A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

Science.gov (United States)

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

Science.gov (United States)

Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

2011-01-01

Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

Science.gov (United States)

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

Science.gov (United States)

Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

2013-03-15

Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

Science.gov (United States)

Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

2017-09-12

The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

Directory of Open Access Journals (Sweden)

Emmanuel O Ariyo

Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

Science.gov (United States)

Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

2017-03-15

This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

Macrocyclic G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, M C; Ulven, Trond

2010-01-01

are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

Science.gov (United States)

Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

2013-01-01

Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

Science.gov (United States)

Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

2013-01-01

Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

Directory of Open Access Journals (Sweden)

Kohal Das

Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

Selectivity in ligand recognition of G-quadruplex loops.

Science.gov (United States)

Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

2009-03-03

A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

Science.gov (United States)

Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2016-01-04

G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

Science.gov (United States)

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

Science.gov (United States)

De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

2016-07-27

The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

Directory of Open Access Journals (Sweden)

Dmitry Kaluzhny

Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

Directory of Open Access Journals (Sweden)

Stefano Alcaro

2013-09-01

Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

DNA secondary structures: stability and function of G-quadruplex structures

Science.gov (United States)

Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

2013-01-01

In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

Science.gov (United States)

Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

2013-10-01

G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

International Nuclear Information System (INIS)

Das, Anubrata; Misra, H.S.

2015-01-01

Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

Science.gov (United States)

Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

2014-10-01

Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

Science.gov (United States)

Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

2015-05-01

Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

Multimerization rules for G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

2017-01-01

Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

Science.gov (United States)

David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

2016-05-19

G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

Science.gov (United States)

Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

2017-07-15

Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

Local epigenetic reprogramming induced by G-quadruplex ligands

Science.gov (United States)

Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

2017-11-01

DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

Directory of Open Access Journals (Sweden)

Rosalba Perrone

Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

Directory of Open Access Journals (Sweden)

Giovanna Sattin

Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

Science.gov (United States)

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

Science.gov (United States)

Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

2015-12-02

G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A mRNA-Responsive G-Quadruplex-Based Drug Release System

Directory of Open Access Journals (Sweden)

Hidenobu Yaku

2015-04-01

Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

Efficient Long-Range Hole Transport Through G-Quadruplexes.

Science.gov (United States)

Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

2017-10-09

DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

Science.gov (United States)

Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

2017-10-20

Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

Directory of Open Access Journals (Sweden)

Rowe J

2009-08-01

Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

Science.gov (United States)

Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

2018-10-05

G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

Science.gov (United States)

Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

2013-10-01

Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

2009-01-01

the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

Science.gov (United States)

Ranjan, Nihar; Davis, Erik; Xue, Liang

2013-01-01

The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

Science.gov (United States)

Phan, Anh Tuân; Mergny, Jean-Louis

2002-01-01

Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

Directory of Open Access Journals (Sweden)

Juan Hu

2013-01-01

Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

Science.gov (United States)

Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

2016-10-01

Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

Science.gov (United States)

Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

2015-12-02

Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

OpenAIRE

Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

2015-01-01

Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

G-Quadruplexes in DNA Replication: A Problem or a Necessity?

Science.gov (United States)

Valton, Anne-Laure; Prioleau, Marie-Noëlle

2016-11-01

DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

Directory of Open Access Journals (Sweden)

Andrzej S Kudlicki

Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

Science.gov (United States)

Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

2018-05-25

DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

Science.gov (United States)

Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

2016-10-13

We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

Science.gov (United States)

Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

2018-03-01

A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

Science.gov (United States)

Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

2014-01-01

O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

Directory of Open Access Journals (Sweden)

Gajjela Raju

Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

Science.gov (United States)

Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

2012-01-01

Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

Directory of Open Access Journals (Sweden)

Deanna N Edwards

Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

DEFF Research Database (Denmark)

Porru, Manuela; Artuso, Simona; Salvati, Erica

2015-01-01

We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

RPA-mediated unfolding of systematically varying G-quadruplex structures.

Science.gov (United States)

Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

2013-05-21

G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

Science.gov (United States)

Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

2018-06-01

Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

Directory of Open Access Journals (Sweden)

Aaron J. Stevens

2017-03-01

Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

DEFF Research Database (Denmark)

Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

2017-01-01

Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

Science.gov (United States)

Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

2018-05-01

Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

Science.gov (United States)

Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

2009-11-25

Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

Science.gov (United States)

Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

2018-02-01

As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

Science.gov (United States)

Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

2015-01-01

The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

Science.gov (United States)

Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

2017-12-01

Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

Science.gov (United States)

Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

2009-09-16

We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

Simultaneous G-Quadruplex DNA Logic.

Science.gov (United States)

Bader, Antoine; Cockroft, Scott L

2018-04-03

A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

Science.gov (United States)

Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

2014-09-03

Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

Science.gov (United States)

Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

2017-03-10

Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

Science.gov (United States)

Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

2017-01-01

G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

Directory of Open Access Journals (Sweden)

Vikas Yadav

2017-07-01

Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

Energy Technology Data Exchange (ETDEWEB)

Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

2014-08-21

Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

Science.gov (United States)

Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

2018-06-01

G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

Science.gov (United States)

Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

2018-02-15

Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

Science.gov (United States)

Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

2017-08-01

Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

Science.gov (United States)

Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

2012-06-05

The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

Science.gov (United States)

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

Science.gov (United States)

Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

Directory of Open Access Journals (Sweden)

Md. Monirul Islam

2015-06-01

Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Aishwarya Prakash

2011-01-01

Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates

International Nuclear Information System (INIS)

Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.

1991-01-01

Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures

Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

Science.gov (United States)

Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

2016-03-02

The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

DEFF Research Database (Denmark)

Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

2011-01-01

G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

Science.gov (United States)

Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

2013-05-01

G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

Science.gov (United States)

Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

2015-01-01

A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

Directory of Open Access Journals (Sweden)

Yunqiang Bian

2014-04-01

Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

Science.gov (United States)

Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

2018-03-01

Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

Directory of Open Access Journals (Sweden)

Natalia Rizeq

2017-12-01

Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

Science.gov (United States)

Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

2009-01-01

Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

John A Capra

2010-07-01

Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

Energy Technology Data Exchange (ETDEWEB)

Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

2017-02-15

In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

Science.gov (United States)

Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

2014-07-23

L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

G-Quadruplexes influence pri-microRNA processing.

Science.gov (United States)

Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

2018-02-01

RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

Directory of Open Access Journals (Sweden)

Khondaker M Rahman

Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

Science.gov (United States)

Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

2013-03-05

Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

Science.gov (United States)

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

Science.gov (United States)

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

“One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

Directory of Open Access Journals (Sweden)

David Monchaud

2010-01-01

Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

Science.gov (United States)

Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2015-02-15

Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

Science.gov (United States)

Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

2015-03-02

Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

2014-01-01

G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

2017-01-01

Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

Science.gov (United States)

De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

2013-11-20

A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

G-quadruplex recognition activities of E. Coli MutS

Directory of Open Access Journals (Sweden)

Ehrat Edward A

2012-07-01

Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

Science.gov (United States)

Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

2012-09-19

Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

2017-01-01

Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

Thermal stability of DNA quadruplex-duplex hybrids.

Science.gov (United States)

Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

2014-01-14

DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

Science.gov (United States)

Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

2013-01-01

We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

Directory of Open Access Journals (Sweden)

Ka-Ho Leung

Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

Science.gov (United States)

Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

2014-01-01

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

Science.gov (United States)

Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

2017-12-21

An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

Science.gov (United States)

Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

2014-02-21

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

Science.gov (United States)

Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

2015-06-22

A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

DEFF Research Database (Denmark)

Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

2012-01-01

Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

Czech Academy of Sciences Publication Activity Database

Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

2014-01-01

Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

Directory of Open Access Journals (Sweden)

Ezekiel Crenshaw

Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

Czech Academy of Sciences Publication Activity Database

Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

2015-01-01

Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

RPA prevents G-rich structure formation at lagging-strand telomeres to allow maintenance of chromosome ends.

Science.gov (United States)

Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane

2015-07-14

Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.

A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

Science.gov (United States)

Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

2016-06-15

The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

Science.gov (United States)

Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

2018-03-01

Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

Science.gov (United States)

Lech, Christopher Jacques; Phan, Anh Tuân

2017-06-20

Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

Directory of Open Access Journals (Sweden)

Charikleia Papadopoulou

2015-12-01

Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

Science.gov (United States)

Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

2017-07-21

G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

Directory of Open Access Journals (Sweden)

Felipe Opazo

2015-01-01

Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

Science.gov (United States)

Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

2014-09-01

A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

Science.gov (United States)

Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

2014-09-05

The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

Science.gov (United States)

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-09-21

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

Science.gov (United States)

Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

2018-03-01

The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

Science.gov (United States)

Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

2010-01-15

A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

Science.gov (United States)

Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

2010-08-21

A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

Science.gov (United States)

Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

2018-06-01

APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

Science.gov (United States)

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

Science.gov (United States)

Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

2014-07-15

For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

Science.gov (United States)

Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

2018-06-01

The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

Structure of a Stable G-Hairpin

Czech Academy of Sciences Publication Activity Database

Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

2017-01-01

Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Czech Academy of Sciences Publication Activity Database

Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

2017-01-01

Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

Science.gov (United States)

Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

2014-08-01

Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

Science.gov (United States)

Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

2017-06-02

G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

Science.gov (United States)

Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

2017-12-01

A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA and RNA Quadruplex-Binding Proteins

Czech Academy of Sciences Publication Activity Database

Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

2014-01-01

Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

DEFF Research Database (Denmark)

Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

2011-01-01

Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

Science.gov (United States)

Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

2017-09-05

The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Science.gov (United States)

Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

2017-10-01

We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

Directory of Open Access Journals (Sweden)

Julia H Chariker

Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

Science.gov (United States)

Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

2018-02-07

Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

Science.gov (United States)

Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

2018-02-08

G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

Science.gov (United States)

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

Directory of Open Access Journals (Sweden)

Jinzhi Tan

2009-05-01

Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

Science.gov (United States)

Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

2014-01-29

We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

DEFF Research Database (Denmark)

Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

2017-01-01

The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

2017-01-01

Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

Science.gov (United States)

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

2007-01-01

Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

Science.gov (United States)

Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

2014-01-01

Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

Science.gov (United States)

Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

2018-05-01

Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

Science.gov (United States)

Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

2018-03-09

Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

Science.gov (United States)

Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

2018-05-01

An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

Science.gov (United States)

Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

2017-03-14

G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

Extended molecular dynamics of a c-kit promoter quadruplex

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

2015-01-01

Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

Science.gov (United States)

Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

2018-04-21

An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

DEFF Research Database (Denmark)

Foulk, M. S.; Urban, J. M.; Casella, Cinzia

2015-01-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

Science.gov (United States)

Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

2015-08-04

Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

Charge splitters and charge transport junctions based on guanine quadruplexes

Science.gov (United States)

Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

2018-04-01

Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

DEFF Research Database (Denmark)

Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

2016-01-01

DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

Science.gov (United States)

Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

2011-05-17

Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

Science.gov (United States)

Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

2017-11-29

G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

Science.gov (United States)

Kocman, Vojč; Plavec, Janez

2017-05-01

Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

Science.gov (United States)

Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

2015-03-28

Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

Science.gov (United States)

Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

2016-01-15

Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

Science.gov (United States)

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

Directory of Open Access Journals (Sweden)

Victor Constantin Diculescu

2010-01-01

Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

Science.gov (United States)

Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

2015-05-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

Science.gov (United States)

Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

2015-01-01

This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

Science.gov (United States)

Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

2015-11-23

A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

2017-01-01

Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

2009-01-01

A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

Science.gov (United States)

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

Energy Technology Data Exchange (ETDEWEB)

Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

2015-08-05

Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

Directory of Open Access Journals (Sweden)

Bidisha Sengupta

Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

Science.gov (United States)

Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

2013-01-01

Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

High-resolution AFM structure of DNA G-wires in aqueous solution.

Science.gov (United States)

Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

2018-05-17

We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

Czech Academy of Sciences Publication Activity Database

Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

2017-01-01

Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

Science.gov (United States)

Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

2015-08-26

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

2017-01-01

Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

Science.gov (United States)

Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

2015-01-28

In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

Science.gov (United States)

Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

2017-10-18

G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Yanhua Chen

2016-05-01

Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

Science.gov (United States)

Dhapola, Parashar; Chowdhury, Shantanu

2016-01-01

DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

Isolation of deletion alleles by G4 DNA-induced mutagenesis

NARCIS (Netherlands)

Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

C9orf72 nucleotide repeat structures initiate molecular cascades of disease.

Science.gov (United States)

Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou

2014-03-13

A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.

FANCJ couples replication past natural fork barriers with maintenance of chromatin structure.

Science.gov (United States)

Schwab, Rebekka A; Nieminuszczy, Jadwiga; Shin-ya, Kazuo; Niedzwiedz, Wojciech

2013-04-01

Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer-predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.

DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

Czech Academy of Sciences Publication Activity Database

Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

2009-01-01

Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Science.gov (United States)

Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

2011-01-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

Science.gov (United States)

Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

2017-06-01

To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

Science.gov (United States)

Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

2014-01-01

The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

Science.gov (United States)

2015-01-01

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

Science.gov (United States)

Mostafavi, Najmeh; Ebrahimi, Ali

2018-06-01

In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

Science.gov (United States)

Tawani, Arpita; Kumar, Amit

2015-01-01

Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

Science.gov (United States)

Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

2011-12-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

Science.gov (United States)

Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

2016-04-12

Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

Science.gov (United States)

Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

2012-04-14

The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

Directory of Open Access Journals (Sweden)

Charlotte Rehm

Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

Science.gov (United States)

Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

Energy Technology Data Exchange (ETDEWEB)

Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

2017-10-09

IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

Science.gov (United States)

Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

2018-06-01

An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

Directory of Open Access Journals (Sweden)

Alexandro Membrino

Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

Directory of Open Access Journals (Sweden)

Oyoshi Takanori

2012-01-01

Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

2016-01-01

Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats

Science.gov (United States)

Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.

2010-01-01

Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468

Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

Science.gov (United States)

Hirashima, Kyotaro; Seimiya, Hiroyuki

2015-02-27

Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

Science.gov (United States)

Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

2016-01-15

The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

Science.gov (United States)

Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

2013-02-01

Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

DEFF Research Database (Denmark)

Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

2016-01-01

of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

Science.gov (United States)

Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

2018-02-10

The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

Science.gov (United States)

Zaccaria, F; Paragi, G; Fonseca Guerra, C

2016-08-21

The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

DEFF Research Database (Denmark)

Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

2012-01-01

Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

Czech Academy of Sciences Publication Activity Database

Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

2010-01-01

Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

Stability of Human Telomere Quadruplexes at High DNA Concentrations

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

2014-01-01

Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

Czech Academy of Sciences Publication Activity Database

Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

2014-01-01

Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

Site specific replacements of a single loop nucleoside with a dibenzyl linker may switch the activity of TBA from anticoagulant to antiproliferative.

Science.gov (United States)

Scuotto, Maria; Rivieccio, Elisa; Varone, Alessia; Corda, Daniela; Bucci, Mariarosaria; Vellecco, Valentina; Cirino, Giuseppe; Virgilio, Antonella; Esposito, Veronica; Galeone, Aldo; Borbone, Nicola; Varra, Michela; Mayol, Luciano

2015-09-18

Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13. © Crown copyright 2015.

Crystal structures of the human G3BP1 NTF2-like domain visualize FxFG Nup Repeat Specificity

DEFF Research Database (Denmark)

Vognsen, Tina Reinholdt; Möller, Ingvar Rúnar; Kristensen, Ole

2013-01-01

Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat...... peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded...

Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

Science.gov (United States)

Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

2015-01-01

Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

A bouquet of DNA structures: Emerging diversity

Directory of Open Access Journals (Sweden)

Mahima Kaushik

2016-03-01

Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

A bouquet of DNA structures: Emerging diversity.

Science.gov (United States)

Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant

2016-03-01

Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

Czech Academy of Sciences Publication Activity Database

Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

2015-01-01

Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

A self-consistent MoD-WM/MM structural refinement method: characterization of hydrogen bonding in the orytricha nova G-1uar

Energy Technology Data Exchange (ETDEWEB)

Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV

2008-01-01

This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.

Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

Science.gov (United States)

Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

2010-06-01

The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

DEFF Research Database (Denmark)

Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

2011-01-01

Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

Science.gov (United States)

Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

2017-01-01

To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

[Structure and evolution of the eukaryotic FANCJ-like proteins].

Science.gov (United States)

Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi

2015-02-01

The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.

RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

Science.gov (United States)

Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

2012-05-11

T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

2009-01-01

Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

Structural characterization of the Man5 glycoform of human IgG3 Fc

Energy Technology Data Exchange (ETDEWEB)

Shah, Ishan S.; Lovell, Scott; Mehzabeen, Nurjahan; Battaile, Kevin P.; Tolbert, Thomas J. (Kansas); (HWMRI)

2017-12-01

Immunoglobulin G (IgG) consists of four subclasses in humans: IgG1, IgG2, IgG3 and IgG4, which are highly conserved but have unique differences that result in subclass-specific effector functions. Though IgG1 is the most extensively studied IgG subclass, study of other subclasses is important to understand overall immune function and for development of new therapeutics. When compared to IgG1, IgG3 exhibits a similar binding profile to Fcγ receptors and stronger activation of complement. All IgG subclasses are glycosylated at N297, which is required for Fcγ receptor and C1q complement binding as well as maintaining optimal Fc conformation. We have determined the crystal structure of homogenously glycosylated human IgG3 Fc with a GlcNAc2Man5 (Man5) high mannose glycoform at 1.8 Å resolution and compared its structural features with published structures from the other IgG subclasses. Although the overall structure of IgG3 Fc is similar to that of other subclasses, some structural perturbations based on sequence differences were revealed. For instance, the presence of R435 in IgG3 (and H435 in the other IgG subclasses) has been implicated to result in IgG3-specific properties related to binding to protein A, protein G and the neonatal Fc receptor (FcRn). The IgG3 Fc structure helps to explain some of these differences. Additionally, protein-glycan contacts observed in the crystal structure appear to correlate with IgG3 affinity for Fcγ receptors as shown by binding studies with IgG3 Fc glycoforms. Finally, this IgG3 Fc structure provides a template for further studies aimed at engineering the Fc for specific gain of function.

Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

Science.gov (United States)

Spinello, A; Barone, G; Grunenberg, J

2016-01-28

In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

An RNA-binding compound that stabilizes the HIV-1 gRNA packaging signal structure and specifically blocks HIV-1 RNA encapsidation.

Science.gov (United States)

Ingemarsdotter, Carin K; Zeng, Jingwei; Long, Ziqi; Lever, Andrew M L; Kenyon, Julia C

2018-03-14

NSC260594, a quinolinium derivative from the NCI diversity set II compound library, was previously identified in a target-based assay as an inhibitor of the interaction between the HIV-1 (ψ) stem-loop 3 (SL3) RNA and Gag. This compound was shown to exhibit potent antiviral activity. Here, the effects of this compound on individual stages of the viral lifecycle were examined by qRT-PCR, ELISA and Western blot, to see if its actions were specific to the viral packaging stage. The structural effects of NSC260594 binding to the HIV-1 gRNA were also examined by SHAPE and dimerization assays. Treatment of cells with NSC260594 did not reduce the number of integration events of incoming virus, and treatment of virus producing cells did not affect the level of intracellular Gag protein or viral particle release as determined by immunoblot. However, NSC260594 reduced the incorporation of gRNA into virions by up to 82%, without affecting levels of gRNA inside the cell. This reduction in packaging correlated closely with the reduction in infectivity of the released viral particles. To establish the structural effects of NSC260594 on the HIV-1 gRNA, we performed SHAPE analyses to pinpoint RNA structural changes. NSC260594 had a stabilizing effect on the wild type RNA that was not confined to SL3, but that was propagated across the structure. A packaging mutant lacking SL3 did not show this effect. NSC260594 acts as a specific inhibitor of HIV-1 RNA packaging. No other viral functions are affected. Its action involves preventing the interaction of Gag with SL3 by stabilizing this small RNA stem-loop which then leads to stabilization of the global packaging signal region (psi or ψ). This confirms data, previously only shown in analyses of isolated SL3 oligonucleotides, that SL3 is structurally labile in the presence of Gag and that this is critical for the complete psi region to be able to adopt different conformations. Since replication is otherwise unaffected by NSC260594

Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

Czech Academy of Sciences Publication Activity Database

Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

2004-01-01

Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection.

Science.gov (United States)

Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang

2011-01-28

In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).

Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

Science.gov (United States)

Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

2015-04-15

Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

Czech Academy of Sciences Publication Activity Database

Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

2014-01-01

Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Structural basis for different phosphoinositide specificities of the PX domains of sorting nexins regulating G-protein signaling.

Science.gov (United States)

Mas, Caroline; Norwood, Suzanne J; Bugarcic, Andrea; Kinna, Genevieve; Leneva, Natalya; Kovtun, Oleksiy; Ghai, Rajesh; Ona Yanez, Lorena E; Davis, Jasmine L; Teasdale, Rohan D; Collins, Brett M

2014-10-10

Sorting nexins (SNXs) or phox homology (PX) domain containing proteins are central regulators of cell trafficking and signaling. A subfamily of PX domain proteins possesses two unique PX-associated domains, as well as a regulator of G protein-coupled receptor signaling (RGS) domain that attenuates Gαs-coupled G protein-coupled receptor signaling. Here we delineate the structural organization of these RGS-PX proteins, revealing a protein family with a modular architecture that is conserved in all eukaryotes. The one exception to this is mammalian SNX19, which lacks the typical RGS structure but preserves all other domains. The PX domain is a sensor of membrane phosphoinositide lipids and we find that specific sequence alterations in the PX domains of the mammalian RGS-PX proteins, SNX13, SNX14, SNX19, and SNX25, confer differential phosphoinositide binding preferences. Although SNX13 and SNX19 PX domains bind the early endosomal lipid phosphatidylinositol 3-phosphate, SNX14 shows no membrane binding at all. Crystal structures of the SNX19 and SNX14 PX domains reveal key differences, with alterations in SNX14 leading to closure of the binding pocket to prevent phosphoinositide association. Our findings suggest a role for alternative membrane interactions in spatial control of RGS-PX proteins in cell signaling and trafficking. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Structure of human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7)

International Nuclear Information System (INIS)

Arai, Ryoichi; Yoshikawa, Seiko; Murayama, Kazutaka; Imai, Yuzuru; Takahashi, Ryosuke; Shirouzu, Mikako; Yokoyama, Shigeyuki

2006-01-01

The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way as UbcH7. The human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7) is involved in protein degradation, including a process known as endoplasmic reticulum-associated degradation (ERAD). The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The UBE2G2 structure comprises a single domain consisting of an antiparallel β-sheet with four strands, five α-helices and two 3 10 -helices. Structural comparison of human UBE2G2 with yeast Ubc7 indicated that the overall structures are similar except for the long loop region and the C-terminal helix. Superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way to UbcH7. In addition, the extra loop region of UBE2G2 may interact with the RING domain or its neighbouring region and may be involved in the binding specificity and stability

Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

Czech Academy of Sciences Publication Activity Database

Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

2014-01-01

Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Unfolding mechanism of thrombin-binding aptamer revealed by molecular dynamics simulation and Markov State Model.

Science.gov (United States)

Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong

2016-04-05

Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.

Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

2016-01-01

Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

Science.gov (United States)

Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

2015-01-01

Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

Science.gov (United States)

Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

2017-12-15

Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

In-depth analysis of subclass-specific conformational preferences of IgG antibodies

Directory of Open Access Journals (Sweden)

Xinsheng Tian

2015-01-01

Full Text Available IgG subclass-specific differences in biological function and in vitro stability are often referred to variations in the conformational flexibility, while this flexibility has rarely been characterized. Here, small-angle X-ray scattering data from IgG1, IgG2 and IgG4 antibodies, which were designed with identical variable regions, were thoroughly analysed by the ensemble optimization method. The extended analysis of the optimized ensembles through shape clustering reveals distinct subclass-specific conformational preferences, which provide new insights for understanding the variations in physical/chemical stability and biological function of therapeutic antibodies. Importantly, the way that specific differences in the linker region correlate with the solution structure of intact antibodies is revealed, thereby visualizing future potential for the rational design of antibodies with designated physicochemical properties and tailored effector functions. In addition, this advanced computational approach is applicable to other flexible multi-domain systems and extends the potential for investigating flexibility in solutions of macromolecules by small-angle X-ray scattering.

Backbone modified TBA analogues endowed with antiproliferative activity.

Science.gov (United States)

Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo

2017-05-01

The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

Science.gov (United States)

Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

2018-08-01

In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

Science.gov (United States)

Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

2016-11-01

Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

Directory of Open Access Journals (Sweden)

Minglei Yang

Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Czech Academy of Sciences Publication Activity Database

Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

2011-01-01

Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

International Nuclear Information System (INIS)

Revaud, D.

2009-06-01

Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

Determination of specific IgG antibody by crossed radioimmunoelectrophoresis

International Nuclear Information System (INIS)

Nordvall, S.L.; Uhlin, T.; Einarsson, R.

1983-01-01

A crossed radioimmunoelectrophoretic method was developed for detection of honey bee venom specific IgG antibodies in patient sera. At the serum concentration 1/200 the contrast between specific binding and backgroud was the most favourable. The detection limit was fairly low, approximately 30 kU/l(IgG RAST units). A reference system based on the reference kits in Phadebas IgG-RAST was elaborated. (author)

Determination of specific IgG antibody by crossed radioimmunoelectrophoresis

Energy Technology Data Exchange (ETDEWEB)

Nordvall, S.L. (Dept. of Paediatrics, University Hospital, Uppsala, Sweden); Uhlin, T.; Einarsson, R. (Allergy Research, Pharmacia Diagnostics AB, Uppsala, Sweden)

1983-01-01

A crossed radioimmunoelectrophoretic method was developed for detection of honey bee venom specific IgG antibodies in patient sera. At the serum concentration 1/200 the contrast between specific binding and backgroud was the most favourable. The detection limit was fairly low, approximately 30 kU/l(IgG RAST units). A reference system based on the reference kits in Phadebas IgG-RAST was elaborated.

Structure of Sphingolipids From Sea Cucumber Cucumaria frondosa and Structure-Specific Cytotoxicity Against Human HepG2 Cells.

Science.gov (United States)

Jia, Zicai; Song, Yu; Tao, Suyuan; Cong, Peixu; Wang, Xiaoxu; Xue, Changhu; Xu, Jie

2016-03-01

To investigate the relationship between structure and activity, three glucocerebroside series (CFC-1, CFC-2 and CFC-3), ceramides (CF-Cer) and long-chain bases (CF-LCB) of sea cucumber Cucumaria frondosa (C. frondosa) were isolated and evaluated in HepG2 cells. The molecular species of CFC-1, CFC-2 and CFC-3 and CF-Cer were identified using reversed-phase liquid chromatography with heated electrospray ionization coupled to high-resolution mass spectrometry (RPLC-HESI-HRMS), and determined on the basis of chemical and spectroscopic evidence: For the three glucocerebroside series, fatty acids (FA) were mainly saturated (18:0 and 22:0), monounsaturated (22:1, 23:1 and 24:1) and 2-hydroxyl FA (2-HFA) (23:1 h and 24:1 h), the structure of long-chain bases (LCB) were dihydroxy (d17:1, d18:1 and d18:2) and trihydroxy (t16:0 and t17:0), and the glycosylation was glucose; For CF-Cer, FA were primarily saturated (17:0) and monounsaturated (16:1 and 19:1), the structure of LCB were dihydroxy (d17:1 and d18:1), and trihydroxy (t16:0). The results of cell experiment indicated that all of three glucocerebroside series, CF-Cer and CF-LCB exhibited an inhibitory effects on cell proliferation. Moreover, CFC-3 was most effective in three glucocerebrosides to HepG-2 cell viability. The inhibition effect of CF-LCB was the strongest, and the inhibition effect of CF-Cer was much stronger than glucocerebrosides.

Isolation of Mal d 1 and Api g 1 - specific recombinant antibodies from mouse IgG Fab fragment libraries - Mal d 1-specific antibody exhibits cross-reactivity against Bet v 1.

Science.gov (United States)

Haka, Jaana; Niemi, Merja H; Iljin, Kristiina; Reddy, Vanga Siva; Takkinen, Kristiina; Laukkanen, Marja-Leena

2015-05-27

Around 3-5% of the population suffer from IgE-mediated food allergies in Western countries and the number of food-allergenic people is increasing. Individuals with certain pollen allergies may also suffer from a sensitisation to proteins in the food products. As an example a person sensitised to the major birch pollen allergen, Bet v 1, is often sensitised to its homologues, such as the major allergens of apple, Mal d 1, and celery, Api g 1, as well. Development of tools for the reliable, sensitive and quick detection of allergens present in various food products is essential for allergic persons to prevent the consumption of substances causing mild and even life-threatening immune responses. The use of monoclonal antibodies would ensure the specific detection of the harmful food content for a sensitised person. Mouse IgG antibody libraries were constructed from immunised mice and specific recombinant antibodies for Mal d 1 and Api g 1 were isolated from the libraries by phage display. More detailed characterisation of the resulting antibodies was carried out using ELISA, SPR experiments and immunoprecipitation assays. The allergen-specific Fab fragments exhibited high affinity towards the target recombinant allergens. Furthermore, the Fab fragments also recognised native allergens from natural sources. Interestingly, isolated Mal d 1-specific antibody bound also to Bet v 1, the main allergen eliciting the cross-reactivity syndrome between the birch pollen and apple. Despite the similarities in Api g 1 and Bet v 1 tertiary structures, the isolated Api g 1-specific antibodies showed no cross-reactivity to Bet v 1. Here, high-affinity allergen-specific recombinant antibodies were isolated with interesting binding properties. With further development, these antibodies can be utilised as tools for the specific and reliable detection of allergens from different consumable products. This study gives new preliminary insights to elucidate the mechanism behind the pollen

Polyaniline nanofibers with a high specific surface area and an improved pore structure for supercapacitors

Science.gov (United States)

Xu, Hailing; Li, Xingwei; Wang, Gengchao

2015-10-01

Polyaniline (PANI) with a high specific surface area and an improved pore structure (HSSA-PANI) has been prepared by using a facile method, treating PANI nanofibers with chloroform (CHCl3), and its structure, morphology and pore structure are investigated. The specific surface area and pore volume of HSSA-PANI are 817.3 m2 g-1 and 0.6 cm3 g-1, and those of PANI are 33.6 m2 g-1 and 0.2 cm3 g-1. As electrode materials, a large specific surface area and pore volume can provide high electroactive regions, accelerate the diffusion of ions, and mitigate the electrochemical degradation of active materials. Compared with PANI, the capacity retention rate of HSSA-PANI is 90% with a growth of current density from 5.0 to 30 A g-1, and that of PANI is 29%. At a current density of 30 A g-1, the specific capacitance of HSSA-PANI still reaches 278.3 F g-1, and that of PANI is 86.7 F g-1. At a current density of 5.0 A g-1, the capacitance retention of HSSA-PANI is 53.1% after 2000 cycles, and that of PANI electrode is only 28.1%.

DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

Energy Technology Data Exchange (ETDEWEB)

Revaud, D.

2009-06-15

Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

Human IgG4: a structural perspective.

Science.gov (United States)

Davies, Anna M; Sutton, Brian J

2015-11-01

IgG4, the least represented human IgG subclass in serum, is an intriguing antibody with unique biological properties, such as the ability to undergo Fab-arm exchange and limit immune complex formation. The lack of effector functions, such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity, is desirable for therapeutic purposes. IgG4 plays a protective role in allergy by acting as a blocking antibody, and inhibiting mast cell degranulation, but a deleterious role in malignant melanoma, by impeding IgG1-mediated anti-tumor immunity. These findings highlight the importance of understanding the interaction between IgG4 and Fcγ receptors. Despite a wealth of structural information for the IgG1 subclass, including complexes with Fcγ receptors, and structures for intact antibodies, high-resolution crystal structures were not reported for IgG4-Fc until recently. Here, we highlight some of the biological properties of human IgG4, and review the recent crystal structures of IgG4-Fc. We discuss the unexpected conformations adopted by functionally important Cγ2 domain loops, and speculate about potential implications for the interaction between IgG4 and FcγRs. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

p53 binds human telomeric G-quadruplex in vitro

Czech Academy of Sciences Publication Activity Database

Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

2016-01-01

Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

Deconstructing IgG4-related disease involvement of midline structures: Comparison to common mimickers.

Science.gov (United States)

Lanzillotta, Marco; Campochiaro, Corrado; Trimarchi, Matteo; Arrigoni, Gianluigi; Gerevini, Simonetta; Milani, Raffaella; Bozzolo, Enrica; Biafora, Matteo; Venturini, Elena; Cicalese, Maria Pia; Stone, John H; Sabbadini, Maria Grazia; Della-Torre, Emanuel

2017-07-01

A series of destructive and tumefactive lesions of the midline structures have been recently added to the spectrum of IgG4-related disease (IgG4-RD). We examined the clinical, serological, endoscopic, radiological, and histological features that might be of utility in distinguishing IgG4-RD from other forms of inflammatory conditions with the potential to involve the sinonasal area and the oral cavity. We studied 11 consecutive patients with erosive and/or tumefactive lesions of the midline structures referred to our tertiary care center. All patients underwent serum IgG4 measurement, flow cytometry for circulating plasmablast counts, nasal endoscopy, radiological studies, and histological evaluation of tissue specimens. The histological studies included immunostaining studies to assess the number of IgG4 + plasma cells/HPF for calculation of the IgG4+/IgG + plasma cell ratio. Five patients with granulomatosis with polyangiitis (GPA), three with cocaine-induced midline destructive lesions (CIMDL), and three with IgG4-RD were studied. We found no clinical, endoscopic, or radiological findings specific for IgG4-RD. Increased serum IgG4 and plasmablasts levels were not specific for IgG4-RD. Rather, all 11 patients had elevated blood plasmablast concentrations, and several patients with GPA and CIMDL had elevated serum IgG4 levels. Storiform fibrosis and an IgG4+/IgG + plasma cell ratio >20% on histological examination, however, were observed only in patients with IgG4-RD. Histological examination of bioptic samples from the sinonasal area and oral cavity represents the mainstay for the diagnosis of IgG4-RD involvement of the midline structures.

Shedding lights on the flexible-armed porphyrins: Human telomeric G4 DNA interaction and cell photocytotoxicity research.

Science.gov (United States)

Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei

2017-08-01

DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.

A Label-Free and Sensitive Fluorescent Qualitative Assay for Bisphenol A Based on Rolling Circle Amplification/Exonuclease III-Combined Cascade Amplification.

Science.gov (United States)

Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong

2016-10-21

Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.

Timothy-specific IgG antibody levels vary with the pollen seasons.

Science.gov (United States)

Nordvall, S L; Larsson, P H; Johansson, S G

1986-11-01

Serum samples were collected from eight grass pollen hypersensitive children during a 4-year period. The sera were assayed for contents of timothy-specific IgE antibodies by RAST. Timothy-specific IgG and IgA antibodies were quantified by a refined ELISA in which covalent binding of the antigen to the polystyrene solid phase had been performed. IgG antibodies were also assayed by a Sepharose-protein-A technique with radiolabelled timothy allergens as the antigen. It was possible to register clearcut seasonal variations with postseasonally boosted antibody levels not only of timothy-specific IgE but also of IgG antibody. Both IgG1 and IgG4 antibodies specific for timothy showed seasonal variations of a similar degree. It was not possible to register seasonal variations of the same magnitude of timothy-specific IgA antibodies.

Strong preference of BRCA1 protein to topologically constrained non-B DNA structures

Czech Academy of Sciences Publication Activity Database

Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva

2016-01-01

Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016

Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

Energy Technology Data Exchange (ETDEWEB)

Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.; Liu, Corey W.; Nygaard, Rie; Rosenbaum, Daniel M.; Fung, Juan José; Choi, Hee-Jung; Thian, Foon Sun; Kobilka, Tong Sun; Puglisi, Joseph D.; Weis, William I.; Pardo, Leonardo; Prosser, R. Scott; Mueller, Luciano; Kobilka, Brian K. (Stanford-MED); (Toronto); (BMS); (UAB, Spain)

2010-01-14

G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.

Structural basis for G9a-like protein lysine methyltransferase inhibition by BIX-01294

Energy Technology Data Exchange (ETDEWEB)

Chang, Yanqi; Zhang, Xing; Horton, John R.; Upadhyay, Anup K.; Spannhoff, Astrid; Liu, Jin; Synder, James P.; Bedford, Mark T.; Cheng, Xiaodong; (Emory-MED); (Emory); (Texas)

2009-03-26

Histone lysine methylation is an important epigenetic mark that regulates gene expression and chromatin organization. G9a and G9a-like protein (GLP) are euchromatin-associated methyltransferases that repress transcription by methylating histone H3 Lys9. BIX-01294 was originally identified as a G9a inhibitor during a chemical library screen of small molecules and has previously been used in the generation of induced pluripotent stem cells. Here we present the crystal structure of the catalytic SET domain of GLP in complex with BIX-01294 and S-adenosyl-L-homocysteine. The inhibitor is bound in the substrate peptide groove at the location where the histone H3 residues N-terminal to the target lysine lie in the previously solved structure of the complex with histone peptide. The inhibitor resembles the bound conformation of histone H3 Lys4 to Arg8, and is positioned in place by residues specific for G9a and GLP through specific interactions.

Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis

International Nuclear Information System (INIS)

Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.

2004-01-01

Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)

Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

Science.gov (United States)

2016-11-01

proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

Measurement of the Proton and Deuteron Spin Structure Functions G1 and G2

Energy Technology Data Exchange (ETDEWEB)

Tobias, Al

2003-04-02

The SLAC experiment E155 was a deep-inelastic scattering experiment that scattered polarized electrons off polarized proton and deuteron targets in the effort to measure precisely the proton and deuteron spin structure functions. The nucleon structure functions g{sub 1} and g{sub 2} are important quantities that help test our present models of nucleon structure. Such information can help quantify the constituent contributions to the nucleon spin. The structure functions g{sub 1}{sup p} and G{sub 1}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.9 and 1 {le} Q{sup 2} {le} 40 GeV{sup 2} by scattering 48.4 GeV longitudinally polarized electrons off longitudinally polarized protons and deuterons. In addition, the structure functions g{sub 2}{sup p} and g{sub 2}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.7 and 1 {le} Q{sup 2} {le} 17 GeV{sup 2} by scattering 38.8 GeV longitudinally polarized electrons off transversely polarized protons and deuterons. The measurements of g{sub 1} confirm the Bjorken sum rule and find the net quark polarization to be {Delta}{Sigma} = 0.23 {+-} 0.04 {+-} 0.6 while g{sub 2} is found to be consistent with the g{sub 2}{sup WW} model.

Evaluation of cysticercus-specific IgG (total and subclasses and IgE antibody responses in cerebrospinal fluid samples from patients with neurocysticercosis showing intrathecal production of specific IgG antibodies

Directory of Open Access Journals (Sweden)

Lisandra Akemi Suzuki

Full Text Available In the present study, an enzyme-linked immunosorbent assay (ELISA standardized with vesicular fluid of Taenia solium cysticerci was used to screen for IgG (total and subclasses and IgE antibodies in cerebrospinal fluid (CSF samples from patients with neurocysticercosis showing intrathecal production of specific IgG antibodies and patients with other neurological disorders. The following results were obtained: IgG-ELISA: 100% sensitivity (median of the ELISA absorbances (MEA=1.17 and 100% specificity; IgG1-ELISA: 72.7% sensitivity (MEA=0.49 and 100% specificity; IgG2-ELISA: 81.8% sensitivity (MEA=0.46 and 100% specificity; IgG3-ELISA: 63.6% sensitivity (MEA=0.12 and 100% specificity; IgG4-ELISA: 90.9% sensitivity (MEA=0.85 and 100% specificity; IgE-ELISA 93.8% sensitivity (MEA=0.60 and 100% specificity. There were no significant differences between the sensitivities and specificities in the detection of IgG-ELISA and IgE-ELISA, although in CSF samples from patients with neurocysticercosis the MEA of the IgG-ELISA was significantly higher than that of the IgE-ELISA. The sensitivity and MEA values of the IgG4-ELISA were higher than the corresponding values for the other IgG subclasses. Future studies should address the contribution of IgG4 and IgE antibodies to the physiopathology of neurocysticercosis.

21 CFR 866.5520 - Immunoglobulin G (Fab fragment specific) immunological test system.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fab fragment specific... Test Systems § 866.5520 Immunoglobulin G (Fab fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fab fragment specific) immunological test system is a device that consists...

21 CFR 866.5540 - Immunoglobulin G (Fd fragment specific) immunological test system.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fd fragment specific... Test Systems § 866.5540 Immunoglobulin G (Fd fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fd fragment specific) immunological test system is a device that consists of...

21 CFR 866.5530 - Immunoglobulin G (Fc fragment specific) immunological test system.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fc fragment specific... Test Systems § 866.5530 Immunoglobulin G (Fc fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fc fragment specific) immunological test system is a device that consists of...

Remarks on Hamiltonian structures in G2-geometry

International Nuclear Information System (INIS)

Cho, Hyunjoo; Salur, Sema; Todd, A. J.

2013-01-01

In this article, we treat G 2 -geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G 2 -structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G 2 -structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry

Transposable elements and G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

2015-01-01

Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

Immunoradiometric assay for cytomegalovirus-specific IgG antibodies

International Nuclear Information System (INIS)

Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J.

1990-01-01

An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 [human cytomegalovirus (CMV)] has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab

HCMV gB shares structural and functional properties with gB proteins from other herpesviruses

Energy Technology Data Exchange (ETDEWEB)

Sharma, Sapna [Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 (United States); Wisner, Todd W.; Johnson, David C. [Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, OR 97239 (United States); Heldwein, Ekaterina E., E-mail: katya.heldwein@tufts.edu [Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 (United States)

2013-01-20

Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.

Galactosylated poly(ε-caprolactone) membrane promoted liver-specific functions of HepG2 cells in vitro

Energy Technology Data Exchange (ETDEWEB)

Zhang, Yan, E-mail: zhang_yan@ecust.edu.cn [The Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Zhang, Yi [The Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Chen, Min; Zhou, Yan [The State Key Laboratory of Bioreactor Engineering, School of Bioengineering, East China University of Science and Technology, Shanghai, 200237 (China); Lang, Meidong, E-mail: mdlang@ecust.edu.cn [The Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China)

2014-08-01

The lack of pendant functional groups on the PCL backbone has been a great challenge for surface bioactivation of poly(ε-caprolactone) (PCL). In the present study, covalently galactosylated PCL (GPCL) was developed through coupling between the amino-functionalized PCL (NPCL) and the lactobionic acid (LA) and its potential application in maintenance of physiological functions of HepG2 cells was further evaluated. The structure and properties of GPCL were explored by {sup 1}H NMR, FT-IR, GPC and DSC. Moreover, the incorporation of galactose ligands onto GPCL membranes not only promoted higher wettability, but also radically changed surface morphology in comparison with PCL and NPCL according to the contact angle measurement and atomic force microscopy. When HepG2 cells were seeded onto these membranes, the cells on GPCL membranes showed more pronounced cell adhesion and tended to form aggregates during the initial adhesion stage and then progressively grew into multi-layer structures compared to those without galactose ligands by the observation with fluorescence microscope and scanning electron microscopy. Furthermore, live–dead assay and functional tests demonstrated that HepG2 cells on GPCL membranes had superior viability and maintained better liver-specific functions. Collectively, GPCL has great potential for hepatic tissue engineering scaffolds. - Graphical abstract: The specific recognition between the galactose ligands on the galactosylated poly(ε-caprolactone) membrane and the ASGPR on the HepG2 cell surface. The galactosylated poly(ε-caprolactone) membranes improved the cell-matrix interaction. The galactosylated functionalized PCL scaffold is a potential candidate for liver tissue engineering. - Highlights: • The specific recognition between the galactose ligands on the galactosylated poly(ε-caprolactone) membrane and the ASGPR on the HepG2 cell surface. • The galactosylated poly(ε-caprolactone) membranes improved the cell-matrix interaction. �

Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

Science.gov (United States)

2017-01-01

We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

Application of Food-specific IgG Antibody Detection in Allergy Dermatosis

Directory of Open Access Journals (Sweden)

Yine Hu

2015-01-01

Full Text Available The application of food-specific IgG antibody detection in allergy dermatoses was explored. 181 patients with allergy dermatoses were diagnosed from January to September 2014 and 20 healthy subjects were selected. Fourteen kinds of food-specific IgG antibodies were detected by ELISA method among all the subjects. The positive rates of IgG antibody of the patient group and the healthy group were respectively 65.2% and 5.0%. The positive rates of IgG antibody of egg, milk, shrimp and crab took a large proportion in three groups of patients with three kinds of allergy dermatoses of urticaria, eczema and allergic dermatitis, the proportion of which was respectively 70.2%, 77.8% and 71.7%. Among urticaria and allergic dermatitis patients with positive antibody, the positive rate of children was significantly higher than that of adults (p0.05. Allergy dermatoses are closely related to food-specific IgG antibodies, and the allergy dermatoses patients have a high incidence rate of food intolerance; detecting IgG antibody in the serum of patients is of great significance for the diagnosis and treatment of allergy dermatoses.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

Science.gov (United States)

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Mouse allergen-specific immunoglobulin G4 and risk of mouse skin test sensitivity

NARCIS (Netherlands)

Matsui, E. C.; Diette, G. B.; Krop, E. J. M.; Aalberse, R. C.; Smith, A. L.; Eggleston, P. A.

2006-01-01

High serum levels of cat-specific IgG and IgG4 are associated with protection against allergic sensitization to cat, but whether this association applies to other animal allergens remains unclear. To determine if high levels of mouse-specific IgG and IgG4 are associated with a decreased risk of

Mouse allergen exposure and immunologic responses: IgE-mediated mouse sensitization and mouse specific IgG and IgG4 levels

NARCIS (Netherlands)

Matsui, Elizabeth C.; Krop, Esmeralda J. M.; Diette, Gregory B.; Aalberse, Rob C.; Smith, Abigail L.; Eggleston, Peyton A.

2004-01-01

Although there is evidence that contact with mice is associated with IgE-mediated mouse sensitization and mouse specific antibody responses, the exposure-response relationships remain unclear. To determine whether IgE-mediated mouse sensitization and mouse specific IgG (mIgG) and mIgG4 levels

IgE and allergen-specific immunotherapy-induced IgG4 recognize similar epitopes of Bet v 1, the major allergen of birch pollen.

Science.gov (United States)

Groh, N; von Loetzen, C S; Subbarayal, B; Möbs, C; Vogel, L; Hoffmann, A; Fötisch, K; Koutsouridou, A; Randow, S; Völker, E; Seutter von Loetzen, A; Rösch, P; Vieths, S; Pfützner, W; Bohle, B; Schiller, D

2017-05-01

Allergen-specific immunotherapy (AIT) with birch pollen generates Bet v 1-specific immunoglobulin (Ig)G 4 which blocks IgE-mediated hypersensitivity mechanisms. Whether IgG 4 specific for Bet v 1a competes with IgE for identical epitopes or whether novel epitope specificities of IgG 4 antibodies are developed is under debate. We sought to analyze the epitope specificities of IgE and IgG 4 antibodies from sera of patients who received AIT. 15 sera of patients (13/15 received AIT) with Bet v 1a-specific IgE and IgG 4 were analyzed. The structural arrangements of recombinant (r)Bet v 1a and rBet v 1a _11x , modified in five potential epitopes, were analyzed by circular dichroism and nuclear magnetic resonance spectroscopy. IgE binding to Bet v 1 was assessed by ELISA and mediator release assays. Competitive binding of monoclonal antibodies specific for Bet v 1a and serum IgE/IgG 4 to rBet v 1a and serum antibody binding to a non-allergenic Bet v 1-type model protein presenting an individual epitope for IgE was analyzed in ELISA and western blot. rBet v 1a _11x had a Bet v 1a - similar secondary and tertiary structure. Monomeric dispersion of rBet v 1a _11x was concentration and buffer-dependent. Up to 1500-fold increase in the EC 50 for IgE-mediated mediator release induced by rBet v 1a _11x was determined. The reduction of IgE and IgG 4 binding to rBet v 1a _11x was comparable in 67% (10/15) of sera. Bet v 1a-specific monoclonal antibodies inhibited binding of serum IgE and IgG 4 to 66.1% and 64.9%, respectively. Serum IgE and IgG 4 bound specifically to an individual epitope presented by our model protein in 33% (5/15) of sera. Patients receiving AIT develop Bet v 1a-specific IgG 4 which competes with IgE for partly identical or largely overlapping epitopes. The similarities of epitopes for IgE and IgG 4 might stimulate the development of epitope-specific diagnostics and therapeutics. © 2016 John Wiley & Sons Ltd.

IgG4 autoantibodies against muscle-specific kinase undergo Fab-arm exchange in myasthenia gravis patients.

Science.gov (United States)

Koneczny, Inga; Stevens, Jo A A; De Rosa, Anna; Huda, Saif; Huijbers, Maartje G; Saxena, Abhishek; Maestri, Michelangelo; Lazaridis, Konstantinos; Zisimopoulou, Paraskevi; Tzartos, Socrates; Verschuuren, Jan; van der Maarel, Silvère M; van Damme, Philip; De Baets, Marc H; Molenaar, Peter C; Vincent, Angela; Ricciardi, Roberta; Martinez-Martinez, Pilar; Losen, Mario

2017-02-01

Autoimmunity mediated by IgG4 subclass autoantibodies is an expanding field of research. Due to their structural characteristics a key feature of IgG4 antibodies is the ability to exchange Fab-arms with other, unrelated, IgG4 molecules, making the IgG4 molecule potentially monovalent for the specific antigen. However, whether those disease-associated antigen-specific IgG4 are mono- or divalent for their antigens is unknown. Myasthenia gravis (MG) with antibodies to muscle specific kinase (MuSK-MG) is a well-recognized disease in which the predominant pathogenic IgG4 antibody binds to extracellular epitopes on MuSK at the neuromuscular junction; this inhibits a pathway that clusters the acetylcholine (neurotransmitter) receptors and leads to failure of neuromuscular transmission. In vitro Fab-arm exchange-inducing conditions were applied to MuSK antibodies in sera, purified IgG4 and IgG1-3 sub-fractions. Solid-phase cross-linking assays were established to determine the extent of pre-existing and inducible Fab-arm exchange. Functional effects of the resulting populations of IgG4 antibodies were determined by measuring inhibition of agrin-induced AChR clustering in C2C12 cells. To confirm the results, κ/κ, λ/λ and hybrid κ/λ IgG4s were isolated and tested for MuSK antibodies. At least fifty percent of patients had IgG4, but not IgG1-3, MuSK antibodies that could undergo Fab-arm exchange in vitro under reducing conditions. Also MuSK antibodies were found in vivo that were divalent (monospecific for MuSK). Fab-arm exchange with normal human IgG4 did not prevent the inhibitory effect of serum derived MuSK antibodies on AChR clustering in C2C12 mouse myotubes. The results suggest that a considerable proportion of MuSK IgG4 could already be Fab-arm exchanged in vivo. This was confirmed by isolating endogenous IgG4 MuSK antibodies containing both κ and λ light chains, i.e. hybrid IgG4 molecules. These new findings demonstrate that Fab-arm exchanged antibodies

Complex DNA structures and structures of DNA complexes

International Nuclear Information System (INIS)

Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.

1994-01-01

Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful

Complex DNA structures and structures of DNA complexes

Energy Technology Data Exchange (ETDEWEB)

Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)

1994-12-01

Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.

Crystal structure of the conserved herpesvirus fusion regulator complex gH—gL

Energy Technology Data Exchange (ETDEWEB)

Chowdary, Tirumala K.; Cairns, Tina M.; Atanasiu, Doina; Cohen, Gary H.; Eisenberg, Roselyn J.; Heldwein, Ekaterina E. [UPENN; (Tufts-MED)

2015-02-09

Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH–gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH–gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH–gL activates gB for fusion, possibly through direct binding. Formation of a gB–gH–gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB–gH–gL interface a promising antiviral target.

Non-"g" Residuals of the SAT and ACT Predict Specific Abilities

Science.gov (United States)

Coyle, Thomas R.; Purcell, Jason M.; Snyder, Anissa C.; Kochunov, Peter

2013-01-01

This research examined whether non-"g" residuals of the SAT and ACT subtests, obtained after removing g, predicted specific abilities. Non-"g" residuals of the verbal and math subtests of the SAT and ACT were correlated with academic (verbal and math) and non-academic abilities (speed and shop), both based on the Armed Services…

Comparative studies on the structure and adhesion of setae in G. gecko and G. swinhonis

Institute of Scientific and Technical Information of China (English)

GUO; Ce; WANG; WenBo; YU; Min; DAI; ZhenDong

2007-01-01

Scanning electron microscopy (SEM) and histological techniques were used to observe and study the setae structures of two gecko species (G. gecko and G. swinhonis) and the relationships between these structures and the adhesive forces. The SEM results showed that the setae of these two species were densely distributed in an orderly fashion, and branched with curved tips. The setae of G. gecko had cluster structures, each cluster containing 4-6 setae whose terminal branches curved towards the center of the toes at ～ 10(°-), the tips of the branches like spatulae and densely arrayed at an interval of less than 0.2-0.3 μm. On the contrary, the branch tips in the setae of G. swinhonis were curled, and the terminal parts of setae curved towards the center of the toes at various angles. Usually the setae of these gecko species branch twice at the top at intervals greater than that of G. gecko. The histological observation found that inside the setae of these two species there were plenty of unevenly distributed contents, such as epithelia, fat cells, pigmental cells and muscle tissue, but no gland cells existed. The results of functional experiments suggested that modifying the structure of gecko's setae could reduce its adhesive ability dramatically, demonstrating the positive correlation between the structure of the gecko's setae and its adhesive ability. The above results provide important information in designing bio-mimic setae and bio-gecko robots.

Cardiomyocyte-specific deletion of the G protein-coupled estrogen receptor (GPER) leads to left ventricular dysfunction and adverse remodeling: A sex-specific gene profiling analysis.

Science.gov (United States)

Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne

2017-08-01

Activation of G protein-coupled estrogen receptor (GPER) by its agonist, G1, protects the heart from stressors such as pressure-overload, ischemia, a high-salt diet, estrogen loss, and aging, in various male and female animal models. Due to nonspecific effects of G1, the exact functions of cardiac GPER cannot be concluded from studies using systemic G1 administration. Moreover, global knockdown of GPER affects glucose homeostasis, blood pressure, and many other cardiovascular-related systems, thereby confounding interpretation of its direct cardiac actions. We generated a cardiomyocyte-specific GPER knockout (KO) mouse model to specifically investigate the functions of GPER in cardiomyocytes. Compared to wild type mice, cardiomyocyte-specific GPER KO mice exhibited adverse alterations in cardiac structure and impaired systolic and diastolic function, as measured by echocardiography. Gene deletion effects on left ventricular dimensions were more profound in male KO mice compared to female KO mice. Analysis of DNA microarray data from isolated cardiomyocytes of wild type and KO mice revealed sex-based differences in gene expression profiles affecting multiple transcriptional networks. Gene Set Enrichment Analysis (GSEA) revealed that mitochondrial genes are enriched in GPER KO females, whereas inflammatory response genes are enriched in GPER KO males, compared to their wild type counterparts of the same sex. The cardiomyocyte-specific GPER KO mouse model provides us with a powerful tool to study the functions of GPER in cardiomyocytes. The gene expression profiles of the GPER KO mice provide foundational information for further study of the mechanisms underlying sex-specific cardioprotection by GPER. Copyright © 2016 Elsevier B.V. All rights reserved.

Far-red fluorescent probes for canonical and non-canonical nucleic acid structures: current progress and future implications.

Science.gov (United States)

Suseela, Y V; Narayanaswamy, Nagarjun; Pratihar, Sumon; Govindaraju, Thimmaiah

2018-02-05

The structural diversity and functional relevance of nucleic acids (NAs), mainly deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are indispensable for almost all living organisms, with minute aberrations in their structure and function becoming causative factors in numerous human diseases. The standard structures of NAs, termed canonical structures, are supported by Watson-Crick hydrogen bonding. Under special physiological conditions, NAs adopt distinct spatial organisations, giving rise to non-canonical conformations supported by hydrogen bonding other than the Watson-Crick type; such non-canonical structures have a definite function in controlling gene expression and are considered as novel diagnostic and therapeutic targets. Development of molecular probes for these canonical and non-canonical DNA/RNA structures has been an active field of research. Among the numerous probes studied, probes with turn-on fluorescence in the far-red (600-750 nm) region are highly sought-after due to minimal autofluorescence and cellular damage. Far-red fluorescent probes are vital for real-time imaging of NAs in live cells as they provide good resolution and minimal perturbation of the cell under investigation. In this review, we present recent advances in the area of far-red fluorescent probes of DNA/RNA and non-canonical G-quadruplex structures. For the sake of continuity and completeness, we provide a brief overview of visible fluorescent probes. Utmost importance is given to design criteria, characteristic properties and biological applications, including in cellulo imaging, apart from critical discussion on limitations of the far-red fluorescent probes. Finally, we offer current and future prospects in targeting canonical and non-canonical NAs specific to cellular organelles, through sequence- and conformation-specific far-red fluorescent probes. We also cover their implications in chemical and molecular biology, with particular focus on decoding various disease

Accurate CpG and non-CpG cytosine methylation analysis by high-throughput locus-specific pyrosequencing in plants.

Science.gov (United States)

How-Kit, Alexandre; Daunay, Antoine; Mazaleyrat, Nicolas; Busato, Florence; Daviaud, Christian; Teyssier, Emeline; Deleuze, Jean-François; Gallusci, Philippe; Tost, Jörg

2015-07-01

Pyrosequencing permits accurate quantification of DNA methylation of specific regions where the proportions of the C/T polymorphism induced by sodium bisulfite treatment of DNA reflects the DNA methylation level. The commercially available high-throughput locus-specific pyrosequencing instruments allow for the simultaneous analysis of 96 samples, but restrict the DNA methylation analysis to CpG dinucleotide sites, which can be limiting in many biological systems. In contrast to mammals where DNA methylation occurs nearly exclusively on CpG dinucleotides, plants genomes harbor DNA methylation also in other sequence contexts including CHG and CHH motives, which cannot be evaluated by these pyrosequencing instruments due to software limitations. Here, we present a complete pipeline for accurate CpG and non-CpG cytosine methylation analysis at single base-resolution using high-throughput locus-specific pyrosequencing. The devised approach includes the design and validation of PCR amplification on bisulfite-treated DNA and pyrosequencing assays as well as the quantification of the methylation level at every cytosine from the raw peak intensities of the Pyrograms by two newly developed Visual Basic Applications. Our method presents accurate and reproducible results as exemplified by the cytosine methylation analysis of the promoter regions of two Tomato genes (NOR and CNR) encoding transcription regulators of fruit ripening during different stages of fruit development. Our results confirmed a significant and temporally coordinated loss of DNA methylation on specific cytosines during the early stages of fruit development in both promoters as previously shown by WGBS. The manuscript describes thus the first high-throughput locus-specific DNA methylation analysis in plants using pyrosequencing.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

Science.gov (United States)

Zhang, Z.; Birkedal, V.; Gothelf, K. V.

2016-05-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

DEFF Research Database (Denmark)

Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

2016-01-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

"SP-G", a putative new surfactant protein--tissue localization and 3D structure.

Directory of Open Access Journals (Sweden)

Felix Rausch

Full Text Available Surfactant proteins (SP are well known from human lung. These proteins assist the formation of a monolayer of surface-active phospholipids at the liquid-air interface of the alveolar lining, play a major role in lowering the surface tension of interfaces, and have functions in innate and adaptive immune defense. During recent years it became obvious that SPs are also part of other tissues and fluids such as tear fluid, gingiva, saliva, the nasolacrimal system, and kidney. Recently, a putative new surfactant protein (SFTA2 or SP-G was identified, which has no sequence or structural identity to the already know surfactant proteins. In this work, computational chemistry and molecular-biological methods were combined to localize and characterize SP-G. With the help of a protein structure model, specific antibodies were obtained which allowed the detection of SP-G not only on mRNA but also on protein level. The localization of this protein in different human tissues, sequence based prediction tools for posttranslational modifications and molecular dynamic simulations reveal that SP-G has physicochemical properties similar to the already known surfactant proteins B and C. This includes also the possibility of interactions with lipid systems and with that, a potential surface-regulatory feature of SP-G. In conclusion, the results indicate SP-G as a new surfactant protein which represents an until now unknown surfactant protein class.

Presence of specific IgG antibody to grain dust does not go with respiratory symptoms.

Science.gov (United States)

Park, H S; Suh, C H; Nahm, D H; Kim, H Y

1999-02-01

A high prevalence of work-related symptoms in relation to grain dust exposure has been reported in grain dust workers, but the role of the specific IgG antibody is unknown. To study the possible role of specific IgG (sIgG) and specific IgG4 (sIgG4) in the development of work-related symptoms, sIgG and sIgG4 subclass antibodies against grain dust antigens were determined by ELISA in sera from 43 workers and 27 non-exposed controls. They were compared with results of specific IgE antibodies, exposure intensity and the presence of respiratory symptoms. SIgG and sIgG4 antibodies were detectable in almost all sera of exposed workers, and the prevalence were significantly higher than those of controls (pgrain dust exposure and may unlikely play a role in the etiology of respiratory symptoms.

Crystal Structure of the Conserved Herpes Virus Fusion Regulator Complex gH–gL

Energy Technology Data Exchange (ETDEWEB)

Chowdary, T.; Cairns, T; Atanasiu, D; Cohen, G; Eisenberg, R; Heldwein, E

2010-01-01

Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.

Crystal structure of the conserved herpes virus fusion regulator complex gH-gL

Energy Technology Data Exchange (ETDEWEB)

Chowdary, Tirumala K; Cairns, Tina M; Atanasiu, Doina; Cohen, Gary H; Eisenberg, Roselyn J; Heldwein, Ekaterina E [UPENN; (Tufts-MED)

2010-09-13

Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.

Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

Directory of Open Access Journals (Sweden)

Weronika Kotkowiak

2018-03-01

Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.

Autism-specific covariation in perceptual performances: "g" or "p" factor?

Science.gov (United States)

Meilleur, Andrée-Anne S; Berthiaume, Claude; Bertone, Armando; Mottron, Laurent

2014-01-01

Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination) and mid-level (e.g., pattern matching) tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals. We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ) and Raven Progressive Matrices (RPM). We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence. In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism. Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor). Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor), which may drive perceptual abilities differently in autistic and

Autism-specific covariation in perceptual performances: "g" or "p" factor?

Directory of Open Access Journals (Sweden)

Andrée-Anne S Meilleur

Full Text Available Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination and mid-level (e.g., pattern matching tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals.We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ and Raven Progressive Matrices (RPM. We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence.In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism.Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor. Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor, which may drive perceptual abilities differently in

NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III1

International Nuclear Information System (INIS)

Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.

2009-01-01

The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III 1 region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III 1 region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III 1 and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III 1 in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg 88 to Ala 88 (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III 1 region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.

Human Leukocyte Antigen-G and Regulatory T Cells during Specific Immunotherapy for Pollen Allergy

DEFF Research Database (Denmark)

Sørensen, Anja Elaine; Johnsen, Claus R; Dalgaard, Louise Torp

2013-01-01

of the cytokine profile towards a TH1-polarized immune response. We investigated the effects of SIT on T cells, on immunomodulation of human leukocyte antigen (HLA)-G, which has been associated with allergy, on regulatory cytokine expression, and on serum allergen-specific antibody subclasses (IgE and IgG4......). Methods: Eleven birch and/or grass pollen-allergic patients and 10 healthy nonatopic controls were studied before and during SIT. Tregs, chemokine receptors, soluble HLA-G (sHLA-G), Ig-like transcript (ILT) 2, specific IgE, and IgG4 were studied. Peripheral blood mononuclear cells (PBMCs) were stimulated...... with pollen extract in vitro and immune factors were evaluated. Results: During SIT, the main changes in the peripheral blood were an increase in CXCR3+CD4+CD25+CD127low/- Tregs and a decrease in CCR4+CD4+CD25+CD127low/- Tregs, an increase in allergen-specific IgG4, and a decrease in sHLA-G during the first...

A sensitive electrochemical aptasensor for ATP detection based on exonuclease III-assisted signal amplification strategy.

Science.gov (United States)

Bao, Ting; Shu, Huawei; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

2015-03-03

A target-induced structure-switching electrochemical aptasensor for sensitive detection of ATP was successfully constructed which was based on exonuclease III-catalyzed target recycling for signal amplification. With the existence of ATP, methylene blue (MB) labeled hairpin DNA formed G-quadruplex with ATP, which led to conformational changes of the hairpin DNA and created catalytic cleavage sites for exonuclease III (Exo III). Then the structure-switching DNA hybridized with capture DNA which made MB close to electrode surface. Meanwhile, Exo III selectively digested aptamer from its 3'-end, thus G-quadruplex structure was destroyed and ATP was released for target recycling. The Exo III-assisted target recycling amplified electrochemical signal significantly. Fluorescence experiment was performed to confirm the structure-switching process of the hairpin DNA. In fluorescence experiment, AuNPs-aptamer conjugates were synthesized, AuNPs quenched fluorescence of MB, the target-induced structure-switching made Exo III digested aptamer, which restored fluorescence. Under optimized conditions, the proposed aptasensor showed a linear range of 0.1-20 nM with a detection limit of 34 pM. In addition, the proposed aptasensor had good stability and selectivity, offered promising choice for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Preparation of grafted microspheres CPVA-g-PSSS and studies on their drug-carrying and colon-specific drug delivery properties

International Nuclear Information System (INIS)

Gao, Baojiao; Fang, Li; Men, Jiying; Zhang, Yanyan

2013-01-01

Sodium 4-styrene sulfonate (SSS) was graft-polymerized on the surfaces of crosslinked polyvinyl alcohol (CPVA) microspheres in a manner of surface-initiated graft-polymerization by using cerium salt-hydroxyl group redox initiation system, obtaining the grafted microspheres CPVA-g-PSSS. The chemical structure and physicochemical characters of CPVA-g-PSSS microspheres were fully characterized with infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and zeta potential determination. The aim of this work is to constitute a novel colon-specific drug delivery system via molecular design by using CPVA-g-PSSS microspheres as the drug-carrying material and by taking metronidazole (MTZ) as the model drug. The drug-carrying ability and mechanism of the grafted microspheres CPVA-g-PSSS for MTZ were investigated. Finally, in-vitro release tests for the drug-carrying microspheres were conducted. The experimental results show that in an acidic medium, the grafted microspheres CPVA-g-PSSS exhibit strong adsorption ability for MTZ by driving of electrostatic interaction, and have an adsorption capacity of 112 mg/g, displaying the high efficiency of drug-carrying. The in-vitro release behavior of the drug-carried microspheres is highly pH-sensitive. In the medium of pH = 1, the drug-carrying microspheres do not release the drug, whereas in the medium of pH = 7.4, a sudden delivery phenomenon of the drug will occur, displaying an excellent colon-specific drug delivery behavior. Highlights: ► A metronidazole colon-specific drug delivery was constituted using grafted polymeric microspheres. ► Grafted polymeric microspheres CPVA-g-PSSS were prepared via surface-initiated graft-polymerization. ► The release of the drug-carrying microspheres is highly pH-sensitive. ► The drug-carrying microspheres display an excellent colon-specific drug delivery behavior

Preparation of grafted microspheres CPVA-g-PSSS and studies on their drug-carrying and colon-specific drug delivery properties

Energy Technology Data Exchange (ETDEWEB)

Gao, Baojiao, E-mail: gaobaojiao@126.com [Department of Chemical Engineering, North University of China, Taiyuan 030051, People' s Republic of China (China); Fang, Li [School of Chemistry and Chemical engineering, Shanxi University, Taiyuan 030006 (China); Men, Jiying; Zhang, Yanyan [Department of Chemical Engineering, North University of China, Taiyuan 030051, People' s Republic of China (China)

2013-04-01

Sodium 4-styrene sulfonate (SSS) was graft-polymerized on the surfaces of crosslinked polyvinyl alcohol (CPVA) microspheres in a manner of surface-initiated graft-polymerization by using cerium salt-hydroxyl group redox initiation system, obtaining the grafted microspheres CPVA-g-PSSS. The chemical structure and physicochemical characters of CPVA-g-PSSS microspheres were fully characterized with infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and zeta potential determination. The aim of this work is to constitute a novel colon-specific drug delivery system via molecular design by using CPVA-g-PSSS microspheres as the drug-carrying material and by taking metronidazole (MTZ) as the model drug. The drug-carrying ability and mechanism of the grafted microspheres CPVA-g-PSSS for MTZ were investigated. Finally, in-vitro release tests for the drug-carrying microspheres were conducted. The experimental results show that in an acidic medium, the grafted microspheres CPVA-g-PSSS exhibit strong adsorption ability for MTZ by driving of electrostatic interaction, and have an adsorption capacity of 112 mg/g, displaying the high efficiency of drug-carrying. The in-vitro release behavior of the drug-carried microspheres is highly pH-sensitive. In the medium of pH = 1, the drug-carrying microspheres do not release the drug, whereas in the medium of pH = 7.4, a sudden delivery phenomenon of the drug will occur, displaying an excellent colon-specific drug delivery behavior. Highlights: ► A metronidazole colon-specific drug delivery was constituted using grafted polymeric microspheres. ► Grafted polymeric microspheres CPVA-g-PSSS were prepared via surface-initiated graft-polymerization. ► The release of the drug-carrying microspheres is highly pH-sensitive. ► The drug-carrying microspheres display an excellent colon-specific drug delivery behavior.

Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

Science.gov (United States)

Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

2017-11-01

In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.

Science.gov (United States)

Lee, Hui Sun; Im, Wonpil

2017-01-01

Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.

Internal circle uplifts, transversality and stratified G-structures

Energy Technology Data Exchange (ETDEWEB)

Babalic, Elena Mirela [Department of Theoretical Physics, National Institute of Physics and Nuclear Engineering,Str. Reactorului no.30, P.O.BOX MG-6, Postcode 077125, Bucharest-Magurele (Romania); Department of Physics, University of Craiova,13 Al. I. Cuza Str., Craiova 200585 (Romania); Lazaroiu, Calin Iuliu [Center for Geometry and Physics, Institute for Basic Science,Pohang 790-784 (Korea, Republic of)

2015-11-24

We study stratified G-structures in N=2 compactifications of M-theory on eight-manifolds M using the uplift to the auxiliary nine-manifold M̂=M×S{sup 1}. We show that the cosmooth generalized distribution D̂ on M̂ which arises in this formalism may have pointwise transverse or non-transverse intersection with the pull-back of the tangent bundle of M, a fact which is responsible for the subtle relation between the spinor stabilizers arising on M and M̂ and for the complicated stratified G-structure on M which we uncovered in previous work. We give a direct explanation of the latter in terms of the former and relate explicitly the defining forms of the SU(2) structure which exists on the generic locus U of M to the defining forms of the SU(3) structure which exists on an open subset Û of M̂, thus providing a dictionary between the eight- and nine-dimensional formalisms.

Label-free colorimetric detection of Hg²⁺ based on Hg²⁺-triggered exonuclease III-assisted target recycling and DNAzyme amplification.

Science.gov (United States)

Ren, Wang; Zhang, Ying; Huang, Wei Tao; Li, Nian Bing; Luo, Hong Qun

2015-06-15

This work reported a label-free colorimetric assay for sensitive detection of Hg(2+) based on Hg(2+)-triggered hairpin DNA probe (H-DNA) termini-binding and exonuclease Ш (Exo Ш)-assisted target recycling, as well as hemin/G-quadruplex (DNAzyme) signal amplification. The specific binding of free Hg(2+) with the thymine-thymine (T-T) mismatches termini of H-DNA could immediately trigger the Exo Ш digestion, and then set free G-quadruplex segments and Hg(2+). The Exo Ш impellent recycling of ultratrace Hg(2+) produced numerous G-quadruplexes. The corresponding DNAzymes catalyzed efficiently the H2O2-mediated oxidation of the ABTS(2-) to the colored product in the presence of hemin. Using the color change as the output signal, and the Exo Ш-aided Hg(2+) recycling and DNAzyme as the signal amplifier, the ultrasensitive assay system successfully achieved visual detection of Hg(2+) as low as 1.0 nM by the naked eye, and was suitable for field monitoring. The calibration curve was linear in the range of 50.0 pM to 20.0 nM for Hg(2+) (R=0.9962) with a detection limit of 10.0 pM. Moreover, this proposed strategy showed excellent selectivity, portability and low-cost, and was successfully applied to colorimetric detection of Hg(2+) in laboratory tap water and Jialing river water samples. Copyright © 2015 Elsevier B.V. All rights reserved.

The Fab Conformations in the Solution Structure of Human Immunoglobulin G4 (IgG4) Restrict Access to Its Fc Region

Science.gov (United States)

Rayner, Lucy E.; Hui, Gar Kay; Gor, Jayesh; Heenan, Richard K.; Dalby, Paul A.; Perkins, Stephen J.

2014-01-01

Human IgG4 antibody shows therapeutically useful properties compared with the IgG1, IgG2, and IgG3 subclasses. Thus IgG4 does not activate complement and shows conformational variability. These properties are attributable to its hinge region, which is the shortest of the four IgG subclasses. Using high throughput scattering methods, we studied the solution structure of wild-type IgG4(Ser222) and a hinge mutant IgG4(Pro222) in different buffers and temperatures where the proline substitution suppresses the formation of half-antibody. Analytical ultracentrifugation showed that both IgG4 forms were principally monomeric with sedimentation coefficients s20,w0 of 6.6–6.8 S. A monomer-dimer equilibrium was observed in heavy water buffer at low temperature. Scattering showed that the x-ray radius of gyration Rg was unchanged with concentration in 50–250 mm NaCl buffers, whereas the neutron Rg values showed a concentration-dependent increase as the temperature decreased in heavy water buffers. The distance distribution curves (P(r)) revealed two peaks, M1 and M2, that shifted below 2 mg/ml to indicate concentration-dependent IgG4 structures in addition to IgG4 dimer formation at high concentration in heavy water. Constrained x-ray and neutron scattering modeling revealed asymmetric solution structures for IgG4(Ser222) with extended hinge structures. The IgG4(Pro222) structure was similar. Both IgG4 structures showed that their Fab regions were positioned close enough to the Fc region to restrict C1q binding. Our new molecular models for IgG4 explain its inability to activate complement and clarify aspects of its stability and function for therapeutic applications. PMID:24876381

In-depth analysis of subclass-specific conformational preferences of IgG antibodies

DEFF Research Database (Denmark)

Tian, Xinsheng; Vestergaard, Bente; Thorolfsson, Matthias

2015-01-01

IgG subclass-specific differences in biological function and in vitro stability are often referred to variations in the conformational flexibility, while this flexibility has rarely been characterized. Here, small-angle X-ray scattering data from IgG1, IgG2 and IgG4 antibodies, which were designe...... properties and tailored effector functions. In addition, this advanced computational approach is applicable to other flexible multi-domain systems and extends the potential for investigating flexibility in solutions of macromolecules by small-angle X-ray scattering....

Characterizing the strand-specific distribution of non-CpG methylation in human pluripotent cells.

Science.gov (United States)

Guo, Weilong; Chung, Wen-Yu; Qian, Minping; Pellegrini, Matteo; Zhang, Michael Q

2014-03-01

DNA methylation is an important defense and regulatory mechanism. In mammals, most DNA methylation occurs at CpG sites, and asymmetric non-CpG methylation has only been detected at appreciable levels in a few cell types. We are the first to systematically study the strand-specific distribution of non-CpG methylation. With the divide-and-compare strategy, we show that CHG and CHH methylation are not intrinsically different in human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). We also find that non-CpG methylation is skewed between the two strands in introns, especially at intron boundaries and in highly expressed genes. Controlling for the proximal sequences of non-CpG sites, we show that the skew of non-CpG methylation in introns is mainly guided by sequence skew. By studying subgroups of transposable elements, we also found that non-CpG methylation is distributed in a strand-specific manner in both short interspersed nuclear elements (SINE) and long interspersed nuclear elements (LINE), but not in long terminal repeats (LTR). Finally, we show that on the antisense strand of Alus, a non-CpG site just downstream of the A-box is highly methylated. Together, the divide-and-compare strategy leads us to identify regions with strand-specific distributions of non-CpG methylation in humans.

Is immunotherapy-induced birch-pollen-specific IgG4 a marker for decreased allergen-specific sensitivity?

DEFF Research Database (Denmark)

Bodtger, U; Ejrnaes, A M; Hummelshoj, L

2005-01-01

The role of IgG4 during allergen-specific immunotherapy (SIT) is still controversial. The available studies present paramount differences in in vitro techniques, allergens, and clinical outcome parameters. By implementing a sensitive method, and pivotal clinical outcome parameters, we wanted to a...

Specific IgG and its subclass antibodies after immunotherapy with gynandropsis gynandra

Directory of Open Access Journals (Sweden)

Latha G

2005-01-01

Full Text Available Background : About 10 to 15 % of the Indian population is known to suffer from major allergic disorders such as Asthma, Rhinitis, Atopic Dermatitis and Urticaria. Aeroallergens play a major role in the pathogenesis of respiratory allergic diseases. Among the aeroallergens, pollens are major causative agents. The predominance of pollen allergens necessitate the need to assess the specific immunotherapy (SIT in allergic patients. Objective : To evaluate the effect of immunotherapy based on the presence of IgG and its subclass antibodies towards whole pollen antigen of Gynandropsis gynandra (G.gynandra and its fractions. Material and Methods : A study was conducted in 30 bronchial asthma patients on immunotherapy, by assessing the levels of IgG and its subclasses specific to G. gynandra pollen. Results : There was a significant increase in IgG and its subclass antibodies to whole pollen antigen and its fractions i.e.> 90kD, 46-37kD and 36-32kD after the course of IT. Conclusion : The use of peptide fractions may be more appropriate instead of the whole pollen antigen to test the effect of immunotherapy.

Structural basis of genomic RNA (gRNA) dimerization and packaging determinants of mouse mammary tumor virus (MMTV).

Science.gov (United States)

Aktar, Suriya J; Vivet-Boudou, Valérie; Ali, Lizna M; Jabeen, Ayesha; Kalloush, Rawan M; Richer, Delphine; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A

2014-11-14

One of the hallmarks of retroviral life cycle is the efficient and specific packaging of two copies of retroviral gRNA in the form of a non-covalent RNA dimer by the assembling virions. It is becoming increasingly clear that the process of dimerization is closely linked with gRNA packaging, and in some retroviruses, the latter depends on the former. Earlier mutational analysis of the 5' end of the MMTV genome indicated that MMTV gRNA packaging determinants comprise sequences both within the 5' untranslated region (5' UTR) and the beginning of gag. The RNA secondary structure of MMTV gRNA packaging sequences was elucidated employing selective 2'hydroxyl acylation analyzed by primer extension (SHAPE). SHAPE analyses revealed the presence of a U5/Gag long-range interaction (U5/Gag LRI), not predicted by minimum free-energy structure predictions that potentially stabilizes the global structure of this region. Structure conservation along with base-pair covariations between different strains of MMTV further supported the SHAPE-validated model. The 5' region of the MMTV gRNA contains multiple palindromic (pal) sequences that could initiate intermolecular interaction during RNA dimerization. In vitro RNA dimerization, SHAPE analysis, and structure prediction approaches on a series of pal mutants revealed that MMTV RNA utilizes a palindromic point of contact to initiate intermolecular interactions between two gRNAs, leading to dimerization. This contact point resides within pal II (5' CGGCCG 3') at the 5' UTR and contains a canonical "GC" dyad and therefore likely constitutes the MMTV RNA dimerization initiation site (DIS). Further analyses of these pal mutants employing in vivo genetic approaches indicate that pal II, as well as pal sequences located in the primer binding site (PBS) are both required for efficient MMTV gRNA packaging. Employing structural prediction, biochemical, and genetic approaches, we show that pal II functions as a primary point of contact between

Thrombin–aptamer recognition: a revealed ambiguity

OpenAIRE

Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena

2011-01-01

Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the a...

NMO-IgG: A Specific Biomarker for Neuromyelitis Optica

Directory of Open Access Journals (Sweden)

Brian G. Weinshenker

2006-01-01

Full Text Available Neuromyelitis optica (NMO is an inflammatory demyelinating disease that principally targets the optic nerves and spinal cord and often leads to severe disability and occasionally life threatening respiratory failure. Although its clinical manifestations overlap with those of multiple sclerosis (MS, in established cases these two conditions can be distinguished on the basis of clinical, radiological, and routine spinal fluid studies. The diagnosis in early cases or limited forms of NMO is difficult. We recently discovered a unique IgG autoantibody (NMO-IgG that is highly specific to patients with NMO and thus a valuable diagnostic aid. Its antigen, aquaporin-4 (AQP4, is the central nervous system’s predominant water channel protein. This antibody has not yet been proven to be pathogenic, but several facts suggest that it might be, including the similarity of the immunohistochemical pattern of NMO-(AQP4 IgG binding to mouse CNS tissues to the pattern of immune complex deposition in autopsied patients’ spinal cord tissue. The spectrum of diseases identified by NMO-IgG is broader than has previously been recognized clinically and includes incomplete forms of NMO, such as recurrent transverse myelitis without optic neuritis and recurrent optic neuritis without myelitis.

Evolution of Positioning Techniques in Cellular Networks, from 2G to 4G

Directory of Open Access Journals (Sweden)

Rafael Saraiva Campos

2017-01-01

Full Text Available This review paper presents within a common framework the mobile station positioning methods applied in 2G, 3G, and 4G cellular networks, as well as the structure of the related 3GPP technical specifications. The evolution path through the generations is explored in three steps at each level: first, the new network elements supporting localization features are introduced; then, the standard localization methods are described; finally, the protocols providing specific support to mobile station positioning are studied. To allow a better understanding, this paper also brings a brief review of the cellular networks evolution paths.

Crystal Structure and Substrate Specificity of PTPN12

Directory of Open Access Journals (Sweden)

Hui Li

2016-05-01

Full Text Available PTPN12 is an important tumor suppressor that plays critical roles in various physiological processes. However, the molecular basis underlying the substrate specificity of PTPN12 remains uncertain. Here, enzymological and crystallographic studies have enabled us to identify two distinct structural features that are crucial determinants of PTPN12 substrate specificity: the pY+1 site binding pocket and specific basic charged residues along its surface loops. Key structurally plastic regions and specific residues in PTPN12 enabled recognition of different HER2 phosphorylation sites and regulated specific PTPN12 functions. In addition, the structure of PTPN12 revealed a CDK2 phosphorylation site in a specific PTPN12 loop. Taken together, our results not only provide the working mechanisms of PTPN12 for desphosphorylation of its substrates but will also help in designing specific inhibitors of PTPN12.

Structure-based drug design for G protein-coupled receptors.

Science.gov (United States)

Congreve, Miles; Dias, João M; Marshall, Fiona H

2014-01-01

Our understanding of the structural biology of G protein-coupled receptors has undergone a transformation over the past 5 years. New protein-ligand complexes are described almost monthly in high profile journals. Appreciation of how small molecules and natural ligands bind to their receptors has the potential to impact enormously how medicinal chemists approach this major class of receptor targets. An outline of the key topics in this field and some recent examples of structure- and fragment-based drug design are described. A table is presented with example views of each G protein-coupled receptor for which there is a published X-ray structure, including interactions with small molecule antagonists, partial and full agonists. The possible implications of these new data for drug design are discussed. © 2014 Elsevier B.V. All rights reserved.

An Immunoglobulin G1 Monoclonal Antibody Highly Specific to the Wall of Cryptosporidium Oocysts

Science.gov (United States)

Weir, C.; Vesey, G.; Slade, M.; Ferrari, B.; Veal, D. A.; Williams, K.

2000-01-01

The detection of Cryptosporidium oocysts in drinking water is critically dependent on the quality of immunofluorescent reagents. Experiments were performed to develop a method for producing highly specific antibodies to Cryptosporidium oocysts that can be used for water testing. BALB/c mice were immunized with six different antigen preparations and monitored for immunoglobulin G (IgG) and IgM responses to the surface of Cryptosporidium oocysts. One group of mice received purified oocyst walls, a second group received a soluble protein preparation extracted from the outside of the oocyst wall, and the third group received whole inactivated oocysts. Three additional groups were immunized with sequentially prepared oocyst extracts to provide for a comparison of the immune response. Mice injected with the soluble protein extract demonstrated an IgG response to oocysts surface that was not seen in the whole-oocyst group. Mice injected with whole oocysts showed an IgM response only, while mice injected with purified oocyst walls showed little increase in IgM or IgG levels. Of the additional reported preparations only one, BME (2-mercaptoethanol treated), produced a weak IgM response to the oocyst wall. A mouse from the soluble oocyst extract group yielding a high IgG response was utilized to produce a highly specific IgG1 monoclonal antibody (Cry104) specific to the oocyst surface. Comparative flow cytometric analysis indicated that Cry104 has a higher avidity and specificity to oocysts in water concentrates than other commercially available antibodies. PMID:10973448

Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

DEFF Research Database (Denmark)

Bokoch, Michael P; Zou, Yaozhong; Rasmussen, Søren Gøgsig Faarup

2010-01-01

extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known...... conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive...... about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the beta(2) adrenergic...

Decoding Finger Flexion From Band-specific ECoG Signals in Humans

Directory of Open Access Journals (Sweden)

Nanying eLiang

2012-06-01

Full Text Available This article presents the method that won the BCI competition IV addressed to the pre- diction of the finger flexion from ECoG signals. ECoG-based BCIs have recently drawn the attention from the community. Indeed, ECoG can provide a higher spatial resolution, a higher signal quality and is more suitable for long-term use than classical EEG recordings. These characteristics allow to decode precise brain activities and to realize efficient ECoG-based neu- roprostheses. Signal processing is a very important task in BCIs research for translating brain signals into commands. Here, we present a linear regression method based on the amplitude modulation of band-specific ECoG including a short term memory for individual finger flexion prediction. The effectiveness of the method was proven by achieving the highest value of corre- lation coefficient between the predicted and recorded finger flexion values on data set 4 during the BCI competition IV.

Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

Science.gov (United States)

Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

2017-12-01

Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structural Properties of G,T-Parallel Duplexes

Directory of Open Access Journals (Sweden)

Anna Aviñó

2010-01-01

Full Text Available The structure of G,T-parallel-stranded duplexes of DNA carrying similar amounts of adenine and guanine residues is studied by means of molecular dynamics (MD simulations and UV- and CD spectroscopies. In addition the impact of the substitution of adenine by 8-aminoadenine and guanine by 8-aminoguanine is analyzed. The presence of 8-aminoadenine and 8-aminoguanine stabilizes the parallel duplex structure. Binding of these oligonucleotides to their target polypyrimidine sequences to form the corresponding G,T-parallel triplex was not observed. Instead, when unmodified parallel-stranded duplexes were mixed with their polypyrimidine target, an interstrand Watson-Crick duplex was formed. As predicted by theoretical calculations parallel-stranded duplexes carrying 8-aminopurines did not bind to their target. The preference for the parallel-duplex over the Watson-Crick antiparallel duplex is attributed to the strong stabilization of the parallel duplex produced by the 8-aminopurines. Theoretical studies show that the isomorphism of the triads is crucial for the stability of the parallel triplex.

R-loops and initiation of DNA replication in human cells: a missing link?

Directory of Open Access Journals (Sweden)

Rodrigo eLombraña

2015-04-01

Full Text Available The unanticipated widespread occurrence of stable hybrid DNA/RNA structures (R-loops in human cells and the increasing evidence of their involvement in several human malignancies have invigorated the research on R-loop biology in recent years. Here we propose that physiological R-loop formation at CpG island promoters can contribute to DNA replication origin specification at these regions, the most efficient replication initiation sites in mammalian cells. Quite likely, this occurs by the strand-displacement reaction activating the formation of G-quadruplex structures that target the Origin Recognition Complex (ORC in the single-stranded conformation. In agreement with this, we found that R-loops co-localize with the ORC within the same CpG island region in a significant fraction of these efficient replication origins, precisely at the position displaying the highest density of G4 motifs. This scenario builds on the connection between transcription and replication in human cells and suggests that R-loop dysregulation at CpG island promoter-origins might contribute to the phenotype of DNA replication abnormalities and loss of genome integrity detected in cancer cells.

A Label-Free and Sensitive Fluorescent Qualitative Assay for Bisphenol A Based on Rolling Circle Amplification/Exonuclease III-Combined Cascade Amplification

Directory of Open Access Journals (Sweden)

Xia Li

2016-10-01

Full Text Available Bisphenol A (BPA detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA/Exonuclease III (Exo III-combined cascade amplification strategy. First, the duplex DNA probe (RP with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of “G-quadruplex” in lantern-like structures. Finally, the continuously enriched “G-quadruplex lanterns” were lightened by zinc(II-protoporphyrin IX (ZnPPIX generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10−17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.

Templated Synthesis of Single-Walled Carbon Nanotubes with Specific Structure.

Science.gov (United States)

Yang, Feng; Wang, Xiao; Li, Meihui; Liu, Xiyan; Zhao, Xiulan; Zhang, Daqi; Zhang, Yan; Yang, Juan; Li, Yan

2016-04-19

Single-walled carbon nanotubes (SWNTs) have shown great potential in various applications attributed to their unique structure-dependent properties. Therefore, the controlled preparation of chemically and structurally pristine SWNTs is a crucial issue for their advanced applications (e.g., nanoelectronics) and has been a great challenge for two decades. Epitaxial growth from well-defined seeds has been shown to be a promising strategy to control the structure of SWNTs. Segments of carbon nanotubes, including short pipes from cutting of preformed nanotubes and caps from opening of fullerenes or cyclodehydrogenation of polycyclic hydrocarbon precursors, have been used as the seeds to grow SWNTs. Single-chirality SWNTs were obtained with both presorted chirality-pure SWNT segments and end caps obtained from polycyclic hydrocarbon molecules with designed structure. The main challenges of nanocarbon-segment-seeded processes are the stability of the seeds, yield, and efficiency. Catalyst-mediated SWNT growth is believed to be more efficient. The composition and morphology of the catalyst nanoparticles have been widely reported to affect the chirality distribution of SWNTs. However, chirality-specific SWNT growth is hard to achieve by alternating catalysts. The specificity of enzyme-catalyzed reactions brings us an awareness of the essentiality of a unique catalyst structure for the chirality-selective growth of SWNTs. Only catalysts with the desired atomic arrangements in their crystal planes can act as structural templates for chirality-specific growth of SWNTs. We have developed a new family of catalysts, tungsten-based intermetallic compounds, which have high melting points and very special crystal structures, to facilitate the growth of SWNTs with designed chirality. By the use of W6Co7 catalysts, (12,6) SWNTs were directly grown with purity higher than 92%. Both high-resolution transmission electron microscopy measurements and density functional theory simulations

Structural Analysis of Botulinum Neurotoxin Type G Receptor Binding

Energy Technology Data Exchange (ETDEWEB)

Schmitt, John; Karalewitz, Andrew; Benefield, Desire A.; Mushrush, Darren J.; Pruitt, Rory N.; Spiller, Benjamin W.; Barbieri, Joseph T.; Lacy, D. Borden (Vanderbilt); (MCW)

2010-10-19

Botulinum neurotoxin (BoNT) binds peripheral neurons at the neuromuscular junction through a dual-receptor mechanism that includes interactions with ganglioside and protein receptors. The receptor identities vary depending on BoNT serotype (A-G). BoNT/B and BoNT/G bind the luminal domains of synaptotagmin I and II, homologous synaptic vesicle proteins. We observe conditions under which BoNT/B binds both Syt isoforms, but BoNT/G binds only SytI. Both serotypes bind ganglioside G{sub T1b}. The BoNT/G receptor-binding domain crystal structure provides a context for examining these binding interactions and a platform for understanding the physiological relevance of different Syt receptor isoforms in vivo.

Universal, colorimetric microRNA detection strategy based on target-catalyzed toehold-mediated strand displacement reaction

Science.gov (United States)

Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu

2018-02-01

In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.

Synthesis, structural studies and biological properties of new TBA analogues containing an acyclic nucleotide.

Science.gov (United States)

Coppola, Teresa; Varra, Michela; Oliviero, Giorgia; Galeone, Aldo; D'Isa, Giuliana; Mayol, Luciano; Morelli, Elena; Bucci, Maria-Rosaria; Vellecco, Valentina; Cirino, Giuseppe; Borbone, Nicola

2008-09-01

A new modified acyclic nucleoside, namely N(1)-(3-hydroxy-2-hydroxymethyl-2-methylpropyl)-thymidine, was synthesized and transformed into a building block useful for oligonucleotide (ON) automated synthesis. A series of modified thrombin binding aptamers (TBAs) in which the new acyclic nucleoside replaces, one at the time, the thymidine residues were then synthesized and characterized by UV, CD, MS, and (1)H NMR. The biological activity of the resulting TBAs was tested by Prothrombin Time assay (PT assay) and by purified fibrinogen clotting assay. From a structural point of view, nearly all the new TBA analogues show a similar behavior as the unmodified counterpart, being able to fold into a bimolecular or monomolecular quadruplex structure depending on the nature of monovalent cations (sodium or potassium) coordinated in the quadruplex core. From the comparison of structural and biological data, some important structure-activity relationships emerged, particularly when the modification involved the TT loops. In agreement with previous studies we found that the folding ability of TBA analogues is more affected by modifications involving positions 4 and 13, rather than positions 3 and 12. On the other hand, the highest anti-thrombin activities were detected for aptamers containing the modification at T13 or T12 positions, thus indicating that the effects produced by the introduction of the acyclic nucleoside on the biological activity are not tightly connected with structure stabilities. It is noteworthy that the modification at T7 produces an ON being more stable and active than the natural TBA.

Comparative sequence and structural analyses of G-protein-coupled receptor crystal structures and implications for molecular models.

Directory of Open Access Journals (Sweden)

Catherine L Worth

Full Text Available BACKGROUND: Up until recently the only available experimental (high resolution structure of a G-protein-coupled receptor (GPCR was that of bovine rhodopsin. In the past few years the determination of GPCR structures has accelerated with three new receptors, as well as squid rhodopsin, being successfully crystallized. All share a common molecular architecture of seven transmembrane helices and can therefore serve as templates for building molecular models of homologous GPCRs. However, despite the common general architecture of these structures key differences do exist between them. The choice of which experimental GPCR structure(s to use for building a comparative model of a particular GPCR is unclear and without detailed structural and sequence analyses, could be arbitrary. The aim of this study is therefore to perform a systematic and detailed analysis of sequence-structure relationships of known GPCR structures. METHODOLOGY: We analyzed in detail conserved and unique sequence motifs and structural features in experimentally-determined GPCR structures. Deeper insight into specific and important structural features of GPCRs as well as valuable information for template selection has been gained. Using key features a workflow has been formulated for identifying the most appropriate template(s for building homology models of GPCRs of unknown structure. This workflow was applied to a set of 14 human family A GPCRs suggesting for each the most appropriate template(s for building a comparative molecular model. CONCLUSIONS: The available crystal structures represent only a subset of all possible structural variation in family A GPCRs. Some GPCRs have structural features that are distributed over different crystal structures or which are not present in the templates suggesting that homology models should be built using multiple templates. This study provides a systematic analysis of GPCR crystal structures and a consistent method for identifying

Comparative sequence and structural analyses of G-protein-coupled receptor crystal structures and implications for molecular models.

Science.gov (United States)

Worth, Catherine L; Kleinau, Gunnar; Krause, Gerd

2009-09-16

Up until recently the only available experimental (high resolution) structure of a G-protein-coupled receptor (GPCR) was that of bovine rhodopsin. In the past few years the determination of GPCR structures has accelerated with three new receptors, as well as squid rhodopsin, being successfully crystallized. All share a common molecular architecture of seven transmembrane helices and can therefore serve as templates for building molecular models of homologous GPCRs. However, despite the common general architecture of these structures key differences do exist between them. The choice of which experimental GPCR structure(s) to use for building a comparative model of a particular GPCR is unclear and without detailed structural and sequence analyses, could be arbitrary. The aim of this study is therefore to perform a systematic and detailed analysis of sequence-structure relationships of known GPCR structures. We analyzed in detail conserved and unique sequence motifs and structural features in experimentally-determined GPCR structures. Deeper insight into specific and important structural features of GPCRs as well as valuable information for template selection has been gained. Using key features a workflow has been formulated for identifying the most appropriate template(s) for building homology models of GPCRs of unknown structure. This workflow was applied to a set of 14 human family A GPCRs suggesting for each the most appropriate template(s) for building a comparative molecular model. The available crystal structures represent only a subset of all possible structural variation in family A GPCRs. Some GPCRs have structural features that are distributed over different crystal structures or which are not present in the templates suggesting that homology models should be built using multiple templates. This study provides a systematic analysis of GPCR crystal structures and a consistent method for identifying suitable templates for GPCR homology modelling that will

Structure models of G72, the product of a susceptibility gene to schizophrenia.

Science.gov (United States)

Kato, Yusuke; Fukui, Kiyoshi

2017-02-01

The G72 gene is one of the most susceptible genes to schizophrenia and is contained exclusively in the genomes of primates. The product of the G72 gene modulates the activity of D-amino acid oxidase (DAO) and is a small protein prone to aggregate, which hampers its structural studies. In addition, lack of a known structure of a homologue makes it difficult to use the homology modelling method for the prediction of the structure. Thus, we first developed a hybrid ab initio approach for small proteins prior to the prediction of the structure of G72. The approach uses three known ab initio algorithms. To evaluate the hybrid approach, we tested our prediction of the structure of the amino acid sequences whose structures were already solved and compared the predicted structures with the experimentally solved structures. Based on these comparisons, the average accuracy of our approach was calculated to be ∼5 Å. We then applied the approach to the sequence of G72 and successfully predicted the structures of the N- and C-terminal domains (ND and CD, respectively) of G72. The predicted structures of ND and CD were similar to membrane-bound proteins and adaptor proteins, respectively. © The Authors 2016. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Structure and anticoagulant activity of a sulfated galactan from the red alga, Gelidium crinale. Is there a specific structural requirement for the anticoagulant action?

Science.gov (United States)

Pereira, Maria G; Benevides, Norma M B; Melo, Marcia R S; Valente, Ana Paula; Melo, Fábio R; Mourão, Paulo A S

2005-09-05

Marine red algae are an abundant source of sulfated galactans with potent anticoagulant activity. However, the specific structural motifs that confer biological activity remain to be elucidated. We have now isolated and purified a sulfated galactan from the marine red alga, Gellidium crinale. The structure of this polysaccharide was determined using NMR spectroscopy. It is composed of the repeating structure -4-alpha-Galp-(1-->3)-beta-Galp1--> but with a variable sulfation pattern. Clearly 15% of the total alpha-units are 2,3-di-sulfated and another 55% are 2-sulfated. No evidence for the occurrence of 3,6-anhydro alpha-galactose units was observed in the NMR spectra. We also compared the anticoagulant activity of this sulfated galactan with a polysaccharide from the species, Botryocladia occidentalis, with a similar saccharide chain but with higher amounts of 2,3-di-sulfated alpha-units. The sulfated galactan from G. crinale has a lower anticoagulant activity on a clotting assay when compared with the polysaccharide from B. occidentalis. When tested in assays using specific proteases and coagulation inhibitors, these two galactans showed significant differences in their activity. They do not differ in thrombin inhibition mediated by antithrombin, but in assays where heparin cofactor II replaces antithrombin, the sulfated galactan from G. crinale requires a significantly higher concentration to achieve the same inhibitory effect as the polysaccharide from B. occidentalis. In contrast, when factor Xa instead of thrombin is used as the target protease, the sulfated galactan from G. crinale is a more potent anticoagulant. These observations suggest that the proportion and/or the distribution of 2,3-di-sulfated alpha-units along the galactan chain may be a critical structural motif to promote the interaction of the protease with specific protease and coagulation inhibitors.

MAZ-binding G4-decoy with locked nucleic acid and twisted intercalating nucleic acid modifications suppresses KRAS in pancreatic cancer cells and delays tumor growth in mice

DEFF Research Database (Denmark)

Cogoi, Susanna; Zorzet, Sonia; Rapozzi, Valentina

2013-01-01

and stability, two polycyclic aromatic hydrocarbon units (TINA or AMANY) were inserted internally, to cap the quadruplex. The most active G4-decoy (2998), which had two para-TINAs, strongly suppressed KRAS expression in Panc-1 cells. It also repressed their metabolic activity (IC50 = 520 nM), and it inhibited...... cell growth and colony formation by activating apoptosis. We finally injected 2998 and control oligonucleotides 5153, 5154 (2 nmol/mouse) intratumorally in SCID mice bearing a Panc-1 xenograft. After three treatments, 2998 reduced tumor xenograft growth by 64% compared with control and increased...

Computational docking, molecular dynamics simulation and subsite structure analysis of a maltogenic amylase from Bacillus lehensis G1 provide insights into substrate and product specificity.

Science.gov (United States)

Manas, Nor Hasmaliana Abdul; Bakar, Farah Diba Abu; Illias, Rosli Md

2016-06-01

Maltogenic amylase (MAG1) from Bacillus lehensis G1 displayed the highest hydrolysis activity on β-cyclodextrin (β-CD) to produce maltose as a main product and exhibited high transglycosylation activity on malto-oligosaccharides with polymerization degree of three and above. These substrate and product specificities of MAG1 were elucidated from structural point of view in this study. A three-dimensional structure of MAG1 was constructed using homology modeling. Docking of β-CD and malto-oligosaccharides was then performed in the MAG1 active site. An aromatic platform in the active site was identified which is responsible in substrate recognition especially in determining the enzyme's preference toward β-CD. Molecular dynamics (MD) simulation showed MAG1 structure is most stable when docked with β-CD and least stable when docked with maltose. The docking analysis and MD simulation showed that the main subsites for substrate stabilization in the active site are -2, -1, +1 and +2. A bulky residue, Trp359 at the +2 subsite was identified to cause steric interference to the bound linear malto-oligosaccharides thus prevented it to occupy subsite +3, which can only be reached by a highly bent glucose molecule such as β-CD. The resulted modes of binding from docking simulation show a good correlation with the experimentally determined hydrolysis pattern. The subsite structure generated from this study led to a possible mode of action that revealed how maltose was mainly produced during hydrolysis. Furthermore, maltose only occupies subsite +1 and +2, therefore could not be hydrolyzed or transglycosylated by the enzyme. This important knowledge has paved the way for a novel structure-based molecular design for modulation of its catalytic activities. Copyright © 2016 Elsevier Inc. All rights reserved.

Detection of virus-specific intrathecally synthesised immunoglobulin G with a fully automated enzyme immunoassay system

Directory of Open Access Journals (Sweden)

Weissbrich Benedikt

2007-05-01

Full Text Available Abstract Background The determination of virus-specific immunoglobulin G (IgG antibodies in cerebrospinal fluid (CSF is useful for the diagnosis of virus associated diseases of the central nervous system (CNS and for the detection of a polyspecific intrathecal immune response in patients with multiple sclerosis. Quantification of virus-specific IgG in the CSF is frequently performed by calculation of a virus-specific antibody index (AI. Determination of the AI is a demanding and labour-intensive technique and therefore automation is desirable. We evaluated the precision and the diagnostic value of a fully automated enzyme immunoassay for the detection of virus-specific IgG in serum and CSF using the analyser BEP2000 (Dade Behring. Methods The AI for measles, rubella, varicella-zoster, and herpes simplex virus IgG was determined from pairs of serum and CSF samples of patients with viral CNS infections, multiple sclerosis and of control patients. CSF and serum samples were tested simultaneously with reference to a standard curve. Starting dilutions were 1:6 and 1:36 for CSF and 1:1386 and 1:8316 for serum samples. Results The interassay coefficient of variation was below 10% for all parameters tested. There was good agreement between AIs obtained with the BEP2000 and AIs derived from the semi-automated reference method. Conclusion Determination of virus-specific IgG in serum-CSF-pairs for calculation of AI has been successfully automated on the BEP2000. Current limitations of the assay layout imposed by the analyser software should be solved in future versions to offer more convenience in comparison to manual or semi-automated methods.

Generation and characterisation of murine monoclonal antibodies specific for cervine immunoglobulin light chain, IgM and IgG

International Nuclear Information System (INIS)

Hibma, M.; Griffin, J.F.T.

1992-01-01

Monoclonal antibodies (mAb) which react with cervine immunoglobulin (Ig) light chain, IgM and IgG were produced using conventional cell fusion technology. Hybridoma supernatants were initially screened for specificity against cervine Ig using an enzyme-linked immunosorbent assay (ELISA). The specificity of supernatants against size-fractionated cervine Ig was further determined. Supernatants were characterised using western blotting and autoradiographic techniques. The mAb OU1G, OU2G and OU3G were specific for cervine gamma-chain of IgG, whereas OU1L was specific for light chain of Ig. A further mAb (OU1M) bound IgM and not IgG. These mAb were found to have varying cross-reactivity against Ig from other species

The spin-dependent structure function g1 of the deuteron

International Nuclear Information System (INIS)

Bueltmann, S.

1996-01-01

Results on the spin-dependent structure function g 1 d of the deuteron measured by the Spin Muon Collaboration at CERN are presented. They are based on deep-inelastic scattering of 190 GeV polarized muons off a polarized deuteron target in the kinematic range of 0.003 ≤ x Bj ≤ 0.7 and 1 GeV 2 ≤ Q 2 ≤ 60 GeV 2 . The structure function is found to be negative for small values of x Bj , while the proton structure function g 1 p measured earlier by the SMC is positive over the whole x Bj -range. The Bjorken sum rule is in good agreement with the first moments of the structure functions, while the Ellis-Jaffe sum rule is violated by more than three standard deviations for the deuteron measurement. (author)

Amplified fluorescent aptasensor through catalytic recycling for highly sensitive detection of ochratoxin A.

Science.gov (United States)

Wei, Yin; Zhang, Ji; Wang, Xu; Duan, Yixiang

2015-03-15

This paper describes a novel approach utilizing nano-graphite-aptamer hybrid and DNase I for the amplified detection of ochratoxin A (OTA) for the first time. Nano-graphite can effectively quench the fluorescence of carboxyfluorescein (FAM) labeled OTA specific aptamer due to their strong π-π; stacking interactions; while upon OTA addition, it will bind with aptamer to fold into an OTA-aptamerG-quadruplex structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the G-quadruplex structure can be cleaved by DNase I, and in such case OTA is delivered from the complex. The released OTA then binds other FAM-labeled aptamers on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled aptamers from the nano-graphite, which leads to significant amplification of the signal. Under the optimized conditions, the present amplified sensing system exhibits high sensitivity toward OTA with a limit of detection of 20nM (practical measurement), which is about 100-fold higher than that of traditional unamplified homogeneous assay. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples. The proposed assay is simple, cost-effective, and might open a door for the development of new assays for other biomolecules. This aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer. Copyright © 2014 Elsevier B.V. All rights reserved.

Thyrocyte-specific Gq/G11 deficiency impairs thyroid function and prevents goiter development.

Science.gov (United States)

Kero, Jukka; Ahmed, Kashan; Wettschureck, Nina; Tunaru, Sorin; Wintermantel, Tim; Greiner, Erich; Schütz, Günther; Offermanns, Stefan

2007-09-01

The function of the adult thyroid is regulated by thyroid-stimulating hormone (TSH), which acts through a G protein-coupled receptor. Overactivation of the TSH receptor results in hyperthyroidism and goiter. The Gs-mediated stimulation of adenylyl cyclase-dependent cAMP formation has been regarded as the principal intracellular signaling mechanism mediating the action of TSH. Here we show that the Gq/G11-mediated signaling pathway plays an unexpected and essential role in the regulation of thyroid function. Mice lacking the alpha subunits of Gq and G11 specifically in thyroid epithelial cells showed severely reduced iodine organification and thyroid hormone secretion in response to TSH, and many developed hypothyroidism within months after birth. In addition, thyrocyte-specific Galphaq/Galpha11-deficient mice lacked the normal proliferative thyroid response to TSH or goitrogenic diet, indicating an essential role of this pathway in the adaptive growth of the thyroid gland. Our data suggest that Gq/G11 and their downstream effectors are promising targets to interfere with increased thyroid function and growth.

Structural similarity and category-specificity

DEFF Research Database (Denmark)

Gerlach, Christian; Law, Ian; Paulson, Olaf B

2004-01-01

It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...

Site specific incorporation of heavy atom-containing unnatural amino acids into proteins for structure determination

Science.gov (United States)

Xie, Jianming [San Diego, CA; Wang, Lei [San Diego, CA; Wu, Ning [Boston, MA; Schultz, Peter G [La Jolla, CA

2008-07-15

Translation systems and other compositions including orthogonal aminoacyl tRNA-synthetases that preferentially charge an orthogonal tRNA with an iodinated or brominated amino acid are provided. Nucleic acids encoding such synthetases are also described, as are methods and kits for producing proteins including heavy atom-containing amino acids, e.g., brominated or iodinated amino acids. Methods of determining the structure of a protein, e.g., a protein into which a heavy atom has been site-specifically incorporated through use of an orthogonal tRNA/aminoacyl tRNA-synthetase pair, are also described.

Prevalence of rubella-specific IgG antibodies in unimmunized young female population

Directory of Open Access Journals (Sweden)

Jayakrishnan Thayyil

2016-01-01

Full Text Available Context: Rubella is a mild self-limiting disease all over the world; nevertheless, it is of significant public health importance due to its teratogenic effect of congenital rubella syndrome. Rubella vaccine is currently not included in the national immunization program in India. Rubella-specific IgG in the unvaccinated population is a marker of previous rubella infection. Rubella IgG estimation in children will provide data for initiation and necessary modification to the immunization strategy. Aims: In this background, this study was conducted with an aim to know the age-specific susceptibility of acquiring rubella infections and future risk of congenital rubella syndrome (CRS among girls. Settings and Design: This was a community-based, observational study. Participants and Methods: The study was conducted at a randomly selected rural area Mavoor Panchayath of Kozhikode District, Kerala, among adolescent girls. The estimation of rubella-specific IgG antibody was done by quantitative enzyme-linked immunosorbent assay method. IgG titer value of >15 IU was taken positive, 8-15 IU as equivocal, and <8 IU as negative. Statistical Analysis Used: Statistical analysis was performed using Statistical program for Social science version 16 for Windows. Chi-square test was applied to find out significant difference and Fisher′s exact test wherever applicable. Results: The data and blood sample collection was done from 250 girls. The mean IgG titer was 151.93 ± 128.78 IU, and as per the criteria, 68.3% were positive, 28.5% were negative, and 3.2% were equivocal. At this age, majority (68.3% of the girls get protection by natural infection without any vaccine. Some girls (32% may remain susceptible to infection during adulthood and pregnancy. Conclusions: Natural rubella infection was widely prevalent among child population and at this age. An immunization policy recommending rubella-containing vaccine is highly desirable to prevent rubella and CRS.

CMV-specific T cell isolation from G-CSF mobilized peripheral blood: depletion of myeloid progenitors eliminates non-specific binding of MHC-multimers.

Science.gov (United States)

Beloki, Lorea; Ciaurriz, Miriam; Mansilla, Cristina; Zabalza, Amaya; Perez-Valderrama, Estela; Samuel, Edward R; Lowdell, Mark W; Ramirez, Natalia; Olavarria, Eduardo

2014-11-19

Cytomegalovirus (CMV)-specific T cell infusion to immunocompromised patients following allogeneic Hematopoietic Stem Cell Transplantation (allo-HSCT) is able to induce a successful anti-viral response. These cells have classically been manufactured from steady-state apheresis samples collected from the donor in an additional harvest prior to G-CSF mobilization, treatment that induces hematopoietic stem cell (HSC) mobilization to the periphery. However, two closely-timed cellular collections are not usually available in the unrelated donor setting, which limits the accessibility of anti-viral cells for adoptive immunotherapy. CMV-specific cytotoxic T cell (CTL) manufacture from the same G-CSF mobilized donor stem cell harvest offers great regulatory advantages, but the isolation using MHC-multimers is hampered by the high non-specific binding to myeloid progenitors, which reduces the purity of the cellular product. In the present study we describe an easy and fast method based on plastic adherence to remove myeloid cell subsets from 11 G-CSF mobilized donor samples. CMV-specific CTLs were isolated from the non-adherent fraction using pentamers and purity and yield of the process were compared to products obtained from unmanipulated samples. After the elimination of unwanted cell subtypes, non-specific binding of pentamers was notably reduced. Accordingly, following the isolation process the purity of the obtained cellular product was significantly improved. G-CSF mobilized leukapheresis samples can successfully be used to isolate antigen-specific T cells with MHC-multimers to be adoptively transferred following allo-HSCT, widening the accessibility of this therapy in the unrelated donor setting. The combination of the clinically translatable plastic adherence process to the antigen-specific cell isolation using MHC-multimers improves the quality of the therapeutic cellular product, thereby reducing the clinical negative effects associated with undesired

Elevated Serum IgG4 Defines Specific Clinical Phenotype of Rheumatoid Arthritis

Directory of Open Access Journals (Sweden)

Le-Feng Chen

2014-01-01

Full Text Available Objectives. To explore the correlation of serum IgG4 (sIgG4 with clinical manifestations or therapeutic response in rheumatoid arthritis (RA. Methods. Consecutive 136 RA patients were recruited and followed up at regular interval. SIgG4 was detected by immunonephelometry. Serial synovial tissue sections from 46 RA patients were stained immunohistochemically for IgG4. Results. Forty-six percent of 136 RA patients had elevated sIgG4. Patients with elevated sIgG4 had higher sIgG4/sIgG ratio, C-reactive protein, erythrocyte sedimentation rate, rheumatoid factor, and anticyclic citrullinated peptide antibodies than those with normal sIgG4 (all P<0.05. Among 45 patients who received methotrexate and leflunomide therapy, 50% (9/18 of patients with elevated sIgG4 and 85% (23/27 of patients with normal sIgG4 reached therapeutic target (disease activity score of 28 joints < 3.2 at 6-month visit (χ2=6.508, P=0.011. IgG4-positive plasma cell count correlated positively with sIgG4, total synovitis score, and CD3-, CD20-, and CD38-positive cell counts (all P<0.05. Conclusions. Our results showed that elevated sIgG4 in RA is common and disproportional to total IgG and RA with elevated sIgG4 may be a specific clinical phenotype with higher disease activity, higher level of autoantibodies, and poor response to methotrexate and leflunomide therapy.

Specific Abilities May Increment Psychometric g for High Ability Populations

Science.gov (United States)

2016-04-14

tend to sort themselves into jobs that are commensurate with their ability level ( McCormick , DeNisi, & Staw, 1979; McCormick , Jeanneret, & Mecham...of Genetic Psychology, 153, 229-230. Specific abilities, g, & high ability populations 14 McCormick , E. J., DeNisi, A. S., & Shaw, J. B... McCormick , E. J., Jeanneret, P. R., & Mecham, R. C. (1972). A study of job characteristics and job dimensions as based on the Position Analysis Questionnaire

ROLE OF PREEXISTING VIRUS-SPECIFIC IgG IN PRIMARY DISEASE AND IN REINFECTION WITH RESPIRATORY SYNCYTIAL VIRUS

Directory of Open Access Journals (Sweden)

V. Z. Krivitskaya

2012-01-01

Full Text Available Abstract. The aim of the study is evaluation of links between presence in blood of specific pre-existing IgG to respiratory-syncytial virus (RSV, clinical course of RSV infection and character specific to RSV humoral immune response in patients of different ages. The antibodies were detected by ELISA using whole RS virus or synthetic peptides corresponded to the selected determinants of the envelope RSV proteins. It was shown that RS specific maternal IgG antibodies passively transferred to babies in utero can circulate in the blood up to 10 months of life. The analysis of paired sera of 45 babies in the age of 1–10 months revealed firstly that presence of maternal IgG specific antibodies to the conservative B-cell immunogenic determinants of the F-protein (amino acids 221–232 and/or the G-protein (amino acids 152–164 and 184–198 is coupled with more high morbidity of primary RSV infection (89% versus 56%, p = 0.023, and also with more high frequency of complicated by bronchus obstruction course of the disease (81% versus 20%, р = 0.001 in compare with babies who were serologically negative to the maternal determinants specific antibodies. The correlation analysis has shown that the high presence of maternal determinant-specific IgG in the blood in babies till 10 months of life is associated in the case of primary infection with disbalance of humoral anti-viral immune response: intensive synthesis of serum RSV IgA. This is evidence of complicated course of infection with simultaneous suppression of response to RSV specific IgG. As opposed to the primary RSV infection in patients older than 3 years (n = 121 it was not detected links between anamnestic determinant-specific IgG synthesized by own immune system as the results of previous disease episodes and synthesis of anti-RSV IgG, IgM, IgE and IgA in RSV re-infections. In the contrast to babies in more older patients the feedback connection between level of pre-existing determinant-specific

Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

DEFF Research Database (Denmark)

Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub

2018-01-01

Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...

The "G-Spot" Is Not a Structure Evident on Macroscopic Anatomic Dissection of the Vaginal Wall.

Science.gov (United States)

Hoag, Nathan; Keast, Janet R; O'Connell, Helen E

2017-12-01

Controversy exists in the literature regarding the presence or absence of an anatomic "G-spot." However, few studies have examined the detailed topographic or histologic anatomy of the putative G-spot location. To determine the anatomy of the anterior vaginal wall and present detailed, systematic, accessible findings from female cadaveric dissections to provide anatomic clarity with respect to this location. Systematic anatomic dissections were performed on 13 female cadavers (32-97 years old, 8 fixed and 5 fresh) to characterize the gross anatomy of the anterior vaginal wall. Digital photography was used to document dissections. Dissection preserved the anterior vaginal wall, urethra, and clitoris. In 9 cadavers, the vaginal epithelial layer was reflected to expose the underlying urethral wall and associated tissues. In 4 cadavers, the vaginal wall was left intact before preservation. Once photographed, 8 specimens were transversely sectioned for macroscopic inspection and histologic examination. The presence or absence of a macroscopic anatomic structure at detailed cadaveric pelvis dissection that corresponds to the previously described G-spot and gross anatomic description of the anterior vaginal wall. Deep to the lining epithelium of the anterior vaginal wall is the urethra. There is no macroscopic structure other than the urethra and vaginal wall lining in the location of the putative G-spot. Specifically, there is no apparent erectile or "spongy" tissue in the anterior vaginal wall, except where the urethra abuts the clitoris distally. The absence of an anatomic structure corresponding to the putative G-spot helps clarify the controversy on this subject. Limitations to this study include limited access to specimens immediately after death and potential for observational bias. In addition, age, medical history, and cause of death are not publishable for privacy reasons. However, it is one of the most thorough and complete anatomic evaluations documenting the

Structuring Formal Requirements Specifications for Reuse and Product Families

Science.gov (United States)

Heimdahl, Mats P. E.

2001-01-01

In this project we have investigated how formal specifications should be structured to allow for requirements reuse, product family engineering, and ease of requirements change, The contributions of this work include (1) a requirements specification methodology specifically targeted for critical avionics applications, (2) guidelines for how to structure state-based specifications to facilitate ease of change and reuse, and (3) examples from the avionics domain demonstrating the proposed approach.

DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

Science.gov (United States)

Thys, Ryan Griffin; Wang, Yuh-Hwa

2015-11-27

DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Structure, stability and behaviour of nucleic acids in ionic liquids

Science.gov (United States)

Tateishi-Karimata, Hisae; Sugimoto, Naoki

2014-01-01

Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

DEFF Research Database (Denmark)

Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

2016-01-01

1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

Facile method for the site-specific, covalent attachment of full-length IgG onto nanoparticles.

Science.gov (United States)

Hui, James Zhe; Al Zaki, Ajlan; Cheng, Zhiliang; Popik, Vladimir; Zhang, Hongtao; Luning Prak, Eline T; Tsourkas, Andrew

2014-08-27

Antibodies, most commonly IgGs, have been widely used as targeting ligands in research and therapeutic applications due to their wide array of targets, high specificity and proven efficacy. Many of these applications require antibodies to be conjugated onto surfaces (e.g. nanoparticles and microplates); however, most conventional bioconjugation techniques exhibit low crosslinking efficiencies, reduced functionality due to non-site-specific labeling and random surface orientation, and/or require protein engineering (e.g. cysteine handles), which can be technically challenging. To overcome these limitations, we have recombinantly expressed Protein Z, which binds the Fc region of IgG, with an UV active non-natural amino acid benzoylphenyalanine (BPA) within its binding domain. Upon exposure to long wavelength UV light, the BPA is activated and forms a covalent link between the Protein Z and the bound Fc region of IgG. This technology was combined with expressed protein ligation (EPL), which allowed for the introduction of a fluorophore and click chemistry-compatible azide group onto the C-terminus of Protein Z during the recombinant protein purification step. This enabled the crosslinked-Protein Z-IgG complexes to be efficiently and site-specifically attached to aza-dibenzocyclooctyne-modified nanoparticles, via copper-free click chemistry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structure-function analysis of STING activation by c[G(2',5')pA(3',5')p] and targeting by antiviral DMXAA.

Science.gov (United States)

Gao, Pu; Ascano, Manuel; Zillinger, Thomas; Wang, Weiyi; Dai, Peihong; Serganov, Artem A; Gaffney, Barbara L; Shuman, Stewart; Jones, Roger A; Deng, Liang; Hartmann, Gunther; Barchet, Winfried; Tuschl, Thomas; Patel, Dinshaw J

2013-08-15

Binding of dsDNA by cyclic GMP-AMP (cGAMP) synthase (cGAS) triggers formation of the metazoan second messenger c[G(2',5')pA(3',5')p], which binds the signaling protein STING with subsequent activation of the interferon (IFN) pathway. We show that human hSTING(H232) adopts a "closed" conformation upon binding c[G(2',5')pA(3',5')p] and its linkage isomer c[G(2',5')pA(2',5')p], as does mouse mSting(R231) on binding c[G(2',5')pA(3',5')p], c[G(3',5')pA(3',5')p] and the antiviral agent DMXAA, leading to similar "closed" conformations. Comparing hSTING to mSting, 2',5'-linkage-containing cGAMP isomers were more specific triggers of the IFN pathway compared to the all-3',5'-linkage isomer. Guided by structural information, we identified a unique point mutation (S162A) placed within the cyclic-dinucleotide-binding site of hSTING that rendered it sensitive to the otherwise mouse-specific drug DMXAA, a conclusion validated by binding studies. Our structural and functional analysis highlights the unexpected versatility of STING in the recognition of natural and synthetic ligands within a small-molecule pocket created by the dimerization of STING. Copyright © 2013 Elsevier Inc. All rights reserved.

A sensitive electrochemical aptasensor based on palladium nanoparticles decorated graphene–molybdenum disulfide flower-like nanocomposites and enzymatic signal amplification

Energy Technology Data Exchange (ETDEWEB)

Jing, Pei; Yi, Huayu; Xue, Shuyan; Chai, Yaqin; Yuan, Ruo; Xu, Wenju, E-mail: xwju@swu.edu.cn

2015-01-01

Highlights: • PDDA–G–MoS{sub 2} nanoflowers were firstly used for the fabrication of thrombin aptasensor. • MoS{sub 2} was adopted to enhance the surface area of graphene and accelerate the electron transfer. • GOD, PdNPs and hemin/G-quadruplex could amplify the electrochemical signal through synergetic catalysis. • The proposed aptasensor displayed an improved sensitivity. - Abstract: In the present study, with the aggregated advantages of graphene and molybdenum disulfide (MoS{sub 2}), we prepared poly(diallyldimethylammonium chloride)–graphene/molybdenum disulfide (PDDA–G–MoS{sub 2}) nanocomposites with flower-like structure, large surface area and excellent conductivity. Furthermore, an advanced sandwich-type electrochemical assay for sensitive detection of thrombin (TB) was fabricated using palladium nanoparticles decorated PDDA–G–MoS{sub 2} (PdNPs/PDDA–G–MoS{sub 2}) as nanocarriers, which were functionalized by hemin/G-quadruplex, glucose oxidase (GOD), and toluidine blue (Tb) as redox probes. The signal amplification strategy was achieved as follows: Firstly, the immobilized GOD could effectively catalyze the oxidation of glucose to gluconolactone, coupling with the reduction of the dissolved oxygen to H{sub 2}O{sub 2}. Then, both PdNPs and hemin/G-quadruplex acting as hydrogen peroxide (HRP)-mimicking enzyme could further catalyze the reduction of H{sub 2}O{sub 2}, resulting in significant electrochemical signal amplification. So the proposed aptasensor showed high sensitivity with a wide dynamic linear range of 0.0001 to 40 nM and a relatively low detection limit of 0.062 pM for TB determination. The strategy showed huge potential of application in protein detection and disease diagnosis.

Hormesis of specific IgG antibody to rabies virus in serum of mice irradiated with low dose γ-rays

International Nuclear Information System (INIS)

Liu Qingjie; Chen Deqing

1998-01-01

Objective: To explore the effect of low dose ionizing radiation on specific antibody in mouse serum. Methods: Kunming strain male mice, weighing 18-22 g, aged 6-8 weeks, were immunized intraperitoneally with rabies vaccine after exposure to cobalt-60 γ-rays. The specific IgG antibody against rabies virus in mouse serum was measured. Results: (1) The serum levels of specific IgG in mice irradiated with 5-30 cGy γ-rays were significantly elevated in comparison with those in control mice (P<0.01), the optimum stimulating dose being 10 cGy. (2) Exposure to 10 cGy caused significant enhancement and earlier emergence of the peak level of specific IgG in serum. (3) The hormesis of specific IgG to rabies virus induced by 10 cGy γ-rays could last one week at least. Conclusion: Low dose ionizing radiation can enhance the level of specific antibody in mouse serum, and this effect can last for one week at least

Molecular insights into the specific recognition between the RNA binding domain qRRM2 of hnRNP F and G-tract RNA: A molecular dynamics study.

Science.gov (United States)

Wang, Lingyun; Yan, Feng

2017-12-09

Heterogeneous nuclear ribonucleoprotein F (hnRNP F) controls the expression of various genes through regulating the alternative splicing of pre-mRNAs in the nucleus. It uses three quasi-RNA recognition motifs (qRRMs) to recognize G-tract RNA which contains at least three consecutive guanines. The structures containing qRRMs of hnRNP F in complex with G-tract RNA have been determined by nuclear magnetic resonance (NMR) spectroscopy, shedding light on the recognition mechanism of qRRMs with G-tract RNA. However, knowledge of the recognition details is still lacking. To investigate how qRRMs specifically bind with G-tract RNA and how the mutations of any guanine to an adenine in the G-tract affect the binding, molecular dynamics simulations with binding free energy analysis were performed based on the NMR structure of qRRM2 in complex with G-tract RNA. Simulation results demonstrate that qRRM2 binds strongly with G-tract RNA, but any mutation of the G-tract leads to a drastic reduction of the binding free energy. Further comparisons of the energetic components reveal that van der Waals and non-polar interactions play essential roles in the binding between qRRM2 and G-tract RNA, but the interactions are weakened by the effect of RNA mutations. Structural and dynamical analyses indicate that when qRRM2 binds with G-tract RNA, both qRRM2 and G-tract maintain stabilized structures and dynamics; however, the stability is disrupted by the mutations of the G-tract. These results provide novel insights into the recognition mechanism of qRRM2 with G-tract RNA that are not elucidated by the NMR technique. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of FMD virus type specific IgG1, IgG2 and IgA antibodies in milk and serum of buffaloes vaccinated with oil adjuvanted polyvalent FMD vaccine

Directory of Open Access Journals (Sweden)

R. Sharma

2010-02-01

Full Text Available The present investigation was carried out on 15 randomly selected milch buffaloes divided into three groups on the basis of lactation at an organized farm, to study the foot and mouth disease virus type specific antibodies in milk and serum following FMD vaccination. Milk and serum samples collected before vaccination i.e. 0 day and on 7, 14, 28, 42 and 56 days post vaccination, were analyzed for the detection of FMD virus specific IgG1, IgG2 and IgA antibody response by indirect double antibody sandwich ELISA. Significant FMD virus type specific antibody titres (IgG1, IgG2 and IgA were detected in milk and serum of buffaloes on different days post vaccination, though the levels of antibodies were lower in milk as compared to serum. FMD virus type specific IgG1 was found to be the predominant subclass as compared to IgG2 and IgA both in milk and serum of vaccinated buffaloes. Milk and serum IgG1, IgG2 and IgA antibody titres were positively correlated with values of regression coefficient (R as 0.506, 0.434 and 0.396, respectively.