with elevated sIgG4 may be a specific clinical phenotype with higher disease activity, higher level of autoantibodies, and poor response to methotrexate and leflunomide therapy.
Specific Abilities May Increment Psychometric g for High Ability Populations
2016-04-14
tend to sort themselves into jobs that are commensurate with their ability level ( McCormick , DeNisi, & Staw, 1979; McCormick , Jeanneret, & Mecham...of Genetic Psychology, 153, 229-230. Specific abilities, g, & high ability populations 14 McCormick , E. J., DeNisi, A. S., & Shaw, J. B... McCormick , E. J., Jeanneret, P. R., & Mecham, R. C. (1972). A study of job characteristics and job dimensions as based on the Position Analysis Questionnaire
Directory of Open Access Journals (Sweden)
V. Z. Krivitskaya
2012-01-01
Full Text Available Abstract. The aim of the study is evaluation of links between presence in blood of specific pre-existing IgG to respiratory-syncytial virus (RSV, clinical course of RSV infection and character specific to RSV humoral immune response in patients of different ages. The antibodies were detected by ELISA using whole RS virus or synthetic peptides corresponded to the selected determinants of the envelope RSV proteins. It was shown that RS specific maternal IgG antibodies passively transferred to babies in utero can circulate in the blood up to 10 months of life. The analysis of paired sera of 45 babies in the age of 1–10 months revealed firstly that presence of maternal IgG specific antibodies to the conservative B-cell immunogenic determinants of the F-protein (amino acids 221–232 and/or the G-protein (amino acids 152–164 and 184–198 is coupled with more high morbidity of primary RSV infection (89% versus 56%, p = 0.023, and also with more high frequency of complicated by bronchus obstruction course of the disease (81% versus 20%, р = 0.001 in compare with babies who were serologically negative to the maternal determinants specific antibodies. The correlation analysis has shown that the high presence of maternal determinant-specific IgG in the blood in babies till 10 months of life is associated in the case of primary infection with disbalance of humoral anti-viral immune response: intensive synthesis of serum RSV IgA. This is evidence of complicated course of infection with simultaneous suppression of response to RSV specific IgG. As opposed to the primary RSV infection in patients older than 3 years (n = 121 it was not detected links between anamnestic determinant-specific IgG synthesized by own immune system as the results of previous disease episodes and synthesis of anti-RSV IgG, IgM, IgE and IgA in RSV re-infections. In the contrast to babies in more older patients the feedback connection between level of pre-existing determinant-specific
DEFF Research Database (Denmark)
Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub
2018-01-01
Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...
The "G-Spot" Is Not a Structure Evident on Macroscopic Anatomic Dissection of the Vaginal Wall.
Hoag, Nathan; Keast, Janet R; O'Connell, Helen E
2017-12-01
Controversy exists in the literature regarding the presence or absence of an anatomic "G-spot." However, few studies have examined the detailed topographic or histologic anatomy of the putative G-spot location. To determine the anatomy of the anterior vaginal wall and present detailed, systematic, accessible findings from female cadaveric dissections to provide anatomic clarity with respect to this location. Systematic anatomic dissections were performed on 13 female cadavers (32-97 years old, 8 fixed and 5 fresh) to characterize the gross anatomy of the anterior vaginal wall. Digital photography was used to document dissections. Dissection preserved the anterior vaginal wall, urethra, and clitoris. In 9 cadavers, the vaginal epithelial layer was reflected to expose the underlying urethral wall and associated tissues. In 4 cadavers, the vaginal wall was left intact before preservation. Once photographed, 8 specimens were transversely sectioned for macroscopic inspection and histologic examination. The presence or absence of a macroscopic anatomic structure at detailed cadaveric pelvis dissection that corresponds to the previously described G-spot and gross anatomic description of the anterior vaginal wall. Deep to the lining epithelium of the anterior vaginal wall is the urethra. There is no macroscopic structure other than the urethra and vaginal wall lining in the location of the putative G-spot. Specifically, there is no apparent erectile or "spongy" tissue in the anterior vaginal wall, except where the urethra abuts the clitoris distally. The absence of an anatomic structure corresponding to the putative G-spot helps clarify the controversy on this subject. Limitations to this study include limited access to specimens immediately after death and potential for observational bias. In addition, age, medical history, and cause of death are not publishable for privacy reasons. However, it is one of the most thorough and complete anatomic evaluations documenting the
Structuring Formal Requirements Specifications for Reuse and Product Families
Heimdahl, Mats P. E.
2001-01-01
In this project we have investigated how formal specifications should be structured to allow for requirements reuse, product family engineering, and ease of requirements change, The contributions of this work include (1) a requirements specification methodology specifically targeted for critical avionics applications, (2) guidelines for how to structure state-based specifications to facilitate ease of change and reuse, and (3) examples from the avionics domain demonstrating the proposed approach.
DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.
Thys, Ryan Griffin; Wang, Yuh-Hwa
2015-11-27
DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Structure, stability and behaviour of nucleic acids in ionic liquids
Tateishi-Karimata, Hisae; Sugimoto, Naoki
2014-01-01
Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2016-01-01
1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...
Facile method for the site-specific, covalent attachment of full-length IgG onto nanoparticles.
Hui, James Zhe; Al Zaki, Ajlan; Cheng, Zhiliang; Popik, Vladimir; Zhang, Hongtao; Luning Prak, Eline T; Tsourkas, Andrew
2014-08-27
Antibodies, most commonly IgGs, have been widely used as targeting ligands in research and therapeutic applications due to their wide array of targets, high specificity and proven efficacy. Many of these applications require antibodies to be conjugated onto surfaces (e.g. nanoparticles and microplates); however, most conventional bioconjugation techniques exhibit low crosslinking efficiencies, reduced functionality due to non-site-specific labeling and random surface orientation, and/or require protein engineering (e.g. cysteine handles), which can be technically challenging. To overcome these limitations, we have recombinantly expressed Protein Z, which binds the Fc region of IgG, with an UV active non-natural amino acid benzoylphenyalanine (BPA) within its binding domain. Upon exposure to long wavelength UV light, the BPA is activated and forms a covalent link between the Protein Z and the bound Fc region of IgG. This technology was combined with expressed protein ligation (EPL), which allowed for the introduction of a fluorophore and click chemistry-compatible azide group onto the C-terminus of Protein Z during the recombinant protein purification step. This enabled the crosslinked-Protein Z-IgG complexes to be efficiently and site-specifically attached to aza-dibenzocyclooctyne-modified nanoparticles, via copper-free click chemistry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gao, Pu; Ascano, Manuel; Zillinger, Thomas; Wang, Weiyi; Dai, Peihong; Serganov, Artem A; Gaffney, Barbara L; Shuman, Stewart; Jones, Roger A; Deng, Liang; Hartmann, Gunther; Barchet, Winfried; Tuschl, Thomas; Patel, Dinshaw J
2013-08-15
Binding of dsDNA by cyclic GMP-AMP (cGAMP) synthase (cGAS) triggers formation of the metazoan second messenger c[G(2',5')pA(3',5')p], which binds the signaling protein STING with subsequent activation of the interferon (IFN) pathway. We show that human hSTING(H232) adopts a "closed" conformation upon binding c[G(2',5')pA(3',5')p] and its linkage isomer c[G(2',5')pA(2',5')p], as does mouse mSting(R231) on binding c[G(2',5')pA(3',5')p], c[G(3',5')pA(3',5')p] and the antiviral agent DMXAA, leading to similar "closed" conformations. Comparing hSTING to mSting, 2',5'-linkage-containing cGAMP isomers were more specific triggers of the IFN pathway compared to the all-3',5'-linkage isomer. Guided by structural information, we identified a unique point mutation (S162A) placed within the cyclic-dinucleotide-binding site of hSTING that rendered it sensitive to the otherwise mouse-specific drug DMXAA, a conclusion validated by binding studies. Our structural and functional analysis highlights the unexpected versatility of STING in the recognition of natural and synthetic ligands within a small-molecule pocket created by the dimerization of STING. Copyright © 2013 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Jing, Pei; Yi, Huayu; Xue, Shuyan; Chai, Yaqin; Yuan, Ruo; Xu, Wenju, E-mail: xwju@swu.edu.cn
2015-01-01
Highlights: • PDDA–G–MoS{sub 2} nanoflowers were firstly used for the fabrication of thrombin aptasensor. • MoS{sub 2} was adopted to enhance the surface area of graphene and accelerate the electron transfer. • GOD, PdNPs and hemin/G-quadruplex could amplify the electrochemical signal through synergetic catalysis. • The proposed aptasensor displayed an improved sensitivity. - Abstract: In the present study, with the aggregated advantages of graphene and molybdenum disulfide (MoS{sub 2}), we prepared poly(diallyldimethylammonium chloride)–graphene/molybdenum disulfide (PDDA–G–MoS{sub 2}) nanocomposites with flower-like structure, large surface area and excellent conductivity. Furthermore, an advanced sandwich-type electrochemical assay for sensitive detection of thrombin (TB) was fabricated using palladium nanoparticles decorated PDDA–G–MoS{sub 2} (PdNPs/PDDA–G–MoS{sub 2}) as nanocarriers, which were functionalized by hemin/G-quadruplex, glucose oxidase (GOD), and toluidine blue (Tb) as redox probes. The signal amplification strategy was achieved as follows: Firstly, the immobilized GOD could effectively catalyze the oxidation of glucose to gluconolactone, coupling with the reduction of the dissolved oxygen to H{sub 2}O{sub 2}. Then, both PdNPs and hemin/G-quadruplex acting as hydrogen peroxide (HRP)-mimicking enzyme could further catalyze the reduction of H{sub 2}O{sub 2}, resulting in significant electrochemical signal amplification. So the proposed aptasensor showed high sensitivity with a wide dynamic linear range of 0.0001 to 40 nM and a relatively low detection limit of 0.062 pM for TB determination. The strategy showed huge potential of application in protein detection and disease diagnosis.
Hormesis of specific IgG antibody to rabies virus in serum of mice irradiated with low dose γ-rays
International Nuclear Information System (INIS)
Liu Qingjie; Chen Deqing
1998-01-01
Objective: To explore the effect of low dose ionizing radiation on specific antibody in mouse serum. Methods: Kunming strain male mice, weighing 18-22 g, aged 6-8 weeks, were immunized intraperitoneally with rabies vaccine after exposure to cobalt-60 γ-rays. The specific IgG antibody against rabies virus in mouse serum was measured. Results: (1) The serum levels of specific IgG in mice irradiated with 5-30 cGy γ-rays were significantly elevated in comparison with those in control mice (P<0.01), the optimum stimulating dose being 10 cGy. (2) Exposure to 10 cGy caused significant enhancement and earlier emergence of the peak level of specific IgG in serum. (3) The hormesis of specific IgG to rabies virus induced by 10 cGy γ-rays could last one week at least. Conclusion: Low dose ionizing radiation can enhance the level of specific antibody in mouse serum, and this effect can last for one week at least
Wang, Lingyun; Yan, Feng
2017-12-09
Heterogeneous nuclear ribonucleoprotein F (hnRNP F) controls the expression of various genes through regulating the alternative splicing of pre-mRNAs in the nucleus. It uses three quasi-RNA recognition motifs (qRRMs) to recognize G-tract RNA which contains at least three consecutive guanines. The structures containing qRRMs of hnRNP F in complex with G-tract RNA have been determined by nuclear magnetic resonance (NMR) spectroscopy, shedding light on the recognition mechanism of qRRMs with G-tract RNA. However, knowledge of the recognition details is still lacking. To investigate how qRRMs specifically bind with G-tract RNA and how the mutations of any guanine to an adenine in the G-tract affect the binding, molecular dynamics simulations with binding free energy analysis were performed based on the NMR structure of qRRM2 in complex with G-tract RNA. Simulation results demonstrate that qRRM2 binds strongly with G-tract RNA, but any mutation of the G-tract leads to a drastic reduction of the binding free energy. Further comparisons of the energetic components reveal that van der Waals and non-polar interactions play essential roles in the binding between qRRM2 and G-tract RNA, but the interactions are weakened by the effect of RNA mutations. Structural and dynamical analyses indicate that when qRRM2 binds with G-tract RNA, both qRRM2 and G-tract maintain stabilized structures and dynamics; however, the stability is disrupted by the mutations of the G-tract. These results provide novel insights into the recognition mechanism of qRRM2 with G-tract RNA that are not elucidated by the NMR technique. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
R. Sharma
2010-02-01
Full Text Available The present investigation was carried out on 15 randomly selected milch buffaloes divided into three groups on the basis of lactation at an organized farm, to study the foot and mouth disease virus type specific antibodies in milk and serum following FMD vaccination. Milk and serum samples collected before vaccination i.e. 0 day and on 7, 14, 28, 42 and 56 days post vaccination, were analyzed for the detection of FMD virus specific IgG1, IgG2 and IgA antibody response by indirect double antibody sandwich ELISA. Significant FMD virus type specific antibody titres (IgG1, IgG2 and IgA were detected in milk and serum of buffaloes on different days post vaccination, though the levels of antibodies were lower in milk as compared to serum. FMD virus type specific IgG1 was found to be the predominant subclass as compared to IgG2 and IgA both in milk and serum of vaccinated buffaloes. Milk and serum IgG1, IgG2 and IgA antibody titres were positively correlated with values of regression coefficient (R as 0.506, 0.434 and 0.396, respectively.
Laux-Biehlmann, Alexis; Chung, Hélène; Mouheiche, Jinane; Vérièpe, Julie; Delalande, François; Lamshöft, Marc; Welters, Ingeborg D; Soldevila, Stéphanie; Bazin, Hervé; Lamarque, Laurent; Van Dorsselaer, Alain; Poisbeau, Pierrick; Schneider, Francis; Goumon, Yannick; Garnero, Patrick
2014-01-01
Endogenous morphine and its derivatives (morphine-6-glucuronide [M6G]; morphine-3-glucuronide [M3G]) are formed by mammalian cells from dopamine. Changes in the concentrations of endogenous morphine have been demonstrated in several pathologies (sepsis, Parkinson's disease, etc.), and they might be relevant as pathological markers. While endogenous morphine levels are detectable using enzyme-linked immunosorbant assay (ELISA), mass spectrometry (MS) analysis was, so far, the only approach to detect and quantify M6G. This study describes the preparation of a specific anti-M6G rabbit polyclonal antibody and its validation. The specificity of this antibody was assessed against 30 morphine-related compounds. Then, a M6G-specific ELISA-assay was tested to quantify M6G in the plasma of healthy donors, morphine-treated, and critically ill patients. The antibody raised against M6G displays a strong affinity for M6G, codeine-6-glucuronide, and morphine-3-6-glucuronide, whereas only weak cross-reactivities were observed for the other compounds. Both M6G-ELISA and LC-MS/MS approaches revealed the absence of M6G in the plasma of healthy donors (controls, n = 8). In all positive donors treated with morphine-patch (n = 5), M6G was detected using both M6G-ELISA and LC-MS/MS analysis. Finally, in a study on critically ill patients with circulating endogenous morphine (n = 26), LC-MS/MS analysis revealed that 73% of the positive-patients (19 of 26), corresponding to high M6G-levels in M6G-ELISA, contained M6G. In conclusion, we show that endogenous M6G can be found at higher levels than morphine in the blood of morphine-naive patients. With respect to the interest of measuring endogenous M6G in pathologies, we provide evidences that our ELISA procedure represents a powerful tool as it can easily and specifically detect endogenous M6G levels. © 2013 International Union of Biochemistry and Molecular Biology.
Characterizing the strand-specific distribution of non-CpG methylation in human pluripotent cells
Guo, Weilong; Chung, Wen-Yu; Qian, Minping; Pellegrini, Matteo; Zhang, Michael Q.
2013-01-01
DNA methylation is an important defense and regulatory mechanism. In mammals, most DNA methylation occurs at CpG sites, and asymmetric non-CpG methylation has only been detected at appreciable levels in a few cell types. We are the first to systematically study the strand-specific distribution of non-CpG methylation. With the divide-and-compare strategy, we show that CHG and CHH methylation are not intrinsically different in human embryonic stem cells (ESCs) and induced pluripotent stem cells...
Energy Technology Data Exchange (ETDEWEB)
Modolo, Luzia V.; Li, Lenong; Pan, Haiyun; Blount, Jack W.; Dixon, Richard A.; Wang, Xiaoqiang; (SRNF)
2010-09-21
The glycosyltransferase UGT78G1 from Medicago truncatula catalyzes the glycosylation of various (iso)flavonoids such as the flavonols kaempferol and myricetin, the isoflavone formononetin, and the anthocyanidins pelargonidin and cyanidin. It also catalyzes a reverse reaction to remove the sugar moiety from glycosides. The structures of UGT78G1 bound with uridine diphosphate or with both uridine diphosphate and myricetin were determined at 2.1 {angstrom} resolution, revealing detailed interactions between the enzyme and substrates/products and suggesting a distinct binding mode for the acceptor/product. Comparative structural analysis and mutagenesis identify glutamate 192 as a key amino acid for the reverse reaction. This information provides a basis for enzyme engineering to manipulate substrate specificity and to design effective biocatalysts with glycosylation and/or deglycosylation activity.
Yang-Mills solutions and Spin(7)-instantons on cylinders over coset spaces with G2-structure
International Nuclear Information System (INIS)
Haupt, Alexander S.
2016-01-01
We study g-valued Yang-Mills fields on cylinders Z(G/H)=ℝ×G/H, where G/H is a compact seven-dimensional coset space with G 2 -structure, g is the Lie algebra of G, and Z(G/H) inherits a Spin(7)-structure. After imposing a general G-invariance condition, Yang-Mills theory with torsion on Z(G/H) reduces to Newtonian mechanics of a point particle moving in ℝ n under the influence of some quartic potential and possibly additional constraints. The kinematics and dynamics depends on the chosen coset space. We consider in detail three coset spaces with nearly parallel G 2 -structure and four coset spaces with SU(3)-structure. For each case, we analyze the critical points of the potential and present a range of finite-energy solutions. We also study a higher-dimensional analog of the instanton equation. Its solutions yield G-invariant Spin(7)-instanton configurations on Z(G/H), which are special cases of Yang-Mills configurations with torsion.
12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure
2010-01-01
..._Code Relationship CodeThe code indicating how the customer is related to the account. Possible values... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Deposit-Customer Join File Structure G Appendix... GENERAL POLICY RESOLUTION AND RECEIVERSHIP RULES Pt. 360, App. G Appendix G to Part 360—Deposit-Customer...
RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP
Czech Academy of Sciences Publication Activity Database
Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.
2014-01-01
Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
J. Groen (Jan); P. Koraka (Penelope); J. Velzing (Jans); C. Copra (Cederick); A.D.M.E. Osterhaus (Albert)
2000-01-01
textabstractThe performance of six commercially available immunoassay systems for the detection of dengue virus-specific immunoglobulin M (IgM) and IgG antibodies in serum was evaluated. These included two IgM and IgG enzyme immunoassays (EIA) from MRL Laboratories and PanBio, a rapid
Casas, Jesús; Ibarguren, Maitane; Álvarez, Rafael; Terés, Silvia; Lladó, Victoria; Piotto, Stefano P; Concilio, Simona; Busquets, Xavier; López, David J; Escribá, Pablo V
2017-09-01
G proteins often bear myristoyl, palmitoyl and isoprenyl moieties, which favor their association with the membrane and their accumulation in G Protein Coupled Receptor-rich microdomains. These lipids influence the biophysical properties of membranes and thereby modulate G protein binding to bilayers. In this context, we showed here that geranylgeraniol, but neither myristate nor palmitate, increased the inverted hexagonal (H II ) phase propensity of phosphatidylethanolamine-containing membranes. While myristate and palmitate preferentially associated with phosphatidylcholine membranes, geranylgeraniol favored nonlamellar-prone membranes. In addition, Gαi 1 monomers had a higher affinity for lamellar phases, while Gβγ and Gαβγ showed a marked preference for nonlamellar prone membranes. Moreover, geranylgeraniol enhanced the binding of G protein dimers and trimers to phosphatidylethanolamine-containing membranes, yet it decreased that of monomers. By contrast, both myristate and palmitate increased the Gαi 1 preference for lamellar membranes. Palmitoylation reinforced the binding of the monomer to PC membranes and myristoylation decreased its binding to PE-enriched bilayer. Finally, binding of dimers and trimers to lamellar-prone membranes was decreased by palmitate and myristate, but it was increased in nonlamellar-prone bilayers. These results demonstrate that co/post-translational G protein lipid modifications regulate the membrane lipid structure and that they influence the physico-chemical properties of membranes, which in part explains why G protein subunits sort to different plasma membrane domains. This article is part of a Special Issue entitled: Membrane Lipid Therapy: Drugs Targeting Biomembranes edited by Pablo V. Escribá. Copyright © 2017 Elsevier B.V. All rights reserved.
Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika
2014-08-01
This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.
X-ray structure of the mammalian GIRK2-βγ G-protein complex
Energy Technology Data Exchange (ETDEWEB)
Whorton, Matthew R.; MacKinnon, Roderick [Rockefeller
2013-07-30
G-protein-gated inward rectifier K+ (GIRK) channels allow neurotransmitters, through G-protein-coupled receptor stimulation, to control cellular electrical excitability. In cardiac and neuronal cells this control regulates heart rate and neural circuit activity, respectively. Here we present the 3.5Å resolution crystal structure of the mammalian GIRK2 channel in complex with βγ G-protein subunits, the central signalling complex that links G-protein-coupled receptor stimulation to K+ channel activity. Short-range atomic and long-range electrostatic interactions stabilize four βγ G-protein subunits at the interfaces between four K+ channel subunits, inducing a pre-open state of the channel. The pre-open state exhibits a conformation that is intermediate between the closed conformation and the open conformation of the constitutively active mutant. The resultant structural picture is compatible with ‘membrane delimited’ activation of GIRK channels by G proteins and the characteristic burst kinetics of channel gating. The structures also permit a conceptual understanding of how the signalling lipid phosphatidylinositol-4,5-bisphosphate (PIP2) and intracellular Na+ ions participate in multi-ligand regulation of GIRK channels.
Crystal structure of the human beta2 adrenergic G-protein-coupled receptor
DEFF Research Database (Denmark)
Rasmussen, Søren Gøgsig Faarup; Choi, Hee-Jung; Rosenbaum, Daniel M
2007-01-01
Structural analysis of G-protein-coupled receptors (GPCRs) for hormones and neurotransmitters has been hindered by their low natural abundance, inherent structural flexibility, and instability in detergent solutions. Here we report a structure of the human beta2 adrenoceptor (beta2AR), which was ...
G2S: A web-service for annotating genomic variants on 3D protein structures.
Wang, Juexin; Sheridan, Robert; Sumer, S Onur; Schultz, Nikolaus; Xu, Dong; Gao, Jianjiong
2018-01-27
Accurately mapping and annotating genomic locations on 3D protein structures is a key step in structure-based analysis of genomic variants detected by recent large-scale sequencing efforts. There are several mapping resources currently available, but none of them provides a web API (Application Programming Interface) that support programmatic access. We present G2S, a real-time web API that provides automated mapping of genomic variants on 3D protein structures. G2S can align genomic locations of variants, protein locations, or protein sequences to protein structures and retrieve the mapped residues from structures. G2S API uses REST-inspired design conception and it can be used by various clients such as web browsers, command terminals, programming languages and other bioinformatics tools for bringing 3D structures into genomic variant analysis. The webserver and source codes are freely available at https://g2s.genomenexus.org. g2s@genomenexus.org. Supplementary data are available at Bioinformatics online. © The Author (2018). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
In vivo study about specific captation of 125 I-insulin by rat brain structures
International Nuclear Information System (INIS)
Sanvitto, G.L.
1986-01-01
The specific captation of 125 I-insulin was evaluated by brain structures, as olfactory bulbous, hypothalamus and cerebellum in rats, from in vivo experiences that including two different aspects: captation measure of 125 I-insulin after the intravenous injection of the labelled hormone, in fed rats and in rats with 48 h of fast or convulsion, procedure by the pentylene tetrazole; captation measure of 125 I-insulin after intra-cerebral-ventricular injection of the labelled hormone in fed rats. (C.G.C.)
Crystal structure of an eIF4G-like protein from Danio rerio
Energy Technology Data Exchange (ETDEWEB)
Bae, Euiyoung; Bitto, Eduard; Bingman, Craig A.; McCoy, Jason G.; Wesenberg, Gary E.; Phillips, Jr., George N. (UW)
2012-04-18
The gene LOC 91917 Danio rerio (zebrafish) encodes a protein annotated in the UniProt knowledgebase as the middle domain of eukaryotic initiation factor 4G domain containing protein b (MIF4Gdb). Its molecular weight is 25.8 kDa, and it comprises 222 amino acid residues. BLAST searches revealed homologues of D. rerio MIF4Gdb in many eukaryotes including humans. The homologue sand MIF4Gdb were identified as members of the Pfam family, MIF4G (PF2854), which is named after the middle domain of eukaryotic initiation factor 4G (eIF4G). eIF4G is a component of eukaryotic translational initiation complex, and contains binding sites for other initiation factors, suggesting its critical role in translational initiation. The MIF4G domain also occurs in several other proteins involved in RNA metabolism, including the Nonsense-mediated mRNA decay 2 protein (NMD2/UPF2), and the nuclear cap-binding protein 80-kDa subunit (CBP80). Sequence and structure analysis of the MIF4G domains in many proteins indicate that the domain assumes an all helical fold and has tandem repeated motifs. The zebrafish protein described here has homology to domains of other proteins variously referred to as NIC-containing proteins (NMD2, eIF4G, CBP80). The biological function of D. rerio MIF4Gdb has not yet been experimentally characterized, and the annotation is based on amino acid sequence comparison. D. rerio MIF4Gdb did not share more than 25% sequence identity with any protein for which the three-dimensional structure is known and was selected as a target for structure determination by the Center for Eukaryotic Structural Genomics (CESG). Here, they report the crystal structure of D. rerio MIF4Gdb (UniGene code Dr.79360, UniProt code Q5EAQ1, CESG target number GO.79294).
Lee, Hui Sun; Im, Wonpil
2016-04-01
Molecular recognition by protein mostly occurs in a local region on the protein surface. Thus, an efficient computational method for accurate characterization of protein local structural conservation is necessary to better understand biology and drug design. We present a novel local structure alignment tool, G-LoSA. G-LoSA aligns protein local structures in a sequence order independent way and provides a GA-score, a chemical feature-based and size-independent structure similarity score. Our benchmark validation shows the robust performance of G-LoSA to the local structures of diverse sizes and characteristics, demonstrating its universal applicability to local structure-centric comparative biology studies. In particular, G-LoSA is highly effective in detecting conserved local regions on the entire surface of a given protein. In addition, the applications of G-LoSA to identifying template ligands and predicting ligand and protein binding sites illustrate its strong potential for computer-aided drug design. We hope that G-LoSA can be a useful computational method for exploring interesting biological problems through large-scale comparison of protein local structures and facilitating drug discovery research and development. G-LoSA is freely available to academic users at http://im.compbio.ku.edu/GLoSA/. © 2016 The Protein Society.
Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2014-05-30
Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.
Specificity of Structural Assessment of Knowledge
Trumpower, David L.; Sharara, Harold; Goldsmith, Timothy E.
2010-01-01
This study examines the specificity of information provided by structural assessment of knowledge (SAK). SAK is a technique which uses the Pathfinder scaling algorithm to transform ratings of concept relatedness into network representations (PFnets) of individuals' knowledge. Inferences about individuals' overall domain knowledge based on the…
Energy Technology Data Exchange (ETDEWEB)
Zhang, Ruili; Liu, Jian; Xiao, Jianyuan [Department of Modern Physics and School of Nuclear Science and Technology, University of Science and Technology of China, Hefei, Anhui 230026 (China); Key Laboratory of Geospace Environment, CAS, Hefei, Anhui 230026 (China); Qin, Hong, E-mail: hongqin@princeton.edu [Plasma Physics Laboratory, Princeton University, Princeton, New Jersey 08543 (United States); Department of Modern Physics and School of Nuclear Science and Technology, University of Science and Technology of China, Hefei, Anhui 230026 (China); Davidson, Ronald C. [Plasma Physics Laboratory, Princeton University, Princeton, New Jersey 08543 (United States)
2016-07-15
The two-stream instability is probably the most important elementary example of collective instabilities in plasma physics and beam-plasma systems. For a warm plasma with two charged particle species, the instability diagram of the two-stream instability based on a 1D warm-fluid model exhibits an interesting band structure that has not been explained. We show that the band structure for this instability is the consequence of the Hamiltonian nature of the warm two-fluid system. Interestingly, the Hamiltonian nature manifests as a complex G-Hamiltonian structure in wave-number space, which directly determines the instability diagram. Specifically, it is shown that the boundaries between the stable and unstable regions are locations for Krein collisions between eigenmodes with different Krein signatures. In terms of physics, this rigorously implies that the system is destabilized when a positive-action mode resonates with a negative-action mode, and that this is the only mechanism by which the system can be destabilized. It is anticipated that this physical mechanism of destabilization is valid for other collective instabilities in conservative systems in plasma physics, accelerator physics, and fluid dynamics systems, which admit infinite-dimensional Hamiltonian structures.
Directory of Open Access Journals (Sweden)
Yin’e Hu
2015-01-01
Full Text Available To use food-specific IgG antibody detection to explore its application in the allergy dermatoses. 181 patients were included from January 2014 to September 2014. Fourteen food-specific IgG antibodies were detected by ELISA. The positive rates of IgG antibody of the patient group and the healthy group were significantly different. The positive rates of IgG antibody of egg, milk, shrimp and crab took a large proportion in three groups of patients with three kinds of allergy dermatoses of urticaria, eczema and allergic dermatitis, the proportion of which was respectively 70.2%, 77.8% and 71.7%. There was mild and moderate intolerance of food in the allergic dermatitis group while there was no distribution difference of food intolerance in urticaria group and eczema group. Among urticaria and allergic dermatitis patients with positive antibody, the positive rate of children was significantly higher than that of adults while there was no significant difference between children and adults among eczema patients with positive antibody. Allergy dermatoses are closely related to food-specific IgG antibody and the allergy dermatoses patients have a high incidence rate of food intolerance; detecting IgG antibody in patients is of great significance for the diagnosis and treatment of allergy dermatoses.
Specific-structured lipids: nutritional perspectives and production potentials
DEFF Research Database (Denmark)
Xu, Xuebing; Høy, Carl-Erik; Balchen, Steen
1997-01-01
Structured lipids are referring to any triacylglycerols containing both long chain fatty acids (mostly essential fatty acids) and medium or short chain fatty acids. In case of specific-structured lipids (SSLs), each group of fatty acids locates specifically at sn-2 or -1.3 positions of the glycerol...... backbone. Recently the nutritional perspectives of this kind of lipids attract many interests. This causes an increasing interest in the production of them by lipase-catalyzed interesterification. One of the advantages of lipase method over chemical ones is that SSLs can be produced with particular fatty...
Ganglioside-specific IgG and IgA recruit leukocyte effector functions in Guillain-Barre syndrome
Sorge, N.M. van; Yuki, N.; Koga, M.; Susuki, K.; Jansen, M.D.; Kooten, C. van; Wokke, J.H.; Winkel, J.G.J. van de; Pol, W.L. van der; Berg, L.H. van den
2007-01-01
The capacity of ganglioside-specific autoantibodies to recruit leukocyte effector functions was studied. Serum samples from 87 patients with Guillain–Barré (GBS) or Miller Fisher syndrome (MFS), containing GM1-, GQ1b-, or GD1b-specific IgG or IgA, were tested for leukocyte activating capacity.
Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.
Neidle, Stephen
2004-09-15
Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.
Spoerry, Christian; Hessle, Pontus; Lewis, Melanie J; Paton, Lois; Woof, Jenny M; von Pawel-Rammingen, Ulrich
2016-01-01
Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use.
Specificity and Effector Functions of Human RSV-Specific IgG from Bovine Milk.
Directory of Open Access Journals (Sweden)
Gerco den Hartog
Full Text Available Respiratory syncytial virus (RSV infection is the second most important cause of death in the first year of life, and early RSV infections are associated with the development of asthma. Breastfeeding and serum IgG have been shown to protect against RSV infection. Yet, many infants depend on bovine milk-based nutrition, which at present lacks intact immunoglobulins.To investigate whether IgG purified from bovine milk (bIgG can modulate immune responses against human RSV.ELISAs were performed to analyse binding of bIgG to human respiratory pathogens. bIgG or hRSV was coated to plates to assess dose-dependent binding of bIgG to human Fcγ receptors (FcγR or bIgG-mediated binding of myeloid cells to hRSV respectively. S. Epidermidis and RSV were used to test bIgG-mediated binding and internalisation of pathogens by myeloid cells. Finally, the ability of bIgG to neutralise infection of HEp2 cells by hRSV was evaluated.bIgG recognised human RSV, influenza haemagglutinin and Haemophilus influenza. bIgG bound to FcγRII on neutrophils, monocytes and macrophages, but not to FcγRI and FcγRIII, and could bind simultaneously to hRSV and human FcγRII on neutrophils. In addition, human neutrophils and dendritic cells internalised pathogens that were opsonised with bIgG. Finally, bIgG could prevent infection of HEp2 cells by hRSV.The data presented here show that bIgG binds to hRSV and other human respiratory pathogens and induces effector functions through binding to human FcγRII on phagocytes. Thus bovine IgG may contribute to immune protection against RSV.
Specificity and Effector Functions of Human RSV-Specific IgG from Bovine Milk.
den Hartog, Gerco; Jacobino, Shamir; Bont, Louis; Cox, Linda; Ulfman, Laurien H; Leusen, Jeanette H W; van Neerven, R J Joost
2014-01-01
Respiratory syncytial virus (RSV) infection is the second most important cause of death in the first year of life, and early RSV infections are associated with the development of asthma. Breastfeeding and serum IgG have been shown to protect against RSV infection. Yet, many infants depend on bovine milk-based nutrition, which at present lacks intact immunoglobulins. To investigate whether IgG purified from bovine milk (bIgG) can modulate immune responses against human RSV. ELISAs were performed to analyse binding of bIgG to human respiratory pathogens. bIgG or hRSV was coated to plates to assess dose-dependent binding of bIgG to human Fcγ receptors (FcγR) or bIgG-mediated binding of myeloid cells to hRSV respectively. S. Epidermidis and RSV were used to test bIgG-mediated binding and internalisation of pathogens by myeloid cells. Finally, the ability of bIgG to neutralise infection of HEp2 cells by hRSV was evaluated. bIgG recognised human RSV, influenza haemagglutinin and Haemophilus influenza. bIgG bound to FcγRII on neutrophils, monocytes and macrophages, but not to FcγRI and FcγRIII, and could bind simultaneously to hRSV and human FcγRII on neutrophils. In addition, human neutrophils and dendritic cells internalised pathogens that were opsonised with bIgG. Finally, bIgG could prevent infection of HEp2 cells by hRSV. The data presented here show that bIgG binds to hRSV and other human respiratory pathogens and induces effector functions through binding to human FcγRII on phagocytes. Thus bovine IgG may contribute to immune protection against RSV.
Carvalho, Josue´; Queiroz, João A.; Cruz, Carla
2017-01-01
Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…
G-protein-coupled receptor structures were not built in a day.
Blois, Tracy M; Bowie, James U
2009-07-01
Among the most exciting recent developments in structural biology is the structure determination of G-protein-coupled receptors (GPCRs), which comprise the largest class of membrane proteins in mammalian cells and have enormous importance for disease and drug development. The GPCR structures are perhaps the most visible examples of a nascent revolution in membrane protein structure determination. Like other major milestones in science, however, such as the sequencing of the human genome, these achievements were built on a hidden foundation of technological developments. Here, we describe some of the methods that are fueling the membrane protein structure revolution and have enabled the determination of the current GPCR structures, along with new techniques that may lead to future structures.
Filippova, Ekaterina V.; Weigand, Steven; Osipiuk, Jerzy; Kiryukhina, Olga; Joachimiak, Andrzej; Anderson, Wayne F.
2015-01-01
The spermidine N-acetyltransferase SpeG is a dodecameric enzyme that catalyzes the transfer of an acetyl group from acetyl-coenzyme A to polyamines such as spermidine and spermine. SpeG has an allosteric polyamine-binding site and acetylating polyamines regulates their intracellular concentrations. The structures of SpeG from Vibrio cholerae in complexes with polyamines and cofactor have been characterized earlier. Here, we present the dodecameric structure of SpeG from V. cholerae in a ligan...
Long, Feng; Zhu, Anna; Wang, Hongchen
2014-11-07
Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.
Solution structures of α-conotoxin G1 determined by two-dimensional NMR spectroscopy
International Nuclear Information System (INIS)
Pardi, A.; Galdes, A.; Florance, J.; Maniconte, D.
1989-01-01
Two-dimensional NMR data have been used to generate solution structures of α-conotoxin G1, a potent peptide antagonist of the acetylcholine receptor. Structural information was obtained in the form of proton-proton internuclear distance constraints, and initial structures were produced with a distance geometry algorithm. Energetically more favorable structures were generated by using the distance geometry structures as input for a constrained energy minimization program. The results of both of these calculations indicate that the overall backbone conformation of the molecule is well-defined by the NMR data whereas the side-chain conformations are generally less well-defined. The main structural features derived from the NMR data were the presence of tight turns centered on residues Pro 5 and Arg 9 . The solution structures are compared with previous proposed models of conotoxin G1, and the NMR data are interpreted in conjunction with chemical modification studies and structural properties of other antagonists of the acetylcholine receptor to gain insight into structure-activity relationships in these peptide toxins
Coitinho, Juliana B; Pereira, Mozart S; Costa, Débora M A; Guimarães, Samuel L; Araújo, Simara S; Hengge, Alvan C; Brandão, Tiago A S; Nagem, Ronaldo A P
2016-09-27
The salicylaldehyde dehydrogenase (NahF) catalyzes the oxidation of salicylaldehyde to salicylate using NAD(+) as a cofactor, the last reaction of the upper degradation pathway of naphthalene in Pseudomonas putida G7. The naphthalene is an abundant and toxic compound in oil and has been used as a model for bioremediation studies. The steady-state kinetic parameters for oxidation of aliphatic or aromatic aldehydes catalyzed by 6xHis-NahF are presented. The 6xHis-NahF catalyzes the oxidation of aromatic aldehydes with large kcat/Km values close to 10(6) M(-1) s(-1). The active site of NahF is highly hydrophobic, and the enzyme shows higher specificity for less polar substrates than for polar substrates, e.g., acetaldehyde. The enzyme shows α/β folding with three well-defined domains: the oligomerization domain, which is responsible for the interlacement between the two monomers; the Rossmann-like fold domain, essential for nucleotide binding; and the catalytic domain. A salicylaldehyde molecule was observed in a deep pocket in the crystal structure of NahF where the catalytic C284 and E250 are present. Moreover, the residues G150, R157, W96, F99, F274, F279, and Y446 were thought to be important for catalysis and specificity for aromatic aldehydes. Understanding the molecular features responsible for NahF activity allows for comparisons with other aldehyde dehydrogenases and, together with structural information, provides the information needed for future mutational studies aimed to enhance its stability and specificity and further its use in biotechnological processes.
A Flexible Frame Structure for 5G Wide Area
DEFF Research Database (Denmark)
Pedersen, Klaus I.; Frederiksen, Frank; Berardinelli, Gilberto
2015-01-01
In this paper we present a 5G frame structure designed for efficient support of users with highly diverse service requirements, including mobile broadband (MBB) data, mission critical communication (MCC), and massive machine communication (MMC). The proposed solution encompasses flexible multiple...... transmission, as well as efficient time-frequency inter-cell interference coordination. Numerical results are presented, including simple comparison against LTE....
Filippova, Ekaterina V; Weigand, Steven; Osipiuk, Jerzy; Kiryukhina, Olga; Joachimiak, Andrzej; Anderson, Wayne F
2015-11-06
The spermidine N-acetyltransferase SpeG is a dodecameric enzyme that catalyzes the transfer of an acetyl group from acetyl coenzyme A to polyamines such as spermidine and spermine. SpeG has an allosteric polyamine-binding site and acetylating polyamines regulate their intracellular concentrations. The structures of SpeG from Vibrio cholerae in complexes with polyamines and cofactor have been characterized earlier. Here, we present the dodecameric structure of SpeG from V. cholerae in a ligand-free form in three different conformational states: open, intermediate and closed. All structures were crystallized in C2 space group symmetry and contain six monomers in the asymmetric unit cell. Two hexamers related by crystallographic 2-fold symmetry form the SpeG dodecamer. The open and intermediate states have a unique open dodecameric ring. This SpeG dodecamer is asymmetric except for the one 2-fold axis and is unlike any known dodecameric structure. Using a fluorescence thermal shift assay, size-exclusion chromatography with multi-angle light scattering, small-angle X-ray scattering analysis, negative-stain electron microscopy and structural analysis, we demonstrate that this unique open dodecameric state exists in solution. Our combined results indicate that polyamines trigger conformational changes and induce the symmetric closed dodecameric state of the protein when they bind to their allosteric sites. Copyright © 2015. Published by Elsevier Ltd.
Norris, C R; Byerly, J R; Decile, K C; Berghaus, R D; Walby, W F; Schelegle, E S; Hyde, D M; Gershwin, L J
2003-12-15
Allergic asthma, a Th2 cell driven response to inhaled allergens, has classically been thought of as predominantly mediated by IgE antibodies. To investigate the role of other immunoglobulin classes (e.g., IgG and IgA) in the immunopathogenesis of allergic asthma, levels of these allergen-specific immunoglobulins were measured in serum and mucosal fluids. Bermuda grass allergen (BGA)-specific IgG and IgA ELISAs in serum and bronchoalveolar lavage fluid (BALF) were developed and optimized in an experimental model of BGA-induced feline asthma. Levels of BGA-specific IgG and IgA significantly increased over time in serum and BALF after allergen sensitization. Additionally, these elevated levels of BGA-specific IgG and IgA were seen in conjunction with the development of an asthmatic phenotype indicated by positive intradermal skin tests, enhanced airways hyperreactivity, and increased eosinophil percentages in the BALF.
Avnir, Yuval; Prachanronarong, Kristina L; Zhang, Zhen; Hou, Shurong; Peterson, Eric C; Sui, Jianhua; Zayed, Hatem; Kurella, Vinodh B; McGuire, Andrew T; Stamatatos, Leonidas; Hilbert, Brendan J; Bohn, Markus-Frederik; Kowalik, Timothy F; Jensen, Jeffrey D; Finberg, Robert W; Wang, Jennifer P; Goodall, Margaret; Jefferis, Roy; Zhu, Quan; Kurt Yilmaz, Nese; Schiffer, Celia A; Marasco, Wayne A
2017-12-12
The heavy chain IGHV1-69 germline gene exhibits a high level of polymorphism and shows biased use in protective antibody (Ab) responses to infections and vaccines. It is also highly expressed in several B cell malignancies and autoimmune diseases. G6 is an anti-idiotypic monoclonal Ab that selectively binds to IGHV1-69 heavy chain germline gene 51p1 alleles that have been implicated in these Ab responses and disease processes. Here, we determine the co-crystal structure of humanized G6 (hG6.3) in complex with anti-influenza hemagglutinin stem-directed broadly neutralizing Ab D80. The core of the hG6.3 idiotope is a continuous string of CDR-H2 residues starting with M53 and ending with N58. G6 binding studies demonstrate the remarkable breadth of binding to 51p1 IGHV1-69 Abs with diverse CDR-H3, light chain, and antigen binding specificities. These studies detail the broad expression of the G6 cross-reactive idiotype (CRI) that further define its potential role in precision medicine. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuval Avnir
2017-12-01
Full Text Available The heavy chain IGHV1-69 germline gene exhibits a high level of polymorphism and shows biased use in protective antibody (Ab responses to infections and vaccines. It is also highly expressed in several B cell malignancies and autoimmune diseases. G6 is an anti-idiotypic monoclonal Ab that selectively binds to IGHV1-69 heavy chain germline gene 51p1 alleles that have been implicated in these Ab responses and disease processes. Here, we determine the co-crystal structure of humanized G6 (hG6.3 in complex with anti-influenza hemagglutinin stem-directed broadly neutralizing Ab D80. The core of the hG6.3 idiotope is a continuous string of CDR-H2 residues starting with M53 and ending with N58. G6 binding studies demonstrate the remarkable breadth of binding to 51p1 IGHV1-69 Abs with diverse CDR-H3, light chain, and antigen binding specificities. These studies detail the broad expression of the G6 cross-reactive idiotype (CRI that further define its potential role in precision medicine.
Light-stimulated cargo release from a core–shell structured nanocomposite for site-specific delivery
International Nuclear Information System (INIS)
Cai, Yun; Ling, Li; Li, Xiaofang; Chen, Meng; Su, Likai
2015-01-01
This paper reported a core–shell structured site-specific delivery system with a light switch triggered by low energy light (λ=510 nm). Its core was composed of supermagnetic Fe 3 O 4 nanoparticles for magnetic guiding and targeting. Its outer shell consisted of mesoporous silica molecular sieve MCM-41 which offered highly ordered hexagonal tunnels for cargo capacity. A light switch N1-(4aH-cyclopenta[1,2-b:5,4-b′]dipyridin-5(5aH)-ylidene)benzene-1, 4-diamine (CBD) was covalently grafted into these hexagonal tunnels, serving as light stimuli acceptor with loading content of 1.1 μM/g. This composite was fully characterized and confirmed by SEM, TEM, XRD patterns, N 2 adsorption/desorption, thermogravimetric analysis, IR, UV–vis absorption and emission spectra. Experimental data suggested that this composite had a core as wide as 150 nm and could be magnetically guided to specific sites. Its hexagonal tunnels were as long as 180 nm. Upon light stimuli of “on” and “off” states, controllable release was observed with short release time of ~900 s (90% capacity). - Graphical abstract: A core–shell structured site-specific delivery system with a light switch triggered by yellow light was constructed. Controllable release was observed with short release time of ~900 s (90% capacity). - Highlights: • A core–shell structured site-specific delivery system was constructed. • It consisted of Fe 3 O 4 core and MCM-41 shell grafted with light switch. • This delivery system was triggered by low energy light. • Controllable release was observed with short release time of ~900 s
Light-stimulated cargo release from a core–shell structured nanocomposite for site-specific delivery
Energy Technology Data Exchange (ETDEWEB)
Cai, Yun; Ling, Li; Li, Xiaofang [Department of Neurology, Affiliated Hospital of Hebei University, Baoding 071000 (China); Chen, Meng [Department of Rheumatology, Affiliated Hospital of Hebei University, Baoding 071000 (China); Su, Likai, E-mail: zhangdong19992003@163.com [Department of Neurology, Affiliated Hospital of Hebei University, Baoding 071000 (China)
2015-03-15
This paper reported a core–shell structured site-specific delivery system with a light switch triggered by low energy light (λ=510 nm). Its core was composed of supermagnetic Fe{sub 3}O{sub 4} nanoparticles for magnetic guiding and targeting. Its outer shell consisted of mesoporous silica molecular sieve MCM-41 which offered highly ordered hexagonal tunnels for cargo capacity. A light switch N1-(4aH-cyclopenta[1,2-b:5,4-b′]dipyridin-5(5aH)-ylidene)benzene-1, 4-diamine (CBD) was covalently grafted into these hexagonal tunnels, serving as light stimuli acceptor with loading content of 1.1 μM/g. This composite was fully characterized and confirmed by SEM, TEM, XRD patterns, N{sub 2} adsorption/desorption, thermogravimetric analysis, IR, UV–vis absorption and emission spectra. Experimental data suggested that this composite had a core as wide as 150 nm and could be magnetically guided to specific sites. Its hexagonal tunnels were as long as 180 nm. Upon light stimuli of “on” and “off” states, controllable release was observed with short release time of ~900 s (90% capacity). - Graphical abstract: A core–shell structured site-specific delivery system with a light switch triggered by yellow light was constructed. Controllable release was observed with short release time of ~900 s (90% capacity). - Highlights: • A core–shell structured site-specific delivery system was constructed. • It consisted of Fe{sub 3}O{sub 4} core and MCM-41 shell grafted with light switch. • This delivery system was triggered by low energy light. • Controllable release was observed with short release time of ~900 s.
Energy Technology Data Exchange (ETDEWEB)
Hamilton, R G [Johns Hopkins Univ., Baltimore, MD (USA). Dept. of Medicine; Hussain, R; Ottesen, E A [National Inst. of Allergy and Infectious Diseases, Bethesda, MD (USA); Adkinson, Jr, N F [Johns Hopkins Univ., Baltimore, MD (USA). School of Medicine
1981-07-17
The authors have developed a non-competitive solid-phase radioimmunoassay (SPRIA) to quantitate both human IgE and IgG antibodies against soluble adult antigens of Brugia malayi (B.m.), a filarial parasite causing extensive infection throughout the tropics. Previously enzyme-linked immunosorbent assays (ELISA) had been used to detect ..mu..g/ml levels of IgG anti-B.m., but IgE antibodies were difficult to detect in this system. Since the SPRIA successfully quantitates both IgG and IgE anti-B.m., they sought to examine the reasons for the SPRIA's apparent superiority in detecting IgE anti-B.m. by extracting specific IgG from sera with high levels of IgE and IgG anti-B.m. antibodies. IgE anti-B.m. was then quantitated in these sera using both the SPRIA and ELISA methods. Results indicate that IgG anti-B.m. does not interfere with detection of specific IgE antibody in the SPRIA but does interfere in the ELISA. While ELISA permits detection of IgE anti-B.m. in the absence of competing IgG anti-B.m., as levels of specific IgG increase, the IgE is no longer detectable. These differences between SPRIA and ELISA can be explained by the SPRIA's antigen excess conditions which assure that there are sufficient antigens both to detect all anti-B.m. antibodies present in the serum and to adequately represent all antigen specificities in the crude B.m. extract. Their findings commend the use of SPRIA methods over ELISA in assessment of B.m.-specific IgE antibody in filariasis and indicate a potential role for SPRIA methods in absolute quantitation of specific serum antibodies.
Hui, James Z; Tsourkas, Andrew
2014-09-17
Antibody conjugates have been used in a variety of applications from immunoassays to drug conjugates. However, it is becoming increasingly clear that in order to maximize an antibody's antigen binding ability and to produce homogeneous antibody-conjugates, the conjugated molecule should be attached onto IgG site-specifically. We previously developed a facile method for the site-specific modification of full length, native IgGs by engineering a recombinant Protein Z that forms a covalent link to the Fc domain of IgG upon exposure to long wavelength UV light. To further improve the efficiency of Protein Z production and IgG conjugation, we constructed a panel of 13 different Protein Z variants with the UV-active amino acid benzoylphenylalanine (BPA) in different locations. By using this panel of Protein Z to cross-link a range of IgGs from different hosts, including human, mouse, and rat, we discovered two previously unknown Protein Z variants, L17BPA and K35BPA, that are capable of cross-linking many commonly used IgG isotypes with efficiencies ranging from 60% to 95% after only 1 h of UV exposure. When compared to existing site-specific methods, which often require cloning or enzymatic reactions, the Protein Z-based method described here, utilizing the L17BPA, K35BPA, and the previously described Q32BPA variants, represents a vastly more accessible and efficient approach that is compatible with nearly all native IgGs, thus making site-specific conjugation more accessible to the general research community.
The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
Czworkowski, J; Wang, J; Steitz, T A; Moore, P B
1994-01-01
Elongation factor G (EF-G) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, EF-Tu--whose structure is already known--it is a member of the GTPase superfamily. We have determined the crystal structure of EF-G--GDP from Thermus thermophilus. It is an elongated molecule whose large, N-terminal domain resembles the G domain of EF-Tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in E...
DiGiacomo, Vincent; Marivin, Arthur; Garcia-Marcos, Mikel
2018-01-23
Heterotrimeric G proteins are signal-transducing switches conserved across eukaryotes. In humans, they work as critical mediators of intercellular communication in the context of virtually any physiological process. While G protein regulation by G protein-coupled receptors (GPCRs) is well-established and has received much attention, it has become recently evident that heterotrimeric G proteins can also be activated by cytoplasmic proteins. However, this alternative mechanism of G protein regulation remains far less studied than GPCR-mediated signaling. This Viewpoint focuses on recent advances in the characterization of a group of nonreceptor proteins that contain a sequence dubbed the "Gα-binding and -activating (GBA) motif". So far, four proteins present in mammals [GIV (also known as Girdin), DAPLE, CALNUC, and NUCB2] and one protein in Caenorhabditis elegans (GBAS-1) have been described as possessing a functional GBA motif. The GBA motif confers guanine nucleotide exchange factor activity on Gαi subunits in vitro and activates G protein signaling in cells. The importance of this mechanism of signal transduction is highlighted by the fact that its dysregulation underlies human diseases, such as cancer, which has made the proteins attractive new candidates for therapeutic intervention. Here we discuss recent discoveries on the structural basis of GBA-mediated activation of G proteins and its evolutionary conservation and compare them with the better-studied mechanism mediated by GPCRs.
Crystal Structure of a Lipid G Protein-Coupled Receptor
Energy Technology Data Exchange (ETDEWEB)
Hanson, Michael A; Roth, Christopher B; Jo, Euijung; Griffith, Mark T; Scott, Fiona L; Reinhart, Greg; Desale, Hans; Clemons, Bryan; Cahalan, Stuart M; Schuerer, Stephan C; Sanna, M Germana; Han, Gye Won; Kuhn, Peter; Rosen, Hugh; Stevens, Raymond C [Scripps; (Receptos)
2012-03-01
The lyso-phospholipid sphingosine 1-phosphate modulates lymphocyte trafficking, endothelial development and integrity, heart rate, and vascular tone and maturation by activating G protein-coupled sphingosine 1-phosphate receptors. Here, we present the crystal structure of the sphingosine 1-phosphate receptor 1 fused to T4-lysozyme (S1P1-T4L) in complex with an antagonist sphingolipid mimic. Extracellular access to the binding pocket is occluded by the amino terminus and extracellular loops of the receptor. Access is gained by ligands entering laterally between helices I and VII within the transmembrane region of the receptor. This structure, along with mutagenesis, agonist structure-activity relationship data, and modeling, provides a detailed view of the molecular recognition and requirement for hydrophobic volume that activates S1P1, resulting in the modulation of immune and stromal cell responses.
Equilibrious Strand Exchange Promoted by DNA Conformational Switching
Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang
2013-01-01
Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.
Environmental effects on the structure of the G-matrix.
Wood, Corlett W; Brodie, Edmund D
2015-11-01
Genetic correlations between traits determine the multivariate response to selection in the short term, and thereby play a causal role in evolutionary change. Although individual studies have documented environmentally induced changes in genetic correlations, the nature and extent of environmental effects on multivariate genetic architecture across species and environments remain largely uncharacterized. We reviewed the literature for estimates of the genetic variance-covariance (G) matrix in multiple environments, and compared differences in G between environments to the divergence in G between conspecific populations (measured in a common garden). We found that the predicted evolutionary trajectory differed as strongly between environments as it did between populations. Between-environment differences in the underlying structure of G (total genetic variance and the relative magnitude and orientation of genetic correlations) were equal to or greater than between-population differences. Neither environmental novelty, nor the difference in mean phenotype predicted these differences in G. Our results suggest that environmental effects on multivariate genetic architecture may be comparable to the divergence that accumulates over dozens or hundreds of generations between populations. We outline avenues of future research to address the limitations of existing data and characterize the extent to which lability in genetic correlations shapes evolution in changing environments. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.
Ogawa, Seiji; Watanabe, Toshihide; Moriyuki, Kazumi; Goto, Yoshikazu; Yamane, Shinsaku; Watanabe, Akio; Tsuboi, Kazuma; Kinoshita, Atsushi; Okada, Takuya; Takeda, Hiroyuki; Tani, Kousuke; Maruyama, Toru
2016-05-15
The modification of the novel G protein-biased EP2 agonist 1 has been investigated to improve its G protein activity and develop a better understanding of its structure-functional selectivity relationship (SFSR). The optimization of the substituents on the phenyl ring of 1, followed by the inversion of the hydroxyl group on the cyclopentane moiety led to compound 9, which showed a 100-fold increase in its G protein activity compared with 1 without any increase in β-arrestin recruitment. Furthermore, SFSR studies revealed that the combination of meta and para substituents on the phenyl moiety was crucial to the functional selectivity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Emmerich, Petra; Mika, Angela; von Possel, Ronald; Rackow, Anne; Liu, Yang; Schmitz, Herbert; Sherifi, Kurtesh; Halili, Barie; Jakupi, Xhevat; Berisha, Lindita; Ahmeti, Salih
2018-01-01
As the most widespread tick-borne arbovirus causing infections in numerous countries in Asia, Africa and Europe, Crimean-Congo Hemorrhagic Fever Virus (CCHFV, family Nairoviridae) was included in the WHO priority list of emerging pathogens needing urgent Research & Development attention. To ensure preparedness for potential future outbreak scenarios, reliable diagnostic tools for identification of acute cases as well as for performance of seroprevalence studies are necessary. Here, the CCHFV ortholog of the major bunyavirus antigen, the nucleoprotein (NP), was recombinantly expressed in E.coli, purified and directly labeled with horseradish peroxidase (HRP). Employing this antigen, two serological tests, a μ-capture ELISA for the detection of CCHFV-specific IgM antibodies (BLACKBOX CCHFV IgM) and an IgG immune complex (IC) ELISA for the detection of CCHFV-specific IgG antibodies (BLACKBOX CCHFV IgG), were developed. Test performance was evaluated and compared with both in-house gold standard testing by IgM/IgG indirect immunofluorescence (IIF) and commercially available ELISA tests (VectoCrimean-CHF-IgM/IgG, Vector-Best, Russia) using a serum panel comprising paired samples collected in Kosovo during the years 2013–2016 from 15 patients with an acute, RT-PCR-confirmed CCHFV infection, and 12 follow-up sera of the same patients collected approximately one year after having overcome the infection. Reliably detecting IgM antibodies in all acute phase sera collected later than day 4 after onset of symptoms, both IgM ELISAs displayed excellent diagnostic and analytical sensitivity (100%, 95% confidence interval (CI): 85.2%–100.0%). While both IgG ELISAs readily detected the high IgG titers present in convalescent patients approximately one year after having overcome the infection (sensitivity 100%, 95% CI: 73.5%–100.0%), the newly developed BLACKBOX CCHFV IgG ELISA was superior to the commercial IgG ELISA in detecting the rising IgG titers during the acute phase
Smits, Henk L.; Abdoel, Theresia H.; Solera, Javier; Clavijo, Encarnacion; Diaz, Ramon
2003-01-01
To fulfill the need for a simple and rapid diagnostic test for human brucellosis, we used the immunochromatographic lateral flow assay format to develop two assays, one for the detection of Brucella-specific immunoglobulin M (IgM) antibodies and one for the detection of Brucella-specific IgG
Directory of Open Access Journals (Sweden)
Lisandra Akemi Suzuki
2013-01-01
Full Text Available In the present study, an enzyme-linked immunosorbent assay (ELISA standardized with vesicular fluid of Taenia solium cysticerci was used to screen for IgG (total and subclasses and IgE antibodies in cerebrospinal fluid (CSF samples from patients with neurocysticercosis showing intrathecal production of specific IgG antibodies and patients with other neurological disorders. The following results were obtained: IgG-ELISA: 100% sensitivity (median of the ELISA absorbances (MEA=1.17 and 100% specificity; IgG1-ELISA: 72.7% sensitivity (MEA=0.49 and 100% specificity; IgG2-ELISA: 81.8% sensitivity (MEA=0.46 and 100% specificity; IgG3-ELISA: 63.6% sensitivity (MEA=0.12 and 100% specificity; IgG4-ELISA: 90.9% sensitivity (MEA=0.85 and 100% specificity; IgE-ELISA 93.8% sensitivity (MEA=0.60 and 100% specificity. There were no significant differences between the sensitivities and specificities in the detection of IgG-ELISA and IgE-ELISA, although in CSF samples from patients with neurocysticercosis the MEA of the IgG-ELISA was significantly higher than that of the IgE-ELISA. The sensitivity and MEA values of the IgG4-ELISA were higher than the corresponding values for the other IgG subclasses. Future studies should address the contribution of IgG4 and IgE antibodies to the physiopathology of neurocysticercosis.No presente estudo, uma reação imunoenzimática (ELISA padronizada com o fluido vesicular de cisticercos de Taenia solium foi utilizada para avaliar as respostas de anticorpos anti-cisticercos IgG (total e subclasses e IgE em amostras de líquido cefalorraquidiano (LCR de pacientes com neurocisticercose apresentando produção intratecal de anticorpos específicos IgG e pacientes com outras desordens neurológicas. Os seguintes resultados foram obtidos: ELISA-IgG: 100% de sensibilidade (mediana das absorbâncias das reações ELISA (MAE=1,17 e especificidade 100%; ELISA-IgG1: sensibilidade 72,7% (MAE=0,49 e especificidade 100%; ELISA-IgG2
Energy Technology Data Exchange (ETDEWEB)
Hao, Ruirui [Hubei Key Laboratory of Pollutant Analysis and Reuse Technology, Institute for Advanced Materials, College of Chemistry and Chemical Engineering, Hubei Normal University, Huangshi 435002 (China); Wang, Guohong, E-mail: wanggh2003@163.com [Hubei Key Laboratory of Pollutant Analysis and Reuse Technology, Institute for Advanced Materials, College of Chemistry and Chemical Engineering, Hubei Normal University, Huangshi 435002 (China); Jiang, Chuanjia [State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Luoshi Road 122, Wuhan, 430070 (China); Tang, Hua [School of Materials Science and Engineering, Jiangsu University, Zhenjiang, 212013 (China); Xu, Qingchuan [Hubei Key Laboratory of Pollutant Analysis and Reuse Technology, Institute for Advanced Materials, College of Chemistry and Chemical Engineering, Hubei Normal University, Huangshi 435002 (China)
2017-07-31
Highlights: • High surface area g-C{sub 3}N4/TiO{sub 2} is obtained by combined hydrothermal-calcination method. • HCl formation from Ti precursor changed the structural properties of the composite. • Composite exhibited visible light photocatalytic performance for RhB degradation. • A 3 g of melamine for 0.5 mL TiCl{sub 4} was found to be the optimum content. - Abstract: Semiconductor-based photocatalysis is a promising method for degradation of environmental pollutants, but the activity of most widely used photocatalysts such as titania (TiO{sub 2}) is still unsatisfactory under visible light. Herein, we synthesized a highly efficient visible-light-responsive heterojunction catalysts based on graphitic carbon nitride (g-C{sub 3}N{sub 4}) and TiO{sub 2}. The g-C{sub 3}N{sub 4}/TiO{sub 2} heterojunction composites with high specific surface area were prepared via in situ hydrothermal synthesis followed by calcination, using titanium tetrachloride (TiCl{sub 4}) and melamine as precursors. Interesting, HCl from the hydrolysis of TiCl{sub 4} served as the proton source to acidify the melamine. The g-C{sub 3}N{sub 4}/TiO{sub 2} heterojunction composites exhibited higher photocatalytic performance for decomposition of Rhodamine B (RhB) than pure g-C{sub 3}N{sub 4} or TiO{sub 2} under visible light irradiation. The high activity can be ascribed to the high specific surface area (up to 115.6 m{sup 2} g{sup −1}) of the g-C{sub 3}N{sub 4}/TiO{sub 2} composites and a synergistic heterojunction structure between TiO{sub 2} and g-C{sub 3}N{sub 4}. Moreover, the photocatalytic performances of the g-C{sub 3}N{sub 4}/TiO{sub 2} composites rely on the content of melamine in the synthesis precursors: with an optimum melamine content (3 g for 0.5 mL of TiCl{sub 4}), the sample showed the highest photocatalytic performance, which is superior to pure TiO{sub 2} and g-C{sub 3}N{sub 4} by a factor of 18.7 and 3.5, respectively. Active species trapping experiments revealed that
G{sub 2}-structures and quantization of non-geometric M-theory backgrounds
Energy Technology Data Exchange (ETDEWEB)
Kupriyanov, Vladislav G. [Centro de Matemática, Computação e Cognição, Universidade de Federal do ABC,Santo André, SP (Brazil); Tomsk State University,Tomsk (Russian Federation); Szabo, Richard J. [Department of Mathematics, Heriot-Watt University,Colin Maclaurin Building, Riccarton, Edinburgh EH14 4AS (United Kingdom); Maxwell Institute for Mathematical Sciences,Edinburgh (United Kingdom); The Higgs Centre for Theoretical Physics,Edinburgh (United Kingdom)
2017-02-20
We describe the quantization of a four-dimensional locally non-geometric M-theory background dual to a twisted three-torus by deriving a phase space star product for deformation quantization of quasi-Poisson brackets related to the nonassociative algebra of octonions. The construction is based on a choice of G{sub 2}-structure which defines a nonassociative deformation of the addition law on the seven-dimensional vector space of Fourier momenta. We demonstrate explicitly that this star product reduces to that of the three-dimensional parabolic constant R-flux model in the contraction of M-theory to string theory, and use it to derive quantum phase space uncertainty relations as well as triproducts for the nonassociative geometry of the four-dimensional configuration space. By extending the G{sub 2}-structure to a Spin(7)-structure, we propose a 3-algebra structure on the full eight-dimensional M2-brane phase space which reduces to the quasi-Poisson algebra after imposing a particular gauge constraint, and whose deformation quantisation simultaneously encompasses both the phase space star products and the configuration space triproducts. We demonstrate how these structures naturally fit in with previous occurences of 3-algebras in M-theory.
A Precision Measurement of the Spin Structure Function G(2)(P)
Energy Technology Data Exchange (ETDEWEB)
Benmouna, N
2004-01-05
The spin structure function g{sub 2}(x,Q{sup 2}) and the virtual photon asymmetry A{sub 2}(x,Q{sup 2}) were measured for the proton using deep inelastic scattering. The experiment was conducted at the Stanford Linear Accelerator Center (SLAC), where longitudinally polarized electrons at 29.1 and 32.3 GeV were scattered from a transversely polarized NH{sub 3} target. Large data sets were accumulated using three independent spectrometers covering a kinematic range 0.02 {le} x {le} 0.8 and 1 {le} Q{sup 2} {le} 20 (GeV/c){sup 2}. This new data is the first data precise enough to distinguish between current models for the proton. The structure function g{sub 2}{sup p} was found to be reasonably consistent with the twist-2 Wandzura-Wilczek calculation. The Q{sup 2} dependence of g{sub 2} approximately follows the Q{sup 2} dependence of g{sub 2}{sup WW}, although the data are not precise enough to rule out no Q{sup 2} dependence. The absolute value for A{sub 2}{sup p} was found to be significantly smaller than the Soffer limit over the measured range. The virtual photon asymmetry A{sub 2} was also found to be inconsistent with zero over much of the measured range.
Wu, Hong-Zhang; Zhong, Qing-Hua; Bandaru, Sateesh; Liu, Jin; Lau, Woon Ming; Li, Li-Li; Wang, Zhenling
2018-04-18
The optical properties and condensation degree (structure) of polymeric g-C 3 N 4 depend strongly on the process temperature. For polymeric g-C 3 N 4 , its structure and condensation degree depend on the structure of molecular strand(s). Here, the formation and electronic structure properties of the g-C 3 N 4 nanoribbon are investigated by studying the polymerization and crystallinity of molecular strand(s) employing first-principle density functional theory. The calculations show that the width of the molecular strand has a significant effect on the electronic structure of polymerized and crystallized g-C 3 N 4 nanoribbons, a conclusion which would be indirect evidence that the electronic structure depends on the structure of g-C 3 N 4 . The edge shape also has a distinct effect on the electronic structure of the crystallized g-C 3 N 4 nanoribbon. Furthermore, the conductive band minimum and valence band maximum of the polymeric g-C 3 N 4 nanoribbon show a strong localization, which is in good agreement with the quasi-monomer characters. In addition, molecular strands prefer to grow along the planar direction on graphene. These results provide new insight on the properties of the g-C 3 N 4 nanoribbon and the relationship between the structure and properties of g-C 3 N 4 .
Hyperfine structure in 229gTh3+ as a probe of the 229gTh→ 229mTh nuclear excitation energy.
Beloy, K
2014-02-14
We identify a potential means to extract the 229gTh→ 229mTh nuclear excitation energy from precision microwave spectroscopy of the 5F(5/2,7/2) hyperfine manifolds in the ion 229gTh3+. The hyperfine interaction mixes this ground fine structure doublet with states of the nuclear isomer, introducing small but observable shifts to the hyperfine sublevels. We demonstrate how accurate atomic structure calculations may be combined with the measurement of the hyperfine intervals to quantify the effects of this mixing. Further knowledge of the magnetic dipole decay rate of the isomer, as recently reported, allows an indirect determination of the nuclear excitation energy.
Sensory memory of structure-from-motion is shape-specific.
Pastukhov, Alexander; Füllekrug, Jana; Braun, Jochen
2013-08-01
Perceptual priming can stabilize the phenomenal appearance of multistable visual displays (Leopold, Wilke, Maier, & Logothetis, Nature Neuroscience, 5, 605-609, 2002). Prior exposure to such displays induces a sensory memory of their appearance, which persists over long intervals and intervening stimulation, and which facilitates renewed perception of the same appearance. Here, we investigated perceptual priming for the apparent rotation in depth of ambiguous structure-from-motion (SFM) displays. Specifically, we generated SFM objects with different three-dimensional shapes and presented them in random order and with intervening blank periods. To assess perceptual priming, we established the probability that a perceived direction of rotation would persist between successive objects. In general, persistence was greatest between identical objects, intermediate between similar objects, and negligible between dissimilar objects. These results demonstrate unequivocally that sensory memory for apparent rotation is specific to three-dimensional shape, contrary to previous reports (e.g., Maier, Wilke, Logothetis, & Leopold, Current Biology, 13, 1076-1085, 2003). Because persistence did not depend on presentation order for any pair of objects, it provides a commutative measure for the similarity of object shapes. However, it is not clear exactly which features or aspects of object shape determine similarity. At least, we did not find simple, low-level features (such as volume overlap, heterogeneity, or rotational symmetry) that could have accounted for all observations. Accordingly, it seems that sensory memory of SFM (which underlies priming of ambiguous rotation) engages higher-level representations of object surface and shape.
Mechanism for G2 phase-specific nuclear export of the kinetochore protein CENP-F.
Loftus, Kyle M; Cui, Heying; Coutavas, Elias; King, David S; Ceravolo, Amanda; Pereiras, Dylan; Solmaz, Sozanne R
2017-08-03
Centromere protein F (CENP-F) is a component of the kinetochore and a regulator of cell cycle progression. CENP-F recruits the dynein transport machinery and orchestrates several cell cycle-specific transport events, including transport of the nucleus, mitochondria and chromosomes. A key regulatory step for several of these functions is likely the G2 phase-specific export of CENP-F from the nucleus to the cytosol, where the cytoplasmic dynein transport machinery resides; however, the molecular mechanism of this process is elusive. Here, we have identified 3 phosphorylation sites within the bipartite classical nuclear localization signal (cNLS) of CENP-F. These sites are specific for cyclin-dependent kinase 1 (Cdk1), which is active in G2 phase. Phosphomimetic mutations of these residues strongly diminish the interaction of the CENP-F cNLS with its nuclear transport receptor karyopherin α. These mutations also diminish nuclear localization of the CENP-F cNLS in cells. Notably, the cNLS is phosphorylated in the -1 position, which is important to orient the adjacent major motif for binding into its pocket on karyopherin α. We propose that localization of CENP-F is regulated by a cNLS, and a nuclear export pathway, resulting in nuclear localization during most of interphase. In G2 phase, the cNLS is weakened by phosphorylation through Cdk1, likely resulting in nuclear export of CENP-F via the still active nuclear export pathway. Once CENP-F resides in the cytosol, it can engage in pathways that are important for cell cycle progression, kinetochore assembly and the faithful segregation of chromosomes into daughter cells.
International Nuclear Information System (INIS)
Hamilton, R.G.; Adkinson, N.F. Jr.
1981-01-01
The authors have developed a non-competitive solid-phase radioimmunoassay (SPRIA) to quantitate both human IgE and IgG antibodies against soluble adult antigens of Brugia malayi (B.m.), a filarial parasite causing extensive infection throughout the tropics. Previously enzyme-linked immunosorbent assays (ELISA) had been used to detect μg/ml levels of IgG anti-B.m., but IgE antibodies were difficult to detect in this system. Since the SPRIA successfully quantitates both IgG and IgE anti-B.m., they sought to examine the reasons for the SPRIA's apparent superiority in detecting IgE anti-B.m. by extracting specific IgG from sera with high levels of IgE and IgG anti-B.m. antibodies. IgE anti-B.m. was then quantitated in these sera using both the SPRIA and ELISA methods. Results indicate that IgG anti-B.m. does not interfere with detection of specific IgE antibody in the SPRIA but does interfere in the ELISA. While ELISA permits detection of IgE anti-B.m. in the absence of competing IgG anti-B.m., as levels of specific IgG increase, the IgE is no longer detectable. These differences between SPRIA and ELISA can be explained by the SPRIA's antigen excess conditions which assure that there are sufficient antigens both to detect all anti-B.m. antibodies present in the serum and to adequately represent all antigen specificities in the crude B.m. extract. Their findings commend the use of SPRIA methods over ELISA in assessment of B.m.-specific IgE antibody in filariasis and indicate a potential role for SPRIA methods in absolute quantitation of specific serum antibodies. (Auth.)
G2-structures for N = 1 supersymmetric AdS4 solutions of M-theory
Grigorian, Sergey
2018-04-01
We study the N = 1 supersymmetric solutions of D = 11 supergravity obtained as a warped product of four-dimensional anti-de Sitter space with a seven-dimensional Riemannian manifold M. Using the octonion bundle structure on M we reformulate the Killing spinor equations in terms of sections of the octonion bundle on M. The solutions then define a single complexified G 2-structure on M or equivalently two real G 2-structures. We then study the torsion of these G 2-structures and the relationships between them.
Interleukin-11 binds specific EF-hand proteins via their conserved structural motifs.
Kazakov, Alexei S; Sokolov, Andrei S; Vologzhannikova, Alisa A; Permyakova, Maria E; Khorn, Polina A; Ismailov, Ramis G; Denessiouk, Konstantin A; Denesyuk, Alexander I; Rastrygina, Victoria A; Baksheeva, Viktoriia E; Zernii, Evgeni Yu; Zinchenko, Dmitry V; Glazatov, Vladimir V; Uversky, Vladimir N; Mirzabekov, Tajib A; Permyakov, Eugene A; Permyakov, Sergei E
2017-01-01
Interleukin-11 (IL-11) is a hematopoietic cytokine engaged in numerous biological processes and validated as a target for treatment of various cancers. IL-11 contains intrinsically disordered regions that might recognize multiple targets. Recently we found that aside from IL-11RA and gp130 receptors, IL-11 interacts with calcium sensor protein S100P. Strict calcium dependence of this interaction suggests a possibility of IL-11 interaction with other calcium sensor proteins. Here we probed specificity of IL-11 to calcium-binding proteins of various types: calcium sensors of the EF-hand family (calmodulin, S100B and neuronal calcium sensors: recoverin, NCS-1, GCAP-1, GCAP-2), calcium buffers of the EF-hand family (S100G, oncomodulin), and a non-EF-hand calcium buffer (α-lactalbumin). A specific subset of the calcium sensor proteins (calmodulin, S100B, NCS-1, GCAP-1/2) exhibits metal-dependent binding of IL-11 with dissociation constants of 1-19 μM. These proteins share several amino acid residues belonging to conservative structural motifs of the EF-hand proteins, 'black' and 'gray' clusters. Replacements of the respective S100P residues by alanine drastically decrease its affinity to IL-11, suggesting their involvement into the association process. Secondary structure and accessibility of the hinge region of the EF-hand proteins studied are predicted to control specificity and selectivity of their binding to IL-11. The IL-11 interaction with the EF-hand proteins is expected to occur under numerous pathological conditions, accompanied by disintegration of plasma membrane and efflux of cellular components into the extracellular milieu.
Energy Technology Data Exchange (ETDEWEB)
Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J. (Medical School, Manchester (United Kingdom). Department of Medical microbiology, Virology Unit); Morell, G. (Regional Blood Transfusion Centre, manchester (United Kingdom))
1990-03-01
An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 (human cytomegalovirus (CMV)) has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab.
Macfarlane, D E; Manzel, L
1998-02-01
Phosphorothioate oligodeoxynucleotides containing CpG (CpG-ODN) activate immune responses. We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231. They also inhibit IL-6 synthesis and thymidine uptake by human unfractionated PBMC induced by CpG-ODN. The compounds did not inhibit LPS-induced responses. Half-maximal inhibition required 10 nM quinacrine or 100 nM chloroquine. Inhibition was noncompetitive with respect to CpG-ODN. Quinine, quinidine, and primaquine were much less powerful. Quinacrine was effective even when added after the CpG-ODN. Near-toxic concentrations of ammonia plus bafilomycin A1 (used to inhibit vesicular acidification) did not reduce the efficacy of the quinacrine, but the effects of both quinacrine and chloroquine were enhanced by inhibition of the multidrug resistance efflux pump by verapamil. Agents that bind to DNA, including propidium iodide, Hoechst dye 33258, and coralyne chloride did not inhibit CpG-ODN effect, nor did 4-bromophenacyl bromide, an inhibitor of phospholipase A2. Examination of the structure-activity relationship of seventy 4-aminoquinoline and 9-aminoacridine analogues reveals that increased activity was conferred by bulky hydrophobic substituents on positions 2 and 6 of the quinoline nucleus. No correlation was found between published antimalarial activity and ability to block CpG-ODN-induced effects. These results are discussed in the light of the ability of quinacrine and chloroquine to induce remission of rheumatoid arthritis and lupus erythematosus.
STUDY ON SEROPREVALENCE OF MUMPS - SPECIFIC IgG ANTIBODIES IN A HEALTHY POPULATION
Directory of Open Access Journals (Sweden)
Milena Karcheva
2010-09-01
Full Text Available Mumps is a vaccine preventable viral infection. Its typical clinical manifestations are characterized by pain and swelling of the salivary glands, fever, and fatigue. Often other organs are affected - testes in males after puberty (orchitis, ovaries in women (ooforitis, pancreas (pancreatitis, central nervous system (meningities. The use of specific immune prophylaxis led to a significant success in the fight against mumps, but there are still unresolved issues related to the immunological and epidemiological effectiveness of the vaccines. The disease continues to interest researchers today. The main issues being tackled are related to the conduct of virological, clinical and sero-epidemiological studies in different countries. Objectives of the study is to determine the frequency distribution of mumps-specific IgG antibodies in healthy populations in the region of Pleven, Bulgaria. Methods: a cross-sectional sero - epidemiological representative population - based survey in the area was made. Enzyme immunoassay method was used for an indirect proof of mumps - specific IgG serum antibodies. 410 people were examined at an average age of 25 (1 to 84. Of these, 250 (61 % were women and 160 (39 % - men. Results: Of all test results, the negative were 72 (19 %, the borderline were 12 (3 %, the positive were 182 (44 %, and highly positive were 144 (35 %. The vaccination status showed that 242 (69 % of all surveyed were immunized with a vaccine against mumps. According to the immunization schedule in Bulgaria, 132 (33 % people were immunized with monovaccine during the years - 1 intake, 80 (20 % with trivaccine - 1 intake, and 64 (16 % - 2 doses. Conclusion: We believe that despite the specific immunprophylaxis carried out against mumps decades on end, the necessary level of protection leading to its elimination has not yet been reached.
Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism
International Nuclear Information System (INIS)
Welin, Martin; Nordlund, Paer
2010-01-01
Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.
Sievers, S; Cretich, M; Gagni, P; Ahrens, B; Grishina, G; Sampson, H A; Niggemann, B; Chiari, M; Beyer, K
2017-08-01
Microarray-based component-resolved diagnostics (CRD) has become an accepted tool to detect allergen-specific IgE sensitization towards hundreds of allergens in parallel from one drop of serum. Nevertheless, specificity and sensitivity as well as a simultaneous detection of allergen-specific IgG 4 , as a potential parameter for tolerance development, remain to be optimized. We applied the recently introduced silicon chip coated with a functional polymer named copoly(DMA-NAS-MAPS) to the simultaneous detection of food allergen-specific IgE and IgG 4 , and compared it with ImmunoCAP and ImmunoCAP ISAC. Inter- and intraslide variation, linearity of signal and working range, sensitivity and application of internal calibrations for IgE and IgG 4 were assessed. Native and recombinant allergenic proteins from hen's egg and cow's milk were spotted on silicon chips coated with copoly(DMA-NAS-MAPS) along with known concentrations for human IgE and IgG 4 . A serum pool and 105 patient samples were assessed quantitatively and semi-quantitatively with the ImmunoCAP and ImmunoCAP ISAC and correlated with IgE- and IgG 4 -specific fluorescence on silicon microarrays. Allergen-specific IgE and IgG 4 were detected in parallel using two fluorescent dyes with no crosstalk. Results from the ImmunoCAP correlated better with microarray fluorescence than with ImmunoCAP ISAC except for the allergen ovomucoid. The working range of the silicon microarray for total hen's egg-specific IgE was comparable to the range of 0.1 to >100 kU A /L of the ImmunoCAP system, whereas for total cow's milk, the silicon microarray was less sensitive. Detectable allergen-specific IgG 4 could be determined only for low concentrations, but still correlated positively with ImmunoCAP results. We confirmed the ability of the polymer coated silicon microarray to be comparably sensitive to the ImmunoCAP ISAC for various food allergens. This suggests that the copoly(DMA-NAS-MAPS) microarray is a low-cost, self
Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J
1993-05-01
The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry
Measurement of the proton spin structure function g1p
International Nuclear Information System (INIS)
Pussieux, T.
1994-10-01
In order to check the Bjorken sum rule and confirm the EMC surprising conclusion on the spin structure of the proton, the measurement of the spin structure function of the proton has been performed by the Spin Muon Collaboration via the polarized muon nucleon deep inelastic scattering. The results of the 1993 run are presented within a kinematical range of 0.003 2 = 10 GeV 2 . The first moment of the polarized spin structure function g 1 p is found to be two standard deviations below the Ellis-Jaffe sum rule. Assuming SU(3) for hyperons β decays, the quark spin contribution to the proton spin is extracted. Combining all available data on proton, neutron and deuton, The Bjorken sum rule is confirmed within 10%. (author). 25 refs., 3 figs., 2 tabs
Zhao, Hui; Wang, Yong-Sheng; Tang, Xian; Zhou, Bin; Xue, Jin-Hua; Liu, Hui; Liu, Shan-Du; Cao, Jin-Xiu; Li, Ming-Hui; Chen, Si-Han
2015-08-05
We report on an enzyme-free and label-free strategy for the ultrasensitive determination of adenosine. A novel multipurpose adenosine aptamer (MAAP) is designed, which serves as an effective target recognition probe and a capture probe for malachite green. In the presence of adenosine, the conformation of the MAAP is converted from a hairpin structure to a G-quadruplex. Upon addition of malachite green into this solution, a noticeable enhancement of resonance light scattering was observed. The signal response is directly proportional to the concentration of adenosine ranging from 75 pM to 2.2 nM with a detection limit of 23 pM, which was 100-10,000 folds lower than those obtained by previous reported methods. Moreover, this strategy has been applied successfully for detecting adenosine in human urine and blood samples, further proving its reliability. The mechanism of adenosine inducing MAAP to form a G-quadruplex was demonstrated by a series of control experiments. Such a MAAP probe can also be used to other strategies such as fluorescence or spectrophotometric ones. We suppose that this strategy can be expanded to develop a universal analytical platform for various target molecules in the biomedical field and clinical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.
Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang
2012-03-01
Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.
Classification of compact homogeneous spaces with invariant G(2)-structures
Czech Academy of Sciences Publication Activity Database
Le, Hong-Van; Munir, M.
2012-01-01
Roč. 12, č. 2 (2012), s. 303-328 ISSN 1615-715X R&D Projects: GA AV ČR IAA100190701 Institutional support: RVO:67985840 Keywords : compact homogeneous space * G(2)-structure Subject RIV: BA - General Mathematics Impact factor: 0.371, year: 2012 http://www.degruyter.com/view/j/advg.2012.12.issue-2/advgeom.2011.054/advgeom.2011.054. xml
Umehara, Hisanori; Okazaki, Kazuichi; Nakamura, Takuji; Satoh-Nakamura, Tomomi; Nakajima, Akio; Kawano, Mitsuhiro; Mimori, Tsuneyo; Chiba, Tsutomu
2017-05-01
IgG4-related disease (IgG4-RD) is a fascinating clinical entity proposed by Japanese investigators, and includes a wide variety of diseases, formerly diagnosed as Mikulicz's disease (MD), autoimmune pancreatitis (AIP), interstitial nephritis, prostatitis, retroperitoneal fibrosis, etc. Although all clinicians in every field of medicine may encounter this new disease, a unifying diagnostic criterion has not been established. In 2011, the Japanese IgG4 team, organized by the Ministry of Health, Labor and Welfare (MHLW) of Japan, published comprehensive diagnostic criteria for IgG4-RD. Several problems with these criteria have arisen in clinical practice, however, including the difficulty obtaining biopsy samples from some patients, and the sensitivity and the specificity of techniques used to measure serum IgG4 concentrations. Although serum IgG4 concentration is an important clinical marker for IgG4-RD, its diagnostic utility in differentiating IgG4-RD from other diseases, called IgG4-RD mimickers, remains unclear. This review describes the current optimal approach for the diagnosis of IgG4-RD, based on both comprehensive and organ-specific diagnostic criteria, in patients with diseases such as IgG4-related pancreatitis (AIP), sclerosing cholangitis, and renal, lung and orbital diseases.
Negron Rios, Luis M.
The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.
The spin dependent structure function g1 of the deuteron and the proton
International Nuclear Information System (INIS)
Klostermann, L.
1995-01-01
This thesis presents a study on the spin structure of the nucleon, via deep inelastic scattering (DIS) of polarised nuons on polarised proton and deuterium targets. The work was done in the Spin Muon Collaboration (SMC) at CERN in Geneva. From the asymmetry in the scattering cross section for nucleon and lepton spins parallel and anti-parallel, one con determine the spin dependent structure function g 1 , which contains information on the quark and gluon spin distribution functions. The interpretation in the frame work of the quark parton model (QPM) of earlier results on g 1 p by the European Muon Collaboration (EMC), gave an indication that only a small fraction of the proton spin, compatible with zero, is carried by the spins of the constituent quarks. The SMC was set up to check this unexpected result with improved accuracy, and to combine measurements of g 1 p and g 1 d to test a fundamental sum rule in quantum chromodynamics (QCD), the Bjorken sum rule. (orig./WL)
Directory of Open Access Journals (Sweden)
Karasuyama Hajime
2011-04-01
Full Text Available Abstract Background There have been few reports on the role of Fc receptors (FcRs and immunoglobulin G (IgG in asthma. The purpose of this study is to clarify the role of inhibitory FcRs and antigen presenting cells (APCs in pathogenesis of asthma and to evaluate antigen-transporting and presenting capacity by APCs in the tracheobronchial mucosa. Methods In FcγRIIB deficient (KO and C57BL/6 (WT mice, the effects of intratracheal instillation of antigen-specific IgG were analysed using the model with sensitization and airborne challenge with ovalbumin (OVA. Thoracic lymph nodes instilled with fluorescein-conjugated OVA were analysed by fluorescence microscopy. Moreover, we analysed the CD11c+ MHC class II+ cells which intaken fluorescein-conjugated OVA in thoracic lymph nodes by flow cytometry. Also, lung-derived CD11c+ APCs were analysed by flow cytometry. Effects of anti-OVA IgG1 on bone marrow dendritic cells (BMDCs in vitro were also analysed. Moreover, in FcγRIIB KO mice intravenously transplanted dendritic cells (DCs differentiated from BMDCs of WT mice, the effects of intratracheal instillation of anti-OVA IgG were evaluated by bronchoalveolar lavage (BAL. Results In WT mice, total cells and eosinophils in BAL fluid reduced after instillation with anti-OVA IgG1. Anti-OVA IgG1 suppressed airway inflammation in hyperresponsiveness and histology. In addition, the number of the fluorescein-conjugated OVA in CD11c+ MHC class II+ cells of thoracic lymph nodes with anti-OVA IgG1 instillation decreased compared with PBS. Also, MHC class II expression on lung-derived CD11c+ APCs with anti-OVA IgG1 instillation reduced. Moreover, in vitro, we showed that BMDCs with anti-OVA IgG1 significantly decreased the T cell proliferation. Finally, we demonstrated that the lacking effects of anti-OVA IgG1 on airway inflammation on FcγRIIB KO mice were restored with WT-derived BMDCs transplanted intravenously. Conclusion Antigen-specific IgG ameliorates
Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji
2008-03-01
The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (PCIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.
Structure of unliganded HSV gD reveals a mechanism for receptor-mediated activation of virus entry
Energy Technology Data Exchange (ETDEWEB)
Krummenacher, Claude; Supekar, Vinit M.; Whitbeck, J. Charles; Lazear, Eric; Connolly, Sarah A.; Eisenberg, Roselyn J.; Cohen, Gary H.; Wiley, Don C.; Carfi, Andrea (UPENN); (IRBM); (CHLMM)
2010-07-19
Herpes simplex virus (HSV) entry into cells requires binding of the envelope glycoprotein D (gD) to one of several cell surface receptors. The 50 C-terminal residues of the gD ectodomain are essential for virus entry, but not for receptor binding. We have determined the structure of an unliganded gD molecule that includes these C-terminal residues. The structure reveals that the C-terminus is anchored near the N-terminal region and masks receptor-binding sites. Locking the C-terminus in the position observed in the crystals by an intramolecular disulfide bond abolished receptor binding and virus entry, demonstrating that this region of gD moves upon receptor binding. Similarly, a point mutant that would destabilize the C-terminus structure was nonfunctional for entry, despite increased affinity for receptors. We propose that a controlled displacement of the gD C-terminus upon receptor binding is an essential feature of HSV entry, ensuring the timely activation of membrane fusion.
Purification of specific structured lipids by distillation: Effects on acyl migration
DEFF Research Database (Denmark)
Xu, Xuebing; Skands, A.; Adler-Nissen, Jens
2001-01-01
The cause and effects of acyl migration during the purification of specific structured lipids by distillation were studied in a conventional batch deodorizer with stripping steam. The mixture of specific structured lipids produced by lipase-catalyzed acidolysis between rapeseed oil and capric acid...... influenced the rate of acyl migration, and their combinations made the effect more severe. However, diacylglycerols were found to be the main reason for acyl migration. In the distillation of the specific structured lipid product mixture, distillation temperature and time were the main factors to determine...... the degree of acyl migration and the extent of separation of free fatty acids. The results indicate that more efficient separation technology should be used to improve the quality of the purified structured lipids. in order to reduce the distillation temperature, vacuum should be made as low as possible...
Porous silicon structures with high surface area/specific pore size
Northrup, M.A.; Yu, C.M.; Raley, N.F.
1999-03-16
Fabrication and use of porous silicon structures to increase surface area of heated reaction chambers, electrophoresis devices, and thermopneumatic sensor-actuators, chemical preconcentrates, and filtering or control flow devices. In particular, such high surface area or specific pore size porous silicon structures will be useful in significantly augmenting the adsorption, vaporization, desorption, condensation and flow of liquids and gases in applications that use such processes on a miniature scale. Examples that will benefit from a high surface area, porous silicon structure include sample preconcentrators that are designed to adsorb and subsequently desorb specific chemical species from a sample background; chemical reaction chambers with enhanced surface reaction rates; and sensor-actuator chamber devices with increased pressure for thermopneumatic actuation of integrated membranes. Examples that benefit from specific pore sized porous silicon are chemical/biological filters and thermally-activated flow devices with active or adjacent surfaces such as electrodes or heaters. 9 figs.
A novel CpG island set identifies tissue-specific methylation at developmental gene loci.
Directory of Open Access Journals (Sweden)
Robert Illingworth
2008-01-01
Full Text Available CpG islands (CGIs are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.
The structures of colour string for e+e- → qq-barg and υ → 3g
International Nuclear Information System (INIS)
Tian Lili; Xie Qubing; Si Zongguo
1993-01-01
In Lund model, the explanation of e + e - → qq-barg → 3 jets and υ → 3g → h's is based on applying Lund string fragmentation model to their assumed structures of colour string for qq-barg and 3g systems. In this paper, starting from the colour wave functions of qq-barg and 3 g systems, we study these colour string structures by QCD directly. The results reveal the reasonableness and accuracy of Lund string pictures
Generation of Multilayered 3D Structures of HepG2 Cells Using a Bio-printing Technique.
Jeon, Hyeryeon; Kang, Kyojin; Park, Su A; Kim, Wan Doo; Paik, Seung Sam; Lee, Sang-Hun; Jeong, Jaemin; Choi, Dongho
2017-01-15
Chronic liver disease is a major widespread cause of death, and whole liver transplantation is the only definitive treatment for patients with end-stage liver diseases. However, many problems, including donor shortage, surgical complications and cost, hinder their usage. Recently, tissue-engineering technology provided a potential breakthrough for solving these problems. Three-dimensional (3D) printing technology has been used to mimic tissues and organs suitable for transplantation, but applications for the liver have been rare. A 3D bioprinting system was used to construct 3D printed hepatic structures using alginate. HepG2 cells were cultured on these 3D structures for 3 weeks and examined by fluorescence microscopy, histology and immunohistochemistry. The expression of liverspecific markers was quantified on days 1, 7, 14, and 21. The cells grew well on the alginate scaffold, and liver-specific gene expression increased. The cells grew more extensively in 3D culture than two-dimensional culture and exhibited better structural aspects of the liver, indicating that the 3D bioprinting method recapitulates the liver architecture. The 3D bioprinting of hepatic structures appears feasible. This technology may become a major tool and provide a bridge between basic science and the clinical challenges for regenerative medicine of the liver.
Directory of Open Access Journals (Sweden)
Yoshiko Matsuda
2017-07-01
Full Text Available The recent attention given to diseases associated with memory B-cell (mBC-produced antibodies (Abs suggests the need for a similar in vitro assay to evaluate the functions of mBCs. Here, we cultured peripheral blood mononuclear cells (PBMCs with the intent to collect mBC-derived Abs in vitro and maintain their cell–cell contact-dependent interactions with helper T-cells. PBMCs were cultured with interleukin (IL-21, CpG-oligodeoxynucleotides (ODN, phorbol myristate acetate (PMA, and phytohemagglutinin/leucoagglutinin (PHA-L in 24-well flat-bottom plates (5 × 105 cells/well. A culture supernatant analysis of PBMCs from healthy donors (n = 10 indicated that antigen-specific IgM Ab levels in a PBMC culture supernatant might be better able to demonstrate the antigen sensitization status in a smaller peripheral blood sample, compared to IgG because Epstein–Barr virus-specific IgM mBCs circulate peripherally at a significantly higher frequency once antiviral humoral immunity has stabilized. Thus, our in vitro assay demonstrated the potential significance of antigen-specific IgM Ab production in the culture supernatants. Furthermore, an analysis of cultured PBMCs from allograft kidney recipients (n = 16 sensitized with de novo donor-specific human leukocyte antigen (HLA-specific Abs (DSAs showed that IgM-type HLA-specific Abs were detected mainly from the culture supernatants from PBMCs of patients with stable graft function, whereas IgG isotype HLA Abs were detectable only from patients with biopsy-proven antibody-mediated rejection. In other words, these IgG isotype Abs also represented an activated humoral immune response in vivo. Additionally, IgM- and IgG-expressing mBCs from healthy donors (n = 5 were cultured with IL-21, CpG-ODN, and a supernatant produced by stimulating CD19+ B-cell-depleted PBMCs with PHA-L and PMA in 24-well flat-bottom plates (1 × 105 cells/well, and the resulting in vitro analysis provided some
A Precision Measurement of the Spin Structure Functions f^p_1 and g^g_1
Energy Technology Data Exchange (ETDEWEB)
Toole, T.
2004-12-13
In Experiment E155 at the Stanford Linear Accelerator Center, the spin dependent structure function g{sub 1}(x,Q{sup 2}) was measured for both the proton and deuteron. This was accomplished by scattering 48.3 GeV highly polarized electrons (0.813 {+-} 0.020) off polarized {sup 15}NH{sub 3} (proton) and {sup 6}LiD (deuteron) targets. Data were collected in March and April of 1997 using three fixed angle, momentum analyzing spectrometers centered at 2.75{sup o}, 5.5{sup o}, and 10.5{sup o}. This enabled a kinematic coverage of 0.01 < x < 0.9 and 1 GeV{sup 2} < Q{sup 2} < 40 GeV{sup 2}. At an average Q{sup 2} of 5 GeV{sup 2}, the integrals in the measured region were f{sub 0.014}{sup 0.9}g{sub 1}(x)dx = 0.119 {+-} 0.002(stat.) {+-} 0.009(syst.) for the proton and 0.043 {+-} 0.003(stat.) {+-} 0.003(syst.) for the deuteron. Using a perturbative QCD analysis which included a global data set, the results were found to be consistent with the Bjorken Sum Rule. Asymmetry measurements also were made using photoproduced hadrons. Data were collected concurrently with the g{sub 1} data. For the proton, the asymmetries were small and non-zero. The deuteron measurements were consistent with zero.
Finding Specification Pages from the Web
Yoshinaga, Naoki; Torisawa, Kentaro
This paper presents a method of finding a specification page on the Web for a given object (e.g., ``Ch. d'Yquem'') and its class label (e.g., ``wine''). A specification page for an object is a Web page which gives concise attribute-value information about the object (e.g., ``county''-``Sauternes'') in well formatted structures. A simple unsupervised method using layout and symbolic decoration cues was applied to a large number of the Web pages to acquire candidate attributes for each class (e.g., ``county'' for a class ``wine''). We then filter out irrelevant words from the putative attributes through an author-aware scoring function that we called site frequency. We used the acquired attributes to select a representative specification page for a given object from the Web pages retrieved by a normal search engine. Experimental results revealed that our system greatly outperformed the normal search engine in terms of this specification retrieval.
Energy Technology Data Exchange (ETDEWEB)
Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail: yunatswu@swu.edu.cn
2016-04-15
The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.
A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.
Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao
2012-06-01
Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.
Structure-based discovery of inhibitors of the YycG histidine kinase
DEFF Research Database (Denmark)
Qin, X.; Zhang, J.; Xu, B.
2006-01-01
inhibitors of YycG histidine kinase thus are of potential value as leads for developing new antibiotics against infecting staphylococci. The structure-based virtual screening (SBVS) technology can be widely used in screening potential inhibitors of other bacterial TCSs, since it is more rapid and efficacious...... than traditional screening technology....
Isolation and structure-function characterization of a signaling-active rhodopsin-G protein complex.
Gao, Yang; Westfield, Gerwin; Erickson, Jon W; Cerione, Richard A; Skiniotis, Georgios; Ramachandran, Sekar
2017-08-25
The visual photo-transduction cascade is a prototypical G protein-coupled receptor (GPCR) signaling system, in which light-activated rhodopsin (Rho*) is the GPCR catalyzing the exchange of GDP for GTP on the heterotrimeric G protein transducin (G T ). This results in the dissociation of G T into its component α T -GTP and β 1 γ 1 subunit complex. Structural information for the Rho*-G T complex will be essential for understanding the molecular mechanism of visual photo-transduction. Moreover, it will shed light on how GPCRs selectively couple to and activate their G protein signaling partners. Here, we report on the preparation of a stable detergent-solubilized complex between Rho* and a heterotrimer (G T *) comprising a Gα T /Gα i1 chimera (α T *) and β 1 γ 1 The complex was formed on native rod outer segment membranes upon light activation, solubilized in lauryl maltose neopentyl glycol, and purified with a combination of affinity and size-exclusion chromatography. We found that the complex is fully functional and that the stoichiometry of Rho* to Gα T * is 1:1. The molecular weight of the complex was calculated from small-angle X-ray scattering data and was in good agreement with a model consisting of one Rho* and one G T *. The complex was visualized by negative-stain electron microscopy, which revealed an architecture similar to that of the β 2 -adrenergic receptor-G S complex, including a flexible α T * helical domain. The stability and high yield of the purified complex should allow for further efforts toward obtaining a high-resolution structure of this important signaling complex. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Dewitte, Griet; Walmagh, Maarten; Diricks, Margo; Lepak, Alexander; Gutmann, Alexander; Nidetzky, Bernd; Desmet, Tom
2016-09-10
UDP-glycosyltransferases (UGTs) are a promising class of biocatalysts that offer a sustainable alternative for chemical glycosylation of natural products. In this study, we aimed to characterize plant-derived UGTs from the GT-1 family with an emphasis on their acceptor promiscuity and their potential application in glycosylation processes. Recombinant expression in E. coli provided sufficient amounts of enzyme for the in-depth characterization of the salicylic acid UGT from Capsella rubella (UGT-SACr) and the stevia UGT from Stevia rebaudiana (UGT-76G1Sr). The latter was found to have a remarkably broad specificity with activities on a wide diversity of structures, from aliphatic and branched alcohols, over small phenolics to larger flavonoids, terpenoids and even higher glycoside compounds. As an example for its industrial potential, the glycosylation of curcumin was thoroughly evaluated. Under optimized conditions, 96% of curcumin was converted within 24h into the corresponding curcumin β-glycosides. In addition, the reaction was performed in a coupled system with sucrose synthase from Glycine max, to enable the cost-efficient (re)generation of UDP-Glc from sucrose as abundant and renewable resource. Copyright © 2016 Elsevier B.V. All rights reserved.
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Directory of Open Access Journals (Sweden)
Jeffrey D Nanson
Full Text Available Ketoacyl-acyl carrier protein reductases (FabG are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP linked thioesters within the bacterial type II fatty acid synthesis (FASII pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG, the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Liang, Chun; Zhu, Houxiang
2018-01-01
The CRISPR-Cpf1 system has been successfully applied in genome editing. However, target efficiency of the CRISPR-Cpf1 system varies among different gRNA sequences. We reanalyzed the published CRISPR-Cpf1 gRNAs data and found many sequence and structural features related to their target efficiency. Using machine learning technology, a SVM model was created to predict target efficiency for any given gRNAs. We have developed the first web service application, CRISPR-DT (CRISPR DNA Targeting), to...
Perez, Elizabeth M; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon
2017-03-21
Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year.
International Nuclear Information System (INIS)
Gentner, N.E.; Atomic Energy of Canada Ltd., Chalk River, Ontario. Chalk River Nuclear Labs.)
1977-01-01
The major part of the substantial γ-resistance of wild-type Schizosaccharomyces pombe appears to be due to prereplicative recombinational repair mechanisms. The existence of a second 'prereplicative G2' repair pathway, specific for γ-induced damage, has now been deduced from studies of the effect of the repair inhibitor caffeine on γ-irradiated G1 phase and G2 phase cells. Only G2 cells are additionally inactivated on exposure to caffeine after γ-irradiation. This shows that both known caffeine-sensitive γ-repair processes (Genter and Werner, Molec. gen. Genet. 145, 1-5 [1976]) are dependent on the presence of a duplicated genome (2c) at the time of radiation exposure. Pathway I is the known 'prereplicative G2' repair process (Fabre, Radiation Res. 56, 528-539 [1973]) which is involved in both UV- and γ-repair, and which requires post-irradiation protein synthesis for activity. Pathway II represents a second distinct 'prereplicative G2' repair mechanism; it differs from the first in that it is specific for repair of γ-induced damage and appears to be constitutive. (orig.) [de
Measurement of the Proton and Deuteron Spin Structure Function g1 in the Resonance Region
International Nuclear Information System (INIS)
Abe, K.; Akagi, T.; Perry Anthony; Antonov, R.; Arnold, R.G.; Todd Averett; Band, H.R.; Bauer, J.M.; Borel, H.; Peter Bosted; Vincent Breton; Button-Shafer, J.; Jian-Ping Chen; T.E. Chupp; J. Clendenin; C. Comptour; K.P. Coulter; G. Court; Donald Crabb; M. Daoudi; Donal Day; F.S. Dietrich; James Dunne; H. Dutz; R. Erbacher; J. Fellbaum; Andrew Feltham; Helene Fonvieille; Emil Frlez; D. Garvey; R. Gearhart; Javier Gomez; P. Grenier; Keith Griffioen; S. Hoeibraten; Emlyn Hughes; Charles Hyde-Wright; J.R. Johnson; D. Kawall; Andreas Klein; Sebastian Kuhn; M. Kuriki; Richard Lindgren; T.J. Liu; R.M. Lombard-Nelsen; Jacques Marroncle; Tomoyuki Maruyama; X.K. Maruyama; James Mccarthy; Werner Meyer; Zein-Eddine Meziani; Ralph Minehart; Joseph Mitchell; J. Morgenstern; Gerassimos Petratos; R. Pitthan; Dinko Pocanic; C. Prescott; R. Prepost; P. Raines; Brian Raue; D. Reyna; A. Rijllart; Yves Roblin; L. Rochester; Stephen Rock; Oscar Rondon-Aramayo; Ingo Sick; Lee Smith; Tim Smith; M. Spengos; F. Staley; P. Steiner; S. St. Lorant; L.M. Stuart; F. Suekane; Z.M. Szalata; Huabin Tang; Y. Terrien; Tracy Usher; Dieter Walz; Frank Wesselmann; J.L. White; K. Witte; C. Young; Brad Youngman; Haruo Yuta; G. Zapalac; Benedikt Zihlmann; Zimmermann, D.
1997-01-01
We have measured the proton and deuteron spin structure functions g 1 p and g 1 d in the region of the nucleon resonances for W 2 2 and Q 2 ≅ 0.5 and Q 2 ≅ 1.2 GeV 2 by inelastically scattering 9.7 GeV polarized electrons off polarized 15 NH 3 and 15 ND 3 targets. We observe significant structure in g 1 p in the resonance region. We have used the present results, together with the deep-inelastic data at higher W 2 , to extract Γ(Q 2 ) (triple b ond) ∫ 0 1 g 1 (x,Q 2 ) dx. This is the first information on the low-Q 2 evolution of Gamma toward the Gerasimov-Drell-Hearn limit at Q 2 = 0
International Nuclear Information System (INIS)
Salo, Heikki; Laurikainen, Eija; Laine, Jarkko; Comerón, Sebastien; Gadotti, Dimitri A.; Kim, Taehyun; Buta, Ron; Sheth, Kartik; Muñoz-Mateos, Juan Carlos; Zaritsky, Dennis; Hinz, Joannah L.; Ho, Luis; Knapen, Johan; Cisternas, Mauricio; Athanassoula, E.; Bosma, Albert; Laine, Seppo; Regan, Michael; De Paz, Armando Gil; Menendez-Delmestre, Karin
2015-01-01
The Spitzer Survey of Stellar Structure in Galaxies (S 4 G) is a deep 3.6 and 4.5 μm imaging survey of 2352 nearby (<40 Mpc) galaxies. We describe the S 4 G data analysis pipeline 4, which is dedicated to two-dimensional structural surface brightness decompositions of 3.6 μm images, using GALFIT3.0. Besides automatic 1-component Sérsic fits, and 2-component Sérsic bulge + exponential disk fits, we present human-supervised multi-component decompositions, which include, when judged appropriate, a central point source, bulge, disk, and bar components. Comparison of the fitted parameters indicates that multi-component models are needed to obtain reliable estimates for the bulge Sérsic index and bulge-to-total light ratio (B/T), confirming earlier results. Here, we describe the preparations of input data done for decompositions, give examples of our decomposition strategy, and describe the data products released via IRSA and via our web page (www.oulu.fi/astronomy/S4G-PIPELINE4/MAIN). These products include all the input data and decomposition files in electronic form, making it easy to extend the decompositions to suit specific science purposes. We also provide our IDL-based visualization tools (GALFIDL) developed for displaying/running GALFIT-decompositions, as well as our mask editing procedure (MASK-EDIT) used in data preparation. A detailed analysis of the bulge, disk, and bar parameters derived from multi-component decompositions will be published separately
Radinsky, Olga; Edri, Avishay; Brusilovsky, Michael; Fedida-Metula, Shlomit; Sobarzo, Ariel; Gershoni-Yahalom, Orly; Lutwama, Julius; Dye, John; Lobel, Leslie; Porgador, Angel
2017-07-20
Ebolavirus is a highly lethal pathogen, causing a severe hemorrhagic disease with a high fatality rate. To better understand immune correlates of protection by virus specific IgG, we investigated the evolution of the Fcγ receptors (FcγRs)-activating capabilities of antiviral IgG in serum samples of long recovered survivors. To this end, longitudinal serum samples from survivors of Sudan ebolavirus (SUDV) infection, studied over years, were examined for the presence of Ebola-GP specific IgG subclasses, and for their binding to FcγRs. We developed a cell-based reporter system to quantitate pathogen-specific antibody binding to FcγRIIIA, FcγRIIA, FcγRIIB and FcγRI. With this system, we demonstrate that anti-GP-specific stimulation of the FcγRI reporter by survivors' sera was substantially high one year after acute infection, with a slight reduction in activity over a decade post infection. We further demonstrate that GP-specific IgG1 is by far the seroprevalent subclass that retained and even enhanced its presence in the sera, over ten years post infection; the prevalence of other GP-specific IgG subclasses was considerably reduced over time. In accordance, GP-specific FcγRI reporter response and GP-specific total IgG1 subclass correlated in the studied group of Ebola survivors. These observations are important for further informing Ebola vaccine and therapeutic development.
Directory of Open Access Journals (Sweden)
Farshad Firuzi
2017-06-01
Full Text Available We consider unit tangent sphere bundle of a Riemannian manifold $ (M,g $ as a $ (2n+1 $-dimensional manifold and we equip it with pseudo-Riemannian $ g $-natural almost contact B-metric structure. Then, by computing coefficients of the structure tensor $ F$, we completely characterize the unit tangent sphere bundle equipped to this structure, with respect to the relevant classification of almost contact B-metric structures, and determine a class such that the unit tangent sphere bundle with mentioned structure belongs to it. Also, we find some curvature conditions such that the mentioned structure satisfies each of eleven basic classes.
IgE, IgG4 and IgA specific to Bet v 1-related food allergens do not predict oral allergy syndrome.
Guhsl, E E; Hofstetter, G; Lengger, N; Hemmer, W; Ebner, C; Fröschl, R; Bublin, M; Lupinek, C; Breiteneder, H; Radauer, C
2015-01-01
Birch pollen-associated plant food allergy is caused by Bet v 1-specific IgE, but presence of cross-reactive IgE to related allergens does not predict food allergy. The role of other immunoglobulin isotypes in the birch pollen-plant food syndrome has not been investigated in detail. Bet v 1-sensitized birch pollen-allergic patients (n = 35) were diagnosed for food allergy by standardized interviews, skin prick tests, prick-to-prick tests and ImmunoCAP. Concentrations of allergen-specific IgE, IgG1, IgG4 and IgA to seven Bet v 1-related food allergens were determined by ELISA. Bet v 1, Cor a 1, Mal d 1 and Pru p 1 bound IgE from all and IgG4 and IgA from the majority of sera. Immunoglobulins to Gly m 4, Vig r 1 and Api g 1.01 were detected in allergy and increased or reduced levels of IgE, IgG1, IgG4 or IgA specific to most Bet v 1-related allergens. Api g 1-specific IgE was significantly (P = 0.01) elevated in celeriac-allergic compared with celeriac-tolerant patients. Likewise, frequencies of IgE (71% vs 15%; P = 0.01) and IgA (86% vs 38%; P = 0.04) binding to Api g 1.01 were increased. Measurements of allergen-specific immunoglobulins are not suitable for diagnosing Bet v 1-mediated plant food allergy to hazelnut and Rosaceae fruits. In contrast, IgE and IgA to the distantly related allergen Api g 1 correlate with allergy to celeriac. © 2014 The Authors. Allergy Published by John Wiley & Sons Ltd.
Quaternary structure of a G-protein-coupled receptor heterotetramer in complex with Gi and Gs.
Navarro, Gemma; Cordomí, Arnau; Zelman-Femiak, Monika; Brugarolas, Marc; Moreno, Estefania; Aguinaga, David; Perez-Benito, Laura; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Pardo, Leonardo; García-Sáez, Ana J; McCormick, Peter J; Franco, Rafael
2016-04-05
G-protein-coupled receptors (GPCRs), in the form of monomers or homodimers that bind heterotrimeric G proteins, are fundamental in the transfer of extracellular stimuli to intracellular signaling pathways. Different GPCRs may also interact to form heteromers that are novel signaling units. Despite the exponential growth in the number of solved GPCR crystal structures, the structural properties of heteromers remain unknown. We used single-particle tracking experiments in cells expressing functional adenosine A1-A2A receptors fused to fluorescent proteins to show the loss of Brownian movement of the A1 receptor in the presence of the A2A receptor, and a preponderance of cell surface 2:2 receptor heteromers (dimer of dimers). Using computer modeling, aided by bioluminescence resonance energy transfer assays to monitor receptor homomerization and heteromerization and G-protein coupling, we predict the interacting interfaces and propose a quaternary structure of the GPCR tetramer in complex with two G proteins. The combination of results points to a molecular architecture formed by a rhombus-shaped heterotetramer, which is bound to two different interacting heterotrimeric G proteins (Gi and Gs). These novel results constitute an important advance in understanding the molecular intricacies involved in GPCR function.
Perceptual learning is specific to the trained structure of information.
Cohen, Yamit; Daikhin, Luba; Ahissar, Merav
2013-12-01
What do we learn when we practice a simple perceptual task? Many studies have suggested that we learn to refine or better select the sensory representations of the task-relevant dimension. Here we show that learning is specific to the trained structural regularities. Specifically, when this structure is modified after training with a fixed temporal structure, performance regresses to pretraining levels, even when the trained stimuli and task are retained. This specificity raises key questions as to the importance of low-level sensory modifications in the learning process. We trained two groups of participants on a two-tone frequency discrimination task for several days. In one group, a fixed reference tone was consistently presented in the first interval (the second tone was higher or lower), and in the other group the same reference tone was consistently presented in the second interval. When following training, these temporal protocols were switched between groups, performance of both groups regressed to pretraining levels, and further training was needed to attain postlearning performance. ERP measures, taken before and after training, indicated that participants implicitly learned the temporal regularity of the protocol and formed an attentional template that matched the trained structure of information. These results are consistent with Reverse Hierarchy Theory, which posits that even the learning of simple perceptual tasks progresses in a top-down manner, hence can benefit from temporal regularities at the trial level, albeit at the potential cost that learning may be specific to these regularities.
Directory of Open Access Journals (Sweden)
AM Marassá
2009-01-01
Full Text Available With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA. A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027 in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.
Directory of Open Access Journals (Sweden)
Fang-Hong Liu
2015-01-01
Full Text Available Background. Insulin induced gene 2 (INSIG2 encodes a protein that has a biological effect on regulation of adipocyte metabolism and body weight. This study aimed to investigate the association of INSIG2 gene -102G>A polymorphism with obesity related phenotypes in Chinese children and test gender-specific effects. Methods. The 2,030 independent individuals aged from 7 to 18 years, including 705 obese cases and 1,325 nonobese controls, were recruited from local schools. We measured the obesity-related phenotypes and detected the serum lipids. We genotype -102G>A polymorphism by using the matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS. Results. In all individuals, we found that the GG/GA genotype of INSIG2 -102G>A polymorphism was associated with risk of severe obesity (OR = 1.62, 95% CI: 1.11–2.36, and P=0.012 under the dominant model. The association with severe obesity existed only in boys (OR = 1.91, 95% CI: 1.15–3.17, P=0.012. The GG/GA genotype of -102G>A polymorphism was also associated with higher waist circumference (β=2.61 cm, P=0.031 in boys. No similar association was found in girls. The polymorphism was not associated with other obesity-related phenotypes, neither in all individuals nor in gender-specific population. Conclusions. This study identified a gender-specific effect of INSIG2 -102G>A polymorphism on risk of severe obesity and waist circumference in Chinese boys.
Site-specific photoconjugation of antibodies using chemically synthesized IgG-binding domains.
Perols, Anna; Karlström, Amelie Eriksson
2014-03-19
Site-specific labeling of antibodies can be performed using the immunoglobulin-binding Z domain, derived from staphylococcal protein A (SpA), which has a well-characterized binding site in the Fc region of antibodies. By introducing a photoactivable probe in the Z domain, a covalent bond can be formed between the Z domain and the antibody by irradiation with UV light. The aim of this study was to improve the conjugation yield for labeling of different subclasses of IgG having different sequence composition, using a photoactivated Z domain variant. Four different variants of the Z domain (Z5BPA, Z5BBA, Z32BPA, and Z32BBA) were synthesized to investigate the influence of the position of the photoactivable probe and the presence of a flexible linker between the probe and the protein. For two of the variants, the photoreactive benzophenone group was introduced as part of an amino acid side chain by incorporation of the unnatural amino acid benzoylphenylalanine (BPA) during peptide synthesis. For the other two variants, the photoreactive benzophenone group was attached via a flexible linker by coupling of benzoylbenzoic acid (BBA) to the ε-amino group of a selectively deprotected lysine residue. Photoconjugation experiments using human IgG1, mouse IgG1, and mouse IgG2A demonstrated efficient conjugation for all antibodies. It was shown that differences in linker length had a large impact on the conjugation efficiency for labeling of mouse IgG1, whereas the positioning of the photoactivable probe in the sequence of the protein had a larger effect for mouse IgG2A. Conjugation to human IgG1 was only to a minor extent affected by position or linker length. For each subclass of antibody, the best variant tested using a standard conjugation protocol resulted in conjugation efficiencies of 41-66%, which corresponds to on average approximately one Z domain attached to each antibody. As a combination of the two best performing variants, Z5BBA and Z32BPA, a Z domain variant with
A Flexible 5G Frame Structure Design for Frequency-Division Duplex Cases
DEFF Research Database (Denmark)
Pedersen, Klaus I.; Berardinelli, Gilberto; Frederiksen, Frank
2016-01-01
A 5G frame structure designed for efficient support of users with highly diverse service requirements is proposed. It includes support for mobile broadband data, mission-critical communication, and massive machine communication. The solution encompasses flexible multiplexing of users on a shared...
MKP1 phosphatase mediates G1-specific dephosphorylation of H3Serine10P in response to DNA damage
Energy Technology Data Exchange (ETDEWEB)
Sharma, Ajit K.; Khan, Shafqat A.; Sharda, Asmita; Reddy, Divya V; Gupta, Sanjay, E-mail: sgupta@actrec.gov.in
2015-08-15
Highlights: • Reversible reduction of H3S10 phosphorylation after DNA damage is G1 phase specific. • Dynamic balance between MAP kinases, MKP1 and MSK1 regulate H3S10P during DDR. • MKP1 associates with chromatin bearing γH2AX in response to DNA damage. • Inhibition of MKP1 activity with specific inhibitor promotes radiation-induced cell death. - Abstract: Histone mark, H3S10 phosphorylation plays a dual role in a cell by maintaining relaxed chromatin for active transcription in interphase and condensed chromatin state in mitosis. The level of H3S10P has also been shown to alter on DNA damage; however, its cell cycle specific behavior and regulation during DNA damage response is largely unexplored. In the present study, we demonstrate G1 cell cycle phase specific reversible loss of H3S10P in response to IR-induced DNA damage is mediated by opposing activities of phosphatase, MKP1 and kinase, MSK1 of the MAP kinase pathway. We also show that the MKP1 recruits to the chromatin in response to DNA damage and correlates with the decrease of H3S10P, whereas MKP1 is released from chromatin during recovery phase of DDR. Furthermore, blocking of H3S10 dephosphorylation by MKP1 inhibition impairs DNA repair process and results in poor survival of WRL68 cells. Collectively, our data proposes a pathway regulating G1 cell cycle phase specific reversible reduction of H3S10P on IR induced DNA damage and also raises the possibility of combinatorial modulation of H3S10P with specific inhibitors to target the cancer cells in G1-phase of cell cycle.
Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate
2016-01-01
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...
Specific central nervous system recruitment of HLA-G(+) regulatory T cells in multiple sclerosis.
Huang, Yu-Hwa; Zozulya, Alla L; Weidenfeller, Christian; Metz, Imke; Buck, Dorothea; Toyka, Klaus V; Brück, Wolfgang; Wiendl, Heinz
2009-08-01
We have recently described a novel population of natural regulatory T cells (T(reg)) that are characterized by the expression of HLA-G and may be found at sites of tissue inflammation (HLA-G(pos) T(reg)). Here we studied the role of these cells in multiple sclerosis (MS), a prototypic autoimmune inflammatory disorder of the central nervous system (CNS). Sixty-four patients with different types of MS, 9 patients with other neurological diseases, and 20 healthy donors were included in this study. Inflamed brain lesions from 5 additional untreated MS patients were examined. HLA-G(pos) T(reg) were analyzed in the cerebrospinal fluid (CSF) by flow cytometry and in inflammatory demyelinating lesions of MS brain specimens by immunohistochemistry. Functional capacity was accessed and transmigration was determined using an in vitro model of the human blood-brain barrier (BBB). HLA-G(pos) T(reg) were found enriched in the inflamed CSF of MS patients and in inflammatory demyelinating lesions of MS brain specimens. HLA-G(pos) T(reg) showed a strong propensity to transmigrate across BBB, which was vigorously driven by inflammatory chemokines, and associated with a gain of suppressive capacity upon transmigration. CSF-derived HLA-G(pos) T(reg) of MS patients represented a population of activated central memory activated T cells with an upregulated expression of inflammatory chemokine receptors and exhibiting full suppressive capacity. Unlike natural FoxP3-expressing T(reg), HLA-G(pos) T(reg) derived from peripheral blood were functionally unimpaired in MS. In MS, HLA-G(pos) T(reg) may serve to control potentially destructive immune responses directly at the sites of CNS inflammation and to counterbalance inflammation once specifically recruited to the CNS.
Filippova, Ekaterina V; Kuhn, Misty L; Osipiuk, Jerzy; Kiryukhina, Olga; Joachimiak, Andrzej; Ballicora, Miguel A; Anderson, Wayne F
2015-03-27
Spermidine N-acetyltransferase, encoded by the gene speG, catalyzes the initial step in the degradation of polyamines and is a critical enzyme for determining the polyamine concentrations in bacteria. In Escherichia coli, studies have shown that SpeG is the enzyme responsible for acetylating spermidine under stress conditions and for preventing spermidine toxicity. Not all bacteria contain speG, and many bacterial pathogens have developed strategies to either acquire or silence it for pathogenesis. Here, we present thorough kinetic analyses combined with structural characterization of the VCA0947 SpeG enzyme from the important human pathogen Vibrio cholerae. Our studies revealed the unexpected presence of a previously unknown allosteric site and an unusual dodecameric structure for a member of the Gcn5-related N-acetyltransferase superfamily. We show that SpeG forms dodecamers in solution and in crystals and describe its three-dimensional structure in several ligand-free and liganded structures. Importantly, these structural data define the first view of a polyamine bound in an allosteric site of an N-acetyltransferase. Kinetic characterization of SpeG from V. cholerae showed that it acetylates spermidine and spermine. The behavior of this enzyme is complex and exhibits sigmoidal curves and substrate inhibition. We performed a detailed non-linear regression kinetic analysis to simultaneously fit families of substrate saturation curves to uncover a simple kinetic mechanism that explains the apparent complexity of this enzyme. Our results provide a fundamental understanding of the bacterial SpeG enzyme, which will be key toward understanding the regulation of polyamine levels in bacteria during pathogenesis. Copyright © 2015. Published by Elsevier Ltd.
DEFF Research Database (Denmark)
Kjaerulff, Søren; Andersen, Nicoline Resen; Borup, Mia Trolle
2007-01-01
Eukaryotic cells normally differentiate from G(1); here we investigate the mechanism preventing expression of differentiation-specific genes outside G(1). In fission yeast, induction of the transcription factor Ste11 triggers sexual differentiation. We find that Ste11 is only active in G(1) when...... Cdk activity is low. In the remaining part of the cell cycle, Ste11 becomes Cdk-phosphorylated at Thr 82 (T82), which inhibits its DNA-binding activity. Since the ste11 gene is autoregulated and the Ste11 protein is highly unstable, this Cdk switch rapidly extinguishes Ste11 activity when cells enter...... S phase. When we mutated T82 to aspartic acid, mimicking constant phosphorylation, cells no longer underwent differentiation. Conversely, changing T82 to alanine rendered Ste11-controlled transcription constitutive through the cell cycle, and allowed mating from S phase with increased frequency...
International Nuclear Information System (INIS)
Varshney, Nishant Kumar; Suresh Kumar, R.; Ignatova, Zoya; Prabhune, Asmita; Pundle, Archana; Dodson, Eleanor; Suresh, C. G.
2012-01-01
A thermostable penicillin G acylase from A. faecalis has been crystallized in two space groups: C222 1 and P4 1 2 1 2. X-ray diffraction data were collected to 3.3 and 3.5 Å resolution, respectively. The enzyme penicillin G acylase (EC 3.5.1.11) catalyzes amide-bond cleavage in benzylpenicillin (penicillin G) to yield 6-aminopenicillanic acid, an intermediate chemical used in the production of semisynthetic penicillins. A thermostable penicillin G acylase from Alcaligenes faecalis (AfPGA) has been crystallized using the hanging-drop vapour-diffusion method in two different space groups: C222 1 , with unit-cell parameters a = 72.9, b = 86.0, c = 260.2 Å, and P4 1 2 1 2, with unit-cell parameters a = b = 85.6, c = 298.8 Å. Data were collected at 293 K and the structure was determined using the molecular-replacement method. Like other penicillin acylases, AfPGA belongs to the N-terminal nucleophilic hydrolase superfamily, has undergone post-translational processing and has a serine as the N-terminal residue of the β-chain. A disulfide bridge has been identified in the structure that was not found in the other two known penicillin G acylase structures. The presence of the disulfide bridge is perceived to be one factor that confers higher stability to this enzyme
The Deuteron Spin-dependent Structure Function $g^{d}_1$ and its First Moment
Alexakhin, V.Yu.; Alexeev, G.D.; Alexeev, M.; Amoroso, A.; Balestra, F.; Ball, J.; Barth, J.; Baum, G.; Becker, M.; Bedfer, Y.; Bernet, C.; Bertini, R.; Bettinelli, M.; Birsa, R.; Bisplinghoff, J.; Bordalo, P.; Bradamante, F.; Bressan, A.; Brona, G.; Burtin, E.; Bussa, M.P.; Bytchkov, V.N.; Chapiro, A.; Cicuttin, A.; Colantoni, M.; Colavita, A.A.; Costa, S.; Crespo, M.L.; d'Hose, N.; Dalla Torre, S.; Das, S.; Dasgupta, S.S.; De Masi, R.; Dedek, N.; Demchenko, D.; Denisov, O.Yu.; Dhara, L.; Diaz, V.; Dinkelbach, A.M.; Donskov, S.V.; Dorofeev, V.A.; Doshita, N.; Duic, V.; Dunnweber, W.; Efremov, A.; Eversheim, P.D.; Eyrich, W.; Faessler, M.; Fauland, P.; Ferrero, A.; Ferrero, L.; Finger, M.; M. Finger jr.; Fischer, H.; Franz, J.; Friedrich, J.M.; Frolov, V.; Garfagnini, R.; Gautheron, F.; Gavrichtchouk, O.P.; Gerassimov, S.; Geyer, R.; Giorgi, M.; Gobbo, B.; Goertz, S.; Gorin, A.M.; Grajek, O.A.; Grasso, A.; Grube, B.; Guskov, A.; Haas, F.; Hannappel, J.; von Harrach, D.; Hasegawa, T.; Hedicke, S.; Heinsius, F.H.; Hermann, R.; Hess, C.; Hinterberger, F.; von Hodenberg, M.; Horikawa, N.; Horikawa, S.; Horn, I.; Ilgner, C.; Ioukaev, A.I.; Ivanchin, I.; Ivanov, O.; Iwata, T.; Jahn, R.; Janata, A.; Joosten, R.; Jouravlev, N.I.; Kabuss, E.; Kang, D.; Ketzer, B.; Khaustov, G.V.; Khokhlov, Yu. A.; Kisselev, Yu.; Klein, F.; Klimaszewski, K.; Koblitz, S.; Koivuniemi, J.H.; Kolosov, V.N.; Komissarov, E.V.; Kondo, K.; Konigsmann, K.; Konorov, I.; Konstantinov, V.F.; Korentchenko, A.S.; Korzenev, A.; Kotzinian, A.M.; Koutchinski, N.A.; Kouznetsov, O.; Kowalik, K.; Kramer, D.; Kravchuk, N.P.; Krivokhizhin, G.V.; Kroumchtein, Z.V.; Kubart, J.; Kuhn, R.; Kukhtin, V.; Kunne, F.; Kurek, K.; Ladygin, M.E.; Lamanna, M.; Le Goff, J.M.; Leberig, M.; Lednev, A.A.; Lehmann, A.; Lichtenstadt, J.; Liska, T.; Ludwig, I.; Maggiora, A.; Maggiora, M.; Magnon, A.; Mallot, G.K.; Marchand, C.; Marroncle, J.; Martin, A.; Marzec, J.; Masek, L.; Massmann, F.; Matsuda, T.; Matthia, D.; Maximov, A.N.; Meyer, W.; Mielech, A.; Mikhailov, Yu. V.; Moinester, M.A.; Nagel, T.; Nahle, O.; Nassalski, J.; Neliba, S.; Neyret, D.P.; Nikolaenko, V.I.; Nikolaev, K.; Nozdrin, A.A.; Obraztsov, V.F.; Olshevsky, A.G.; Ostrick, M.; Padee, A.; Pagano, P.; Panebianco, S.; Panzieri, D.; Paul, S.; Peshekhonov, D.V.; Peshekhonov, V.D.; Piragino, G.; Platchkov, S.; Pochodzalla, J.; Polak, J.; Polyakov, V.A.; Pontecorvo, G.; Popov, A.A.; Pretz, J.; Procureur, S.; Quintans, C.; Ramos, S.; Reicherz, G.; Rondio, E.; Rozhdestvensky, A.M.; Ryabchikov, D.; Samoylenko, V.D.; Sandacz, A.; Santos, H.; Sapozhnikov, M.G.; Savin, I.A.; Schiavon, P.; Schill, C.; Schmitt, L.; Schroeder, W.; Seeharsch, D.; Seimetz, M.; Setter, D.; Shevchenko, O.Yu.; Siebert, H.W.; Silva, L.; Sinha, L.; Sissakian, A.N.; Slunecka, M.; Smirnov, G.I.; Sozzi, F.; Srnka, A.; Stinzing, F.; Stolarski, M.; Sugonyaev, V.P.; Sulc, M.; Sulej, R.; Tchalishev, V.V.; Tessaro, S.; Tessarotto, F.; Teufel, A.; Tkatchev, L.G.; Trippel, S.; Venugopal, G.; Virius, M.; Vlassov, N.V.; Webb, R.; Weise, E.; Weitzel, Q.; Windmolders, R.; Wislicki, W.; Zaremba, K.; Zavertyaev, M.; Zemlyanichkina, E.; Zhao, J.; Zvyagin, A.
2007-01-01
We present a measurement of the deuteron spin-dependent structure function g^d_1 based on the data collected by the COMPASS experiment at CERN during the years 2002-2004. The data provide an accurate evaluation for \\Gamma^d_1, the first moment of g^d_1(x), and for the matrix element of the singlet axial current, a_0. The results of QCD fits in the next to leading order (NLO) on all g1 deep inelastic scattering data are also presented. They provide two solutions with the gluon spin distribution function \\Delta_G positive or negative, which describe the data equally well. In both cases, at Q^2 = 3(GeV/c)^2 the first moment of \\Delta G is found to be of the order of 0:2 - 0:3 in absolute value.
Structures of the G85R Variant of SOD1 in Familial Amyotrophic Lateral Sclerosis
Energy Technology Data Exchange (ETDEWEB)
Cao, Xiaohang; Antonyuk, Svetlana V.; Seetharaman, Sai V.; Whitson, Lisa J.; Taylor, Alexander B.; Holloway, Stephen P.; Strange, Richard W.; Doucette, Peter A.; Valentine, Joan Selverstone; Tiwari, Ashutosh; Hayward, Lawrence J.; Padua, Shelby; Cohlberg, Jeffrey A.; Hasnain, S. Samar; Hart, P. John (Texas-HSC); (Cal. State); (UMASS, MED); (UCLA); (Daresbury)
2008-07-21
Mutations in the gene encoding human copper-zinc superoxide dismutase (SOD1) cause a dominant form of the progressive neurodegenerative disease amyotrophic lateral sclerosis. Transgenic mice expressing the human G85R SOD1 variant develop paralytic symptoms concomitant with the appearance of SOD1-enriched proteinaceous inclusions in their neural tissues. The process(es) through which misfolding or aggregation of G85R SOD1 induces motor neuron toxicity is not understood. Here we present structures of the human G85R SOD1 variant determined by single crystal x-ray diffraction. Alterations in structure of the metal-binding loop elements relative to the wild type enzyme suggest a molecular basis for the metal ion deficiency of the G85R SOD1 protein observed in the central nervous system of transgenic mice and in purified recombinant G85R SOD1. These findings support the notion that metal-deficient and/or disulfide-reduced mutant SOD1 species contribute to toxicity in SOD1-linked amyotrophic lateral sclerosis.