WorldWideScience

Sample records for species oreochromis niloticus

  1. Oreochromis niloticus

    African Journals Online (AJOL)

    USER

    2015-06-01

    Oreochromis niloticus) fed on diets containing watermelon (Citrullus lanatus) seedmeal were evaluated using packed cell volume. (PCV); haemoglobin content (Hb), white blood cell count (WBC), red blood cell count (RBC), ...

  2. Oreochromis niloticus

    African Journals Online (AJOL)

    Effect of diets containing cocoa bean shell and coconut oil cake on the growth of Oreochromis niloticus (LINNE, 1758) in pond. Yacouba BAMBA 1*, N'Golo OUATTARA 2, Siaka OUATTARA 2,. Allassane OUATTARA 1 and Germain GOURENE 1. 1 Laboratoire d'Environnement et de Biologie Aquatique (LEBA), UFR des ...

  3. Oreochromis niloticus

    African Journals Online (AJOL)

    Yomi

    2012-02-28

    Feb 28, 2012 ... 2Nucleic Acids Research Department, Genetic Engineering and Biotechnology Research Institute (GEBRI), City for. Scientific Research and ... neglected in breeding programs for aquaculture species. Quality traits can usually be ... alike is naturally of major concern to the fish farming industry (Rasmussen ...

  4. Molecular identification and pathogenicity of Citrobacter and Serratia species isolated from cultured Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Manal I. El-Barbary

    2017-09-01

    Full Text Available This study aimed to isolate and characterize some pathogenic bacterial strains belonging to the family Enterobacteriaceae. They had been isolated from gills, liver, kidney and skin of naturally infected Oreochromis niloticus and had been identified by biochemical test and 16S rRNA gene using four universal primers. Additionally, the isolates were tested for antimicrobial susceptibility, histopathological alterations of liver, kidney and gills and the pathogenicity of the identified isolates for O. niloticus. The results of phylogenetic analysis placed the isolates in the family Enterobacteriaceae (genera Serratia and Citrobacter based on 99% homology. The primer pair (17F and 1390R is the most appropriate pair of universal primers employed for the identification of 16S rRNA gene as it covers as much as possible of the variable regions (Vs. V1 and V2 regions of 16S rRNA gene presented weak evidence of the diversity of the genera Serratia. The mortality rate was 40–60% after challenging O. niloticus by identified isolates, which revealed its sensitivity to ciprofloxacin and norfloxacin. Histological changes showed dilation in sinusoids with severe vacuolar degeneration in the liver, tubular degeneration and hemorrhage between renal tubules with pyknotic nuclei in the kidney, epithelial hyperplasia, aneurism and evident epithelium interstitial edema in gills of O. niloticus. This study concluded that these isolates should be considered as an opportunistic pathogen of O. niloticus. The study also states that the sequencing of 16S rRNA is an important tool for the identification of unknown bacterial species of fish pathogen. Keywords: Citrobacter sp., Serratia sp., Phylogenetic analysis, Histology, Antibiotic sensitivity, Oreochromis niloticus

  5. The physical growth of Oreochromis niloticus and three plant species on the aquaponic technology

    Science.gov (United States)

    Mustikasari, A.; Marwoto, P.; Iswari, R. S.

    2018-03-01

    The physical growth of Oreochromis niloticus fish and three types of plants consist of Ipomoea Aquatica, Brassica rapa, and Capsicum annuum on the aquaponic technology have been studied. The aquaponic technology system has been done with 200 fishes m-3, water pump with 15 watts solar energy panel, physical and biological filter, and deep flow technique (DFT). In this study, we have reported that the specific growth rate (SGR), survival (SR), Feed conversion ratio (FCR), and Wet weight (W) are used as the physical growth indicator of Oreochromis niloticus fish, while the length and the number of leaves of plants are used as the physical growth indicator of plants. The physical growth of Oreochromis niloticus fish showed that SGR is 5,56% day-1, SR is 97,67%, FCR is 0,92g and the wet weight is 1220g. The physical growth of the plant in aquaponic technology systems has been compared with the hydroponic treatment systems as controls. Analysis with t-test shows that physical growth of Ipomoea Aquatica and Brassica rapa has no significant difference respectively, whereas Capsicum annuum has significant differences compared with controls. Also, Brassica rapa in the aquaponic technology system shows a more yellow leaf color than the control. Based on these results, we conclude that aquaponic technology system provides effective results for the physical growth of Oreochromis niloticus with Ipomoea Aquatica, while additional nutrients for the both Brassica rapa and Capsicum annuum are required.

  6. Proximate composition of Oreochromis niloticus subjected to ...

    African Journals Online (AJOL)

    smoked method gave the highest level of stabilizing in the proximate composition on storage for 28 days. Keywords: Oreochromis niloticus, Preservation methods, Proximate status. Animal Research International (2012) 9(3): 1619 – 1624 ...

  7. Hybridisation between native Oreochromis species and introduced ...

    African Journals Online (AJOL)

    The Nile tilapia Oreochromis niloticus has been introduced throughout Africa outside its native range for aquaculture purposes. Hybridisation between escaped O. niloticus and native Oreochromis species is of concern due to potential negative effects on wild genetic resources for conservation, aquaculture and capture ...

  8. Haematological parameters of Oreochromis niloticus on treatment ...

    African Journals Online (AJOL)

    ... level) was 1.99 mg. The results have been interpreted in the light of existing data on the haematological responses Orechromis niloticus exposed to crude cassava extract. Keywords: Crude cassava, Leaf extract, Haematological parameters. Oreochromis niloticus. Nigerian Journal of Fisheries Vol. 4 (2) 2007: pp. 114-123 ...

  9. Prevalence of helminth infection in Oreochromis niloticus (L) in a fish ...

    African Journals Online (AJOL)

    The parasitic infection rates of cultured Oreochromis niloticus in Rock Water Fish Farm; Jos was surveyed for five months (July–November 1996). A total of 250 Oreochromis niloticus were randomly caught from the earthen ponds. The fish were examined for helminth parasites. Three species of helminthes comprising two ...

  10. Identification of Oreochromis niloticus (Linnaeus, 1758) and Tilapia ...

    African Journals Online (AJOL)

    Isoelectric focusing methodology using LKB 2117 Multiphor 11 electrofocusing apparatus was used for electofocusing and identification of Oreochromis niloticus and Tilapia zilli. The electrographs of the two species suggest clear protein differences producing species specific patterns. There were variations in the protein ...

  11. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  12. Growth response of Oreochromis niloticus fingerlingsfed fermented ...

    African Journals Online (AJOL)

    The study was carried out to determine the growth response of Oreochromis niloticus fingerlings fed fermented Parkia biglobosa (locust beans) diets. P. biglobosa served as an attractant in these diets. Two hundred and twenty-five fingerlings (10.1±0.1 g/fish) mixed sex were treated with five diets containing maize, fishmeal, ...

  13. Haematological Responses Of Oreochromis Niloticus (Trewavas ...

    African Journals Online (AJOL)

    ... effect on the blood forming system as well as on the immune system of the fish and also affected the physico-chemical nature of the test water, which adversely affected the health of the fish. Keywords: Haematological, Oreochromis niloticus, poisonous extracts, local plants. Nigerian Journal of Fisheries Vol. 5 (1) 2008: pp.

  14. Toxicological effects of the herbicide oxyfluorfen on acetylcholinesterase in two fish species: Oreochromis niloticus and Gambusia affinis.

    Science.gov (United States)

    Hassanein, Hamdy M A

    2002-01-01

    The alterations of the AChE activity in the brains of two fresh water fishes; Oreochromis niloticus and Gambusia affinis were measured after exposure to acute, sub-acute and chronic concentrations from the widely used herbicide; oxyfluorfen. Bioassays were conducted under controlled laboratory conditions. The used concentrations were acute: LC50 for 6 days, sub-acute 1/3 LC50 for 15 days and chronic 1/10 LC50 for 30 days. The obtained results showed marked inhibitory effects of the herbicide on the activity of AChE in both fishes. However, these effects were more pronounced in O. niloticus where the decline in the enzyme activity ranged from 19.7 to 81.28% while in case of G. affinis it ranged from 5.7 to 36.7%. These findings demonstrate that G. affinis is most tolerant to oxyfluorfen toxicity compared with O. niloticus.

  15. Production of salinity tolerant Nile tilapia, Oreochromis niloticus ...

    African Journals Online (AJOL)

    Production of salinity tolerant Nile tilapia, Oreochromis niloticus through traditional and modern breeding methods: II. Application of genetically modified breeding by introducing foreign DNA into fish gonads.

  16. Recent introgressive hybridization revealed by exclusive mtDNA transfer from Oreochromis leucostictus (Trewavas, 1933) to Oreochromis niloticus (Linnaeus, 1758) in Lake Baringo, Kenya

    OpenAIRE

    Nyingi, Dorothy W.; Agnèse, Jean-François

    2007-01-01

    Nuclear DNA and mtDNA polymorphisms were surveyed in various species of East African Oreochromis. In Lake Baringo, where only Oreochromis niloticus baringoensis is present, alien mtDNA haplotypes were observed, apparently the result of introgressive hybridization with Oreochromis leucostictus. This introgression is not accompanied by any substantial or recorded transfer of nuclear genes into O. n. baringoensis.

  17. Growth rates of alien Oreochromis niloticus and indigenous ...

    African Journals Online (AJOL)

    Growth rates of indigenous Oreochromis mortimeri and alien Oreochromis niloticus from Lake Kariba were estimated from samples collected in 1997–2000, 2003–2005 and 2010–2011. Growth zones on scales and otoliths of O. niloticus and on the otoliths and opercula of O. mortimeri were deposited annually.

  18. Production d'alevins de Tilapia (Oreochromis niloticus) avec 3 ...

    African Journals Online (AJOL)

    2015 International Formulae Group. All rights reserved. Mots clés: Alevins, Oreochromis niloticus, aliment, croissance, performance. English Title: Production of young Tilapia fish (Oreochromis niloticus) with 3 foods containing under agroindustrial products in the North of Senegal. English Abstract. The study was carried out ...

  19. Growth rates of alien Oreochromis niloticus and indigenous Oreochromis mortimeri in Lake Kariba, Zimbabwe

    NARCIS (Netherlands)

    Chifamba, P. C.; Videler, J. J.

    2014-01-01

    Growth rates of indigenous Oreochromis mortimeri and alien Oreochromis niloticus from Lake Kariba were estimated from samples collected in 1997-2000, 2003-2005 and 2010-2011. Growth zones on scales and otoliths of O. niloticus and on the otoliths and opercula of O. mortimeri were deposited annually.

  20. Kinematics of mouthbrooding in Oreochromis niloticus (Cichlidae).

    Science.gov (United States)

    Van Wassenbergh, Sam; Joris, Iris; Desclée, Mathieu; Liew, Hon Jung; De Boeck, Gudrun; Adriaens, Dominique; Aerts, Peter

    2016-05-15

    Many species from several different families of fishes perform mouthbrooding, where one of the sexes protects and ventilates the eggs inside the mouth cavity. This ventilation behaviour differs from gill ventilation outside the brooding period, as the normal, small-amplitude suction-pump respiration cycles are alternated with actions including near-simultaneous closed-mouth protrusions and high-amplitude depressions of the hyoid. The latter is called churning, referring to its hypothetical function in moving around and repositioning the eggs by a presumed hydrodynamic effect of the marked shifts in volume along the mouth cavity. We tested the hypothesis that churning causes the eggs located posteriorly in the mouth cavity to move anteriorly away from the gill entrance. This would prevent or clear accumulations of brood at the branchial basket, which would otherwise hinder breathing by the parent. Dual-view videos of female Nile tilapias (Oreochromis niloticus) during mouthbrooding showed that churning involves a posterior-to-anterior wave of expansion and compression of the head volume. Flow visualisation with polyethylene microspheres revealed a significant inflow of water entering the gill slits at the zone above the pectoral fin base, followed by a predominantly ventral outflow passing the ventrolaterally flapping branchiostegal membranes. X-ray videos indicated that particularly the brood located close to the gills is moved anteriorly during churning. These data suggest that, in addition to mixing of the brood to aid its oxygenation, an important function of the anterior flow through the gills and buccal cavity during churning is to prevent clogging of the eggs near the gills. © 2016. Published by The Company of Biologists Ltd.

  1. A Relative Prevalence of Oreochromis Niloticus, Clarias Gariepinus ...

    African Journals Online (AJOL)

    A total of 120 Clarias gariepinus, 120 of Heterotis niloticus and 150 Oreochromis niloticus were collected from integrated fish cum chicken reservoir for Aeromonas hydrophila screening. Samples were collected twice monthly for one calendar year. The physico-chemical parameters of the reservoir water were taken each ...

  2. Growth comparison of Nile tilapia (Oreochromis niloticus) and Blue ...

    African Journals Online (AJOL)

    Administrator

    2011-09-26

    Sep 26, 2011 ... This study was conducted to compare and evaluate the productive performance characteristics of the base generation (F0) of Nile tilapia, Oreochromis niloticus and Blue tilapia, Oreochromis aureus under the effect of interspecific hybridization and genetically modified breeding by introducing a fragmented.

  3. assimilation efficiency in two herbivores, oreochromis niloticus and ...

    African Journals Online (AJOL)

    Preferred Customer

    biologia 174:195–200. 8. Getachew Teferra (1993). The composition and nutri- tional status of the diet of Oreochromis niloticus in Lake Chamo, Ethiopia J. Fish Biol. 42:865–874. 9. Getachew Teferra, Bowen, S.H., Eyualem Abebe and. Zenebe Tadesse (2000a). Seasonal variations de- termine diet quality for Oreochromis ...

  4. Growth comparison of Nile tilapia (Oreochromis niloticus) and Blue ...

    African Journals Online (AJOL)

    This study was conducted to compare and evaluate the productive performance characteristics of the base generation (F0) of Nile tilapia, Oreochromis niloticus and Blue tilapia, Oreochromis aureus under the effect of interspecific hybridization and genetically modified breeding by introducing a fragmented purified DNA ...

  5. Growth parameters for Lates niloticus (L.), Bagrus docmak (Forsskal), Oreochromis niloticus (L.), Clarias gariepinus (Burchell) and Synodontis species derived from tag returns

    OpenAIRE

    Asila, A.A.; Okemwa, E.

    1999-01-01

    In a tagging experiment carried out in the Kenyan waters of Lake Victoria, an annual growth increment of 29 cm yr was obtained for Lates niloticus (L.). Growth parameters obtained using the von Bertalanffy model on the growth curve fitted by eye were L (inf.) = 122 cm yr and k = 0.26 yr. Data for other species tagged were inadequate to obtain meaningful results.

  6. Metacercarial Infection of Wild Nile Tilapia (Oreochromis niloticus) from Brazil

    Science.gov (United States)

    Pinto, Hudson A.; Mati, Vitor L. T.; Melo, Alan L.

    2014-01-01

    Fingerlings of Oreochromis niloticus collected in an artificial urban lake from Belo Horizonte, Minas Gerais, Brazil, were evaluated for natural infection with trematodes. Morphological taxonomic identification of four fluke species was performed in O. niloticus examined, and the total prevalence of metacercariae was 60.7% (37/61). Centrocestus formosanus, a heterophyid found in the gills, was the species with the highest prevalence and mean intensity of infection (31.1% and 3.42 (1–42), resp.), followed by the diplostomid Austrodiplostomum compactum (29.5% and 1.27 (1-2)) recovered from the eyes. Metacercariae of Drepanocephalus sp. and Ribeiroia sp., both found in the oral cavity of the fish, were verified at low prevalences (8.2% and 1.6%, resp.) and intensities of infection (only one metacercaria of each of these species per fish). These species of trematodes are reported for the first time in O. niloticus from South America. The potential of occurrence of these parasites in tilapia farming and the control strategies are briefly discussed. PMID:25485302

  7. Natural mating in Nile tilapia (Oreochromis niloticus L.) : implications for reproductive success, inbreeding and cannibalism

    NARCIS (Netherlands)

    Fessehaye, Y.

    2006-01-01

    Niletilapia ( Oreochromis niloticus L.) is one of the most important species among the commercially farmed tilapias. Both small-scale and commercial production of tilapia is rapidly expanding in many countries of the world because

  8. Effect of stocking density on tilapia ( Oreochromis niloticus Linnaeus ...

    African Journals Online (AJOL)

    The study was carried out to evaluate the effect of varying stocking densities on the growth, survival, and yield of tilapia (Oreochromis niloticus Linnaeus 1757) at the freshwater reservoir (average depth, 1.7 m) of the University of Agriculture Abeokuta, Nigeria, for a period of 3 months. Tilapia juvenile with a mean weight of ...

  9. Bacteria Associated with Fresh Tilapia Fish ( Oreochromis niloticus ...

    African Journals Online (AJOL)

    A research was conducted on bacteria micro flora associated with fresh Tilapia fish (Oreochromis niloticus) sold at Sokoto central market, Sokoto. Nigeria. Sections of the skin, gills and intestine of ten randomly selected fishes were aseptically removed by means of a sterile scalpel and pair of sterile scissors. Four (4g) each ...

  10. Heritability of cold tolerance in Nile tilapia, Oreochromis niloticus, juveniles

    NARCIS (Netherlands)

    Charo-Karisa, H.; Rezk, M.A.; Bovenhuis, H.; Komen, J.

    2005-01-01

    The inability of tilapia to tolerate low temperatures is of major economic concern as it reduces their growing season and leads to over winter mortality. In this study, cold tolerance of juvenile Nile tilapia, Oreochromis niloticus, was investigated and heritability estimates obtained. A total of 80

  11. A Survey of Nematode Infection in Oreochromis niloticus (L ...

    African Journals Online (AJOL)

    The incidence and intensity of nematode infection was investigated in Nile tilapia Oreochromis niloticus from Lake Kyoga, Uganda and 11% of the 406 fish examined were parasitized by nematodes of the genus Contracaecum. The prevalence of these parasites was greatest in the smallest and largest size classes, but this ...

  12. The Seasonal Food Habits of Oreochromis niloticus (Osteichthys ...

    African Journals Online (AJOL)

    Stomach contents of 424 adult and juvenile Oreochromis niloticus netted from the Ikpoba Reservoir were analysed. Phytoplankton formed the dominant food items of the fish during the dry and wet months of the sampling period. Zooplankton population in the fish diet was more pronounced during the wet months.

  13. Parasites on cultured Tilapia Oreochromis niloticus (Trewavas) in a ...

    African Journals Online (AJOL)

    4%). The organs affected include the gills, opercula skin, muscles, female gonads, alimentary system. Ecto and endo parasitic infestation were preponderant. The need for close monitoring of the feed and water qualities in aquaculture practices were also discussed. Key words: Parasites, Oreochromis niloticus, Infestation, ...

  14. Studies on the parasites of cultured Oreochromis niloticus (Cichlidae ...

    African Journals Online (AJOL)

    The parasitic infection rates of cultured Oreochromis niloticus in earthened pond in South Eastern Nigeria was surveyed over a 12-month period (July 1999 - June 2000). Out of the 300 specimens examined, 106 (35.33%) were infected with one or more parasites. The parasites recovered were Nematodes: Procamallanus ...

  15. Comparison of fried and baked fish Oreochromis niloticus cakes

    OpenAIRE

    Akinsiku, A.F.

    2008-01-01

    Oreochromis niloticus fish-in-cake were made to improve its food value as well as create new menu. Fried fish-in-cake was 66.2% appealing in its colour, taste, texture and odour to assessors than the 64% rating for baked fish-in-cake.

  16. Bacteria Associated with Fresh Tilapia Fish (Oreochromis niloticus ...

    African Journals Online (AJOL)

    acer

    The isolates were found to be of medical importance. Keywords: Bacteria, Tilapia fish ... target,Systemic bacterial disease: bacteria inwades the fish's body and ... Shinkafi & Ukwaja; Bacteria Associated with Fresh Tilapia Fish (Oreochromis niloticus) Sold At Sokoto Central Market in Sokoto, Nigeria. 218 more prone to raid ...

  17. Levels of Lead, Cadmium and Chromium in Oreochromis Niloticus ...

    African Journals Online (AJOL)

    Lead (Pb), Cadmium (Cd) and Chromium (Cr) levels in Oreochromis niloticus, aquatic plants, water and sawdust were collected and analyzed for Lead, Cadmium and Chromium using atomic absorption spectroscopy. Results obtained showed that sawdust had the highest Lead and Chromium contents of 32.0 + 0.99 μg/g ...

  18. Selection for growth of Nile tilapia (Oreochromis niloticus L.) in low-input environments

    NARCIS (Netherlands)

    Charo-Karisa, H.

    2006-01-01

    Nile tilapia,Oreochromis niloticus,is one of the most important species farmed in the world and is the mainstay of many

  19. Optimal feeding rate for Nile tilapia (Oreochromis niloticus)

    OpenAIRE

    Chowdhury, Dilip Kumar

    2011-01-01

    The aim of this study was to define optimal feeding rates for Nile tilapia (Oreochromis niloticus). Four experiments were carried out to evaluate the effect of feeding rate on growth performance of larger and juvenile tilapia by means of estimating growth rates, apparent nutrient digestibilities, feed utilization, body compositions, and nutrient and energy retentions. One nutritionally balanced diet (crude protein 342, crude fat 67, ash 47, starch 251 (all values in g (kg dry matter)-1)) was ...

  20. Toxicity of Malathion to Nile Tilapia Oreochromis Niloticus (Linn.) Fingerlings

    OpenAIRE

    Virginia Cariño,; Emmanuel Capinpin

    1993-01-01

    The toxicity of a commercial grade malathion on Nile tilapia, Oreochromis niloticus, fingerlings was determined. The 24, 48, 72, and 96-h LC50 of malathion on Nile tilapia fingerlings were 7.19, 5.43, 5.34, and 5.30 mg/l, respectively. Behavioral changes in fish included rapid opercular movement, hyperexcitability, darkening of the body, and contraction of trunk muscles. Moribund fish displayed labored opercular movement, severe contraction of the trunk muscles, erratic swimming, and total lo...

  1. Changes in feeding biology of Nile tilapia, Oreochromis niloticus (L.), after invasion of water hyacinth, Eichhornia crassipes (Mart.) Solms, in Lake Victoria, Kenya

    OpenAIRE

    Njiru, M.

    1999-01-01

    Oreochrimis niloticus (L.) was introduced to Lake victoria in the 1950s. It remained relatively uncommon in catches until 1965, when the numbers began to increase dramatically. It is now the third most important commercial fish species after the Nile perch, Lates niloticus (L.) and Rastrineobola argentea (Pellegrin). Oreochromis niloticus is considered a herbivore, feeding mostly on algae and plant material. The diet now appears to be more diversified , with insects, fish, algae and plant mat...

  2. Molecular characterization of the prolactin receptor in two fish species, tilapia Oreochromis niloticus and rainbow trout, Oncorhynchus mykiss: a comparative approach.

    Science.gov (United States)

    Prunet, P; Sandra, O; Le Rouzic, P; Marchand, O; Laudet, V

    2000-12-01

    We present recent information on the molecular characterization of the prolactin receptor (PRL-R) in two teleost species, tilapia (Oreochromis niloticus) and rainbow trout (Oncorhynchus mykiss), in the perspective of improved understanding of the physiological differences in the control of osmoregulatory function between these two fish species. Although our interest will mainly focus on osmoregulatory organs, we will also discuss evidence of the presence of PRL-R in other tissues such as gonads and hematopoietic organs. The first fish PRL-R was characterized in tilapia. This receptor is similar to that of the long form of mammalian PRL-R, but the most conserved region (extracellular domain) has only 53% identity with mammalian PRL-R. A rainbow trout PRL-R cDNA has been also isolated and appeared very similar in structure to tilapia PRL-R. Expression of the PRL-R gene was studied by Northern blotting for various tissues from tilapia and trout, and a unique transcript size of 3.2-3.4 kb was observed in all tissues studied (including male and female gonads, skin, brain, spleen, head, kidney, and circulating lymphocytes). Osmoregulatory organs (gills, kidney, intestine) were the richest tissues. Using in situ hybridization, PRL-R transcripts were localized in gill chloride cells, both in trout and tilapia. Analysis of PRL-R transcript levels in gills, kidney, and intestine indicated the maintenance of a high level of expression during adaptation to a hyperosmotic environment. These results support PRL being a pleiotropic hormone in fish and suggest the presence of a unique PRL-R form in tilapia and in trout. Finally, characterization of hormone receptor binding has been carried out in both species using a radioreceptor assay (in tilapia) or surface plasmon resonance (SPR) technology (in trout). These studies indicated the presence of a stable hormone-receptor complex in tilapia, while PRL binds to its receptor through an unstable homodimeric complex in trout. Thus, the

  3. Mercury exposure in the freshwater tilapia Oreochromis niloticus

    Energy Technology Data Exchange (ETDEWEB)

    Wang Rui [Department of Biology, Hong Kong University of Science and Technology (HKUST), Clear Water Bay, Kowloon (Hong Kong); Wong Minghung [Croucher Institute for Environmental Sciences, and Department of Biology, Hong Kong Baptist University (Hong Kong); Wang Wenxiong, E-mail: wwang@ust.h [Department of Biology, Hong Kong University of Science and Technology (HKUST), Clear Water Bay, Kowloon (Hong Kong)

    2010-08-15

    Mercury (Hg) can be strongly accumulated and biomagnified along aquatic food chain, but the exposure pathway remains little studied. In this study, we quantified the uptake and elimination of both inorganic mercury [as Hg(II)] and methylmercury (as MeHg) in an important farmed freshwater fish, the tilapia Oreochromis niloticus, using {sup 203}Hg radiotracer technique. The dissolved uptake rates of both mercury species increased linearly with Hg concentration (tested at ng/L levels), and the uptake rate constant of MeHg was 4 times higher than that of Hg(II). Dissolved uptake of mercury was highly dependent on the water pH and dissolved organic carbon concentration. The dietborne assimilation efficiency of MeHg was 3.7-7.2 times higher than that of Hg(II), while the efflux rate constant of MeHg was 7.1 times lower. The biokinetic modeling results showed that MeHg was the greater contributor to the overall mercury bioaccumulation and dietary exposure was the predominant pathway. - Trophic transfer was the predominant pathway for mercury accumulation in tilapia, and methylmercury was more important in contributing to Hg accumulation than Hg(II).

  4. Mercury exposure in the freshwater tilapia Oreochromis niloticus

    International Nuclear Information System (INIS)

    Wang Rui; Wong Minghung; Wang Wenxiong

    2010-01-01

    Mercury (Hg) can be strongly accumulated and biomagnified along aquatic food chain, but the exposure pathway remains little studied. In this study, we quantified the uptake and elimination of both inorganic mercury [as Hg(II)] and methylmercury (as MeHg) in an important farmed freshwater fish, the tilapia Oreochromis niloticus, using 203 Hg radiotracer technique. The dissolved uptake rates of both mercury species increased linearly with Hg concentration (tested at ng/L levels), and the uptake rate constant of MeHg was 4 times higher than that of Hg(II). Dissolved uptake of mercury was highly dependent on the water pH and dissolved organic carbon concentration. The dietborne assimilation efficiency of MeHg was 3.7-7.2 times higher than that of Hg(II), while the efflux rate constant of MeHg was 7.1 times lower. The biokinetic modeling results showed that MeHg was the greater contributor to the overall mercury bioaccumulation and dietary exposure was the predominant pathway. - Trophic transfer was the predominant pathway for mercury accumulation in tilapia, and methylmercury was more important in contributing to Hg accumulation than Hg(II).

  5. Broad Niche Overlap between Invasive Nile Tilapia Oreochromis niloticus and Indigenous Congenerics in Southern Africa: Should We be Concerned?

    Directory of Open Access Journals (Sweden)

    Tsungai A. Zengeya

    2015-07-01

    Full Text Available This study developed niche models for the native ranges of Oreochromis andersonii, O. mortimeri, and O. mossambicus, and assessed how much of their range is climatically suitable for the establishment of O. niloticus, and then reviewed the conservation implications for indigenous congenerics as a result of overlap with O. niloticus based on documented congeneric interactions. The predicted potential geographical range of O. niloticus reveals a broad climatic suitability over most of southern Africa and overlaps with all the endemic congenerics. This is of major conservation concern because six of the eight river systems predicted to be suitable for O. niloticus have already been invaded and now support established populations. Oreochromis niloticus has been implicated in reducing the abundance of indigenous species through competitive exclusion and hybridisation. Despite these well-documented adverse ecological effects, O. niloticus remains one of the most widely cultured and propagated fish species in aquaculture and stock enhancements in the southern Africa sub-region. Aquaculture is perceived as a means of protein security, poverty alleviation, and economic development and, as such, any future decisions on its introduction will be based on the trade-off between socio-economic benefits and potential adverse ecological effects.

  6. Genetic characterisation of four strains of Nile tilapia (Oreochromie Niloticus L.) using microsatellite markers

    NARCIS (Netherlands)

    Rutten, M.J.M.; Komen, J.; Deerenberg, R.M.; Siwek-Gapinska, M.Z.; Bovenhuis, H.

    2004-01-01

    Four domesticated strains of Nile tilapia (Oreochromis niloticus L.) were genetically characterized using 14 microsatellite markers and 64 animals per strain. Two strains, Chitralada (AIT) and International Development Research Centers (IDRC) were obtained from the AIT institute, Bangkok, Thailand.

  7. Evaluation of the performance of two strains of Nile tilapia (Oreochromis Niloticus) in mixed raising systems

    OpenAIRE

    Neves, Patrícia Ribeiro; Ribeiro, Ricardo Pereira; Vargas, Lauro; Natali, Maria Raquel Marçal; Maehana, Káttia Regina; Marengoni, Nilton Garcia

    2008-01-01

    The aim of this study was to evaluate the productive performance of two strains of Nile tilapia (Oreochromis niloticus) in mixed raising systems. A total of 3600 fish-larvae species was used, 1800 belonging to Bouaké lineage, and 1800 to Chitralada. The experiment was carried out in three phases; Phase I in an incubator in 18 boxes, in which two treatments (Bouaké and Chitralada) were tested by using nine repetitions; Phases II and III were performed in 18 cement tanks with the same treatment...

  8. Pertumbuhan dan Kelangsungan Hidup Benih Ikan Nila Gesit (Oreochromis Niloticus) pada Sistem Akuaponik dengan Jenis Tanaman yang Berbeda

    OpenAIRE

    Mulqan, Muhammad; El Rahimi, Sayyid Afdhal; Dewiyanti, Irma

    2017-01-01

    Aquaponics system is a farming system which saving land use and improving the efficiency of nutrient utilization of residual feed and fish metabolism. This system is environmentally friendly fish farming. This research was aimed to measure the growth and survival rate of tilapia (Oreochromis niloticus) on the use of Aquaponics system with different plant species. The difference treatment consisted of four treatments and three repetitions which used plant kale, collards, lettuce and control. R...

  9. Age and growth of Oreochromis niloticus (Perciformes: Cichlidae in Mexico

    Directory of Open Access Journals (Sweden)

    José Luis Gómez-Márquez

    1998-12-01

    Full Text Available Age and growth of Oreochromis niloticus from Lagoon of Coatetelco, Morelos State, Mexico were studied from January through December, 1993. Scales of 318 specimens were collected. Modal length at capture was 10.5-11.5 cm standard length. Scales rings were formed during December. Back-calculated lengths-at-age showed no significant differences by sex. Four check marks were recorded. According to the growth curve parameters for population, the fish grow at a low rate (k=0.07 until they achieve a size (L* of 29.19 cm. Length-frequency analysis (Bhattacharya's Gaussian component determination procedure do not differ significantly (t-student, p<0.05, from the scale reading.

  10. The radiosensitivity of nile tilapia (Oreochromis niloticus) fingerlings

    International Nuclear Information System (INIS)

    Reyes, Michael Joseph T.; Velasco, Pia Victoria V.

    2000-04-01

    The nile tilapia (Oreochromis niloticus), a very popular fish commercially in the Philippines, was studied to determine its radiosensitivity and to see its potential as a biological indicator in aquatic ecosystems. Nile tilapia was seen to be radiosensitive. The fish were exposed to gamma-irradiation and chromosomal aberrations were induced. The various types of aberrations seen were chromatid gaps, chromosome gaps, chromatid fragments, dicentric rings, fusions, despiralizations and translocations. Among the aberrations observed, dicentric rings, fusions and chromosome gaps were strongly correlated with dosage, with only the dicentric rings increasing steadily with increasing dosage. In the course of the study, the lethal dosage 50 for nile tilapia with 18 days was determined and it was observed at 2.0 krad. The modal chromosome number was also established at 2n=44 with a karyotype exhibiting 22 pairs of acrocentric chromosomes with 2 pairs of marker chromosomes present. (Author)

  11. Age and growth of Oreochromis niloticus (Perciformes: Cichlidae in Mexico

    Directory of Open Access Journals (Sweden)

    José Luis Gómez-Márquez

    1998-12-01

    Full Text Available Age and growth of Oreochromis niloticus from Lagoon of Coatetelco, Morelos State, Mexico were studied from January through December, 1993. Scales of 318 specimens were collected. Modal length at capture was 10.5-11.5 cm standard length. Scales rings were formed during December. Back-calculated lengths-at-age showed no significant differences by sex. Four check marks were recorded. According to the growth curve parameters for population, the fish grow at a low rate (k=0.07 until they achieve a size (L* of 29.19 cm. Length-frequency analysis (Bhattacharya's Gaussian component determination procedure do not differ significantly (t-student, pSe realizaron estudios de enero a diciembre de 1993 para conocer la edad y crecimiento de Oreochromis niloticus obtenida de las capturas comerciales de la laguna de Coatetelco, Morelos, Mexico. Se colectaron escamas de 318 peces. La moda de longitud patrón que se obtuvo en la captura fue de 10.5-11.5 cm. Se encontró que la formación de los anillos se realiza en Diciembre. Asimismo, no se detectaron diferencias significativas entre las hembras y los machos para las longitudes retrocalculadas para cada edad. En las escamas se registraron cuatro marcas. Se encontró que de acuerdo a los parametros de la ecuación de crecimiento, los peces tienen baja tasa de crecimiento (k=0.07 y alcanzan un tamaño adecuado (L* =29.19 cm. Los resultados obtenidos por medio del análisis de distribución de frecuencias no difieren significativamente (t-student, p<0.05 de los obtenidos por medio de la lectura de la estructura ósea (escamas.

  12. Toxicidade aguda de herbicidas a tilápia (Oreochromis niloticus Acute toxicity to herbicides to Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    R.G. Botelho

    2009-01-01

    Full Text Available Esta pesquisa teve como objetivo avaliar a sensibilidade de alevinos de Oreochromis niloticus a diversos herbicidas. Para isso, foram realizados dois ensaios, sendo, no primeiro, avaliadas concentrações de atrazina (0; 2,5; 5; 10; e 20 mg L-1, visando a determinação da concentração letal a 50% dos indivíduos (CL50, e, no segundo, a sensibilidade às mesclas dos herbicidas alachlor + atrazina (5,33 + 5,33 mg L-1, diuron + MSMA (5,33 + 2,13 mg L-1, paraquat (1,33 mg L-1 e 2,4-D + picloram (1,28 + 0,34 mg L-1, com contagem de mortes 96 horas após exposição aos produtos. No primeiro ensaio foi observado elevado declínio na sobrevivência dos alevinos a partir de 3 mg L-1 do herbicida atrazina, com CL50 estimada de 5,02 mg L-1. No segundo, a mistura alachlor + atrazina promoveu o maior efeito de mortalidade sobre os alevinos de tilápia. Com 72 horas de exposição, a escala de intoxicação evidenciou redução nos números de indivíduos de, aproximadamente, 17,4% para os produtos paraquat, 2,4-D + picloram e diuron + MSMA e de 100% para alachlor + atrazina. Os dados permitem concluir que a CL50 obtida para o atrazina é inferior àquela mencionada como tóxica para truta e que a mistura alachlor + atrazina pode ser caracterizada como de risco para O. niloticus, mesmo quando aplicada em doses normais de uso.Two assays were carried out to evaluate Oreochromis niloticus sensitivity to different herbicides. In the first experiment, atrazin concentrations (0; 2.5; 5; 10 and 20 mg L-1 were evaluated aiming to determine lethal concentration (LC50 to O. niloticus. In the second assay, the effects of the herbicide mixtures alachlor + atrazin (5.33 + 5.33 mg L-1, diuron + MSMA (5.33 + 2.13 mg L-1 , paraquat (1.33 mg L-1 and 2,4-D + picloran (1.28 + 0.34 mg L-1 , were evaluated on O. niloticus survival after 96 h of exposure. In the first assay, a sharp decrease in fingerlings survival was observed from 3 mg L-1 of atrazin with CL50 value of 5

  13. Heavy metal bioaccumulation in Oreochromis niloticus from Tenango Dam, Puebla, Mexico.

    Science.gov (United States)

    Muñoz-Nájera, Mario Alejandro; Barrera-Escorcia, Guadalupe; Ramírez-Romero, Patricia; Tapia-Silva, Felipe Omar; Rosas-Cedillo, Ricardo

    2018-04-14

    Oreochromis niloticus was used to determine the effects of heavy metals and their concentration in aquatic environments. Its wide distribution, resistance, and economical importance make it a suitable biomonitor. The present study was conducted in the Tenango Dam (Puebla, Mexico) to determine water quality and its impact on O. niloticus, a species that is cultured and commercialized in this area. Five samples were collected over 1 year to evaluate the water's physicochemical parameters (temperature, dissolved oxygen, pH, and hardness) and metal contents (cadmium, chromium, copper, and lead). Metal concentrations, bioconcentration factors, and metallothionein levels were also assessed in O. niloticus livers and muscle tissues. Water and tilapia quality were estimated according to current Mexican guidelines. Results indicated that the water's physicochemical parameters were within acceptable ranges. Metal concentrations, however, suggested that this resource was not suitable for urban use. Moreover, metal levels in fish tissues exceeded the acceptable limits during two periods, rendering it unsuitable for human consumption. The bioconcentration factor indicated that the metals can potentially accumulate in organisms. Furthermore, metallothionein levels in liver and muscle showed a direct correlation with metal concentrations in these tissues. This is the first study to use tilapia as an indicator of contamination in the Tenango Dam, and also the first to describe the presence of metals in this water body.

  14. Adaptation, growth and survival of tilapia (Oreochromis niloticus) in Bafgh brackish water

    OpenAIRE

    Sarsangi, A.H.; Mohammadi, M.; Mashaii, N.; Rajabipou, F.; Bitaraf, A.; Askari, H.M.; Moazedi, J.; Nezamabadi, H.; Hosseinzadeh Sahafi, H.

    2012-01-01

    An experiment was conducted to evaluate the possibility of adaptation, growth and survival of Nile tilapia (Oreochromis niloticus) with 0.3g initial weight and red tilapia (Oreochromis sp.) with 0.7g initial weight in underground brackish water. Fry of Nile tilapia and red tilapia imported from Indonesia and after passing larviculture (25g) were examined separately in fiber glass tank by two replicate. Fish were fed at a restricted feeding program according to standard table during the light ...

  15. Reproductive strategy of Oreochromis niloticus (Pisces: Cichlidae in Opa reservoir, Ile-Ife, Nigeria

    Directory of Open Access Journals (Sweden)

    O.O Komolafe

    2007-06-01

    Full Text Available The fish family Cichlidae has a large diversity and dominates African freshwater bodies, with over 200 species reported in inland waters. Sampling for the fish Oreochromis niloticus (Linnaeus in Opa reservoir, Nigeria, started in October 1997 and extended until February 2000. The fishing methods employed for collecting the 1 430 specimens were cast netting and gillnetting. Egg diameter varied between 2.12 mm and 2.69 mm with a mean of 2.47±0.02. Female gonadosomatic index was 1.34±0.01 (0.12-4.06, n= 637. The male gonadosomatic index was 0.39±0.02 (0.03-1.67, n= 789. In Opa reservoir, O. niloticus bred throughout the study period. The species was a maternal mouth brooder with the female fish carrying eggs and fry in the buccal cavities. The sex ratio of O. niloticus was approximately 1:1 in the reservoir. The fecundity of the species was between 73 eggs and 1 810 eggs per female with a mean fecundity of 815 eggs. Rev. Biol. Trop. 55 (2: 595-602. Epub 2007 June, 29.Estudiamos la tilapia, Oreochromis niloticus (Linnaeus en la reserva de Opa, Nigeria, desde octubre 1997 hasta febrero del 2000. Recolectamos 1 430 especímenes con red lanzada y red de arrastre. El diámetro de los huevos varía entre los 2.12 mm y 2.69 mm con un promedio de 2.47±0.02. El índice gonadosomático de las hembras fue de 1.34±0.01 (0.12-4.06, n= 637, y en machos fue de 0.39±0.02 (0.03-1.67, n= 789. En la reserva este pez se reprodujo durante todo el periodo de estudio. Hay cuido materno: la hembra lleva los huevos y alevines en la boca. La proporción machos/hembras fue aproximadamente 1:1. La fecundidad varía entre 73 y 1 810 huevos por hembra con un promedio de 815 huevos.

  16. Ectoparasites of Nile tilapia (Oreochromis niloticus) in cage farming in a hydroelectric reservoir in Brazil.

    Science.gov (United States)

    Zago, Aline Cristina; Franceschini, Lidiane; Garcia, Fabiana; Schalch, Sérgio Henrique Canello; Gozi, Kátia Suemi; Silva, Reinaldo José da

    2014-01-01

    For this study, we performed a parasitological analysis of cage-cultured Nile tilapia (Oreochromis niloticus) from the Água Vermelha Reservoir, Southeastern Brazil, and verified relationships with limnological data, seasonality, and fish growth phase. From March 2010 to March 2011, sixty-three specimens of O. niloticus in three growth phases (i.e., initial, intermediate, and final) were collected. All fish specimens were infested with at least one ectoparasite species (prevalence = 100%). Five species of protozoans (Trichodina compacta, Trichodina magna, Ichthyophthirius multifiliis, Piscinoodinium pillulare, and Epistylis sp.) and five species of monogenoids (Cichlidogyrus halli, Cichlidogyrus thurstonae, Cichlidogyrus sp. 1, Scutogyrus longicornis, and Gyrodactylus sp.) were observed. The abundance of Trichodina spp. and the prevalence of Epistylis sp. were higher in the dry season, and the prevalence of C. halli was higher in the rainy season. For the majority of ectoparasites found in this study, fish in the intermediate and final phases had higher parasitism rates than those in the initial phase. The data presented may help fish farmers to understand the parasite dynamics of the fish species studied in cage-farming systems.

  17. Neurobehavioural analysis of developmental iron deficiency in Oreochromis aureus × Oreochromis niloticus.

    Science.gov (United States)

    Bai, L-R; Wang, A-L; Zhao, Z-Y; Miao, Y-T

    2014-06-01

    The objective of this study was to examine the association between brain iron measurements of monoamine function and behavioural measurements of learning and memory. Male hybrid tilapias Oreochromis aureus × Oreochromis niloticus were fed either an iron-deficient (ID) diet or an iron-adequate (IA) diet for 8 weeks. The ID fishes showed significantly lower iron content in brain and decreasing learning and memory capacity. The fishes that showed increased learning and memory capacity had higher levels of iron and monoamine oxidase activity in brain. In addition, the results showed that learning and memory behaviours were related to monoamine (dopamine and noradrenaline) concentration in the brain. This suggests that iron can enhance learning and memory capacity in fishes and that the effect may have monoaminergic mediation in discrimination learning and memory tasks. The experimental data suggest that the properties and neural basis of learning and memory of teleosts are notably similar to those of land vertebrates. © 2014 The Fisheries Society of the British Isles.

  18. Masculinization of Nile tilapia (Oreochromis niloticus) by immersion in androgens

    Science.gov (United States)

    Gale, W.L.; Fitzpatrick, M.S.; Lucero, M.; Contreras-Sanchez, W.M.; Schreck, C. B.

    1999-01-01

    The use of all-male populations increases the efficiency and feasibility of tilapia aquaculture. The objective of this study was to determine the efficacy of a short-term immersion procedure for masculinizing Nile tilapia (Oreochromis niloticus). Two synthetic androgens were evaluated: 17α-methyldihydrotestosterone (MDHT) and 17α-methyltestosterone (MT). Exposure (3 h) on 10 and again on 13 days post-fertilization to MDHT at 500 μg/1 successfully masculinized fry in all experiments, resulting in 100, 94 and 83 ± 2% males in Experiments 1, 2 and 3, respectively. Immersions in MDHT or MT at 100 μg/1 resulted in significantly skewed sex ratios in Experiments 1 and 3 (MT resulted in 73 and 83 ± 3% males; and MDHT resulted in 72 and 91 ± 1% males) but not in Experiment 2. Immersion in MT at 500 μg/1 only caused masculinization in Experiment 3. Although further research and refinement is needed, immersion of Nile tilapia in MDHT may provide a practical alternative to the use of steroid-treated feed. Furthermore, when compared with current techniques for steroid-induced sex inversion of tilapia, short-term immersion reduces the period of time that workers are exposed to anabolic steroids.

  19. Visual communication stimulates reproduction in Nile tilapia, Oreochromis niloticus (L.).

    Science.gov (United States)

    Castro, A L S; Gonçalves-de-Freitas, E; Volpato, G L; Oliveira, C

    2009-04-01

    Reproductive fish behavior is affected by male-female interactions that stimulate physiological responses such as hormonal release and gonad development. During male-female interactions, visual and chemical communication can modulate fish reproduction. The aim of the present study was to test the effect of visual and chemical male-female interaction on the gonad development and reproductive behavior of the cichlid fish Nile tilapia, Oreochromis niloticus (L.). Fifty-six pairs were studied after being maintained for 5 days under one of the four conditions (N = 14 for each condition): 1) visual contact (V); 2) chemical contact (Ch); 3) chemical and visual contact (Ch+V); 4) no sensory contact (Iso) - males and females isolated. We compared the reproductive behavior (nesting, courtship and spawning) and gonadosomatic index (GSI) of pairs of fish under all four conditions. Visual communication enhanced the frequency of courtship in males (mean +/- SEM; V: 24.79 +/- 3.30, Ch+V: 20.74 +/- 3.09, Ch: 0.1 +/- 0.07, Iso: 4.68 +/- 1.26 events/30 min; P communication did not affect the reproductive behavior of pairs nor did it enhance the effects of visual contact. Therefore, male-female visual communication is an effective cue, which stimulates reproduction among pairs of Nile tilapia.

  20. Hybridations des taxons Oreochromis niloticus (Linnée, 1758) aux ...

    African Journals Online (AJOL)

    user

    Oreochromis niloticus,. Sarotherodon melanotheron ... confirme les hybridations dans la station expérimentale d'aquaculture de Layo, par l'existence de divers taxons recombinés dont les ... des croisements interspécifiques non contrôlées, provoquant ...

  1. Genetic parameters for reproductive traits in female Nile tilapia (Oreochromis niloticus): II. Fecundity and fertility

    NARCIS (Netherlands)

    Trong, T.Q.; Arendonk, van J.A.M.; Komen, J.

    2013-01-01

    Harvest weight is the main trait in Nile tilapia (Oreochromis niloticus) breeding programmes. The effects of selection for harvest weight on female reproductive traits are unknown. In this paper we estimate genetic parameters for reproductive traits and their correlation with harvest weight using

  2. Genetic analysis of nile tilapia (oreochromis niloticus) selection line reared in two input environments.

    NARCIS (Netherlands)

    Khaw, H.L.; Bovenhuis, H.; Ponzoni, R.W.; Rezk, M.A.; Charo, H.; Komen, J.

    2009-01-01

    Ascertaining the appropriate selection environment for Nile tilapia (Oreochromis niloticus) in Africa is a critical issue. Two data sets derived from two selection lines originating from a common base population were analysed in this study. The lines were selected in two different input

  3. Genotype by production environment interaction in the GIFT strain of Nile tilapia (Oreochromis niloticus)

    NARCIS (Netherlands)

    Khaw, H.L.; Ponzonia, R.W.; Hamzah, A.; Abu-Bakara, K.R.; Bijma, P.

    2012-01-01

    Three discrete generations of GIFT fish (Nile tilapia strain, Oreochromis niloticus; a total of 10,065 fish with pedigree and phenotypic information) were tested in pond and cage culture environments to determine genotype by production environment interaction between both environments in Malaysia.

  4. Water cortisol and testosterone in Nile tilapia (Oreochromis niloticus) recirculating aquaculture systems

    NARCIS (Netherlands)

    Mota, Vasco C.; Martins, Catarina I.M.; Eding, Ep H.; Canário, Adelino V.M.; Verreth, Johan A.J.

    2017-01-01

    The accumulation of steroids released by fish in recirculating aquaculture systems (RAS) may potentially influence their physiology and behavior. The present study examined the release rate of cortisol and testosterone by Nile tilapia, Oreochromis niloticus, and their accumulation in six identical

  5. Yeast single cell protein in the diet of Oreochromis niloticus (L ...

    African Journals Online (AJOL)

    use

    Diets D10 to D50 had fish meal replaced systematically with yeast single cell protein (SCP) in the order 10, 20, 30, 40 and 50%, respectively. Trial feeding was ... Key word: microbial protein, Oreochromis niloticus, feeding, cost benefit, aquaculture. .... Supplementary Feeding for Production of Nile Tilapia, Silver Carp.

  6. Optimizing fish meal-free commercial diets for Nile Tilapia, Oreochromis niloticus

    Science.gov (United States)

    A feeding trial was conducted in a closed recirculating aquaculture system with Nile tilapia Oreochromis niloticus juveniles (mean weight, 6.81 g) to examine the response to a practical diet containing protein primarily from menhaden fish meal (FM) and soybean meal (SBM) (control, Diet 1) or to diet...

  7. Prevalence and diversity of fish-borne zoonotic trematodes in tilapia (Oreochromis niloticus) culture in Guangdong, China

    DEFF Research Database (Denmark)

    Li, Kang; Murrell, Kenneth Darwin; Clausen, Jesper Hedegaard

    The fishborne zoonotic trematode parasites (FZT) which cause liver and intestinal infections in humans are widespread in fish in Southeast Asia. Guangdong Province is the most important region for tilapia (Oreochromis niloticus) culture in China, but it is also an endemic region for FZT. To assess......), and Carassius auratus (4).The FZT species recovered were mainly Haplorchis taichui, and H. pumilio along with some unknown species whose identifications are still being determined. Subsequently a cross-sectional survey for the prevalence and diversity of FZT in tilapia culture systems was conducted in Guangdong...

  8. Hematology of Nile tilapia (Oreochromis niloticus subjected to anesthesia and anticoagulation protocols

    Directory of Open Access Journals (Sweden)

    Nadia Cristine Weinert

    2015-12-01

    Full Text Available Clinical hematology facilitates the diagnosis of disease and can act as a prognostic indicator of pathological conditions in fish. The aim of the present study was to evaluate hematological parameters of Nile tilapia (Oreochromis niloticus subjected to different anesthetics and anticoagulants. Thirty apparently healthy fishes (average weight of 473 ± 35. 50 g and mean total length of 29. 33 ± 0. 37 cm, were selected from the local commercial fish farm in the Lages municipality (Santa Catarina, Brazil. The animals were randomly divided into three groups of 10. In two groups, anesthesia was induced with eugenol (70 mg·L- 1 (EG and Benzocaine hydrochloride (100 mg·L-1 (BG, respectively. Anesthesia was not administered to fish of the third group (CG/control group. Blood samples were obtained by venipuncture of the caudal vessels and placed into microtubes containing sodium heparin or Na2EDTA for further analysis. The results were analyzed by Sigma Stat for Windows, the paired t-test for significant differences between anticoagulants of the same group, and analysis of variance followed by the Tukey test for comparison of means between groups (p ? 0. 05. Most of the observed changes in the erythrogram were significantly higher for the anticoagulant heparin and benzocaine group in comparison to the control group. However, the values obtained for the leukogram were significantly higher for all groups subjected to the Na2EDTA anticoagulant, suggesting that heparin may cause cell clumping. The results suggest that the anesthetics under investigation effectively minimizes the effects of stress caused by handling and invasive procedures, and that the anticoagulant heparin causes less hemolysis in comparison to Na2EDTA for Nile tilapia. Thus, the hematological variations attributed to different anesthetic protocols and/or different anticoagulants should be considered for the species Oreochromis niloticus.

  9. Optimisation of UV Treatment Duration to Induce Haploid Androgenesis in the Nile tilapia (Oreochromis niloticus L.)

    OpenAIRE

    KARAYÜCEL, İsmihan; KARAYÜCEL, Sedat

    2014-01-01

    The optimum UV duration times of eggs were examined in order to develop a simple and safe method for inducing androgenetic development in the Nile tilapia, Oreochromis niloticus. The yield of androgenetic haploid O. niloticus to the pigmentation stage was 18.53 ± 5.3% (relative to controls) with an optimal UV irradiation dose of 540 Jm-2 (at 150 µWcm-2 ) for 6 min. Most embryos developing after fertilisation with normal spermatozoa showed abnormal morphology and a haploid number of chromosome...

  10. The Influence of Some Phytobiotics on Haematological and Some Biochemical Indices at Oreochromis Niloticus – Linnaeus, 1758

    Directory of Open Access Journals (Sweden)

    Alina Antache

    2014-05-01

    Full Text Available The aim of this research was to evaluated the influence of some phytobiotics on haematological profile, leukocyte reaction and some biochemical indices at Oreochromis niloticus species, reared in a recirculating aquaculture system. This experiment was conducted six weeks. The experimental variants were: V1 – control; V2 – 1% Rosmarinus officinalis / kg feed; V3 – 1% Hippophae rhamnoides / kg feed and V4 – 1% Zingiber officinale / kg feed. Blood was analyzed using standard techniques. At the end of the experiment the following parameters were determined: RBCc (x106cells/µL, Hb (g/dL, PVC (%, MCV (µm3, MCH (pg, MCHC (g/dL, TP (g/dL, GLU (mg/dL, cortisol (ng/mL, lysozyme activity (U/mL, absolute number of blood cells (x103 cells/µL and leukogram (%. The results showed that the administration in feed of some phytobiotics lead to signifiant differences (p<0.05 of following parameters: RBCc (x106cells/µL, MCV (µm3, glucose (mg/dL, lysozyme activity (U/mL, monocyte (% and in absolute number of leukocytes, lymphocytes and monocytes. In conclusion, due to decreasing of RBCc, PVC, Hb, MCHC, cortisol, GLU and due to normal concentration of TP, we can say that the administration of sea buckthorn and ginger, but even rosemary administration, in diet improves the physiological status at Oreochromis niloticus species.

  11. Histopathological assessment of cadmium effect on testicles and kidney of Oreochromis niloticus in different salinity

    Science.gov (United States)

    Hayati, Alfiah; Pratiwi, Hanna; Khoiriyah, Inayatul; Winarni, Dwi; Sugiharto

    2017-06-01

    This study was aimed to determine the effect of cadmium on testicles and kidney structure of Oreochromis niloticus in different salinity. Twenty-seven Oreochromis niloticus at age of 5±0.5 months with average size 11±1 cm and average weight 250±50 g were used and divided into nine treatment groups with variations in salinity (0, 5 and 10 ‰) and cadmium levels (0, 2.5, and 5 ppm). After two weeks of treatment periods, testicles and kidney was collected and then processed into histological slide. Result showed that cadmium and salinity variations caused change in diameter of seminiferous tubules in the testicles. Kidney structure also showing various damage such as necrosis and inflammation from groups treated with various concentration of salinity and cadmium. Smallest diameter of seminiferous tubules of the testicles and the highest percentage necrosis and inflammation of kidney was found from salinity:cadmium = 0‰ : 5 ppm treatment.

  12. Ectoparasites of Nile tilapia (Oreochromis niloticus in cage farming in a hydroelectric reservoir in Brazil

    Directory of Open Access Journals (Sweden)

    Aline Cristina Zago

    Full Text Available For this study, we performed a parasitological analysis of cage-cultured Nile tilapia (Oreochromis niloticus from the Água Vermelha Reservoir, Southeastern Brazil, and verified relationships with limnological data, seasonality, and fish growth phase. From March 2010 to March 2011, sixty-three specimens of O. niloticusin three growth phases (i.e., initial, intermediate, and final were collected. All fish specimens were infested with at least one ectoparasite species (prevalence = 100%. Five species of protozoans (Trichodina compacta, Trichodina magna, Ichthyophthirius multifiliis,Piscinoodinium pillulare, and Epistylissp. and five species of monogenoids (Cichlidogyrus halli, Cichlidogyrus thurstonae,Cichlidogyrus sp. 1, Scutogyrus longicornis, and Gyrodactylus sp. were observed. The abundance of Trichodina spp. and the prevalence of Epistylis sp. were higher in the dry season, and the prevalence of C. halli was higher in the rainy season. For the majority of ectoparasites found in this study, fish in the intermediate and final phases had higher parasitism rates than those in the initial phase. The data presented may help fish farmers to understand the parasite dynamics of the fish species studied in cage-farming systems.

  13. Study of Maximum Swimming Speed Tilapia (Oreochromis Niloticus) for Fisheries Management

    OpenAIRE

    Primeswari, Ridha; ', Nofrizal; Sari, T. Ersti Yulika

    2015-01-01

    The purpose of this study was to determine the swimming speed of the free swimming intank and flume tank, an outdoor durability of tilapia (Oreochromis niloticus), and maximumswimming speed tilapia in flume tank. Therefore, to use experimental methods. Free swimmingspeed was 0,25 BL/sec, maximum swimming speed of fish occurs when the fish are given ashock to swim. Negative correlation between speed and endurance swimming R2 = 0,7295 showsa fish swimming endurance decreases at higher speeds. S...

  14. L'étude de la croissance de Oreochromis niloticus par la fertilisation ...

    African Journals Online (AJOL)

    La productivité des eaux dépend de la quantité d'éléments fertilisants apportés à l'étang et des facteurs particuliers à l'étang : la nature du fond, des sédiments, la turbidité, la composition chimique de l'eau, la charge en poisson et la température. Mots-clés : Croissance, Oreochromis niloticus, Fertilisation, Étang, ...

  15. Marine Collagen Peptides from the Skin of Nile Tilapia (Oreochromis niloticus): Characterization and Wound Healing Evaluation

    OpenAIRE

    Hu, Zhang; Yang, Ping; Zhou, Chunxia; Li, Sidong; Hong, Pengzhi

    2017-01-01

    Burns can cause tremendous economic problems associated with irreparable harm to patients and their families. To characterize marine collagen peptides (MCPs) from the skin of Nile tilapia (Oreochromis niloticus), molecular weight distribution and amino acid composition of MCPs were determined, and Fourier transform infrared spectroscopy (FTIR) was used to analyze the chemical structure. Meanwhile, to evaluate the wound healing activity, in vitro and in vivo experiments were carried out. The r...

  16. Antibiotic resistence of Aeromonas hydrophila isolated from Piaractus mesopotamicus (Holmberg, 1887) and Oreochromis niloticus (Linnaeus, 1758)

    OpenAIRE

    Belém-Costa,Andréa; Cyrino,José Eurico Possebon

    2006-01-01

    One of the most important problems involving treatments with antibiotics against Aeromonas hydrophila isolated from fishes is that antibiotic resistance develops readily. The antimicrobial activity of chemotherapeutants in isolates from pacu Piaractus mesopotamicus (Holmberg, 1887) and tilapia Oreochromis niloticus (Linnaeus, 1758) was tested by the Kirby-Bauer disk method, over Mueller-Hinton surface agar previously inoculated with 100 µL of bacterial suspensions. After regular incubation, i...

  17. Effects of colour on growth of Oreochromis niloticus (linnaeus 1757 ...

    African Journals Online (AJOL)

    A feeding trial was conducted for 75 days to determine the effects of tank colours (black, blue, pink, green and white) on growth and nutrient utilization in O. niloticus (10.0 g) fingerling. Result indicated that O. niloticus fed and raised in black and green tanks had better growth performance of 26 ± 0.19 g and 25 ± 0.19 g and ...

  18. Evaluation of the performance of two strains of Nile tilapia (Oreochromis Niloticus in mixed raising systems

    Directory of Open Access Journals (Sweden)

    Patrícia Ribeiro Neves

    2008-06-01

    Full Text Available The aim of this study was to evaluate the productive performance of two strains of Nile tilapia (Oreochromis niloticus in mixed raising systems. A total of 3600 fish-larvae species was used, 1800 belonging to Bouaké lineage, and 1800 to Chitralada. The experiment was carried out in three phases; Phase I in an incubator in 18 boxes, in which two treatments (Bouaké and Chitralada were tested by using nine repetitions; Phases II and III were performed in 18 cement tanks with the same treatments. In phase I, regarding the final weight and gain of weight, Chitralada strain showed the highest final weight values. In phase II, Chitralada showed the highest final weight value when compared with Bouaké, and, considering the gain of weight, Bouaké obtained the best result. In phase III, Chitralada showed better final weight results (104 days of raising, final weight, final length and gain of length/cm (152 days of raising; but, after 279 days of the cultivation, Bouaké showed a higher weight and length gain. These findings showed that Chitralada strain presented the best performance.O objetivo deste trabalho foi avaliar o desempenho produtivo de duas linhagens de tilápia do Nilo (Oreochromis niloticus em sistemas de cultivo misto. Foram utilizados 3600 alevinos de tilápia, 1800 da linhagem Bouaké e 1800 da Chitralada. O experimento foi conduzido em três fases, a Fase I realizada em estufa em 18 caixas, nas quais foram testados dois tratamentos (Bouaké e Chitralada e nove repetições; e a Fase II e III realizadas em 18 tanques de alvenaria, com os mesmos tratamentos. Na fase I, a linhagem Chitralada apresentou os maiores valores para peso final e ganho em peso. Na fase II, a Chitralada apresentou o maior valor para peso final em relação à Bouaké, já para o ganho em peso a Bouaké obteve o melhor resultado. Na fase III, a Chitralada apresentou os melhores resultados para peso final (104 dias de cultivo; peso final, comprimento final e ganho

  19. Mode d'exploitation et durabilité de la pêche de Oreochromis niloticus (Linnaeus, 1758, Clarias gariepinus (Burchell, 1822 et Gymnarchus niloticus (Cuvier, 1829 dans le lac de barrage du Sourou (Burkina Faso

    Directory of Open Access Journals (Sweden)

    Dialla, Z.

    2016-01-01

    Full Text Available Mode of Operation and Sustainability of Oreochromis niloticus (Linnaeus, 1758, Clarias gariepinus (Burchell, 1822 and Gymnarchus niloticus (Cuvier, 1829 Fisheries in the Sourou Dam Lake (Burkina Faso. This research on fishery exploitation in the Sourou dam raises the issue of sustainable management of common property. The central hypothesis is that the effectiveness of co-management for sustainable fishing practices is related to the level of ownership of that management and actors' games by fishing communities. In analysing co-management induced effects on fishing practices and exploitation of C. gariepinus, O. niloticus and G. niloticus species, related to its implementation in Sourou fishery, a research methodology that combines qualitative and quantitative methods is used. Socio-economic surveys were conducted with 30 fishermen in three villages bordering the fishery. Biological surveys were also conducted with catches of C. gariepinus, O. niloticus and G. niloticus of these fishermen,. The results indicate a weak ownership of the co-management model by fishermen and the strategies of actors that consist to minimize the costs of the sustainable management of fisheries resources at individual level. Indeed, even when informed of fisheries regulations, fishermen use prohibited fishing equipment (54.1% of the catches of studied species, and fishi illegally (43.3% of the fishermen. Furthermore, significant proportions of each studied species are captured before their first maturity sizes (52.2% of C. gariepinus, 15.8% of G. niloticus and 14.3% of O. niloticus. So, the central hypothesis is verified because the weak ownership of co-management by fishing communities and the actors' strategies do not encourage them to develop a responsible behavior for sustainable fishing.

  20. Copper sulfate affects Nile tilapia (Oreochromis niloticus) cardiomyocytes structure and contractile function.

    Science.gov (United States)

    de Andrade Waldemarin, Kátia Cristina; Alves, Rosiane Nascimento; Beletti, Marcelo Emílio; Rantin, Francisco Tadeu; Kalinin, Ana Lúcia

    2012-04-01

    Copper sulfate (CuSO(4))is an inorganic chemical product worldwide used as an algaecide and a fungicide in aquaculture and agriculture and being discharged into freshwater environments where it can affect the freshwater fauna, especially fishes. The impact of copper on fish cardiac function was analyzed in two groups of Nile tilapias, Oreochromis niloticus (control group and group exposed to 1 mg l(-1) of CuSO(4) for 96 h). Structural and ultra-structural changes were studied and related to perturbations of the inotropic and chronotropic responses of ventricle strips. Fish of Cu exposed group did not show significant alterations in the medium diameter and in the percentage of collagen in the cardiac myocytes when evaluated through the light microscope. However, the ultrastructural analysis revealed cellular swelling followed by mitochondrial swelling. The myofibrils did not show significant variations among groups. Force contraction was significantly decreased, and rates of time to tension increase (contraction) and decrease (relaxation) were significantly augmented after copper exposure. The results suggest that the copper sulfate impairs the oxidative mitochondrial function and consequently alters the cardiac performance of this species.

  1. Protozoan and metazoan parasites of Nile tilapia Oreochromis niloticus cultured in Brazil

    Directory of Open Access Journals (Sweden)

    Wanderson Pantoja MF

    2012-04-01

    Full Text Available Objective. This study describes the parasitic fauna and relative condition factor (Kn in Nile tilapia Oreochromis niloticus L. (Cichlidae from fish farms in the State of Amapá. Material and methods. 123 fish from four fish farms in the state of Amapá, Brazil were necropsied for parasitological and Kn analysis. Results. 64.2% of the examined fish, had the gills infected with Cichlidogyrus tilapiae Paperna, 1960 (Monogenoidea: Dactylogyridae; Ichthyophthirius multifiliis Fouquet, 1876 (Protozoa: Ciliophora, Trichodina Ehrenberg, 1830 and Paratrichodina africana Kazubski & El-Tantawy, 1986 (Protozoa: Trichodinidae. The highest prevalence found corresponded to Monogenoidea C. tilapiae while the lowest corresponded to Trichodinidae. However, I. multifiliis was the parasite that presented the greatest intensity and abundance. The differences found in the infection rates of the different fish farms due to causes further discussed. The parasitism did not influence the relative condition factor (Kn of fish. This was the first record of P. africana in Brazil and occurred in the Eastern Amazon. Conclusions. In Brazil, Lamproglena sp. is an emerging parasite in the Southern and Southeastern regions, but this crustacean was not found in the Nile tilapia in the State of Amapá. The parasitic infections in Nile tilapia farmed in Brazil are caused by protozoan, monogenoidea, crustacea and digenea species, and the regional differences on their prevalence and intensity rates are discussed in this study.

  2. Chemical communication in tilapia: a comparison of Oreochromis mossambicus with O. niloticus.

    Science.gov (United States)

    Hubbard, Peter C; Mota, Vasco C; Keller-Costa, Tina; da Silva, José Paulo; Canário, Adelino V M

    2014-10-01

    In allopatric speciation species differentiation generally results from different selective pressures in different environments, and identifying the traits responsible helps to understand the isolation mechanism(s) involved. Male Mozambique tilapia (Oreochromis mossambicus) use urine to signal dominance; furthermore, 5β-pregnane-3α,17,20β-triol-3α-glucuronide (and its α-epimer, 5β-pregnane-3α,17,20α-triol-3α-glucuronide), in their urine is a potent pheromone, the concentration of which is correlated with social status. The Nile tilapia (Oreochromisniloticus) is a close relative; species divergence probably resulted from geographical separation around 6 million years ago. This raises the question of whether the two species use similar urinary chemical cues during reproduction. The olfactory potency of urine, and crude extracts, from either species was assessed by the electro-olfactogram and the presence of the steroid glucuronides in urine from the Nile tilapia by liquid-chromatography/mass-spectrometry. Both species showed similar olfactory sensitivity to urine and respective extracts from either species, and similar sensitivity to the steroid glucuronides. 5β-Pregnan-3α,17α,20β-triol-3α-glucuronide was present at high concentrations (approaching 0.5mM) in urine from Nile tilapia, with 5β-pregnan-3α,17α,20α-triol-3α-glucuronide present at lower concentrations, similar to the Mozambique tilapia. Both species also had similar olfactory sensitivity to estradiol-3-glucuronide, a putative urinary cue from females. Together, these results support the idea that reproductive chemical cues have not been subjected to differing selective pressure. Whether these chemical cues have the same physiological and behavioural roles in O. niloticus as O. mossambicus remains to be investigated. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. assimilation efficiency in two herbivores, oreochromis niloticus and ...

    African Journals Online (AJOL)

    Preferred Customer

    that acid lyses of phytoplankton is the means for breaking down and releasing the contents of the cells. Fig. 3. Stomach fullness and stomach pH in O. niloticus at different times of the day (modified from Getachew. Teferra and Fernando, 1989). The best-fit line drawn through all assimilation efficiency values for both fish and ...

  4. The food and feeding habit of Oreochromis niloticus L. (Pisces ...

    African Journals Online (AJOL)

    O. niloticus was found to be essentially phytoplanktivores in Lake Chamo, and the composition of the phytoplankton diet varied seasonally. The diet of both adult and juvenile fish consisted of 10 genera of blue greens whereas green algae and diatoms each contributed 8 genera. Blue greens as a group contributed the bulk ...

  5. Oxidative stress biomarkers in Oreochromis niloticus as early ...

    African Journals Online (AJOL)

    2018-04-10

    Apr 10, 2018 ... hepatocytes of the Rainbow Trout (Oncorhynchus mykiss), in which elevated levels of the pi GST isoform were demonstrated. (Perez-Lopez et al., 2002). The elevated GST activity suggests the presence of pollutants that induce oxidative stress in. O. niloticus in Mazoe and Yellow Jacket Rivers. Muposhi.

  6. Two Myxobolus spp. infecting the kidney of Nile tilapia (Oreochromis niloticus) in the River Nile at Beni-Suef governorate, Egypt, and the associated renal changes.

    Science.gov (United States)

    Abdel-Baki, Abdel-Azeem S; Abdel-Haleem, Heba M; Sakran, Thabet; Zayed, Eman; Ibrahim, Khalid E; Al-Quraishy, Saleh

    2015-03-01

    Two Myxobolus spp. are described from the kidney of the Nile tilapia (Oreochromis niloticus) collected from the River Nile, Egypt. The prevalence of infection was 61 % (47/77), with the infected fish in each case parasitized by the two Myxobolus species simultaneously. The infection was exhibited as free spores in Bowman capsules and renal glomeruli, which makes their original structures difficult to discern. In some cases, the infection appeared as a fibrous plasmodia-like structure containing degenerated developmental stages and spores in the interstitium. The paper identifies each species based on the morphological characteristics of its spores and identifies the histological impacts of Myxobolus infection in this species of fish.

  7. Bioaccumulation of some heavy metals in adult tilapia oreochromis niloticus in Southern part of Laguna de Bay

    International Nuclear Information System (INIS)

    Sandoval, Kristine L.; Padua, Haizelle O.; De Jesus, Editha E.; Enal, Maria Luisa A.

    2010-01-01

    Tilapia, Oreochromis niloticus, one of the most important fish species in Philippine aquaculture, is grown abundantly in Laguna de Bay. A preliminary study was conducted to determine the levels of accumulated mercury (Hg), cadmium (Cd) and lead (Pb) in the muscle tissue of this fresh water fish collected from February (wet season) to March (dry season) 2008 in the southern part of Laguna de Bay. Heavy metal analyses using atomic absorption spectrophotometer (AAS) showed a higher concentration of Hg and Cd during the wet season than in the dry season. However, analysis of variance revealed significant seasonal variation on only in Cd (P=0.0253). Lead, on the other hand, was not detected in the fish samples. The mean concentration set by FAO but the mean level of Cd (0.161 ppm) was almost equal to the limit given for fish. This could represent a significant health risk to the consuming public. (author)

  8. Spatial and temporal variation in population genetic structure of wild Nile tilapia (Oreochromis niloticus) across Africa

    Science.gov (United States)

    2011-01-01

    Background Reconstructing the evolutionary history of a species is challenging. It often depends not only on the past biogeographic and climatic events but also the contemporary and ecological factors, such as current connectivity and habitat heterogeneity. In fact, these factors might interact with each other and shape the current species distribution. However, to what extent the current population genetic structure reflects the past and the contemporary factors is largely unknown. Here we investigated spatio-temporal genetic structures of Nile tilapia (Oreochromis niloticus) populations, across their natural distribution in Africa. While its large biogeographic distribution can cause genetic differentiation at the paleo-biogeographic scales, its restricted dispersal capacity might induce a strong genetic structure at micro-geographic scales. Results Using nine microsatellite loci and 350 samples from ten natural populations, we found the highest genetic differentiation among the three ichthyofaunal provinces and regions (Ethiopian, Nilotic and Sudano-Sahelian) (RST = 0.38 - 0.69). This result suggests the predominant effect of paleo-geographic events at macro-geographic scale. In addition, intermediate divergences were found between rivers and lakes within the regions, presumably reflecting relatively recent interruptions of gene flow between hydrographic basins (RST = 0.24 - 0.32). The lowest differentiations were observed among connected populations within a basin (RST = 0.015 in the Volta basin). Comparison of temporal sample series revealed subtle changes in the gene pools in a few generations (F = 0 - 0.053). The estimated effective population sizes were 23 - 143 and the estimated migration rate was moderate (m ~ 0.094 - 0.097) in the Volta populations. Conclusions This study revealed clear hierarchical patterns of the population genetic structuring of O. niloticus in Africa. The effects of paleo-geographic and climatic events were predominant at macro

  9. Spatial and temporal variation in population genetic structure of wild Nile tilapia (Oreochromis niloticus across Africa

    Directory of Open Access Journals (Sweden)

    Bezault Etienne

    2011-12-01

    Full Text Available Abstract Background Reconstructing the evolutionary history of a species is challenging. It often depends not only on the past biogeographic and climatic events but also the contemporary and ecological factors, such as current connectivity and habitat heterogeneity. In fact, these factors might interact with each other and shape the current species distribution. However, to what extent the current population genetic structure reflects the past and the contemporary factors is largely unknown. Here we investigated spatio-temporal genetic structures of Nile tilapia (Oreochromis niloticus populations, across their natural distribution in Africa. While its large biogeographic distribution can cause genetic differentiation at the paleo-biogeographic scales, its restricted dispersal capacity might induce a strong genetic structure at micro-geographic scales. Results Using nine microsatellite loci and 350 samples from ten natural populations, we found the highest genetic differentiation among the three ichthyofaunal provinces and regions (Ethiopian, Nilotic and Sudano-Sahelian (RST = 0.38 - 0.69. This result suggests the predominant effect of paleo-geographic events at macro-geographic scale. In addition, intermediate divergences were found between rivers and lakes within the regions, presumably reflecting relatively recent interruptions of gene flow between hydrographic basins (RST = 0.24 - 0.32. The lowest differentiations were observed among connected populations within a basin (RST = 0.015 in the Volta basin. Comparison of temporal sample series revealed subtle changes in the gene pools in a few generations (F = 0 - 0.053. The estimated effective population sizes were 23 - 143 and the estimated migration rate was moderate (m ~ 0.094 - 0.097 in the Volta populations. Conclusions This study revealed clear hierarchical patterns of the population genetic structuring of O. niloticus in Africa. The effects of paleo-geographic and climatic events were

  10. Comparative assessment of bioload of healthy and diseased Oreochromis niloticus as means of food security

    OpenAIRE

    Toochukwu Ekwutosi OGBULIE; Harriet Chinyelu NWIGWE; Sylvia Onyinyechi ANYADOH

    2011-01-01

    Thirty-one (31) samples each of diseased and healthy Tilapia fish (Oreochromis niloticus) from Otamiri River, in Nekede, Owerri West; Imo State Nigeria was examined to detect the presence of bacterial and helminth fauna. The intestine, liver, gill, tissue and skin of the fish were examined. Bacteriological analysis revealed counts of healthy diseased organs to fall between 6.0 x 104 – 3.5 x 107 cfu/g and 5.7 x 106 – 1.9 x 1011 cfu/g respectively. The result however indicated that the bacteria...

  11. Behavioral response of tilapia (Oreochromis niloticus) to acute ammonia stress monitored by computer vision.

    Science.gov (United States)

    Xu, Jian-yu; Miao, Xiang-wen; Liu, Ying; Cui, Shao-rong

    2005-08-01

    The behavioral responses of a tilapia (Oreochromis niloticus) school to low (0.13 mg/L), moderate (0.79 mg/L) and high (2.65 mg/L) levels of unionized ammonia (UIA) concentration were monitored using a computer vision system. The swimming activity and geometrical parameters such as location of the gravity center and distribution of the fish school were calculated continuously. These behavioral parameters of tilapia school responded sensitively to moderate and high UIA concentration. Under high UIA concentration the fish activity showed a significant increase (Pfish behavior under acute stress can provide important information useful in predicting the stress.

  12. Apparent nutrient and energy digestibility of canola meal for Nile tilapia (Oreochromis niloticus)

    OpenAIRE

    Furuya, Wilson Massamitu; Pezzato, Luiz Edivaldo [UNESP; Miranda, Edma Carvalho de; Furuya, Valéria Rossetto Barriviera; Barros, Margarida Maria [UNESP; Lanna, Eduardo Arruda Teixeira

    2001-01-01

    Este estudo foi realizado para determinar a energia digestível e a digestibilidade aparente de nutrientes do farelo de canola pela tilápia do Nilo (Oreochromis niloticus). O óxido de crômio (0,1%) foi utilizado como indicador inerte em dieta semi-purificada, com coleta de fezes pelo sistema Guelph. Os peixes foram alimentados até saciedade aparente. O farelo de canola apresentou valores de energia e nutrientes digestíveis de: 77,84; 71,99; 86,92; 88,19; 67,16 e 29,86% para a matéria seca, ene...

  13. A high quality assembly of the Nile Tilapia (Oreochromis niloticus) genome reveals the structure of two sex determination regions.

    Science.gov (United States)

    Conte, Matthew A; Gammerdinger, William J; Bartie, Kerry L; Penman, David J; Kocher, Thomas D

    2017-05-02

    Tilapias are the second most farmed fishes in the world and a sustainable source of food. Like many other fish, tilapias are sexually dimorphic and sex is a commercially important trait in these fish. In this study, we developed a significantly improved assembly of the tilapia genome using the latest genome sequencing methods and show how it improves the characterization of two sex determination regions in two tilapia species. A homozygous clonal XX female Nile tilapia (Oreochromis niloticus) was sequenced to 44X coverage using Pacific Biosciences (PacBio) SMRT sequencing. Dozens of candidate de novo assemblies were generated and an optimal assembly (contig NG50 of 3.3Mbp) was selected using principal component analysis of likelihood scores calculated from several paired-end sequencing libraries. Comparison of the new assembly to the previous O. niloticus genome assembly reveals that recently duplicated portions of the genome are now well represented. The overall number of genes in the new assembly increased by 27.3%, including a 67% increase in pseudogenes. The new tilapia genome assembly correctly represents two recent vasa gene duplication events that have been verified with BAC sequencing. At total of 146Mbp of additional transposable element sequence are now assembled, a large proportion of which are recent insertions. Large centromeric satellite repeats are assembled and annotated in cichlid fish for the first time. Finally, the new assembly identifies the long-range structure of both a ~9Mbp XY sex determination region on LG1 in O. niloticus, and a ~50Mbp WZ sex determination region on LG3 in the related species O. aureus. This study highlights the use of long read sequencing to correctly assemble recent duplications and to characterize repeat-filled regions of the genome. The study serves as an example of the need for high quality genome assemblies and provides a framework for identifying sex determining genes in tilapia and related fish species.

  14. Genetic and environmental factors affecting growth of Nile tilapia (Oreochromis niloticus) juveniles: modelling spatial correlations between hapas

    NARCIS (Netherlands)

    Charo-Karisa, H.; Komen, J.; Rezk, M.A.; Reynolds, S.; Ponzoni, R.W.; Bovenhuis, H.

    2006-01-01

    The aim of this study was to quantify the environmental and genetic effects on early growth of Nile tilapia, Oreochromis niloticus, in hapa-in-earthen pond systems. In a pilot study, we grew swim-up fry with or without supplementary feed in hapas suspended in fertilized ponds at 5, 10, 15, and 20

  15. Digestibility and postprandial ammonia excretion in Nile tilapia (Oreochromis niloticus) fed diets containing different oilseed by-products

    DEFF Research Database (Denmark)

    Obirikorang, Kwasi Adu; Amisah, Stephen; Fialor, Simon Cudjoe

    2015-01-01

    The present study was undertaken to evaluate the potential for using oilseed by-products (soybean, copra and palm kernel meals) as partial replacements of fishmeal in feeds for Nile tilapia (Oreochromis niloticus). Nutrient digestibility and postprandial ammonia excretion rates were examined. A f...

  16. Fishborne trematodes in cultured Nile tilapia (Oreochromis niloticus) and wild-caught fish from Thailand

    DEFF Research Database (Denmark)

    Wiriya, Benjamaporn; Clausen, Jesper Hedegaard; Inpankaew, Tawin

    2013-01-01

    Fish-borne zoonotic trematode (FZT) infections affect the health of more than 18 million people around the world, particularly in Asian countries. Nile tilapia (Oreochromis niloticus) is a white meat fish that has an increasing national and international market. The objective of this study was to...... for vigilance and good management practices by the aquaculture sector. Crown...

  17. Complete genome sequence of Edwardsiella ictaluri isolate RUSVM-1 recovered from nile tilapia (Oreochromis niloticus) in the Western Hemisphere

    Science.gov (United States)

    Edwardsiella ictaluri is a Gram-negative, bacillus that has recently been implicated in disease outbreaks in tilapia and zebrafish. We report here the complete and annotated genome of an isolate from a Nile Tilapia (Oreochromis niloticus), which contains a chromosome of 3,630,639 bp and two plasmids...

  18. Changes in the quality of fishburger produced from Tilapia ( Oreochromis niloticus ) during frozen storage (-18 degrees C)

    DEFF Research Database (Denmark)

    Tokur, B.; Polat, A.; Beklevik, G.

    2004-01-01

    In this study, the chemical and sensory qualities of fishburger produced from tilapia (Oreochromis niloticus) were investigated during frozen storage (-18 degreesC) over 8 months. The ratios of crude protein, lipid, moisture, crude ash, and polyunsaturated fatty acids in tilapiaburger were found...

  19. Prevalence and diversity of fish-borne zoonotic trematodes in tilapia (Oreochromis niloticus) culture in Guangdong, China

    DEFF Research Database (Denmark)

    Li, Kang; Murrell, Kenneth Darwin; Clausen, Jesper Hedegaard

    The fishborne zoonotic trematode parasites (FZT) which cause liver and intestinal infections in humans are widespread in fish in Southeast Asia. Guangdong Province is the most important region for tilapia (Oreochromis niloticus) culture in China, but it is also an endemic region for FZT. To assess...... at the nursery stage of production....

  20. Pesticide residues in Nile tilapia (Oreochromis niloticus) and Nile perch (Lates niloticus) from Southern Lake Victoria, Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Henry, L. [Chemistry Department, University of Dar es Salaam. PO Box 35061, Dar es Salaam (Tanzania); Kishimba, M.A. [Chemistry Department, University of Dar es Salaam. PO Box 35061, Dar es Salaam (Tanzania)]. E-mail: kishimba@chem.udsm.ac.tz

    2006-03-15

    Nile tilapia (Oreochromis niloticus) and Nile perch (Lates niloticus) samples were collected from fish landing stations in nine riparian districts on the Tanzanian side of Lake Victoria and screened for residues of 64 organochlorine, organophosphorus, carbamate, and pyrethroid pesticides. The residue levels in the fish fillet were up to 0.003, 0.03 and 0.2 mg/kg fresh weight (0.7, 3.8 and 42 mg/kg lipid weight) of fenitrothion, DDT and endosulfan, respectively. Mean levels within sites were up to 0.002, 0.02 and 0.1 mg/kg fresh weight (0.5, 0.5 and 16 mg/kg lipid weight), respectively. The detection of higher levels of p,p'-DDT than the degradation products (p,p'-DDD and p,p'-DDE), and higher levels of endosulfan isomers ({alpha} and {beta}) than the sulphate, in fish samples, implied recent exposure of fish to DDT and endosulfan, respectively. Generally, most of the fish samples had residue levels above the average method detection limits (MDLs), but were within the calculated ADI. - Fish from Lake Victoria had relatively low pesticide levels.

  1. Pesticide residues in Nile tilapia (Oreochromis niloticus) and Nile perch (Lates niloticus) from Southern Lake Victoria, Tanzania

    International Nuclear Information System (INIS)

    Henry, L.; Kishimba, M.A.

    2006-01-01

    Nile tilapia (Oreochromis niloticus) and Nile perch (Lates niloticus) samples were collected from fish landing stations in nine riparian districts on the Tanzanian side of Lake Victoria and screened for residues of 64 organochlorine, organophosphorus, carbamate, and pyrethroid pesticides. The residue levels in the fish fillet were up to 0.003, 0.03 and 0.2 mg/kg fresh weight (0.7, 3.8 and 42 mg/kg lipid weight) of fenitrothion, DDT and endosulfan, respectively. Mean levels within sites were up to 0.002, 0.02 and 0.1 mg/kg fresh weight (0.5, 0.5 and 16 mg/kg lipid weight), respectively. The detection of higher levels of p,p'-DDT than the degradation products (p,p'-DDD and p,p'-DDE), and higher levels of endosulfan isomers (α and β) than the sulphate, in fish samples, implied recent exposure of fish to DDT and endosulfan, respectively. Generally, most of the fish samples had residue levels above the average method detection limits (MDLs), but were within the calculated ADI. - Fish from Lake Victoria had relatively low pesticide levels

  2. Experimental infection of Tilapia Lake Virus (TiLV) in Nile tilapia (Oreochromis niloticus) and red tilapia (Oreochromis spp.).

    Science.gov (United States)

    Tattiyapong, Puntanat; Dachavichitlead, Worawan; Surachetpong, Win

    2017-08-01

    Since 2015, a novel orthomyxo-like virus, tilapia lake virus (TiLV) has been associated with outbreaks of disease and massive mortality of cultured Nile and red tilapia (Oreochromis niloticus and Oreochromis spp., respectively) in Thailand. In this study, TiLV was isolated from field samples and propagated in the permissive E-11 cell line, with cytopathic effect (CPE) development within 3-5days post-inoculation. Electron micrographs of infected E-11 cells and fish tissues confirmed the rounded, enveloped virions of 60 to 80nm with characteristics very similar to those of Orthomyxoviridae. In vivo challenge studies showed that high mortality in Nile (86%) and red tilapia (66%) occurred within 4-12days post-infection. The virus was re-isolated from challenged fish tissues in the permissive cell line, and PCR analysis confirmed TiLV as a causative pathogen. The distinct histopathology of challenged fish included massive degeneration and inflammatory cell infiltration in the liver and brain as well as the presence of eosinophilic intracytoplasmic inclusions in hepatocytes and splenic cells. Our results fulfilled Koch's postulates and confirmed that TiLV is an etiologic agent of mass mortality of tilapia in Thailand. The emergence of this virus in many countries has helped increase awareness that it is a potential threat to tilapia aquacultured in Thailand, Asia, and worldwide. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Technical evaluation of tilapia (Oreochromis niloticus) monoculture and tilapia-prawn (Macrobrachium rosenbergii) polyculture in earthen ponds with or without substrates for periphyton development

    NARCIS (Netherlands)

    Uddin, S.; Farzana, A.; Fatema, M.K.; Azim, M.E.; Wahab, M.A.; Verdegem, M.C.J.

    2007-01-01

    The effects of periphyton grown on bamboo substrate, on growth and production of Nile tilapia, Oreochromis niloticus (Genetically Improved Farmed Tilapia strain) in monoculture and polyculture with the freshwater prawn (Macrobrachium rosenbergii) were studied and economically evaluated. The

  4. Effects of substrate addition and supplemental feeding on plankton composition and production in tilapia (Oreochromis niloticus) and freshwater prawn (Macrobrachium rosenbergii) polyculture

    NARCIS (Netherlands)

    Uddin, M.S.; Azim, M.E.; Wahab, M.A.; Verdegem, M.C.J.

    2009-01-01

    This study investigated the effects of substrates and supplemental feeding on growth and production of tilapia (Oreochromis niloticus) and freshwater prawn (Macrobrachium rosenbergii) in a polyculture system. On actual farms, four treatments were evaluated in triplicate: substrate plus feed (herein

  5. A qualitative ecological risk assessment of the invasive Nile tilapia, Oreochromis niloticus in a sub-tropical African river system (Limpopo River, South Africa)

    CSIR Research Space (South Africa)

    Zengeya, TA

    2013-01-01

    Full Text Available This study outlines the development of a qualitative risk assessment method and its application as a screening tool for determining the risk of establishment and spread of the invasive Nile tilapia, Oreochromis niloticus (Linnaeus, 1758), within...

  6. Sperm quality analysis in XX, XY and YY males of the Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Gennotte, V; François, E; Rougeot, C; Ponthier, J; Deleuze, S; Mélard, C

    2012-07-01

    In Nile tilapia (Oreochromis niloticus), individuals with atypical sexual genotype are commonly used in farming (use of YY males to produce all-male offspring), but they also constitute major tools to study sex determinism mechanisms. In other species, sexual genotype and sex reversal procedures affect different aspects of biology, such as growth, behavior and reproductive success. The aim of this study was to assess the influence of sexual genotype on sperm quality in Nile tilapia. Milt characteristics were compared in XX (sex-reversed), XY and YY males in terms of gonadosomatic index, sperm count, sperm motility and duration of sperm motility. Sperm motility was measured by computer-assisted sperm analysis (CASA) quantifying several parameters: total motility, progressive motility, curvilinear velocity, straight line velocity, average path velocity and linearity. None of the sperm traits measured significantly differed between the three genotypes. Mean values of gonadosomatic index, sperm concentration and sperm motility duration of XX, XY and YY males, respectively ranged from 0.92 to 1.33%, from 1.69 to 2.22 ×10(9) cells mL(-1) and from 18'04″ to 27'32″. Mean values of total motility and curvilinear velocity 1 min after sperm activation, respectively ranged from 53 to 58% and from 71 to 76 μm s(-1) for the three genotypes. After 3 min of activity, all the sperm motility and velocity parameters dropped by half and continued to slowly decrease thereafter. Seven min after activation, only 9 to 13% of spermatozoa were still progressive. Our results prove that neither sexual genotype nor hormonal sex reversal treatments affect sperm quality in male Nile tilapias with atypical sexual genotype. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. The effect of titanium dioxide nanoparticles on antioxidant gene expression in tilapia ( Oreochromis niloticus)

    Science.gov (United States)

    Varela-Valencia, Ruth; Gómez-Ortiz, Nikte; Oskam, Gerko; de Coss, Romeo; Rubio-Piña, Jorge; del Río-García, Marcela; Albores-Medina, Arnulfo; Zapata-Perez, Omar

    2014-04-01

    The reactivity of nanoparticles (NPs) in biological systems is well recognized, but there are huge gaps in our understanding of NP toxicity in fish, despite a number of recent ecotoxicity studies. Therefore, the aim of this research was to evaluate the effect of titanium dioxide NPs (TiO2-NPs) on antioxidant gene expression in the tilapia, Oreochromis niloticus. First, different sizes, shapes, and phases of TiO2-NPs were synthesized and characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD), and dynamic light scattering (DLS). Fish were injected intraperitoneally with different concentrations (0.1, 1.0, 10.0 mg/L), sizes (7, 14, and 21 nm), and phases (anatase and rutile) of TiO2-NPs, and sacrificed 3, 6, 12, and 24 h after injection, when their livers were removed. Total RNA was extracted, and expression of the catalase ( CAT), glutathione- S-transferase ( GST), and superoxide dismutase ( SOD) genes was assessed by real-time polymerase chain reaction (RT-PCR). The results showed that injection of 1.0 mg/L TiO2-NPs induced an initial mild increase in CAT, GST, and SOD gene expression in tilapia, after which transcript levels decreased. Fish injected with 7 and 14 nm TiO2-NPs showed an increase in antioxidant transcript levels 6 h after treatment. Finally, the rutile form generated stronger induction of the GST gene than anatase TiO2-NPs during the first 6 h after injection, which suggests that exposure to rutile causes higher levels of reactive oxygen species to be produced.

  8. Effects of irradiation and refrigeration on the nutrients and shelf-life of tilapia (Oreochromis niloticus)

    International Nuclear Information System (INIS)

    Siqueira, Alessandra Aparecida Zilio Cozzo de

    2001-01-01

    The objective of this study is to enhance the shelf-life of processed fish, combining ionizing radiation and refrigeration with minimal processing. The physical, chemical, nutritional and microbiological characteristics of the specie Tilapia nilotica (Oreochromis niloticus) were studied in eviscerated samples and in commercial cuts. The fish were separated into samples irradiated with 1.0, 2.2 and 5 kGy and non-irradiated samples. They were stored at temperatures ranging from 0.5 deg C to -2 deg C for 20 and 30 days. During storage, the level of moisture in the non-irradiated samples decreased and the levels of protein and lipid increased while the irradiated samples remained stable. The levels of pH, TVB-N and NPN increased in the non-irradiated samples but tended to remain stable in the irradiated fish samples. During storage, microbiological analyses for the presence of coliforms proved the efficiency of the irradiation process. The irradiated samples had a microbiological content below the levels established by the Brazilian seafood legislation, whereas the non-irradiated samples had a higher microbiological content and were not in conformity with the officially permitted levels. Salmonella spp. and Staphylococcus aureus were not detected. The levels of amino acids in muscles and fatty acids in oil remained stable in the irradiated fish stored samples but decreased in the non-irradiated ones. Lipid-oxidation, measured by the TBARS test, showed a tendency to increase when the dose of irradiation increased. The storage products after 30 days showed good acceptability for sensorial parameters, appearance, odour, color and texture, so it is possible to increase the shelf life of a minimally processed tilapia using combined irradiation and refrigeration. (author)

  9. PHARMACOKINETIC EVALUATION OF MELOXICAM AFTER INTRAVENOUS AND INTRAMUSCULAR ADMINISTRATION IN NILE TILAPIA (OREOCHROMIS NILOTICUS).

    Science.gov (United States)

    Fredholm, Daniel V; Mylniczenko, Natalie D; KuKanich, Butch

    2016-09-01

    Critically evaluating the pharmacokinetic behavior of a drug in the body provides crucial information about how to effectively treat a patient. Pharmacokinetic studies that exist in fish have primarily focused on drugs used to treat infectious disease, with minimal attention given to analgesic drugs. The objective of this study was to determine the pharmacokinetics of meloxicam (1 mg/kg) in Nile tilapia ( Oreochromis niloticus ) (n = 12). A single dose of meloxicam was administered either i.v. or i.m. Blood samples were obtained at predetermined times after drug injection. Plasma meloxicam concentrations were determined by a validated liquid chromatography/mass spectrometry method, and noncompartmental pharmacokinetic analysis was performed. The mean peak plasma concentration after i.m. injection was 1.95 μg/ml. The mean terminal half-life of meloxicam after i.v. and i.m. administration was 1.36 and 1.8 hr, respectively. The area under the plasma concentration-versus-time curve extrapolated to infinity was 11.26 hr·μg/ml after i.v. administration and 5.72 hr·μg/ml after i.m. administration. Bioavailability of meloxicam after i.m. administration was approximately half that of i.v. administration. Elimination was rapid in both the i.m. and i.v. routes of administration, suggesting that maintaining clinically relevant plasma concentrations may be difficult using this dose. This study represents the first pharmacokinetic evaluation of a nonsteroidal anti-inflammatory drug in a fish species, and further studies evaluating efficacy are needed.

  10. Agonistic and reproductive behaviors in males of red hybrid tilapia, Oreochromis niloticus (Linnaeus, 1758 x O. mossambicus (Peters, 1852 (Osteichthyes: Cichlidae

    Directory of Open Access Journals (Sweden)

    APT Medeiros

    Full Text Available The red hybrid tilapia, Oreochromis niloticus (Linnaeus, 1758 x O. mossambicus (Peters, 1852 is a fertile hybrid used in the semi-intensive level of fish culture in the Northeast of Brazil. It is a territorial cichlid and is highly aggressive towards conspecifics during the breeding season. The purpose of this study was to investigate and describe the aggressive behaviour displayed by the males of this hybrid in non-reproductive and reproductive contexts. Behavioural observations revealed that aggression displayed by the reproductive males of red hybrid tilapia included threatening, undulation, parallel, lateral and frontal attacks, chasing, escape and submission. Possession of a territory influenced male aggressiveness, which was more intense in their own territory than that observed in a neutral situation. The males built nests, irrespective of female presence. All the behavioural patterns were in accordance with those previously described for one parental species, the Nile tilapia, O. niloticus.

  11. Maternal age influences on reproductive rates in Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Fernanda Nogueira Valentin

    2015-04-01

    Full Text Available In this study we examined the effects of the maternal age on the fecundity (absolute and relative, egg production, and fertilization rates of Nile tilapia (Oreochromis niloticus. Females were divided into three groups: Group 1 (6 years old, Group 2 (3 years old, and Group 3 (8 months old. Males of eight months were used in all groups. Twice a week, the females' mouths were examined, and if they had eggs, these were removed and transferred to 2-L incubators. No difference was observed in the absolute fecundity between the different maternal age groups. Relative fecundity and egg production was greater in Group 3 (8 months and fertilization rates were lower in Group 1 (6 years. Younger tilapias are more viable for egg production, because they have better reproductive indexes.

  12. APPARENT DIGESTIBILTY EXPERIMENT WITH NILE TILAPIA (OREOCHROMIS NILOTICUS FED DIETS CONTAINING CITRULLUS LANATUS SEEDMEAL

    Directory of Open Access Journals (Sweden)

    Wasiu Adeyemi JIMOH

    2015-12-01

    Full Text Available Apparent digestibility coefficients of nutrients in Citrullus lanatus based diets were determined for Nile tilapia (Oreochromis niloticus using AIA as marker or indicator. 150 tilapia fingerlings of average weight 6.12±0.05g were acclimatized for a week, weighed and allotted into five dietary treatments; CTR, DT2, DT3, DT4 and DT5 containing 0, 15, 30, 45 and 60% Citrullus lanatus respectively. The diets were isonitrogenous, isocaloric and isolipidic. Each treatment was replicated three times with ten fish per replicate. Fish were fed 5% body weight on two equal proportions per day. The results from the study indicated that there was no significant variation (p>0.05 in the apparent organic matter and gross energy digestibility coefficients of the diets; that there was significant (p0.05 in the apparent digestibility coefficients of nutrients (protein, energy, lipid and carbohydrates between the diets up to 30% replacement levels for tilapia.

  13. Productive performance of Nile tilapia (Oreochromis niloticus) fed at different frequencies and periods with automatic dispenser

    OpenAIRE

    Sousa,R.M.R.; Agostinho,C.A.; Oliveira,F.A.; Argentim,D.; Novelli,P.K.; Agostinho,S.M.M.

    2012-01-01

    Avaliou-se o desempenho de tilápias-do-nilo (Oreochromis niloticus) produzidas em tanque-rede, providas de dispensadores automáticos de ração, alimentadas em diferentes frequências - uma vez por hora e a cada duas horas - e períodos - durante o dia, à noite ou ambos. Dezoito tanques-rede de 1.0m³ foram colocados em um tanque de 2000m² com dois metros de profundidade e renovação de água de 5%. Cento e setenta tilápias, com peso inicial de 16.0±4.9g foram distribuídas em cada tanque-rede de 1m³...

  14. Mechanical and thermal properties of irradiated films based on Tilapia (Oreochromis niloticus) proteins

    International Nuclear Information System (INIS)

    Sabato, S.F.; Nakamurakare, N.; Sobral, P.J.A.

    2007-01-01

    Proteins are considered potential material in natural films as alternative to traditional packaging. When gamma radiation is applied to protein film forming solution it resulted in an improvement in mechanical properties of whey protein films. The objective of this work was the characterization of mechanical and thermal properties of irradiated films based on muscle proteins from Nile Tilapia (Oreochromis niloticus). The films were prepared according to a casting technique with two levels of plasticizer: 25% and 45% glycerol and irradiated in electron accelerator type Radiation Dynamics, 0.550 MeV at dose range from 0 to 200 kGy. Thermal properties and mechanical properties were determined using a differential scanning calorimeter and a texture analyzer, respectively. Radiation from electron beam caused a slightly increase on its tensile strength characteristic at 100 kGy, while elongation value at this dose had no reduction

  15. Application of the comet assay in erythrocytes of Oreochromis niloticus (Pisces: a methodological comparison

    Directory of Open Access Journals (Sweden)

    Cintya A. Christofoletti

    2009-01-01

    Full Text Available The present study applied the comet assay to erythrocytes of Oreochromis niloticus with the aim of improving protocols to detect DNA damage in these cells, by using two distinct pHs (pH = 12.1 and pH > 13 and evaluating whether there is a correspondence between silver and ethidium bromide staining. Comets were visually examined and, the frequency of cells with and without damage was obtained, as well as the distribution of classes and scores. By using the Kruskal-Wallis test, our results revealed that pH 12.1 is more effective, although both pHs can be used. Our findings also suggest that silver staining can substitute ethidium bromide, an expensive and highly toxic stain that requires specific equipment for examination.

  16. Mechanical and thermal properties of irradiated films based on Tilapia (Oreochromis niloticus) proteins

    Energy Technology Data Exchange (ETDEWEB)

    Sabato, S.F. [Radiation Technology Center, IPEN-CNEN/SP, Av. Lineu Prestes 2242, 05508 900 Sao Paulo, SP (Brazil)], E-mail: sfsabato@ipen.br; Nakamurakare, N.; Sobral, P.J.A. [Food Engineering Department, ZEA/FZEA/USP, Av. Duque de Caxias Norte 225, 13635 900 Pirassununga, SP (Brazil)

    2007-11-15

    Proteins are considered potential material in natural films as alternative to traditional packaging. When gamma radiation is applied to protein film forming solution it resulted in an improvement in mechanical properties of whey protein films. The objective of this work was the characterization of mechanical and thermal properties of irradiated films based on muscle proteins from Nile Tilapia (Oreochromis niloticus). The films were prepared according to a casting technique with two levels of plasticizer: 25% and 45% glycerol and irradiated in electron accelerator type Radiation Dynamics, 0.550 MeV at dose range from 0 to 200 kGy. Thermal properties and mechanical properties were determined using a differential scanning calorimeter and a texture analyzer, respectively. Radiation from electron beam caused a slightly increase on its tensile strength characteristic at 100 kGy, while elongation value at this dose had no reduction.

  17. Effects of Microcystis on Hypothalamic-Pituitary-Gonadal-Liver Axis in Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Chen, Jiazhang; Meng, Shunlong; Xu, Hai; Zhang, Zhen; Wu, Xiangyang

    2017-04-01

    In the present study, Nile tilapia (Oreochromis niloticus) were used to assess the endocrine disruption potential of Microcytis aeruginosa. Male Nile tilapia were exposed to lyophilized M. aeruginosa or purified microcystin-LR (8.3 μg/L) for 28 days. The levels of serum hormones (17β-estradiol and testosterone) and transcripts of selected genes in the hypothalamus-pituitary-gonadal-liver axis were analyzed. The results showed that serum hormones were significantly up-regulated, and transcripts of 13 genes (GHRH, PACAP, GH, GHR1, GHR2, IGF1, IGF2, CYP19a, CYP19b, 3β-HSD1, 20β-HSD, 17β-HSD1 and 17β-HSD8) were significantly altered after Microcytis exposure. These results indicate that fish reproduction can be altered in a Microcystis bloom-contaminated aquatic environment.

  18. Molecular structure, distribution, and immunology function of TNFSF13B (BAFF) in Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Liu, Hongzhen; Zhang, Jiaxin; Li, Jianfeng; Song, Jinyun; Zhang, Shuangquan

    2016-04-01

    B cell-activating factor (BAFF)is a member of the tumor necrosis factor (TNF) family and plays roles in B cell survival and maturation. In this study, the full-length cDNA of Nile tilapia (Oreochromis niloticus) BAFF (tBAFF) was amplified from the spleen by reverse transcription PCR (RT-PCR). The open reading frame of this cDNA encodes a protein of 261 amino acids containing a predicted transmembrane domain and a furin protease cleavage site, similar to mammalian, avian, and reptile BAFF. Real-time quantitative PCR (qPCR) analysis revealed that tBAFF is present in various tissues and is predominantly expressed in the spleen. The predicted three-dimensional (3D) structure of the Nile tilapia (Oreochromis niloticus) soluble BAFF (tsBAFF) monomer was determined by (3D) structure modeling monomeranalyzed by (3D) structure mouse counterpart. Both tsBAFF and EGFP/tsBAFF were efficiently expressed in Escherichia coli BL21 (DE3), as confirmed by SDS-PAGE and Western blot analysis. After purification, the EGFP/tsBAFF fusion protein showed a fluorescence spectrum similar to that of EGFP. Laser scanning confocal microscopy showed that EGFP/tsBAFF bound to its receptor. In vitro, tsBAFF promoted the proliferation of Nile tilapia and mouse splenic B cells together with/without a priming agent (Staphylococcus aureus Cowan 1, SAC) or anti-mouse IgM. Furthermore, tsBAFF showed a similar proliferation-stimulating effect on mouse B cells compared to msBAFF. These findings indicate that tsBAFF plays an important role in the proliferation of Nile tilapia B cells and has functional cross-reactivity among Nile tilapia and mammals. Therefore, BAFF may represent a useful factor for enhancing immunological efficacy in animals. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Comparative assessment of bioload of healthy and diseased Oreochromis niloticus as means of food security

    Directory of Open Access Journals (Sweden)

    Toochukwu Ekwutosi OGBULIE

    2011-05-01

    Full Text Available Thirty-one (31 samples each of diseased and healthy Tilapia fish (Oreochromis niloticus from Otamiri River, in Nekede, Owerri West; Imo State Nigeria was examined to detect the presence of bacterial and helminth fauna. The intestine, liver, gill, tissue and skin of the fish were examined. Bacteriological analysis revealed counts of healthy diseased organs to fall between 6.0 x 104 – 3.5 x 107 cfu/g and 5.7 x 106 – 1.9 x 1011 cfu/g respectively. The result however indicated that the bacterial load of the diseased fish samples were higher than those of the apparently healthy fish. Identification tests of the probable bacterial isolates revealed the isolation of Vibrio sp, Renibacterium sp, Aeromonas sp, Klebsiella sp, Yersinia sp, Pseudomonas sp, Nocardia sp, Lactobacillus sp, Sporocytophaga, Staphylococcus sp, Mycobacterium sp, Serratia sp Proteus sp and Edwardsiella sp. Twenty-nine (29 ie 46.8% of the 62 samples studied were found to be infected by helminth fauna identified as Camallanus sp, Procamallanus beviconchus, Capillaria sp, Clinostonium tilapiae, Euclinostonium heterostoma, Cleidodiscus sp and Bothricephalus acheilognathi. Percentage helminth infestation was found to be higher in males than females with sub adults recording the highest infection rate of 56.08%. Hence helminth infestation varies amongst age group. This study therefore reveals the bacterial & helminth load of cultured organs of Oreochromis niloticus with a view to provide information on the state of environmental and personal hygiene in the environment, the level of contamination of water and the security and/or insecurity nature of using fish as food.

  20. Elaboration of fish bouillon cubes using pirambeba (Serrasalmus brandtii and tilapia (Oreochromis niloticusElaboração de caldo de peixe em cubos compactados utilizando pirambeba (Serrasalmus brandtii e tilápia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Katia Lumi Fukushima

    2013-03-01

    Full Text Available Broth cubes are packed spices highly prized for their low cost and for the flavor given to dishes, usually carbohydrate-based. The objective of this work was to establish compressed broth cubes, exploiting the nutritional characteristics of pirambeba (Serrasalmus brandtii and tilapia (Oreochromis niloticus, seeking a new product to the spice market, and contribute to a proper waste disposal of the fishing industry. A formulation of this pattern was prepared, where 30% was replaced by different forms of processing of the species used, resulting in different fish broth, to which analysis of interest were performed. From the analysis, it was concluded that the fish broth using ground tilapia presented the best characteristics when compared to commercial broth. Chemical composition of fish bouillon cubes with species and tilapia pirambeba showed no major differences, which proves that other waste of fish or the fishing industry may also contribute to the production of broths. The broth commercial was less variety of polyunsaturated fatty acids, and low contents of calcium and phosphorus minerals, and more lipids compared to fish broth prepared. Caldos em cubos compactados são temperos muito apreciados por seu baixo custo e por conferir sabor a pratos geralmente à base de carboidratos. Objetivou-se elaborar caldos em cubos compactados, explorando as características nutricionais da pirambeba (Serrasalmus brandtii e tilápia (Oreochromis niloticus, visando um novo produto para o mercado de temperos, além de contribuir para um correto destino de resíduos da indústria pesqueira. Foi elaborada uma formulação padrão onde 30% desta foi substituída pelas diferentes formas de processamento das espécies utilizadas, resultando em diferentes caldos de peixe, para os quais foram realizadas as análises de interesse. A composição centesimal dos temperos contendo espécies tilápia e pirambeba não apresentaram grandes diferenças, o que comprova que

  1. Antibiotic resistence of Aeromonas hydrophila isolated from Piaractus mesopotamicus (Holmberg, 1887 and Oreochromis niloticus (Linnaeus, 1758 Resistência de Aeromonas hydrophila isolada de Piaractus mesopotamicus (Holmberg, 1887 e Oreochromis niloticus (Linnaeus, 1758 a antibióticos

    Directory of Open Access Journals (Sweden)

    Andréa Belém-Costa

    2006-06-01

    Full Text Available One of the most important problems involving treatments with antibiotics against Aeromonas hydrophila isolated from fishes is that antibiotic resistance develops readily. The antimicrobial activity of chemotherapeutants in isolates from pacu Piaractus mesopotamicus (Holmberg, 1887 and tilapia Oreochromis niloticus (Linnaeus, 1758 was tested by the Kirby-Bauer disk method, over Mueller-Hinton surface agar previously inoculated with 100 µL of bacterial suspensions. After regular incubation, isolates from tilapia and pacu were uniformly resistant to amoxicillin, ampicillin, lincomycin, novobiocin, oxacillin, penicillin, and trimetoprim+sulfametoxazole. The A. hydrophila type strain presented resistance to the same antimicrobial substances and also against rifampicin; the bacterial isolate from pacu were the only strain resistant to tetracyclin. Isolates from both pacu and tilapia had intermediate reaction with erytromycin. The use of drugs in commercial fish farms in Brazil can favor the development of resistant bacterial strains in native fish species as already observed for exotic species, commercially produced for longer time.Um dos maiores problemas envolvendo o tratamento com antibióticos contra Aeromonas hydrophila isolada de peixes confinados é a rápida resistência ao antibiótico desenvolvida pela bactéria. A atividade antimicrobiana de quimioterapêuticos em isolados a partir de pacu Piaractus mesopotamicus (Holmberg, 1887 e tilápia Oreochromis niloticus (Linnaeus, 1758 foi verificada pelo método de difusão de antibiótico em discos de Kirby-Bauer, sobre uma superfície de Agar Mueller-Hinton previamente inoculada com 100 µL de suspensão bacteriana. Após o período de incubação, os isolados de tilápia e pacu foram uniformemente resistentes a amoxicilina, ampicilina, lincomicina, novobiocina, oxacilina, penicilina e trimetoprim+sulfametoxazol. A cepa tipo para A. hydrophila apresentou resistência às mesmas subst

  2. An important natural genetic resource of Oreochromis niloticus (Linnaeus, 1758) threatened by aquaculture activities in Loboi drainage, Kenya.

    Science.gov (United States)

    Ndiwa, Titus Chemandwa; Nyingi, Dorothy Wanja; Agnese, Jean-François

    2014-01-01

    The need to improve food security in Africa through culture of tilapias has led to transfer of different species from their natural ranges causing negative impacts on wild fish genetic resources. Loboi swamp in Kenya is fed by three hot springs: Lake Bogoria Hotel, Chelaba and Turtle Springs, hosting natural populations of Oreochromis niloticus. The present study aimed at better genetic characterization of these threatened populations. Partial mtDNA sequences of the D-loop region and variations at 16 microsatellite loci were assessed in the three hot spring populations and compared with three other natural populations of O. niloticus in the region. Results obtained indicated that the hot spring populations had mitochondrial and nuclear genetic variability similar to or higher than the large closely related populations. This may be attributed to the perennial nature of the hot springs, which do not depend on rainfall but rather receive permanent water supply from deep aquifers. The study also revealed that gene flow between the three different hot spring populations was sufficiently low thus allowing their differentiation. This differentiation was unexpected considering the very close proximity of the springs to each other. It is possible that the swamp creates a barrier to free movement of fish from one spring to the other thereby diminishing gene flow. Finally, the most surprising and worrying results were that the three hot spring populations are introgressed by mtDNA genes of O. leucostictus, while microsatellite analysis suggested that some nuclear genes may also have crossed the species barrier. It is very likely that the recent intensification of aquaculture activities in the Loboi drainage may be responsible for these introgressions. Taking into account the importance of these new genetic resources, protection and management actions of the Loboi swamp should be accorded top priority to prevent the loss of these spring populations.

  3. An important natural genetic resource of Oreochromis niloticus (Linnaeus, 1758 threatened by aquaculture activities in Loboi drainage, Kenya.

    Directory of Open Access Journals (Sweden)

    Titus Chemandwa Ndiwa

    Full Text Available The need to improve food security in Africa through culture of tilapias has led to transfer of different species from their natural ranges causing negative impacts on wild fish genetic resources. Loboi swamp in Kenya is fed by three hot springs: Lake Bogoria Hotel, Chelaba and Turtle Springs, hosting natural populations of Oreochromis niloticus. The present study aimed at better genetic characterization of these threatened populations. Partial mtDNA sequences of the D-loop region and variations at 16 microsatellite loci were assessed in the three hot spring populations and compared with three other natural populations of O. niloticus in the region. Results obtained indicated that the hot spring populations had mitochondrial and nuclear genetic variability similar to or higher than the large closely related populations. This may be attributed to the perennial nature of the hot springs, which do not depend on rainfall but rather receive permanent water supply from deep aquifers. The study also revealed that gene flow between the three different hot spring populations was sufficiently low thus allowing their differentiation. This differentiation was unexpected considering the very close proximity of the springs to each other. It is possible that the swamp creates a barrier to free movement of fish from one spring to the other thereby diminishing gene flow. Finally, the most surprising and worrying results were that the three hot spring populations are introgressed by mtDNA genes of O. leucostictus, while microsatellite analysis suggested that some nuclear genes may also have crossed the species barrier. It is very likely that the recent intensification of aquaculture activities in the Loboi drainage may be responsible for these introgressions. Taking into account the importance of these new genetic resources, protection and management actions of the Loboi swamp should be accorded top priority to prevent the loss of these spring populations.

  4. Morphological characteristics of ovarian development of two Nile tilapia (Oreochromis niloticus) strains in mixed-culture systems

    OpenAIRE

    Neves,P.R.; Natali,M.R.M.; Ribeiro,R.P.; Vargas,L.; Maehana,K.R.; Marengoni,N.G.

    2009-01-01

    This study was carried out to morphologically characterize and classify the stages of gonad development in different Nile tilapia strains (Oreochromis niloticus). Eighty-four and ninety-two ovaries from Bouaké and Chitralada strains, respectively, were evaluated at different ovarian developmental phases: initial (104 days of culture), intermediate (152 days of culture), and the final (279 days of culture). The ovaries were microscopically evaluated and submitted to histological processing and...

  5. Pengaruh Suplementasi Bakteri Asam Laktat Isolat UM 1 dan Inulin terhadap Kultur Benih Ikan Nila (Oreochromis niloticus)

    OpenAIRE

    Putri, Virza Ratika Inneke

    2016-01-01

    This study was conducted to see the effect of feeding in the form of Lactic Acid Bacteria (LAB) probiotic UM 1 Isolate and prebiotic (inulin) on survival, specific growth rate and feeding efficiency of tilapia fish (Oreochromis niloticus). The treatment consisted of control, probiotic, prebiotic and sinbiotic addition have been added to aquarium that contained 10 tilapia fish. This research was conducted at the aquarium (40 x 25 x 28 cm) for 21 days. The fish were treated by ...

  6. Skin and subcutaneous mycoses in tilapia (Oreochromis niloticus) caused by Fusarium oxysporum in coinfection with Aeromonas hydrophila

    OpenAIRE

    Cutuli, M.?Teresa; Gibello, Alicia; Rodriguez-Bertos, Antonio; Blanco, M. Mar; Villarroel, Morris; Giraldo, Alejandra; Guarro, Josep

    2015-01-01

    Subcutaneous mycoses in freshwater fish are rare infections usually caused by oomycetes of the genus Saprolegnia and some filamentous fungi. To date, Fusarium infections in farmed fish have only been described in marine fish. Here, we report the presence of Fusarium oxysporum in subcutaneous lesions of Nile tilapia (Oreochromis niloticus). Histopathologic evaluation revealed granuloma formation with fungal structures, and the identity of the etiological agent was demonstrated by morphological...

  7. Novel single nucleotide polymorphisms in candidate genes for growth in tilapia ( Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Breidy Lizeth Cuevas-Rodríguez

    2016-06-01

    Full Text Available ABSTRACT The objective of the present work was to identify and validate single nucleotide variations located in candidate genes to growth traits in tilapia (Oreochromis niloticus. Two transitions were identified in the promoter region of the growth hormone gene (GH; eight nucleotide changes were identified in introns and promoter region of the IGF-I gene; and a transition (T/C was identified in the Myogenin gene (MyoG. The highest genotypic frequency (0.8 for GHpA1 and MyoG was found in the GG and TT homozygous individuals, while the highest frequency (0.9 for GHpB1 was observed in the CT heterozygous fish. There was no genotypic frequency in the CC homozygous tilapia for the GHpB1 and MyoG markers. Based on their allelic frequencies, validation as novel single nucleotide polymorphisms (SNP of those variations located at O. niloticus GH and MyoG genes was possible. These new markers will allow their association with growth traits in tilapia to be exploited in order to determine their potential use as assisted-selection markers.

  8. Prevalence and seasonal variation of ectoparasites in cultured Nile tilapia Oreochromis niloticus in Saudi Arabia.

    Science.gov (United States)

    Suliman, El Amin M; Al-Harbi, Ahmed H

    2016-12-01

    The prevalence, mean intensity and abundance of ectoparasites (monogeneans and trichodinids) from Nile tilapia Oreochromis niloticus were investigated during different seasons of two consecutive years, from January 2011 to December 2012. A total of 360 O . niloticus was collected from three fish farms located in the central region of Saudi Arabia. Prevalence, mean intensity and mean abundance of monogeneans on fish gills were found to be significantly ( p  skin were found to be significantly ( p  skin were found to be higher ( p  < 0.01) in farm (C) (97.5, 875, 857.5 %), then farm (A) (26.67, 399.70, 215.01 %) and farm (B) (4.17, 154.17, 12.5 %) respectively. These results indicated that water quality and nutritional qualities were the major factors that affecting parasite occurrence, while the effect of temperature, seasonality and stocking density might have a secondary role on ectoparasite occurrence. Further studies should investigate that how the nutritional and water qualities affect the immunity of the fish to resist parasite infection.

  9. Marine Collagen Peptides from the Skin of Nile Tilapia (Oreochromis niloticus): Characterization and Wound Healing Evaluation.

    Science.gov (United States)

    Hu, Zhang; Yang, Ping; Zhou, Chunxia; Li, Sidong; Hong, Pengzhi

    2017-03-30

    Burns can cause tremendous economic problems associated with irreparable harm to patients and their families. To characterize marine collagen peptides (MCPs) from the skin of Nile tilapia ( Oreochromis niloticus ), molecular weight distribution and amino acid composition of MCPs were determined, and Fourier transform infrared spectroscopy (FTIR) was used to analyze the chemical structure. Meanwhile, to evaluate the wound healing activity, in vitro and in vivo experiments were carried out. The results showed that MCPs prepared from the skin of Nile tilapia by composite enzymatic hydrolysis were composed of polypeptides with different molecular weights and the contents of polypeptides with molecular weights of less than 5 kDa accounted for 99.14%. From the amino acid composition, the majority of residues, accounting for over 58% of the total residues in MCPs, were hydrophilic. FTIR indicated that the main molecular conformations inside MCPs were random coil. In vitro scratch assay showed that there were significant effects on the scratch closure by the treatment of MCPs with the concentration of 50.0 μg/mL. In the experiments of deep partial-thickness scald wound in rabbits, MCPs could enhance the process of wound healing. Therefore, MCPs from the skin of Nile tilapia ( O. niloticus ) have promising applications in wound care.

  10. Morpho-functional response of Nile tilapia (Oreochromis niloticus) to a homeopathic complex.

    Science.gov (United States)

    Braccini, Graciela Lucca; Natali, Maria Raquel Marçal; Ribeiro, Ricardo Pereira; Mori, Ricardo Hideo; Riggo, Rafael; Oliveira, Carlos A L; Hildebrandt, João Fábio; Vargas, Lauro

    2013-10-01

    This study evaluated the performance, prevalence of ectoparasites and morpho-functional response of the liver and the branchiae of Nile tilapia (Oreochromis niloticus) raised on fish meal with added of the homeopathic complex Homeopatila 100(®) at different concentrations. Post-reversed juvenile Nile tilapia (O. niloticus) of the GIFT (Genetic Improvement of Farmed Tilapia) strain were used in this study. The performance, ectoparasite prevalence and parasite load in the branchiae and skin as well as the liver and branchial histology. Fish were randomly assigned to receive one of four treatments: control, 20 mL hydroalcoholic solution (alcohol 30° GL); 20 mL Homeopatila 100(®) per kg of meal; 40 mL Homeopatila 100(®) per kg of meal; or 60 mL of Homeopatila 100(®) per kg of meal, compared to control with out the addition of the complex. There were four replications per treatment type (16 experimental units total) at a density of 40 fish per m(3) over a period of 57 days. The Kruskal-Wallis H test (p tilapias resulted in improved hepatocytes and intracellular glycogen levels as well as the lowest mean rate of branchial histological changes with an increase in acidic mucin-producing cells compared to neutral mucin-producing cells, compared to control. Copyright © 2013 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  11. Antioxidant activities of red tilapia (Oreochromis niloticus) protein hydrolysates as influenced by thermolysin and alcalase

    Science.gov (United States)

    Daud, Nur'Aliah; Babji, Abdul Salam; Yusop, Salma Mohamad

    2013-11-01

    The hydrolysis process was performed on fish meat from Red Tilapia (Oreochromis niloticus) by enzymes thermolysin and alcalase under optimum conditions. The hydrolysis was performed from 0 - 4 hours at 37°C. Hydrolysates after 2 hours incubation with thermolysin and alcalase had degree of hydrolysis of 76.29 % and 63.49 %, respectively. The freeze dried protein hydrolysate was tested for peptide content and characterized with respect to amino acid composition. The result of increased peptide content in Red Tilapia (O. Niloticus) hydrolysates obtained was directly proportional to the increase activities of different proteolytic enzymes. The result of amino acid composition showed that the sample used contained abundant Gly, Ala, Asp, Glu, Lys and Leu in residues or peptide sequences. Both enzymatic hydrolysates were tested for anti-oxidant activity with DPPH and ABTS assay. Alcalase yielded higher anti-oxidative activity than Thermolysin hydrolysates after 1 hour incubation, but both enzymes hydrolysates showed a significant decrease of anti-oxidant activity after 2 hours of incubation. Hydrolysates from Red Tilapia may contribute as a health promoting ingredient in functional foods to reduce oxidation stress caused by accumulated free radicals.

  12. Effects of dietary genistein on GH/IGF-I axis of Nile tilapia Oreochromis niloticus

    Science.gov (United States)

    Chen, Dong; Wang, Wei; Ru, Shaoguo

    2016-09-01

    There is considerable concern that isoflavones, such as genistein in fish feed composed of soybean protein, aff ects somatic growth in fish. Our previous works demonstrated that 30 and 300 μg/g dietary genistein had no significant eff ect on growth performance in Nile tilapia ( Oreochromis niloticus), but the higher level of genistein (3 000 μg/g) significantly depressed growth. This study was conducted to further examine the eff ects of dietary genistein on the endocrine disruption on growth hormone/insulin-like growth factor-I (GH/IGF-I) axis in Nile tilapia ( O. niloticus). Juvenile fish were fed by hand twice daily to satiation with one of four isonitrogenous and isoenergetic diets, each containing either 0, 30, 300 or 3 000 μg/g genistein. Following an 8-week feeding period, plasma GH and IGF-I levels were investigated by radioimmunoassay and gene expression levels of gh, ghrelin, gnrhs, ghr, npy, npyrs, pacap, ghrs, i gf-I, igf-Ir, and igfbp3 were examined by real-time PCR. The results show that no significant change in plasma GH and IGF-I levels in fish fed with diets containing 30 μg/g and 300 μg/g genistein. mRNA expression of genes along the GH/IGF-I axis remained unaff ected, except for igf-Ir, which was stimulated by the 300 μg/g genistein diet. While in fish fed the 3 000 μg/g genistein diet, the plasma GH and IGF-I levels decreased, and mRNA expression of gh, ghr2, npyr1, igf-I, and igf-Ir were also significantly depressed. In contrast, npy and igfbp3 mRNA expression were enhanced. This study provides convincing evidence for growth impediment by genistein by disturbing the GH/IGF-I axis in Nile tilapia O. niloticus.

  13. A multiparameter investigation into adverse effects of aflatoxin on Oreochromis niloticus health status

    Directory of Open Access Journals (Sweden)

    Magdy E. Mahfouz

    2015-08-01

    Full Text Available Aflatoxin is a common contaminant of foods, particularly in the staple diets of many developing countries. To evaluate adverse effects of aflatoxin B1 (AFB1 toxicity on health status in the Nile tilapia Oreochromis niloticus, fish were fed diet contaminated with either 20 or 100 ppb AFB1 for 6 or 12 weeks. Growth indices, survival rate and hepatosomatic index (HSI were assessed. Blood samples were collected for hematological profiles (e.g. RBCs and WBC count, Hb content. Liver enzyme activity; aspartate aminotransferase (AST, alanine aminotransferase (ALT as well as alkaline phosphatase (ALP, were evaluated and toxin residues in the liver and musculature were detected. Liver histopathological investigations were carried out, whereas antioxidant glutathione peroxidase (GPx and glutathione S-transferase (GST gene expression were determined in this tissue by semi-quantitative RT-PCR. Furthermore, to test the fish immune status, challenge against Aeromonas hydrophila was conducted. Results indicated that 100 ppb AFB1 negatively impacted O. niloticus weight gain, feed efficiency, hematological profiles, HSI as well as liver histopathology, while increase in AST, ALT, ALP liver enzymes activity was evidenced. Further, the expression of liver GPx and GST down-regulated and AFB1 residues were always detected in the liver and only in the musculature in fish fed 100 ppb AFB1 for 12 weeks. The ability of fish to withstand A. hydrophila infection was remarkably lowered. Overall, the results herein demonstrate the toxic effects of AFB1 in O. niloticus. The observed alterations in fish status, especially in the liver coincide well with the expected oxidative stress resulting from the AFB1 toxicity.

  14. Gill histopathological alterations in Nile tilapia, Oreochromis niloticus exposed to treated sewage Water

    Directory of Open Access Journals (Sweden)

    António Fontaínhas-Fernandes

    2008-10-01

    Full Text Available Adult Nile tilapia, Oreochromis niloticus, of both sexes were exposed in wastewater from a sewage treatment plant for a period of 4 days. Gill samples were collected after 24, 48, 72 and 96 h and histopathological changes were analyzed by light and scanning electronic microscopy. Gill epithelium of control O. niloticus (freshwater group was similar to that of other teleosts, while histopathological lesions were observed in exposed fishes. The main histopathological changes were edema, lifting of lamellar and filamentar epithelia and lamellar fusion. Cell proliferation with consequent thickening of the filament epithelium was also found in fishes exposed to the treated sewage water. The severity of the lesions increased with the time of exposure, namely the hyperplasia of the epithelial cells with proliferation of filamentar epithelium and fusion of lamellae observed at 96 h. Additionally, several histopathological results obtained by light microscopy were confirmed through scanning microscopy.Tilápias adultas, Oreochromis niloticus, de ambos os sexos foram expostas em águas residuais de uma estação de tratamento de esgoto durante 4 dias. Amostras de brânquia foram recolhidas após 24, 48, 72 e 96 h e as alterações histopatológicas foram analisadas por microscopia óptica e eletrônica de varredura. O epitélio da brânquia do grupo controle apresentou uma morfologia similar à de outros peixes teleosteos, enquanto foram observadas lesões nos peixes expostos. As principais alterações histopatológicas foram edema, destacamento dos epitélios lamelar e filamentar e fusão lamelar. Os peixes expostos às águas residuais mostraram também proliferação celular com consequente aumento da espessura do filamento branquial. A severidade das lesões aumentou com o tempo de exposição, nomeadamente a hiperplasia das células epiteliais com proliferação do epitélio filamentar e fusão das lamelas observadas preferencialmente às 96 h

  15. Energia digestível para alevinos de tilápia-do-nilo (Oreochromis niloticus Digestible energy for Nile tilapia (Oreochromis niloticus fingerlings

    Directory of Open Access Journals (Sweden)

    Wilson Rogério Boscolo

    2006-06-01

    Full Text Available Avaliou-se o efeito de diferentes níveis de energia digestível na dieta sobre o desempenho de alevinos de tilápia-do-nilo (Oreochromis niloticus. Utilizaram-se 125 alevinos com peso e comprimento iniciais de 0,62±0,12 g e 3,25±0,25 cm, respectivamente, distribuídos em 25 aquários com capacidade de 30 L, em um delineamento experimental inteiramente casualizado, com cinco tratamentos e cinco repetições, em que a unidade experimental consistiu de um aquário contendo cinco alevinos. As rações, isoprotéicas (30% de proteína digestível, isofosfóricas e isocalcíticas, foram formuladas para conter 2.900; 3.025; 3.150; 3.275 e 3.400 kcal/kg de energia digestível. A quantidade de ração fornecida (quatro vezes ao dia correspondeu a 10% da biomassa. Os parâmetros físico-químicos da água (oxigênio dissolvido - OD, pH e condutividade elétrica - CE foram mensurados semanalmente, à tarde, e a temperatura, diariamente, antes da primeira e da última sifonagem, apresentando médias de 8,00±0,05 mg/L; 7,91±0,19; 92,11±2,27 µS/cm e 25,61±0,90ºC, respectivamente. Ao final do experimento, foram analisadas as médias de peso final, ganho de peso, comprimento final, conversão alimentar aparente, sobrevivência e fator de condição. Não foram observadas diferenças no desempenho de alevinos entre os diferentes tratamentos. Recomenda-se a utilização de 2.900 a 3.400 kcal de ED/kg na ração de alevinos de tilápia-do-nilo.The different levels of digestible energy on the performance of Nile tilapia (Oreochromis niloticus fingerlings were evaluated. One hundred and twenty-five fingerlings averaging initial length and weight of 0.62±0.12 and 3.25±0.25 cm were allotted to 25 30L-aquariums, as a completely randomized design with five treatments and five replicates (an aquarium with five fingerlings was considered the experimental unit. The diets, formulated to be isonitrogenous (30% of digestible protein, isophosphorous and isocalcium

  16. Shrimp meal in diets for Nile tilapia ("Oreochromis niloticus" Farinha de camarão em dietas para tilápia do Nilo ("Oreochromis niloticus"

    Directory of Open Access Journals (Sweden)

    Graciela Pessoa Martins

    2008-04-01

    Full Text Available Replacement of conventional ingredients used in fish diets by non-conventional products has been an economic alternative to reduce the cost of feeding. Therefore, 90-day trial was performed to study the effect of shrimp meal (SM inclusion on diets of Nile tilapia fries. Weight gain (WG, feed conversion (FC, apparent feed intake (AFI, fillet yield (FY, fillet income (FI values and protein effiency ratio (PER were evaluated. Each experimental unit was an aquaria with five tilapias (Oreochromis niloticus, mean body weight of 7,9g, total of 120 animals. Treatments were four diets with 0, 25, 50 and 100% of SM replacing the soybean meal, which protein (28.0% and energy (3100 kcal/DE/kg content in diet were similar. Animals were fed three times daily. The offered food was adjusted according to fish live weight. The substitution of soybean by SM reduced WG, FC, AFI, FY and PER. SM inclusion did not affect the FI. Shrimp meal inclusion in diets for Nile tilapia affects negatively the growth performance.O objetivo deste estudo foi testar a inclusão da farinha de camarão (FC em dietas para a tilápia do Nilo. O desempenho dos animais foi avaliado através do ganho de peso (GP, conversão alimentar aparente (CAA, consumo de ração aparente (CRA, peso de filé (PF, rendimento de filé (RF e taxa de eficiência protéica (TEP. O delineamento utilizado no experimento foi em blocos casulaizados distribuídos em 24 caixas de polietileno com capacidade de 150 L supridas por sistema de recirculação fechada de água (0,2L/min. durante 90 dias. Cada unidade experimental era composta por um aquário com cinco tilápias (Oreochromis niloticus com peso médio inicial de aproximadamente 7,9g perfazendo um total de 120 animais. Os tratamentos constituíram-se de quatro rações contendo 0, 25, 50 e 100% de FC em substituição ao farelo de soja, sendo estas isoprotéicas (28,0%PB e isoenergéticas (3100 kcal de EB/kg. Os animais foram alimentados três vezes ao dia

  17. A new record of Myxobolus brachysporus and M. israelensis in the tilapia (Oreochromis niloticus) collected from the Nile River, Egypt.

    Science.gov (United States)

    Abdel-Baki, Abdel-Azeem S; Zayed, Eman; Sakran, Thabet; Al-Quraishy, Saleh

    2015-09-01

    The present study was carried out as part of an ongoing general survey for myxosporean parasites infecting tilapias in the River Nile, Egypt. In the present study, 77 Nile tilapia (Oreochromis niloticus) were collected from boat landing sites at Beni-Suef governorate, Egypt and examined for the myxosporean infection. The infection was encountered as a huge number of free spores in the kidney and the spleen. The infection showed a prevalence of 51.9% (40/77) for Myxobolus brachysporus while it was 25.9% (20/77) for Myxobolus israelensis. Mature spores of M. brachysporus were ellipsoidal and measured 8.6 × 13.2 μm. The polar capsules were subcircular with 5-6 filament turns and measured 4.7 × 3.6 μm. Spores of M. israelensis were ellipsoidal in the frontal view and fusiform in the lateral view. Spore measurements were 13.4 μm long and 8.7 μm wide. The polar capsules were elongated with 6-7 filament coils and measured 8.6 × 3.1 μm. The findings presented here proved that tilapia fishes in the Nile River are still suffering from infections with Myxobolus species. Therefore, further studies should be carried out to survey the Myxobolus infection among tilapias under culture conditions to clarify the pathological impacts of this parasite in tilapias aquaculture.

  18. Distinct expression of three estrogen receptors in response to bisphenol A and nonylphenol in male Nile tilapias (Oreochromis niloticus).

    Science.gov (United States)

    Huang, Weiren; Zhang, Yong; Jia, Xiaoping; Ma, Xilan; Li, Shuisheng; Liu, Yun; Zhu, Pei; Lu, Danqi; Zhao, Huihong; Luo, Wenna; Yi, Shibai; Liu, Xiaochun; Lin, Haoran

    2010-06-01

    Environmental estrogens, such as bisphenol A (BisA) and nonylphenol (NP), have been shown to affect the estrogen receptor (ER) expression and induce male reproductive abnormalities. To elucidate molecular mechanisms of action of xenoestrogenic chemicals on the expression of estrogen receptors in the testes of Nile tilapia (Oreochromis niloticus), three full-length cDNAs respectively encoding ntERalpha, ntERbeta1 and ntERbeta2 were cloned from testes. The amino acid sequences of ntERalpha, ntERbeta1 and ntERbeta2 showed a high degree of similarity to the relevant fish species. Tissue-specific expression study showed that three receptors were highly expressed in pituitary, liver, testis, kidney and intestine tissues. The ntERalpha, ntERbeta1 and ntERbeta2 mRNA expressions were significantly higher at the sexual early recrudescing stage than at other recrudesced stages. After being exposed to xenoestrogens from weeks 2 to 4, the ntERalpha mRNA levels were increased significantly in testes after NP treatment at all sampling times or after 4 weeks of exposure to BPA. The ntERbeta1 mRNA levels remained unchanged, while a significant decrease of the ntERbeta2 mRNA level was observed in testes after exposure to NP and BPA. The present study demonstrates that the regulation of all three ntER subtypes in testes may act via different molecular mechanisms of exposure to NP and BPA.

  19. Molecular and functional characterization of CD59 from Nile tilapia (Oreochromis niloticus) involved in the immune response to Streptococcus agalactiae.

    Science.gov (United States)

    Gan, Zhen; Wang, Bei; Zhou, Wei; Lu, Yishan; Zhu, Weiwei; Tang, Jufen; Jian, JiChang; Wu, Zaohe

    2015-05-01

    CD59, the major inhibitor of membrane attack complex, plays a crucial role in regulation of complement activation. In this paper, a CD59 gene of Nile tilapia, Oreochromis niloticus (designated as On-CD59) was cloned and its expression pattern under the stimulation of Streptococcus agalactiae was investigated. Sequence analysis showed main structural features required for complement-inhibitory activity were detected in the deduced amino acid sequence of On-CD59. In healthy Nile tilapia, the On-CD59 transcripts could be detected in all the examined tissues, with the most abundant expression in the brain. When immunized with inactivated S. agalactiae, there was a clear time-dependent expression pattern of On-CD59 in the skin, brain, head kidney, thymus and spleen, with quite different kinetic expressions. The assays for the complement-inhibitory activity suggested that recombinant On-CD59 protein had a species-selective inhibition of complement. Moreover, our works showed that recombinant On-CD59 protein may possess both binding activities to PGN and LTA and inhibiting activity of S. agalactiae. These findings indicated that On-CD59 may play important roles in the immune response to S. agalactiae in Nile tilapia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Reproduction, food dynamics and exploitation level of Oreochromis niloticus (Perciformes: Cichlidae from artisanal fisheries in Barra Bonita Reservoir, Brazil

    Directory of Open Access Journals (Sweden)

    José Luis Costa Novaes

    2012-06-01

    Full Text Available Nile tilapia (Oreochromis niloticus, which is exotic to South America, is the most common species caught in artisanal fisheries at the Barra Bonita Reservoir, Southeastern Brazil. This species is of great socioeconomic importance for the region and keeps active a population of about 500 fishers. In the present study we assess reproduction, food dynamics and level of exploitation of O. niloticus, caught by artisanal fisheries in the Barra Bonita Reservoir. Specimens were collected monthly, from July 2004-June 2005, and a total of 1 715 specimens were analyzed. Each specimen was examined to obtain biological and biometric data: standard length (cm, total weight (g, reproductive data (sex and stage of maturation, and stomach contents (empty, partly full, and full. We also estimated the sex ratio (by macroscopic observation of gonads, reproductive period (by ovarian development and seasonal average of gonadosomatic index in females, and feeding habits (by stomach contents. The possible relationship between abiotic factors and the reproductive period was statistically verified using Spearman’s Rank Correlation. The FiSAT (ELEFAN I package was used to assess growth parameters, mortality rates and to infer exploitation rate from standard length frequencies. The O. niloticus population had a sex ratio of 1.3:1 (M:F. Results indicated that ripe females were captured throughout the year, with a higher frequency during the winter-2004 (with a frequency of 59%, at a mean temperature of 20.5°C, and in spring-2004 (with a frequency of 60.5% at a mean temperature of 21.18°C. The GSI mean values obtained by season were: winter-2004: 1.71; spring-2004: 1.72; summer-2005: 0.80, and autumn-2005: 1.19. The Spearman correlation indicated positive values with respect to pH, dissolved oxygen, electric conductivity, transparency and chlorophyll a, and negative values with respect to temperature, accumulated rainfall and altimetric benchmark. The main food items

  1. Sex-Related Differences in Hematological Parameters and Organosomatic Indices of Oreochromis niloticus Exposed to Aflatoxin B1 Diet

    Directory of Open Access Journals (Sweden)

    Esther Marijani

    2017-01-01

    Full Text Available A 24-week feeding experiment was conducted to assess whether males and females of Oreochromis niloticus exhibit differences in their hematological responses and organosomatic indices to dietary AFB1 contamination. Triplicate groups of O. niloticus (initial body weight: 24.1 ± 0.6 g were fed with four diets (Diets 1 to 4 containing 0, 20, 200, and 2,000 μg AFB1 kg−1. A significant decrease (P<0.05 in hemoglobin (Hb, red blood cells (RBC, and hematocrit (Hct was observed in AFB1 exposure groups, with the lowest levels recorded in the 2000 μg AFB1 kg−1 treatment. A significant increase in mean white blood cells (WBC, neutrophils, and lymphocytes was observed in AFB1 exposure groups. No sex-related differences in RBC, WBC, lymphocytes, monocytes, and neutrophils levels were observed. However, hemoglobin and hematocrit values for female O. niloticus were significantly lower than those for male O. niloticus. Organosomatic indices showed that the relative liver, kidney, and spleen weights were significantly higher (P<0.05 in the AFB1 supplemented group than in the control group. However, the effect of aflatoxin on organosomatic indices does not depend on sex but rather depends on the dose of aflatoxin in the diet. These results provide useful information for monitoring changes in the health status of male and female O. niloticus.

  2. Growth of Nile tilapia Oreochromis niloticus fed diets with different levels of proteins of yeast

    Directory of Open Access Journals (Sweden)

    Vandir Medri

    2009-06-01

    Full Text Available This experiment was based on observations of 72 juveniles of Nile tilapia (Oreochromis niloticus, sexually reverted with an initial mean weight of 37.27 ± 4.92g, distributed in 12 cages of 100 l to evaluate the effects of the yeast inclusion as proteins source in the diet. The fishes were distributed in a completely randomized design with four treatments (0; 20; 40; and 60% of yeast protein in substitution to the protein of traditional sources with three repetitions. Effects of the treatments were not observed (p > 0.05 on the survival and to food conversion. It was observed a quadratic effect on weight gain (Y = 73.39 + 0.173X - 0.0034X²; R²= 0.9986. It was concluded the best level of yeast inclusion as source proteins in the diet for reversed Nile tilapia juvenile was 25.44%.Foram utilizados 72 juvenis de tilápia do Nilo (Oreochromis niloticus sexualmente revertidos com peso médio inicial de 37.27 ± 4.92g. distribuídos em 12 gaiolas de 100L para avaliar os efeitos da inclusão de levedura como fonte protéica na dieta. Os peixes foram distribuídos em um delineamento inteiramente casualizados com quatro tratamentos (0; 20; 40; e 60% de proteína de levedura em substituição à proteína de fontes tradicionais com três repetições. Não foram observados efeitos dos tratamentos (p > 0.05 sobre a sobrevivência e conversão alimentar. Foi observado efeito quadrático sobre o ganho de peso (Y = 73.39 + 0.173X - 0.0034X²; R² = 0.9986. Concluiu-se que o melhor nível de inclusão de levedura como fonte protéica na dieta para juvenis revertidos de tilápias do Nilo é de 25.44%.

  3. Acute effects of binary mixtures of Type II pyrethroids and organophosphate insecticides on Oreochromis niloticus.

    Science.gov (United States)

    Fai, Patricia Bi Asanga; Tsobgny Kinfack, Joel Stephane; Tala Towa, Yannick Jordan

    2017-09-01

    Pyrethroid and organophosphate insecticides have been used for more than 20 years worldwide to control a variety of insect pest in different settings. These pesticides have been detected in a variety of environmental samples, including surface waters and sediments and therefore there is significant concern about their potential toxic effects on non-target organisms. Mixtures of compounds from these groups of pesticides have been found to frequently show enhanced toxicity but it has been a challenge to predict whether or not enhanced toxicity will occur for a given combination of compounds. This study therefore studied the effects of binary pyrethroid-organophosphate mixtures using cypermethrin, deltamethrin and dimethoate in an acute toxicity test system with Oreochromis niloticus. The 96 h LC50s for individual insecticides were 9.13 µg/l, 9.42 µg/l and 45.52 mg/l for cypermethrin, deltamethrin and dimethoate respectively. These showed that the pyrethroid insecticides were highly toxic to Oreochromis niloticus and were far more toxic than dimethoate. All mixtures were also more toxic than single insecticides throughout the concentration-response curve with mixtures resulting in mortality at concentrations which the individual pesticides in the mixture were below their respective NOECs. In addition, observed mixture toxicities deviated from the predicted mixture effects based either on the Concentration Addition (CA) or Independent Action (IA) models independent of mixture ratio. However, the extent of observed mixture mortality deviation was dependent on the effect level. Significant deviations (MDR > 2.0) were observed at lower concentrations indicating synergistic effects at lower and possibly environmentally relevant concentrations. This is not unexpected since organophosphate insecticides are known to inhibit acetylcholinesterase as well as inactivate esterase, resulting in reduced detoxification of pyrethroid insecticides and consequently greater

  4. Eubiotic effect of a dietary acidifier (potassium diformate on the health status of cultured Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Nermeen M. Abu Elala

    2015-07-01

    Full Text Available In connection with the global demand for safe human food and the production of environmentally friendly aquaculture products, acidifiers are natural organic acids and salts that have received considerable attention as animal-feed additives. The current study was designed to evaluate the effects of potassium diformate (KDF on the growth performance and immunity of cultured Oreochromis niloticus (O. niloticus. Four iso-nitrogenous and iso-caloric rations containing graded levels of KDF, including 0% (control basal diet, 0.1%, 0.2% and 0.3%, were fed separately to four equal fish groups (30 fish/group with an initial body weight of 53.49 ± 6.15 g for sixty days. At the end of the experimental period, the fish groups fed on 0.2% and 0.3% KDF exhibited significant improvements in their feed intake, live weight gain, specific growth rate, feed conversion ratio and protein efficiency ratio, with concomitant improvement of their apparent protein digestibility (p < 0.05. Dietary supplementation of 0.3% KDF appeared to stimulate the beneficial intestinal flora; a proliferation was observed of indigenous probionts (Eubiosis associated with the relative activation of cellular and humeral innate immunity (phagocytic activity/index, nitroblue tetrazolium reduction test and serum/gut mucous lysozyme activity. The cumulative mortality of the fish groups fed on KDF and challenged orally with Aeromonas hydrophila was lower than that of the control group. The resistance against diseases increased with dietary KDF in a dose-dependent manner. Thus, we conclude that the use of acidifiers can be an efficient tool to achieve sustainable, economical and safe fish production.

  5. Nutritional aspects of nile tilapia (Oreochromis niloticus silage Aspectos nutricionais da silagem de tilápia-do-nilo (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Lia Ferraz de Arruda

    2006-12-01

    Full Text Available One third of the world's fishing produce is not directly used for human consumption. Instead, it is used for making animal food or is wasted as residue. It would be ideal to use the raw material thoroughly and to recover by-products, preventing the generation of residues. With the objectives of increasing the income and the production of the industry, as well as minimizing environmental and health problems from fish residue, chemical silage from Tilapia (Oreochromis niloticus processing residues was developed after homogenization and acidification of the biomass with 3% formic acid: propionic, 1:1, addition of antioxidant BHT and maintenance of pH at approximately 4.0. Analyses to determine the moisture, protein, lipids and ash were carried out. The amino acids were examined in an auto analyzer after acid hydrolysis, except for the tryptophan which was determined through colorimetry. The tilapia silage presented contents that were similar to or higher than the FAO standards for all essential amino acids, except for the tryptophan. The highest values found were for glutamic acid, lysine and leucine. The results indicate a potential use of the silage prepared from the Nile tilapia processing residue as a protein source in the manufacturing of fish food.Um terço da captura mundial de pescado não é empregada para o consumo direto na alimentação humana, segue para elaboração de rações ou é desperdiçada como resíduo. O ideal seria utilizar a matéria-prima em toda a sua extensão e recuperar os subprodutos, evitando a própria formação do resíduo. Com os objetivos de aumentar a receita e a eficiência de produção da indústria e, conseqüentemente, minimizar os problemas ambientais e de sanidade, provenientes do resíduo de pescado, procedeu-se à elaboração da silagem química do resíduo de beneficiamento de Tilápia-do-Nilo (Oreocrhromis niloticus após homogeneização e acidificação da biomassa com 3% de ácido f

  6. Fluctuating Asymmetry of Red Tilapia (Oreochromis niloticus in Genteng Fish Hatchery Center, Banyuwangi

    Directory of Open Access Journals (Sweden)

    Darmawan Setia Budi

    2017-05-01

    Full Text Available Fluctuating asymmetry of bilateral meristic characteristic is one of the simple methods that can be used to determine the stability of an individual fish development. This study aims to provide quantitative information about the level of asymmetry red tilapia (Oreochromis niloticus in Genteng Fish Hatchery Center through bilateral meristic characteristic observation. The number of fish used in this study is 100 fish which have a measurement of 5-7 cm. Bilateral meristic characteristic observed is the number of soft pectoral fins, the number of soft pelvic fins, and the number of scales on the lateral line. The results show that the highest value of the fluctuating asymmetry magnitude (FAm and fluctuating asymmetry number (FAn are obtained at the number of scales on the lateral line those are 3.71 and 0.86. Furthermore, on soft pectoral fins, the FAm value obtained is 1.29 and the FAn value is 0.58. Meanwhile, the lowest FAm and FAn values obtained from the soft ventral fins which are 0.93 and 0.50. The overall FAm value is 5.93 and the overall FAn value is 1.94.

  7. Effects of a homeopathic complex on the performance and cortisol levels in Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Merlini, Luiz Sérgio; Vargas, Lauro; Piau, Ranulfo; Ribeiro, Ricardo Pereira; Merlini, Natalie Bertelis

    2014-04-01

    Intensive fish farming results in stress adversely effecting the performance of farmed fish. Plasma cortisol is a validated measure of stress in fish. We evaluated the effect of a homeopathic complex on the cortisol level of Nile tilapias (Oreochromis niloticus). 60 animals with approximate average weight of 100 g each at the start of experiment were randomly distributed in six glass fiber water tanks, capacity 1000 liters, with a daily water renewal rate of 20%. They received one of two treatments: 30 animals in control treatment and 30 animals receiving the homeopathic complex Homeopatila 100. On days 1, 30 and 60, all fish were anesthetized and blood was collected by puncture on the caudal vein, to determine the levels of circulating cortisol. At the end of the experiment the fish receiving a homeopathic complex, had significantly lower circulating cortisol level (17.96 ng/mL ± 0.95) than the control group (38.68 ng/mL ± 1.21) (p < 0.05). Cortisol levels were significantly lower in the treated group than control, and the fish were larger in the treated group. Copyright © 2013 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  8. Diuron metabolites act as endocrine disruptors and alter aggressive behavior in Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Boscolo, Camila Nomura Pereira; Pereira, Thiago Scremin Boscolo; Batalhão, Isabela Gertrudes; Dourado, Priscila Leocadia Rosa; Schlenk, Daniel; de Almeida, Eduardo Alves

    2018-01-01

    Diuron and its biodegradation metabolites were recently reported to cause alterations in plasma steroid hormone concentrations with subsequent impacts on reproductive development in fish. Since steroid hormone biosynthesis is regulated through neurotransmission of the central nervous system (CNS), studies were conducted to determine whether neurotransmitters that control hormone biosynthesis could be affected after diuron and diuron metabolites treatment. As the same neurotransmitters and steroid hormones regulate behavioral outcomes, aggression was also evaluated in male Nile tilapia (Oreochromis niloticus). Male tilapias were exposed for 10 days to waterborne diuron and the metabolites 3,4-dichloroaniline (DCA), 3,4-dichlorophenyl-N-methylurea (DCPMU), at nominal concentrations of 100 ng L -1 . In contrast to Diuron, DCA and DCPMU significantly diminished plasma testosterone concentrations (39.4% and 36.8%, respectively) and reduced dopamine levels in the brain (47.1% and 44.2%, respectively). In addition, concentrations of the stress steroid, cortisol were increased after DCA (71.0%) and DCPMU (57.8-%) exposure. A significant decrease in aggressive behavior was also observed in animals treated with the metabolites DCA (50.9%) and DCPMU (68.8%). These results indicate that biotransformation of diuron to active metabolites alter signaling pathways of the CNS which may impact androgen and the stress response as well as behavior necessary for social dominance, growth, and reproduction. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Acute exposure to pure cylindrospermopsin results in oxidative stress and pathological alterations in tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Puerto, María; Jos, Angeles; Pichardo, Silvia; Moyano, Rosario; Blanco, Alfonso; Cameán, Ana M

    2014-04-01

    Cylindrospermopsin (CYN) is increasingly recognized as a potential threat to drinking water safety, due to its ubiquity. This cyanotoxin has been found to cause toxic effects in mammals, and although fish could be in contact with this toxin, acute toxicity studies on fish are nonexistent. This is the first study showing that single doses of CYN pure standard (200 or 400 μg CYN/kg fish bw) by oral route (gavage) generate histopathological effects in fish (Tilapia-Oreochromis niloticus) exposed to the toxin under laboratory condition. Among the morphological changes, disorganized parenchymal architecture in the liver, dilated Bowman's space in the kidney, fibrolysis in the heart, necrotic enteritis in the intestines, and hemorrhages in the gills, were observed. Moreover, some oxidative stress biomarkers in the liver and kidney of tilapias were altered. Thus, CYN exposure induced increased protein oxidation products in both organs, NADPH oxidase activity was significantly increased with the kidney being the most affected organ, and decreased GSH contents were also detected in both organs, at the higher dose assayed. Copyright © 2012 Wiley Periodicals, Inc.

  10. Antimicrobial Susceptibility of Escherichia coli Isolated from Fresh-Marketed Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Rocha, Rafael Dos Santos; Leite, Lana Oliveira; de Sousa, Oscarina Viana; Vieira, Regine Helena Silva Dos Fernandes

    2014-01-01

    The contamination of seafood by bacteria of fecal origin, especially Escherichia coli, is a widely documented sanitary problem. The objective of the present study was to isolate E. coli strains from the gills, muscle, and body surface of farmed Nile tilapias (Oreochromis niloticus) fresh-marketed in supermarkets in Fortaleza (Ceará, Brazil), to determine their susceptibility to antibiotics of different families (amikacin, gentamicin, imipenem, cephalothin, cefotaxime, ciprofloxacin, aztreonam, ampicillin, nalidixic acid, tetracycline, and sulfametoxazol-trimetoprim), and to determine the nature of resistance by plasmid curing. Forty-four strains (body surface = 25, gills = 15, muscle = 4) were isolated, all of which were susceptible to amikacin, aztreonam, cefotaxime, ciprofloxacin, gentamicin, and imipenem. Gill and body surface samples yielded 11 isolates resistant to ampicillin, tetracycline, and sulfametoxazol-trimetoprim, 4 of which of plasmidial nature. The multiple antibiotic resistance index was higher for strains isolated from body surface than from gills. The overall high antibiotic susceptibility of E. coli strains isolated from fresh-marketed tilapia was satisfactory, although the occasional finding of plasmidial resistance points to the need for close microbiological surveillance of the farming, handling, and marketing conditions of aquaculture products.

  11. Nickel exposure promotes osmoregulatory disturbances in Oreochromis niloticus gills: histopathological and energy dispersive spectrometry analysis.

    Science.gov (United States)

    Marcato, A C C; Yabuki, A T; Fontanetti, C S

    2014-11-01

    Water is an essential factor for maintaining the vital functions of living beings. Nickel is the 24th most abundant element on Earth; it is a heavy metal that is genotoxic and mutagenic in its chloride form. Due to industrial use, its concentration in surface sediments increased considerably. Fish develop characteristics that make them excellent experimental models for studying aquatic toxicology. They are particularly useful because they can alert of the potential danger of chemical substances or environmental pollution. Due to water quality impairment and because there are few published studies that relate nickel to tissue alteration, this study aimed to examine the consequences of nickel in an aquatic environment. For this analysis, individuals of Oreochromis niloticus were exposed for 96 h to three different concentrations of nickel dissolved in water according to the standard established by Brazilian law and compared them to a control group. After exposure, the gills were analyzed using X-ray microanalysis, ultramorphology, and histological and histochemical analysis. The results demonstrated that all the concentrations used in the experiment altered the histophysiology of the individuals exposed. In conclusion, the nickel presents a toxic potential to fish, even at the lowest concentration tested, which is equivalent to half of the concentration allowed by law. The CONAMA resolution should be revised for this parameter because of the interference of this metal in the histophysiology of the tested organism.

  12. Comparative Analysis of Nutritional Value of Oreochromis niloticus (Linnaeus, Nile Tilapia, Meat from Three Different Ecosystems

    Directory of Open Access Journals (Sweden)

    Fanuel Jim

    2017-01-01

    Full Text Available Determination of protein, lipid, and mineral content of fish meat is necessary to ensure that it meets requirements for food regulations and commercial specifications. The objective of the present study was to determine the chemical composition of Oreochromis niloticus (L., Nile tilapia, under three different ecosystems: (1 high pollution and high density of Eichhornia crassipes, that is, water hyacinth (Lake Chivero, (2 medium pollution and medium density of water hyacinth (Lake Manyame, and (3 low pollution and low density of water hyacinth (Lake Kariba. Dry matter, protein, lipids, and ash were evaluated by proximate analysis. Minerals were determined by atomic absorption spectrophotometry and pH was determined by a pH meter. Lake Kariba fish had the highest percentage of dry matter, protein, and ash. These qualities were correlated to low levels of pollutants and high oxygen content in the harvest waters. The phosphorus content of fish from Lake Chivero was very high, in tandem with phosphate levels in the harvest waters. In addition, water from Lake Chivero had an alkaline pH, high nitrate, and low oxygen content. The results suggest that effluent from sewage works and fertilizer industries caused pollution and proliferation of water hyacinth, contributing to pervasion of the chemical composition of fish.

  13. Effects of Dietary Yeast (Saccharomyces cerevisia Supplementation in Practical Diets of Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    José E. P. Cyrino

    2012-01-01

    Full Text Available A 51-day feeding trial was carried out to determine the effects of various dietary levels of brewer’s yeast, Saccharomyces cerevisiae, in the growth performance, body composition and nutrient utilization in Nile tilapia, Oreochromis niloticus, juveniles. Fish (7.6 ± 0.3 g were stocked into eighteen 1,000-L tanks (100 fish per tank; n = 3 and fed to apparent satiation six isonitrogenous (27% crude protein and isoenergetic (19 kJ/g diets, formulated to contain different dried yeast levels (0%, 10%, 15%, 20%, 30% or 40% diet in substitution to fishmeal. Body weight tripled at the end of the feeding trial for fish fed up to 20% dietary yeast incorporation. Daily growth coefficient (DGC, % body weight/day decreased with increasing dietary yeast level (P < 0.0001. Voluntary feed intake (VFI, %BW/day did not vary significantly with increasing yeast level. Fish fed 40% yeast showed significant reduction in protein efficiency rate, protein retention and nitrogen gain. Increasing levels of dietary yeast did not significantly affect protein or lipid digestibility. Dietary dried yeast was seemingly palatable to tilapia juveniles and was suitable up to 15% inclusion to promote growth and efficient diet utilization, without affecting body composition.

  14. Anti-androgenic activities of diuron and its metabolites in male Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Pereira, Thiago Scremin Boscolo; Boscolo, Camila Nomura Pereira; Silva, Danilo Grünig Humberto da; Batlouni, Sergio Ricardo; Schlenk, Daniel; Almeida, Eduardo Alves de

    2015-07-01

    Diuron (3-(3,4-dichlorophenyl)-1,1-dimethylurea) is a widely used herbicide which has been frequently detected in surface waters throughout the world. In vivo bioassay guided fractionation studies indicated that diuron may have estrogenic activity augmented by biotransformation. This study evaluated the effects of diuron and three of its metabolites on plasma hormone concentrations and spermatogenesis of the freshwater fish Nile tilapia (Oreochromis niloticus). Sexually mature male fish were exposed for 25 days to diuron, as well to its metabolites 3,4-dichloroaniline (DCA), 3,4-dichlorophenylurea (DCPU) and 3,4-dichlorophenyl-N-methylurea (DCPMU), at concentrations of 200ng/L. Testosterone levels were decreased by diuron, but had limited effects on gonadal histology. Diuron metabolites, however, caused significant decreases in testosterone and in 11-ketotestosterone, gonadosomatic index, diameter of seminiferous tubules and in the mean percentages of germ cells (spermatids and spermatozoa). We conclude that these metabolites have antiandrogenic activity to male Nile tilapia, potentially causing reproductive impairment in male fish. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Induction of hsp70 by the herbicide oxyfluorfen (Goal) in the Egyptian Nile fish, Oreochromis niloticus.

    Science.gov (United States)

    Hassanein, H M; Banhawy, M A; Soliman, F M; Abdel-Rehim, S A; Müller, W E; Schröder, H C

    1999-07-01

    This paper deals with the expression of the biomarker hsp70 in the liver and kidney of the freshwater fish Oreochromis niloticus following exposure to the herbicide oxyfluorfen (Goal). Fishes were exposed to three concentrations, the 96-h LC50 (3 mg/L), the 96-h (1/2)LC50 (1.5 mg/L), and the 96-h (1/4)LC50 (0.75 mg/L) of oxyfluorfen for 6, 15, and 24 days, respectively, and samples were taken at three different time periods for each concentration. The livers responded to the herbicide by an induction of the expression of both the constitutive (hsp75; Mr 75 kDa) and the inducible (hsp73; Mr 73 kDa) hsp70 proteins. In kidney, the herbicide induced a time-dependent increase in the expression of the constitutive hsp70 (hsp75) as well, but the inducible hsp70 (hsp73) required much longer incubation periods to reach maximal levels (15 and 24 days). Our results suggest that expression of hsp70 in fish is a sensitive indicator of cellular responses to herbicide exposure in the aquatic environment.

  16. Antimicrobial Susceptibility of Escherichia coli Isolated from Fresh-Marketed Nile Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Rafael dos Santos Rocha

    2014-01-01

    Full Text Available The contamination of seafood by bacteria of fecal origin, especially Escherichia coli, is a widely documented sanitary problem. The objective of the present study was to isolate E. coli strains from the gills, muscle, and body surface of farmed Nile tilapias (Oreochromis niloticus fresh-marketed in supermarkets in Fortaleza (Ceará, Brazil, to determine their susceptibility to antibiotics of different families (amikacin, gentamicin, imipenem, cephalothin, cefotaxime, ciprofloxacin, aztreonam, ampicillin, nalidixic acid, tetracycline, and sulfametoxazol-trimetoprim, and to determine the nature of resistance by plasmid curing. Forty-four strains (body surface = 25, gills = 15, muscle = 4 were isolated, all of which were susceptible to amikacin, aztreonam, cefotaxime, ciprofloxacin, gentamicin, and imipenem. Gill and body surface samples yielded 11 isolates resistant to ampicillin, tetracycline, and sulfametoxazol-trimetoprim, 4 of which of plasmidial nature. The multiple antibiotic resistance index was higher for strains isolated from body surface than from gills. The overall high antibiotic susceptibility of E. coli strains isolated from fresh-marketed tilapia was satisfactory, although the occasional finding of plasmidial resistance points to the need for close microbiological surveillance of the farming, handling, and marketing conditions of aquaculture products.

  17. Efficiency of eugenol as anesthetic for the early life stages of Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Paula A.P. Ribeiro

    2015-03-01

    Full Text Available In aquaculture, activities with anesthetic compounds are usually used in order to ensure the welfare of farmed fish, allowing handling out of water with decreased trauma by stress. Presently, there is no information about anesthetic action of eugenol in early life stages of Nile tilapia (Oreochromis niloticus. The objective of this study was to evaluate different concentrations of eugenol for larvae and juveniles of Nile tilapia. Sixty animals were used for each group of weight, group I = 0.02 g; group II = 0.08 g; group III = 0.22 g; group IV = 2.62 g; and group V = 11.64 g. The eugenol concentrations tested were 50, 75, 100, 125, 150 and 175 mg L-1. No mortality was reported during the tests with eugenol. Tilapia larvae with 0.02 g and juveniles around 11.64 g can be anesthetized with eugenol concentrations between 150 and 175 mg L-1, since they determine the shortest sedation time (23 and 72 seconds, for the group of lowest and highest weights, respectively.

  18. Uncaria tomentosa increases growth and immune activity in Oreochromis niloticus challenged with Streptococcus agalactiae.

    Science.gov (United States)

    Yunis-Aguinaga, Jefferson; Claudiano, Gustavo S; Marcusso, Paulo F; Manrique, Wilson Gómez; de Moraes, Julieta R Engrácia; de Moraes, Flávio R; Fernandes, João B K

    2015-11-01

    Cat's claw (Uncaria tomentosa) is an Amazon herb using in native cultures in Peru. In mammals, it has been described several effects of this herb. However, this is the first report of its use on the diet of fish. The aim of this study was to determinate the effect of this plant on the growth and immune activity in Oreochromis niloticus. Nile tilapia (81.3 ± 4.5 g) were distributed into 5 groups and supplemented with 0 (non-supplement fish), 75, 150, 300, and 450 mg of U. tomentosa.kg(-1) of diet for a period of 28 days. Fish were inoculated in the swim bladder with inactivated Streptococcus agalactiae and samples were taken at 6, 24, and 48 h post inoculation (HPI). Dose dependent increases were noted in some of the evaluated times of thrombocytes and white blood cells counts (WBC) in blood and exudate, burst respiratory activity, lysozyme activity, melanomacrophage centers count (MMCs), villi length, IgM by immunohistochemistry in splenic tissue, and unexpectedly on growth parameters. However, dietary supplementation of this herb did not affect red blood cells count (RBC), hemoglobin, and there were no observed histological lesions in gills, intestine, spleen, and liver. The current results demonstrate for the first time that U. tomentosa can stimulate fish immunity and improve growth performance in Nile tilapia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. PERTUMBUHAN, HISTOPATOLOGI OVARIUM DAN FEKUNDITAS IKAN NILA MERAH (OREOCHROMIS NILOTICUS SETELAH PAPARAN PESTISIDA ORGANOFOSFAT

    Directory of Open Access Journals (Sweden)

    IRIANI SETYAWATI

    2011-12-01

    Full Text Available Fish cultures in rice fields or areas that use water from a pesticide-polluted irrigation or river, are particularly vulnerable to the negative impact of pesticides. This study aims to assess the effect of organophosphates on growth, ovarian histopathology and fecundity of red tilapia (Oreochromis niloticus. After acclimatization, 160 fishes (fingerlink stage were kept in four ponds sized 2x1,5x0,8 m each. This study used a complete randomized block design and organophosphate administration through the feed. The study used four groups: control, and variations in dose of 2 ml (D1, 6 ml (D2, and 10 ml (D3 of pesticide per 100 grams of pellet, which is given in the morning (treatment and in the evening (regular feed. Data were taken at week 3, 6, and 9, then the organophosphate treatments were stopped, and the last data were taken at week-18. Statistical analysis was performed by Anova and Duncan's Multiple Range Test. The results showed that the organophosphate pesticide inhibits the growth by reducing fish length and weight, reducing ovarian weight, increasing the number of oocyte atresia, damaging structure of the ovarian histology, and decreasing fecundity by reducing the number of egg production in the ovarian of red tilapia.

  20. Beta-haemolytic streptococci in farmed Nile tilapia, Oreochromis niloticus, from Sullana-Piura, Peru

    Directory of Open Access Journals (Sweden)

    Yessica Ortega A

    2017-01-01

    Full Text Available Objective. This investigation aimed to study the presence of Streptococcus spp. in tilapia (Oreochromis niloticus from fish farm located in Sullana-Piura, Peru. Materials and methods. 150 fish with clinical signs of streptococcal disease were sampled, and the bacterium isolation was performed on blood agar, correlated to histopathological lesions description and molecular confirmation by real-time PCR. Results. The necropsy revealed exophthalmia, hyphema, congestion and/or haemorrhagic meninges, ascites, splenomegaly, hepatomegaly and diffuse haemorrhagic zones throughout the body. 102 isolated positives (54 tilapias to Streptococcus spp. were identified in the microbiological analysis (prevalence of 26%, the brain was the organ with the highest percentage of this bacteria (34.31%, and 19 isolates were beta-haemolytic (18.63% with prevalence of 10.12%. Fish beta-haemolytic streptococci presented epicarditis, perisplenitis and chronic meningitis, panophthalmitis, coagulative necrosis of skeletal muscle and granulomas formation. In the confirmatory test by real-time PCR, any positive tilapia to S. iniae was obtained. The results were analysed using a stochastic simulation of beta distribution using @Risk program uncertainty, reporting an average prevalence of 0.66% in sick tilapias. Conclusions. The analysed fishes were positive to bacteria of the genus Streptococcus, which confirms its presence in the fish farm. However, 19 isolates were beta-haemolytic, and the presence of S. iniae was not positive to the limit prevalence of 2.7% in real-time PCR.

  1. Enterococcus, Myroides, and Exiguobacterium: Bacterial Genus with Probiotic Potential for Nile Tilapia (Oreochromis niloticus Culture

    Directory of Open Access Journals (Sweden)

    Luisa Marcela Villamil Díaz

    2017-09-01

    Full Text Available 120 bacteria were isolated from tilapia intestine and screened according to the antibacterial activity against pathogens such as Aeromonas hydrophila, Edwardsiella tarda and Streptococcus agalactiae, the ability to adhere to intestinal mucus and growth kinetics. The selected bacteria were identified by 16S rRNA sequencing of and were identified as Exigobacterium sp. I9, Enterococcus faecalis I15 and Myroides odoratimimus I19. Furthermore, the in vivo effect on fish growth was assessed by the addition of selected bacteria to juvenile Oreochromis niloticus feed (106 CFU / g, for 15 days. Survival was also determined after a challenge by intraperitoneal injection of E. tarda (100 μL of 105 UFC / mL. The three selected bacteria increased the specific growth rate, reduced mortality of fish during the experimental challenge with E. tarda and did not cause mortality during the addition in the feed. The positive effects observed in vivo are possibly associated with in vitro activity; however, for biosafety reasons, it is recommended that further studies of Exigobacterium sp. I9 and E. faecalis I15 may be carried out since this genus have been reported of as causative agents of fish mortality, whereas in the case of M. odoratimimus I19, verification of positive effects at a higher production scales is desirable.

  2. Effect of grilling and baking on physicochemical and textural properties of tilapia (Oreochromis niloticus) fish burger.

    Science.gov (United States)

    Bainy, Eduarda Molardi; Bertan, Larissa Canhadas; Corazza, Marcos Lucio; Lenzi, Marcelo Kaminski

    2015-08-01

    The influence of two common cooking methods, grilling and baking, on chemical composition, water retention, fat retention, cooking yield, diameter reduction, expressible water, color and mechanical texture of tilapia (Oreochromis niloticus) fish burgers was investigated. Texture analyses were performed using a Warner-Bratzler test. The fish burger had a softer texture with a lower shear force than other meat products reported in the literature. There were no significant differences in proximate composition, diameter reduction, fat retention and expressible water between the grilled and oven-baked fish burgers. Cooking methods did not affect the cooking times and cooking rates. Warner-Bratzler parameters and color were significantly influenced by the cooking method. Grilling contributed to a shear force and work of shearing increase due to the lower cooking yield and water retention. Raw burgers had the highest L* (69.13 ± 0.96) and lowest b* (17.50 ± 0.75) values. Results indicated that baking yielded a product with better cooking characteristics, such as a desired softer texture with lower shear values (4.01 ± 0.54) and increased water retention (95.82 ± 0.77). Additionally, the baked fish burgers were lighter (higher L*) and less red (lower a*) than the grilled ones.

  3. Blockage of progestin physiology disrupts ovarian differentiation in XX Nile tilapia (Oreochromis niloticus)

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Linyan; Luo, Feng; Fang, Xuelian [Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Sciences, Southwest University, Chongqing, 400715 (China); Charkraborty, Tapas [South Ehime Fisheries Research Center, Ehime University, Ainan, 798-4206 (Japan); Wu, Limin; Wei, Jing [Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Sciences, Southwest University, Chongqing, 400715 (China); Wang, Deshou, E-mail: wdeshou@swu.edu.cn [Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Sciences, Southwest University, Chongqing, 400715 (China)

    2016-04-22

    Previous studies indicated that maturation inducing hormone, 17α, 20β-Dihydroxy-4-pregnen-3-one (DHP), probably through nuclear progestin receptor (Pgr), might be involved in spermatogenesis and oogenesis in fish. To further elucidate DHP actions in teleostean ovarian differentiation, we analyzed the expression of pgr in the ovary of Nile tilapia (Oreochromis niloticus), and performed RU486 (a synthetic Pgr antagonist) treatment in XX fish from 5 days after hatching (dah) to 120dah. Tilapia Pgr was abundantly expressed in the follicular cells surrounding oocytes at 30 and 90dah. Continuous RU486 treatment led to the blockage of oogenesis and masculinization of somatic cells in XX fish. Termination of RU486 treatment and maintenance in normal condition resulted in testicular differentiation, and estrogen compensation in RU486-treated XX fish successfully restored oogenesis. In RU486-treated XX fish, transcript levels of female dominant genes were significantly reduced, while male-biased genes were evidently augmented. Meanwhile, both germ cell mitotic and meiotic markers were substantially reduced. Consistently, estrogen production levels were significantly declined in RU486-treated XX fish. Taken together, our data further proved that DHP, possibly through Pgr, might be essential in the ovarian differentiation and estrogen production in fish. - Highlights: • DHP plays a critical role in early stage oogenesis of XX tilapia. • Blockage of DHP actions by RU486 treatment led to masculinization and/or sex reversal in XX tilapia. • Both DHP and estrogen are indispensable for ovarian differentiation.

  4. Blockage of progestin physiology disrupts ovarian differentiation in XX Nile tilapia (Oreochromis niloticus)

    International Nuclear Information System (INIS)

    Zhou, Linyan; Luo, Feng; Fang, Xuelian; Charkraborty, Tapas; Wu, Limin; Wei, Jing; Wang, Deshou

    2016-01-01

    Previous studies indicated that maturation inducing hormone, 17α, 20β-Dihydroxy-4-pregnen-3-one (DHP), probably through nuclear progestin receptor (Pgr), might be involved in spermatogenesis and oogenesis in fish. To further elucidate DHP actions in teleostean ovarian differentiation, we analyzed the expression of pgr in the ovary of Nile tilapia (Oreochromis niloticus), and performed RU486 (a synthetic Pgr antagonist) treatment in XX fish from 5 days after hatching (dah) to 120dah. Tilapia Pgr was abundantly expressed in the follicular cells surrounding oocytes at 30 and 90dah. Continuous RU486 treatment led to the blockage of oogenesis and masculinization of somatic cells in XX fish. Termination of RU486 treatment and maintenance in normal condition resulted in testicular differentiation, and estrogen compensation in RU486-treated XX fish successfully restored oogenesis. In RU486-treated XX fish, transcript levels of female dominant genes were significantly reduced, while male-biased genes were evidently augmented. Meanwhile, both germ cell mitotic and meiotic markers were substantially reduced. Consistently, estrogen production levels were significantly declined in RU486-treated XX fish. Taken together, our data further proved that DHP, possibly through Pgr, might be essential in the ovarian differentiation and estrogen production in fish. - Highlights: • DHP plays a critical role in early stage oogenesis of XX tilapia. • Blockage of DHP actions by RU486 treatment led to masculinization and/or sex reversal in XX tilapia. • Both DHP and estrogen are indispensable for ovarian differentiation.

  5. Water Quality Improvement of Media Culture for Tilapia (Oreochromis niloticus) with Cleaner Production Method

    Science.gov (United States)

    Haeruddin; Supriharyono; Febrianto, S.

    2018-02-01

    The tilapia (Oreochromis niloticus), is known as a high adaptability and brackish water tolerance fish. This fish is also has a meat with high protein content, that ranges about 65 -75%. Generally the tilapia is cultured using a conventional system with high density. It is caused degradation of water quality of media culture, and finally increase mortality rate of fish cultured. The application of tilapia cultivation with cleaner production method by giving enzyme into the feed to upgrade the efficiency of feed utilization, presumed that could improve the water quality of cultivation media. It is due to the lower of feed and feces residues. Therefore the concentration of toxic compounds, such as ammonia, nitrite and sulfide, will be lower. The experiments were conducted for 35 days with a completely factorial randomized design. The first factor was the dosage of enzyme in the feed, consisting of 4 dosages, and the second factor was the duration of the test fish maintenance (5 weeks). Water quality variables examined included ammonia, nitrite and sulfide. The results showed that enzyme dosage had no significantly impact on ammonia, nitrite and sulfide concentrations in the test media culture. However, the feeding with enzyme in low dosage, resulted less concentration of ammonia, nitrite and sulfide than it was without enzyme). The duration of fish cultured has significantly effect on the concentration of ammonia, nitrite and sulfide in the test media. While it is no significantly correlation between dosage and duration of maintenance.

  6. Effect of Poly Aluminium Chloride (PAC) on some blood constituents of Nile Tilapia (Oreochromis niloticus)

    International Nuclear Information System (INIS)

    Adam, H. M.; Agab, H.

    2006-01-01

    Poly aluminium chloride (PAC) is an urban drinking water purification substance that was introduced recently in Sudan and used to substitute polymer poly diallyl dimethyl aluminium chloride (DADMAC) and aluminium sulphate in water purification treatments. This study was conducted to determine its effects on fish health, which is is considered a biological indicator and an essential component of fresh water ecosystem. In this experiment, PAC was used in three different concentrations (0.1, 0.2 and 0.3 ml/1) in experimental tanks to achieve the desirable doses for the study. The tanks were populated by Nile Tilapia fingerlings (Oreochromis niloticus) with an average weight ranging between 70 and 100 grams. Exposure of this fish to PAC resulted in an immediate signification reduction (P<0.01) in haemoglobin concentration, erythrocytes count, packed cell volume, mean corpuscular volume and mean corpuscular haemoglobin concentration of experimental fingerlings blood. The degree of reduction in these parameters was directly proportional to the concentration of PAC used. (Author)

  7. Nutritional Profile and Chemical Stability of Pasta Fortified with Tilapia (Oreochromis niloticus) Flour.

    Science.gov (United States)

    Monteiro, Maria Lúcia G; Mársico, Eliane T; Soares, Manoel S; Magalhães, Amanda O; Canto, Anna Carolina V C S; Costa-Lima, Bruno R C; Alvares, Thiago S; Conte, Carlos A

    2016-01-01

    Physicochemical parameters of pasta enriched with tilapia (Oreochromis niloticus) flour were investigated. Five formulations were prepared with different concentrations of tilapia flour as partial substitute of wheat flour: pasta without tilapia flour (PTF0%), pasta with 6% (PTF6%), 12% (PTF12%), 17% (PTF17%), and 23% (PTF23%) of tilapia flour. The formulations were assessed for proximate composition, fatty acid and amino acid profile on day 1 whereas, instrumental color parameters (L*, a* and b* values), pH, water activity (aw), and lipid and protein oxidation were evaluated on days 1, 7, 14, and 21 of storage at 25°C. Fortification with tilapia flour increased (p tilapia flour decreased (p tilapia flour than their counterparts, and the storage promoted an increase (p tilapia flour has the potential to be a technological alternative to food industry for the nutritional enrichment of traditional pasta with negligible negative effects on the chemical stability of the final product during 21 days at 25°C.

  8. Pertumbuhan dan rasio konversi pakan ikan nila (Oreochromis niloticus dengan penambahan prebiotik

    Directory of Open Access Journals (Sweden)

    NITA ARDITA

    2015-05-01

    Full Text Available Ardita N, Budiharjo A, Sari SLA. 2015. Growth and feed conversion ratio of tilapia fish (Oreochromis niloticus with addition of probiotics. Bioteknologi 12: 16-21. The problems of tilapia farming are the high feed costs and long cultivation time. Feed costs is in the ranges 60-70% from the total cost. Probiotics in the digestive tract will improve the digestion and absorbtion of nutrients. This study was aimed to determine the effect of probiotics on tilapia growth and feed conversion ratio (FCR. This study used a completely randomized design with 4 treatments i.e. 0%, 3%, 4%, and 5% (v/w of probiotic in feed. Probiotics was sprayed into comercial pellets. Tilapia were cultivated for 2 months given by commercial pellets with different proportion of probiotics. The parameters measured were the growth of fish (fish length and fish weight, Survival Rate (SR and FCR. Data was analyzed by ANOVA. The results showed that the addition of probiotics dose 0%, 3%, 4%, and 5% (v/w did not affect significantly to the growth and feed conversion ratio for 8 weeks.

  9. Oxidative stress responses in gills of tilapia (Oreochromis niloticus) at different salinities

    Science.gov (United States)

    Handayani, Kiki Syaputri; Novianty, Zahra; Saputri, Miftahul Rohmah; Irawan, Bambang; Soegianto, Agoes

    2017-08-01

    The objective of present study is to evaluate the impact of different salinities on the levels of CAT, GSH and MDA of the gills of Nile tilapia (Oreochromis niloticus). Nile tilapia was treated by exposure to salinities concentration 0 ‰, 5 ‰ and 10 ‰. Research models were weakened and sacrificed, then took the left and right sides of the gills. The result of gills homogenity was centrifuged for supernatan, then supernatan was proceed with testing levels of CAT, GSH and MDA by ELISA assay methods. The levels of CAT in gills were significantly higher at 10 ‰ than at 5 ‰ and 0 ‰. The levels of GSH in gills were significantly higher at 0 ‰ than 5 ‰. The levels of GSH in gills at 5 ‰ and 10 ‰ salinities were not significantly different. The levels of MDA in gills at salinity 10 ‰ and 5 ‰ were higher than in control gills at 0 ‰ salinities. This occurs because the salinity of 10 ‰ salinity was optimal for live of fish tilapia. In conclusion, salinity impact the increasing of CAT, GSH, and MDA levels in gills of Nile tilapia.

  10. Meningoencephalitis in farmed monosex Nile tilapia (Oreochromis niloticus L. caused by Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Adikesavalu Harresh

    2017-09-01

    Full Text Available Aquaculture of tilapia is a new research venture in India. With intensification in farming practices, tilapia are increasingly susceptible to bacterial infections. This article describes the isolation and identification of pathogenic bacteria from cultured monosex Nile tilapia, Oreochromis niloticus (L., that experienced moderate to severe mortalities in West Bengal, India between September and August 2014 and histopathological alterations in various organs. Gram-positive diplococci, identified as Streptococcus agalactiae with Streptococcus identification kits and 16S rDNA sequencing analysis, were isolated from the brain, operculum, and kidney. Other bacteria from the kidney were identified as Aeromonas sobria, A. caviae, Klebsiella pneumoniae ssp. pneumoniae, Escherichia coli, and Enterobacter cloacae. Staphylococcus epidermis was isolated from opercular hemorrhages. Histological sections of the infected tilapia brain revealed meningoencephalitis and granulomatous lesions. Sections from other organs indicated congestion, hemorrhagic and hyperplastic cells, necrosis, vacuolation, hemosiderin deposition, hypertrophic nuclei, melanomacrophage aggregation, and ruptured veins. This report is the first description of S. agalactiae as a primary pathogen causing meningoencephalitis in cultured tilapia in India.

  11. Induction of triploidy and tetraploidy in Nile tilapia, Oreochromis niloticus (L.)

    Science.gov (United States)

    El Gamal, A.-R.A.; Davis, K.B.; Jenkins, J.A.; Les, Torrans E.

    1999-01-01

    Induction of triploidy and tetraploidy in Nile tilapia, Oreochromis niloticus, was investigated by heat shock, cold shock, hydrostatic pressure, and/ or chemicals (cytochalasin A, B, and D). Additionally, efficacy of combined protocols was determined. Heat shock 10 min after fertilization induced triploidy when incubation temperature was 24 C but not when incubation temperature was 31 C. Heat shock of 40-41 C at 4-6 min after fertilization was effective in inducing up to 100% triploidy with hatchability similar to controls. Cold shock at 13 C for 45 min five min after fertilization induced 85-100% triploids. Heat shock and multiple heat shocking were the most effective treatments for the induction of tetraploidy. Two heat treatments of 41 C applied at 65 and 80 min after fertilization for 5 min each produced approximately 80% tetraploidy in hatched fry. Immersion of fertilized eggs in cytochalasin A, B, or D at concentrations up to 10 ??g/L applied at various times and durations was ineffective in inducing triploidy or tetraploidy.

  12. Reproductive performance of female Nile tilapia ( Oreochromis niloticus fed diets with different digestible energy levels

    Directory of Open Access Journals (Sweden)

    Tamira Maria Orlando

    Full Text Available ABSTRACT This study aimed to evaluate the reproductive performance of female Nile tilapia (Oreochromis niloticus fed diets containing different levels of digestible energy (DE. The fish were housed in 15 fiberglass tanks (500 L in a recirculating system at an average temperature of 27.5 °C. The treatments consisted of five diets with increasing levels of DE (3,200; 3,400; 3,600; 3,800; and 4,000 kcal/kg. The levels of DE did not significantly influence the final weight or the hepatosomatic, gonadosomatic, and visceral fat indices. The absolute fecundity was influenced by the treatments, for which the highest values were observed from the 3,600 kcal/kg DE level and upward. The proximate composition of the fish also had a significant effect on the variables crude protein, ether extract, and ash; the fish fed diets with higher levels of DE exhibited the lowest body protein content, while the accumulation of ether extract exhibited the opposite response. A level of 3,600 kcal/kg of digestible energy should be used in diets with 380 g/kg crude protein and a starch/lipid ratio of 1.33 for female Nile tilapia.

  13. Productive performance of Nile tilapia (Oreochromis niloticus fed at different frequencies and periods with automatic dispenser

    Directory of Open Access Journals (Sweden)

    R.M.R. Sousa

    2012-02-01

    Full Text Available The performance of Nile tilapia (Oreochromis niloticus raised in cages furnished with an automatic dispenser, supplied at different frequencies (once per hour and once every two hours and periods (daytime, nighttime and both was evaluated. Eighteen 1.0m³ cages were placed into a 2000m² pond, two meters deep with a 5% water exchange. One hundred and seventy tilapias, with initial weight of 16.0±4.9g, were dispersed into each 1m³ cage and the feed ration was adjusted every 21 days with biometry. Data was collected from March to July (autumn and winter. Significant difference to final weight (P<0.05 among treatments was observed. The increase in feeding frequency improves the productive performance of Nile tilapias in cages and permitted better management of the food. The better feed conversion rate for high feeding frequency (24 times day-1 can result in saving up to 360kg of food for each ton of fish produced, increasing the economic sustenance for tilapia culture and suggesting less environmental pollution.

  14. Effect of treatments and washing cycles on the quality of Nile tilapia (Oreochromis niloticus protein concentrate

    Directory of Open Access Journals (Sweden)

    Lígia Boarin Alcalde

    2017-08-01

    Full Text Available The extraction of proteins from wastes reduces production costs and environmental pollution. The aim of this work was to evaluate the effect of two treatments involving decanting/sieving or centrifugation and the number of washing cycles on the quality of protein concentrate obtained from mechanically separated meat (MSM of Nile tilapia (Oreochromis niloticus. Results were analyzed in terms of final yield and proximate composition (moisture, protein, fat and ash after each washing cycle. Moisture did not vary statistically with the treatments and after the third washing cycle. However, the process involving centrifugation was more efficient for protein concentration because the final protein content increased 2.0 folds (79.82%, dry basis and fat decreased 6.1 folds (8.29%, dry basis. After four washing cycles, it was obtained a protein concentrate with 79.82% protein, 8.29% lipid and 0.45% ash (dry basis, and 80.0% yield, using the centrifugation procedure. Visual whiteness was highly improved after four washing cycles using both processes. It was concluded that the centrifugation process with four washing cycles was the most appropriate method for producing protein concentrate from MSM of Nile tilapia.

  15. Transmission and pathology of Streptococcus inane in monosex Nile tilapia (Oreochromis niloticus in aquaculture of Bangladesh

    Directory of Open Access Journals (Sweden)

    Md. Mer Mosharraf Hossain

    2014-04-01

    Full Text Available Streptococcus iniae is a major fish pathogen, recently emergent outbreaks were recorded in commercially cultured monosex Nile tilapia (Oreochromis niloticus result in significant losses termed “streptococcosis”-causes unusual appearances with multi-focal pin-point haemorrhages, abscesses, necrosis and ascites in skin, fin, muscle, liver, spleen, kidney, blood, interstitial fluid specially in central nervous system and brain. This disease was more prevalent (>26% at summer when the water temperature was approximately >25oC, percentage of mortality was higher >41% during the overcrowding and improper water chemistry. Raised levels of glucose and ammonium in blood serum causes reduced number of free blood cells released into the haemolymph to stomach and gut, result in refrain from eating in diseased tilapia. Stocking density (200 fish/decimal; class IV had significant effect (P<0.01 on the total production (5,000 to 5,500 kg/ha. S. iniae in the circulating blood cells, extra-tubular haemal spaces containing blood vessels, fixed phagocytes in the hepatopancreas (gastrointestinal tract, bacteria-like particles in the brain tissue, vacuum and necrosis in hepatocytes revealed with histopathology. In vitro study revealed that cohabitation of dead or infected fish with healthy fish resulted infection (horizontal transmission mechanism to the healthy fish.

  16. Innate immune defenses exhibit circadian rhythmicity and differential temporal sensitivity to a bacterial endotoxin in Nile tilapia (Oreochromis niloticus)

    DEFF Research Database (Denmark)

    Lazado, Carlo Cabacang; Skov, Peter Vilhelm; Pedersen, Per Bovbjerg

    2016-01-01

    The present study investigated the daily dynamics of humoral immune defenses and the temporal influence in the sensitivity of these responses to a bacterial endotoxin in Nile tilapia (Oreochromis niloticus). The first experiment subjected the fish to two photoperiod conditions, 12L:12D (LD) and 0L...... exposed at ZT15. Taken together, this study shows that several key components of humoral immunity in tilapia exhibit circadian rhythms and adapt to photoperiodic changes. Further, results of the bacterial endotoxin challenge suggest that responsiveness of serum humoral factors to a biological insult...

  17. Skin and subcutaneous mycoses in tilapia (Oreochromis niloticus) caused by Fusarium oxysporum in coinfection with Aeromonas hydrophila.

    Science.gov (United States)

    Cutuli, M Teresa; Gibello, Alicia; Rodriguez-Bertos, Antonio; Blanco, M Mar; Villarroel, Morris; Giraldo, Alejandra; Guarro, Josep

    2015-09-01

    Subcutaneous mycoses in freshwater fish are rare infections usually caused by oomycetes of the genus Saprolegnia and some filamentous fungi. To date, Fusarium infections in farmed fish have only been described in marine fish. Here, we report the presence of Fusarium oxysporum in subcutaneous lesions of Nile tilapia (Oreochromis niloticus). Histopathologic evaluation revealed granuloma formation with fungal structures, and the identity of the etiological agent was demonstrated by morphological and molecular analyses. Some of the animals died as a result of systemic coinfection with Aeromonas hydrophila.

  18. Changes in lipids and fishy odour development in skin from Nile tilapia (Oreochromis niloticus) stored in ice.

    Science.gov (United States)

    Sae-Leaw, Thanasak; Benjakul, Soottawat; Gokoglu, Nalan; Nalinanon, Sitthipong

    2013-12-01

    Changes in lipids, lipoxygenase activity and fishy odour development in the skin of Nile tilapia (Oreochromis niloticus) during iced storage of 18 days were monitored. Triacylglycerol content of skin decreased with coincidental increases in free fatty acid, monoacylglycerol, diacylglycerol and phospholipid contents during storage (pskin was observed as the storage time increased. The development of fishy odour in Nile tilapia skin during iced storage was mostly governed by lipid oxidation via autoxidation or induced by lipoxygenase. Thus, the extended storage time of whole fish resulted in the pronounced changes in lipids and the increased fishy odour in the skin. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Successful xenogeneic germ cell transplantation from Jundia catfish (Rhamdia quelen) into adult Nile tilapia (Oreochromis niloticus) testes.

    Science.gov (United States)

    Silva, M A; Costa, G M J; Lacerda, S M S N; Brandão-Dias, P F P; Kalapothakis, E; Silva Júnior, A F; Alvarenga, E R; França, L R

    2016-05-01

    Fish germ cell transplantation presents several important potential applications for aquaculture, including the preservation of germplasm from endangered fish species with high genetic and commercial values. Using this technique in studies developed in our laboratory with adult male Nile tilapias (Oreochromis niloticus), all the necessary procedures were successfully established, allowing the production of functional sperm and healthy progeny approximately 2months after allogeneic transplantation. In the present study, we evaluated the viability of the adult Nile tilapia testis to generate sperm after xenogeneic transplant of germ cells from sexually mature Jundia catfish (Rhamdia quelen) that belong to a different taxonomic order. Therefore, in order to investigate at different time-periods post-transplantation, the presence and development of donor PKH26 labeled catfish germ cells were followed in the tilapia seminiferous tubules. From 7 to 20days post-transplantation, only PKH26 labeled spermatogonia were observed, whereas spermatocytes at different stages of development were found at 70days. Germ cell transplantation success and progression of spermatogenesis were indicated by the presence of labeled PKH26 spermatids and sperm on days 90 and 120 post-transplantation, respectively. Confirming the presence of the catfish genetic material in the tilapia testis, all recipient tilapias evaluated (n=8) showed the genetic markers evaluated. Therefore, we demonstrated for the first time that the adult Nile tilapia testis offers the functional conditions for development of spermatogenesis with sperm production from a fish species belonging to a different order, which provides an important new venue for aquaculture advancement. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Phenotype and genetic parameters for body measurements, reproductive traits and gut lenght of Nile tilapia (Oreochromis niloticus) selected for growth in low-input earthen ponds

    NARCIS (Netherlands)

    Charo-Karisa, H.; Bovenhuis, H.; Rezk, M.A.; Ponzoni, R.W.; Arendonk, van J.A.M.; Komen, J.

    2007-01-01

    In this study we present estimates of phenotypic and genetic parameters for body size measurements, reproductive traits, and gut length for Nile tilapia (Oreochromis niloticus) selected for growth in fertilized earthen ponds for two generations. Throughout the experiment, ponds were fertilized daily

  1. Effects of dietary levels of vitamin A on growth, hematology, immune response and resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus iniae

    Science.gov (United States)

    This study was conducted to evaluate the effect of supplemental levels of vitamin A (0, 2,500, 5,000, 10,000, and 20,000 IU/kg diet) on the growth performance, hematology, immune response and resistance of Nile tilapia, Oreochromis niloticus to Streptococcus iniae challenge. Each diet was fed to Nil...

  2. The effect of tryptophan supplemented diets on brain serotonergic activity and plasma cortisol under undisturbed and stressed conditions in grouped-housed Nile tilapia Oreochromis niloticus

    DEFF Research Database (Denmark)

    Martins, C.I.M.; Silva, P.I.M.; Costas, B.

    2013-01-01

    -term supplementation with TRP supplemented diets changes brain serotonergic activity and the stress response associated with slaughter handling in grouped-housed Nile tilapia Oreochromis niloticus. Adult fish (n. =. 108, 490.6. ±. 4.0. g, 12 individuals per tank) were exposed to one of the three treatments...

  3. Production algale et consommation par le Tilapia, Oreochromis niloticus L., au Lac Muhazi (Rwanda. Résumé de thèse de doctorat

    Directory of Open Access Journals (Sweden)

    Mukankomeje, R.

    1992-01-01

    Full Text Available Algal production and consumption by the Tilapia Oreochromis niloticus L., in Lake Muhazi (Rwanda. The article describes shortly the objectives of a Food Early Warning System (FEWS project, as well as its organisation. The specifie case of Somalia, where the project had to evolve in increasingly difficult situations, and the solutions used so as to preserve the output, are described.

  4. Effects of stocking density on production and economics of Nile tilapia (Oreochromis niloticus) and freshwater prawn (Macrobrachium rosenbergii) polyculture in periphyton-based systems

    NARCIS (Netherlands)

    Uddin, S.; Rahman, S.M.S.; Azim, M.E.; Wahab, M.A.; Verdegem, M.C.J.; Verreth, J.A.J.

    2007-01-01

    The present research investigated the effect of stocking density on pond (75 m2, depth 1.2 m) production of Nile tilapia (Oreochromis niloticus) and freshwater prawn (Macrobrachium rosenbergii) stocked at a fixed 3:1 tilapia:prawn ratio. Three stocking densities were tried in triplicate: 20 000 ha¿1

  5. The potential of mixed culture of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) and freshwater giant prawn (Macrobrachium rosenbergii) in periphyton-based systems

    NARCIS (Netherlands)

    Uddin, S.; Azim, M.E.; Wahab, M.A.; Verdegem, M.C.J.

    2006-01-01

    The production performance of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) and freshwater prawn (Macrobrachium rosenbergii) in periphyton-based systems were studied in farmers' ponds at Mymensingh, Bangladesh. Fifteen ponds (200-300 m2 area and 1.0-1.5 m in depth) were used to

  6. Use of distiller’s dried grains with solubles, which had been used as substrate for black soldier fly larvae, in diets for nile tilapia Oreochromis niloticus

    Science.gov (United States)

    A feeding trial was conducted in a closed system with Nile tilapia, Oreochromis niloticus, juveniles (mean initial weight, 2.66 g) to examine total replacement of menhaden fish meal (MFM) with distiller’s dried grains with solubles (DDGS), which had been used as substrate for the production of black...

  7. Ontogenetic diet shifts of Oreochromis niloticus and Tilapia rendalli of the Barra Bonita reservoir (Tietê river, São Paulo State, Brazil=Mudanças ontogenéticas na dieta de Oreochromis niloticus and Tilapia rendalli da represa de Barra Bonita (rio Tietê, Estado de São Paulo, Brasil

    Directory of Open Access Journals (Sweden)

    Edmir Daniel Carvalho

    2012-07-01

    Full Text Available The Nile Tilapia, Oreochromis niloticus, and the Congo Tilapia, Tilapia rendalli, are important members of the African cichlids, and have been introduced to many Brazilian lakes and reservoirs. These species exhibit a large feeding flexibility and may modify their habits during their growth. In the Barra Bonita reservoir, these species are well adapted, representing more than 80% of fish. This study aimed to analyze ontogenetic variation with regard to the diet of these species in this important reservoir. Samples were taken monthly, from March 2007 to February 2008, in Anhembi, São Paulo State. Both species were analyzed by grouping individuals according to size classes. The coexistence of these species was observed in this environment, to which fish were introduced, as well as discreet differences in diet, being that Oreochromis niloticus was considered as an detritivorous, since the detritus was constant in the diet of almost all size classes, and presents some changes in its diet according to the different size classes. While T. rendalli may was defined as herbivorous, and the contribution of food resources to the diet of T. rendalli seems to be different from that of O. niloticus along the size classes.A Tilápia do Nilo, Oreochromis niloticus, e a Tilapia do Congo, Tilapia rendalli, são importantes membros do grupo dos ciclídeos africanos, e têm sido introduzidas em diversos lagos e reservatórios brasileiros. Estas espécies exibem uma grande flexibilidade em suas dietas e podem modificar seus hábitos alimentares durante o crescimento. No reservatório de Barra Bonita, estas espécies estão bem adaptadas, representando mais de 80% da pesca. Este estudo teve como objetivo analisar a variação ontogenética na dieta destas duas espécies neste importante reservatório. Foram realizadas amostras mensais, de Março de 2007 a Fevereiro de 2008, no município de Anhembi, Estado de São Paulo. Ambas as espécies foram analisadas agrupando

  8. Comportamento alimentar da tilápia do Nilo (Oreochromis niloticus frente a diferentes ingredientes alimentares Alimentary ingredients and the feeding behavior of Nile tilápia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Elyara Maria Pereira-da-Silva

    1999-07-01

    Full Text Available Foram avaliadas as respostas comportamentais da tilápia do Nilo (Oreochromis niloticus frente a 14 ingredientes utilizados na alimentação de peixes: farinhas de carne, de peixe, de crisálidas, de camarão, de girassol, de algodão e de mandioca, ovo integral liofilizado, levedura de cana-de-açúcar, farelos de soja e de trigo, glúten de milho, fubá de milho e raspa de mandioca. O método utilizado foi de dupla escolha, comparando-se cada ingrediente peletizado a uma ração denominada controle. Foram empregados quatro aquários (750 litros, contendo, cada um, três alevinos e dois comedouros instalados nos cantos direito e esquerdo, sendo registradas as respostas dos animais para cada ingrediente, separadamente. Concluiu-se que as respostas comportamentais da tilápia variam de acordo com o ingrediente oferecido e que parece existir uma correlação positiva entre o grau de atrato-palatabilidade de um ingrediente e a ocorrência de confrontos agonísticos entre os indivíduos. Sugere-se que ingredientes classificados como de alta atrato-palatabilidade (farinhas de crisálidas, de peixe, de carne, de camarão e ovo liofilizado integral sejam adicionados às dietas especiais para peixes, visando ao aumento da ingestão alimentar nos períodos pré-invernais, situações de estresse ou estados patológicos.Nile Tilapia (Oreochromis niloticus responses to attractivity and taste of fourteen food ingredients, here classified as animal sources (shrimp, fish, silkworm and meat meal, integral lyophilized egg and sugar-cane-yeast, vegetable protein sources (maize gluten, soybean bran, sunflower meal and cotton bran and energetics (maize flour, manioc scraping, manioc bran and wheat bran were investigated. These ingredients were compared to a control diet, using a two-choice method. Four 750 liters aquaria stocked with three fries each and two feeders installed respectively at the right and left corner where used to register the responses of the

  9. Colina e betaína em rações purificadas na nutrição da tilápia do Nilo (Oreochromis niloticus Choline and betaine in purified diets for Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Ivan Vieira

    2001-12-01

    Full Text Available Problemas metabólicos observados em produções intensivas de tilápias do Nilo (Oreochromis niloticus têm sido relacionados à deficiência de colina nas rações. Com o objetivo de avaliar o efeito da suplementação dietética da colina na nutrição da espécie, rações purificadas contendo 0; 375; 750; 1.125; 1.500 ou 1.875 mg de cloreto de colina por kg, foram administradas ad libitum por 42 dias a tilápias do Nilo (5,09 ± 0,14 g, estocados em gaiolas de PVC atóxico (volume = 60 L, alojadas em caixas de polipropileno de 1000 L, em ambiente com condições controladas de temperatura e luminosidade, num delineamento experimental em blocos incompletos casualizados, com três parcelas por bloco (n=5. O ganho de peso (GDP e o índice de conversão alimentar (ICA de todos os tratamentos foram superiores ao controle. Não foram observadas diferenças para a quantidade de lipídios no fígado e tecido corporal, e sobrevivência (S%. Num segundo experimento, os peixes foram alimentados com rações suplementadas com 1.250 ou 2.500 mg de cloreto de colina por kg; ou 1.000; 2.000 ou 3.000 mg de betaína por kg. Não foram observadas diferenças significativas para S% e acúmulo de lipídeos hepáticos ou corporais; o ICA e GDP dos tratamentos suplementados com colina foram superiores aos dos tratamentos suplementados com betaína, mas não diferiram entre si. Níveis de suplementação superiores a 375 mg de cloreto de colina por kg de alimento melhoram o ICA e o GDP da tilápia do Nilo, mas a betaína não substitui efetivamente a colina em rações para a espécie.Metabolic problems detected in intensively raised Nile tilapia (Oreochromis niloticus are credited to possible sub-supplementation of coline in commercial feeds. To investigate the utilization of choline and betaine as feed supplement for the Nile tilapia, groups of 10 fingerlings (5.09 ± 0.14 g stocked in 30 PVC cages (60 L, kept under controlled environmental conditions inside

  10. Molecular characterization of Galectin-8 from Nile tilapia (Oreochromis niloticus Linn.) and its response to bacterial infection.

    Science.gov (United States)

    Unajak, Sasimanas; Pholmanee, Nutthida; Songtawee, Napat; Srikulnath, Kornsorn; Srisapoome, Prapansak; Kiataramkul, Asama; Kondo, Hidehiro; Hirono, Ikuo; Areechon, Nontawith

    2015-12-01

    Galectins belong to the family of galactoside-binding proteins and play a major role in the immune and inflammatory responses of vertebrates and invertebrates. The galectin family is divided into three subtypes based on molecular structure; prototypes, chimera types, and tandem-repeated types. We isolated and characterized the cDNA of galectin-8 (OnGal-8) in Nile tilapia (Oreochromis niloticus). OnGal-8 consisted of a 966 bp open reading frame (ORF) that encoded a 321 amino acid protein (43.47 kDa). Homology and phylogenetic tree analysis suggested the protein was clustered with galectin-8s from other animal species and shared at least 56.8% identity with salmon galectin-8. Structurally, the amino acid sequence included two distinct N- and C- terminus carbohydrate recognition domains (CRDs) of 135 and 133 amino acids, respectively, that were connected by a 39 amino acid polypeptide linker. The N- and C-CRDs contained two conserved WG-E-I and WG-E-T motifs, suggesting they have an important role in mediating the specific interactions between OnGal-8 and saccharide moieties such as β-galactoside. The structure of OnGal-8 was characterized by a two-fold symmetric pattern of 10-and 12-stranded antiparallel ß-sheets of both N- and C-CRDs, and the peptide linker presumably formed a random coil similar to the characteristic tandem-repeat type galectin. The expression of OnGal-8 in healthy fish was highest in the skin, intestine, and brain. Experimental challenge of Nile tilapia with S. agalactiae resulted in significant up-regulation of OnGal-8in the spleen after 5 d. Our results suggest that OnGal-8 is involved in the immune response to bacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Formation of ring marks in stocked tilapia juveniles (Oreochromis aureus/O. niloticus (Perciformes: Cichlidae

    Directory of Open Access Journals (Sweden)

    Ana L Ibañez

    2007-12-01

    Full Text Available Lake Metztitlán was dried up completely in the spring of 1998 and refilled in August of that year. In the period September-November, two cohorts of 1.6 million juveniles of a tilapia hybrid were stocked (Oreochromis aureus/O. niloticus, and monitored every month for one year. Since the date of birth of these juveniles was known, the analyses focused on whether the ring marks of the scales, sagittae and opercula or the circuli of the scales could be used to age them. The ring marks of the scales and opercula showed great variability, and the sagittae had a significant relationship with length, but it is unclear if at least the first ring mark could be formed at the hatchery and reflect changes in diet and/or tank movements in the fish farm. The circuli had a continuous regular behavior, with a formation rate of 10.38±0.93 and 11.38±0.95 circuli/month for the first and second cohorts, respectively. This proportion was maintained during the study period, and could be of help to calculate an approximate age of juveniles, especially in stocked fish that show multiple ring marks because of manipulation in fish farms and stocking events. Rev. Biol. Trop. 55 (3-4: 1005-1013. Epub 2007 December, 28.El lago de Metztitlán se secó completamente en la primavera de 1998, inundándose nuevamente en agosto del mismo año para ser repoblado entre septiembre y noviembre con 1.6 millones de jóvenes de un híbrido de tilapia (Oreochromis aureus/O. niloticus en dos periodos. Ambas cohortes fueron monitoreadas mensualmente durante un año. Debido a que la fecha de nacimiento era conocida, el objetivo del estudio fue evaluar si las marcas anulares de las escamas, las sagittae y los opérculos, o los circuli de las escamas pueden usarse para estimar la edad. Los anillos de las escamas y opérculos mostraron gran variabilidad, mientras que las de las sagittae se relacionaron significativamente con la longitud, sin embargo no quedó claro si al menos el primer

  12. Digestibility, growth, blood chemistry, and enzyme activity of juvenile Oreochromis niloticus fed isocaloric diets containing animal and plant byproducts

    Directory of Open Access Journals (Sweden)

    Magnolia Montoya-Mejía

    Full Text Available ABSTRACT In this work, we studied the digestibility, growth, blood chemistry, and enzyme activity of Nile tilapia (Oreochromis niloticus juveniles (0.95±0.18 g using different animal (fish silage meal, whey meal, bovine blood meal, and red crab meal and plant (extruded bean, extruded chickpea meal, coconut paste, Jatropha curcas meal, and chickpea meal dietary byproducts. Nine isocaloric diets (321.92±9.10 kcal g−1 were evaluated for 60 days. The highest digestibility of crude protein values for animal and plant sources were obtained for the whey (93.6 and extruded bean meal (90.5 diets, respectively. The final body weight was higher for the red crab and extruded chickpea meal diets, meanwhile the fish silage and red crab byproducts obtained the highest protein efficiency ratio. Hematocrit was similar among the diets of each byproduct source and presented correlation with growth parameters. The highest glucose, cholesterol, and triglyceride values were obtained for fish silage (138.0, 260.5, and 389.0 mg dL−1, respectively and whey meal (174.5, 242.3, and 284.0 mg dL−1, respectively groups. A positive correlation was found between the digestibility of crude protein of ingredients and chymotrypsin activity. Oreochromis niloticus is able to better utilize fish silage, whey, extruded bean, and extruded chickpea byproducts, adjusting its digestive physiology. Such ingredients can be used for formulating cheaper and efficient tilapia diets.

  13. Identification and virulence of Aeromonas dhakensis, Pseudomonas mosselii and Microbacterium paraoxydans isolated from Nile tilapia, Oreochromis niloticus, cultivated in Mexico.

    Science.gov (United States)

    Soto-Rodriguez, S A; Cabanillas-Ramos, J; Alcaraz, U; Gomez-Gil, B; Romalde, J L

    2013-09-01

    To identify bacterial pathogens of diseased NiIe tilapia Oreochromis niloticus and determine their virulence. Sixteen bacterial isolates were recovered from diseased Nile tilapias (O. niloticus) reared in floating cages in Adolfo Lopez Mateos (ALM), Sanalona and Dique IV dams in Sinaloa, Mexico, from February to May 2009. The bacterial isolates were identified by phenotypic and molecular (rep-PCR and 16S rRNA sequencing) methods and were mostly isolated from the kidneys and the brain of tilapias. Bacterial cells and extracellular products (ECPs) of strains were characterized and used in experimental infections with sole Solea vulgaris and Mozambican tilapia Oreochromis mossambicus. The fish challenged with Aeromonas dhakensis sp. nov. comb nov, Pseudomonas mosselii and Microbacterium paraoxydans (3·1 × 10(6)  CFU g(-) 1) exhibited mortality between 40 and 100% starting at 6 h postinoculation. The ECPs displayed gelatinase, haemolytic and cytotoxic activity, causing the total destruction of the HeLa cell lines. Aeromonas dhakensis and Ps. mosselii were virulent to O. mossambicus, whereas Mic. paraoxydans displayed virulence to S. vulgaris. This the first time that Aeromonas dhakensis and Ps. mosselii are reported as pathogens to tilapia and Mic. paraoxydans was isolated from fish; then, these fish pathogens could be a threat to farmed Nile tilapia in Mexico. © 2013 The Society for Applied Microbiology.

  14. Histology and ultrastructure of the thymus during development in tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Cao, Jianmeng; Chen, Qiong; Lu, Maixin; Hu, Xinxin; Wang, Miao

    2017-05-01

    The thymus in teleost fishes plays an important role in producing functionally competent T-lymphocytes. However, the thymus in tilapia is not well known, which greatly hampers investigations into the immune responses of tilapia infected by aquatic pathogens. The histological structure and ultrastructure of the thymus in Oreochromis niloticus, including embryos and larvae at different developmental stages, juveniles, and adult fish, were systematically investigated using whole mount in situ hybridization (WISH), and light and transmission electron microscopy (TEM). The position of the thymus primordium was first labeled in the embryo at 2 days post-fertilization (dpf) with the thymus marker gene recombination activating gene 1 (Rag1), when the water temperature was 27 °C. Obvious structures of the thymus were easily observed in 4-dpf embryos. At this stage, the thymus was filled with stem cells. At 6 dpf, the thymus differentiated into the cortex and medulla. The shape of the thymus was 'broad bean'-like during the early stages from 4 to 10 dpf, and became wedge-shaped in fish larvae at 20 dpf. At 6 months post-fertilization (mpf), the thymus differentiated into the peripheral zone, central zone, and inner zone. During this stage, myoid cells and adipocytes appeared in the inner zone following thymus degeneration. Then, the thymus displayed more advanced degeneration by 1 year post-fertilization (ypf), and the separation of cortex and medulla was not observed at this stage. The thymic trabecula and lobule were absent during the entire course of development. However, the typical Hassall's corpuscle was present and underwent degeneration. Additionally, TEM showed that the thymic tissues contained a wide variety of cell types, namely lymphocytes, macrophages, epithelial cells, fibroblasts, and mastocytes. © 2017 Anatomical Society.

  15. Environmental effects on the gills and blood of Oreochromis niloticus exposed to rivers of Bahia, Brazil.

    Science.gov (United States)

    da Cruz, André Luis; Prado, Thiago Matos; Maciel, Letícia Aguilar da Silva; Couto, Ricardo David

    2015-01-01

    Through the integration of chemical, biochemical and morphological analyses, this study investigated the effects of multiple pollutants on environmental biomarkers, such as gill histopathological changes and hematological and biochemical parameters, in Oreochromis niloticus exposed to four sites in the Jacuipe and Subaé rivers over seven days. Sediment analyses identified Sapelba as the most contaminated site, followed by Oliveira de Campinhos, Santo Amaro and Jacuípe. Water analyses revealed aluminum, iron and manganese at all sites. Aluminum and other metal were also detected in the gills of fishes. Fish exposed to the Sapelba site exhibited significant necrosis formation, as well as higher hematological parameters and trend to increase of cortisol levels. However, filament epithelium proliferation was higher at the Oliveira de Campinhos and Santo Amaro sites, at which the lowest levels of the hematological variables were observed. Multivariate analysis grouped some gill histopathological changes together, such as epithelial detachment with edema and lamellar epithelial proliferation with the lamellar fusion of adjacent filaments, revealing relationships among them. Positive associations were identified between sediment contamination and necrosis and cortisol, while water contamination was related with filament epithelium proliferation, aneurism, lamellar fusion and several hematological parameters. Furthermore, relationships between blood parameters and gill histopathological changes demonstrated a joint physiological response that may have resulted from environmental variables such as dissolved oxygen. The results exhibited the direct influence of xenobiotics on these biomarkers but also highlighted the need to consider the complexity of environmental factors to optimize the adoption of these environmental predictive tools. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Effects of fish size on the response of antioxidant systems of Oreochromis niloticus following metal exposures.

    Science.gov (United States)

    Kanak, E G; Dogan, Z; Eroglu, A; Atli, G; Canli, M

    2014-08-01

    The size of a fish is an important factor in its physiology, and metal uptake is affected by animal physiology. In this study, small and large tilapias (Oreochromis niloticus) differing approximately twofold in length and fivefold in weight were compared for their antioxidant response. Both groups were exposed to Cu or Cr (1.0 μg/mL) in a freshwater (-80 mg CaCO3/L, conductivity 1.77 mS/cm) using 2 exposure protocols (20 μM for 48 h and 10 μM for 6 days). Following the exposures, the antioxidant enzyme activities (superoxide dismutase, SOD; catalase, CAT; glutathione peroxidase, GPX; glutathione reductase, GR and glutathione S-transferase, GST) and glutathione (GSH) levels were measured in the liver of fish. Results showed that small fish was affected from exposure conditions much more than large ones as their antioxidant parameters significantly decreased even in controls. Metal exposures of small fish caused significant increases in SOD and CAT activity in acute Cu or Cr exposures. Subchronic Cr exposure of small fish also caused significant increases in CAT, GPx and GST activities, while there was no significant change in Cu-exposed ones. Large fish, however, showed different antioxidant responses as their levels mostly decreased. This study demonstrated that the response of antioxidant system in the liver of tilapia varied in relation to fish sizes and emphasized using different size groups in environmental monitoring and also in evaluation of fish biomarkers.

  17. Acute toxicity of nitrite on tilapia (Oreochromis niloticus) at different external chloride concentrations.

    Science.gov (United States)

    Yanbo, Wang; Wenju, Zhang; Weifen, Li; Zirong, Xu

    2006-03-01

    Tilapias (Oreochromis niloticus) juveniles (total length 4.9 +/- 0.2 cm and weight 1.8 +/- 0.2 g) were exposed to several nitrite concentrations (0, 10, 18, 32, 56 and 100 mg l(-1)) for 96 h, using a semi-static renewal method at chloride levels of 35.0 and 70.0 mg l(-1). At the end of the 96-h period, the median lethal concentration (LC(50)) of nitrite was 28.18 mg l(-1) in water with low chloride content (35.0 mg l(-1)) and 44.67 mg l(-1) with high chloride content (70.0 mg l(-1), respectively). It indicated that high concentrations of chloride ions could reduce the toxicity of nitrite. During the toxicity experiments, the behaviour and clinical signs of tilapias were also observed. Furthermore, the test of toxic mechanism was designed taking five test concentrations, viz., 5, 10, 15 and 20 mg l(-1) and a nitrite-free control. Nitrite exposure produced high levels of methaemoglobin (MHb) but did not seem to cause mortality, as surviving tilapias showed high levels (85.37 +/- 2.23 and 53.82 +/- 3.44 at 35.0 and 70.0 mg l(-1) chloride, respectively). The percentage of MHb exposed to nitrite was significantly higher (P<0.05) than the control (0 mg l(-1) nitrite) and increased with the increasing nitrite concentration. However, the percentage of MHb decreased with the increasing chloride concentration.

  18. Estrogenic and anti-androgenic effects of the herbicide tebuthiuron in male Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    de Almeida, Milena Devechi; Pereira, Thiago Scremin Boscolo; Batlouni, Sergio Ricardo; Boscolo, Camila Nomura Pereira; de Almeida, Eduardo Alves

    2018-01-01

    Tebuthiuron is a phenylurea herbicide widely used in agriculture that can reach the aquatic environments, possibly posing negative effects to the aquatic biota. Phenylurea herbicides, such as diuron, are known to cause estrogenic and anti-androgenic effects in fish, but no such effects were yet reported for tebuthiuron exposure. Thus, the aim of this study was to evaluate if tebuthiuron, at environmentally relevant concentrations (100 and 200ng/L) and after 25days of exposure have estrogenic and/or anti-androgenic effects on male of Nile tilapia (Oreochromis niloticus), through the evaluation of plasmatic testosterone (T) and estradiol (E 2 ) levels, brain aromatase (CYP19) levels (western-blot), and by evaluating the histology of the testicles. When compared to the control group, plasmatic T levels decreased about 76% in the animals exposed to 200ng/L of tebuthiuron, while E 2 levels increased about 94%, which could be related to a significant increase (77%) in CYP19A1 levels, an enzyme that catalyzes the conversion of androgens into estrogens. Histological analyses of the testicles also demonstrated that tebuthiuron at both tested concentrations caused a decrease in the diameter of the seminiferous tubules and in the diameter of the lumen. Therefore, the gonadosomatic index (GSI) was reduced by 36% % in the animals exposed 200ng/L to tebuthiuron. Indeed, the relative frequency of spermatocytes and spermatids increased respectively 73% (200ng/L) and 61% (100ng/L) in the tebuthiuron exposed animals, possibly due to the impairment of sperm release into the lumen, that was decreased 93% (200ng/L) in the treated animals compared to the control. These results confirm that tebuthiuron causes estrogenic and anti-androgenic effects in Nile tilapias at environmentally relevant concentrations. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Changes of Microbiological Quality in Aquaculture tilapia (Oreochromis niloticus) After Irradiation Treatment

    International Nuclear Information System (INIS)

    Ali, H.A.S.

    2015-01-01

    The effect of different doses of gamma irradiation (1, 3 and 5 kGy) on the microbial flora of aquacultured Nile tilapia fish (Oreochromis niloticus) in cages inserted in Manzala Lake, Egypt, was investigated. These fish were fed on poultry by-product meal (PBM) in practical diets as replacement for fish meal protein in which herring fish meal (HFM) were replaced by PBM at ratio of 25 %, 50 %, 75% and 100% in the diet. Based on the results, it could be noticed that there was non-significant effect after partial (25, 50 and 75%) and complete replacement of fish meal protein by poultry by-product meal on the total bacterial count TBC, mould and yeast and Staphylococcus aureus counts (log cfu/g) of tilapia fish. Significant increases in the counts of Escherichia coli, Enterobacteriaceae and Enterobacter aerogenes were recorded, specially at the high levels of replacement (75 and 100%). Concerning the effect of gamma irradiation on fish samples, it could be observed that gamma irradiation with the doses 1,3 and 5 kGy significantly reduced TBC, mould and yeast, S. aureus. E. coli, Enterobacter aerogenes and Enterobacteriaceae counts of all treatments which reached undetectable values by using gamma irradiation doses of 3 and 5 kGy. From the present results, it could be concluded that using poultry by-product meal (PBM) in diets for Nile tilapia as replacement for fish meal protein supplied by herring fish meal (HFM) in the diet (to reduce feeding economic cost) significantly increase the log count of Enterobacteriaceae, Escherichia coli and Enterobacter aerogenes. However using gamma irradiation significantly reduced these counts which were undetectable using 3 and 5 kGy. It could be concluded that using gamma irradiation with dose 3 kGy can improve the hygienic quality of aquacultured Nile tilapia.

  20. Persamaan Prediksi Umur Simpan Filet Ikan Nila (Oreochromis niloticus yang Dikemas Vakum dalam HDPE

    Directory of Open Access Journals (Sweden)

    Rudi Riyanto

    2014-06-01

    Full Text Available Penelitian ini dilakukan untuk mendapatkan data laju penurunan mutu filet ikan nila (Oreochromis niloticus yang dikemas vakum dengan HDPE. Hasil analisis digunakan untuk menentukan indikator yang paling tepat untuk persamaan prediksi umur simpan menggunakan persamaan regresi. Dalam percobaan yang dilakukan filet ikan nila yang dikemas vakum dengan HDPE disimpan pada suhu 0, 10, 20, dan 30 oC. Parameter yang dianalisis adalah TVB-N, pH, TBA, Organoleptik (hedonik, dan TPC (aerob dan anaerob. Data yang dihasilkan menunjukkan bahwa suhu dan lama penyimpanan berpengaruh nyata terhadap laju penurunan mutu filet ikan nila (P<0,05. Berdasarkan tingkat kecepatan parameter mutu untuk mencapai limit toleransi, nilai TVB-N merupakan parameter mutu yang paling tepat untuk dijadikan parameter penentu kinetika pembusukan filet ikan nila. Kandungan TVB filet ikan nila yang disimpan pada suhu 30, 20, 10, dan 0 °C telah melampaui batas mutu (30 mg-N/100 g secara berturut-turut pada penyimpanan 9, 24, 72, dan 168 jam. Berdasarkan hasil pengolahan data nilai TVB filet ikan nila pada beberapa suhu penyimpanan menggunakan persamaan Arrhenius, nilai Ea yang didapatkan sebesar 72,17 KJ/mol dengan menggunakan nilai TVB 30 mg-N/100 g sebagai nilai batas penolakan mutu filet ikan nila. Persamaan prediksi umur simpan (t=jam filet ikan nila dalam HDPE vakum yang didapatkan adalah ln A = ln A0 + (t.exp[26,44-8681(1/T] dengan tingkat akurasi nilai prediksi terhadap nilai mutu filet ikan nila percobaan adalah 73–78%.

  1. Histopathological analysis of tilapia gills (Oreochromis niloticus Linnaeus, 1758) exposed to sugarcane vinasse.

    Science.gov (United States)

    Correia, J E; Christofoletti, C A; Marcato, A C C; Marinho, J F U; Fontanetti, C S

    2017-01-01

    Sugarcane vinasse is one of the main residues generated by the transformation of cane into ethanol. Because of the high organic content (COD), high biochemical oxygen demand (BOD), low pH, the large amount that this residue is generated (15l for every liter of ethanol produced) and their use as fertilizer on the sugarcane crop, this residue is potentially polluting to the soil ecossystem and by percolation to water ecossystem too. Thus, this study aimed to assess the toxicity of vinasse by analyzing Oreochromis niloticus gills exposed to different dilutions (1%, 2.5%, 5% and 10%) in two bioassays. The gills were collected, fixed and analyzed using ultra morphological, histological, and histochemical techniques. After exposure to the vinasse, a statistically significant reduction of the ridges present on the surface of pavimentous cells was observed in one of the bioassays; such structures are responsible for mucus retention, which helps to protect the tissue. In addition, an intumescence of the cells was observed in the treatments with vinasse as well as an increase in the amount of chloridric cells. Some striking tissue changes detected in the treatments were epithelial detachment and loss of integrity of secondary lamellae, causing their rupture and consequent hemorrhage. In the first bioassay, the amount of these changes was statistically significant at the 5% dilution, and the focus of hemorrhage was significant at all dilution ratios. In the second bioassay, the epithelial disorganization was statistically significant only at the 2.5% dilution of vinasse. Moreover, for both bioassays performed, a significant increase in mucous cells was observed when compared with the control. Our results demonstrate the toxic action of sugarcane vinasse, which caused histopathological changes in the exposed animals at all four dilution tested. This highlights the need for caution in the disposal of sugarcane vinasse on the soil, especially due to its capacity for being

  2. Nutritional Profile and Chemical Stability of Pasta Fortified with Tilapia (Oreochromis niloticus Flour.

    Directory of Open Access Journals (Sweden)

    Maria Lúcia G Monteiro

    Full Text Available Physicochemical parameters of pasta enriched with tilapia (Oreochromis niloticus flour were investigated. Five formulations were prepared with different concentrations of tilapia flour as partial substitute of wheat flour: pasta without tilapia flour (PTF0%, pasta with 6% (PTF6%, 12% (PTF12%, 17% (PTF17%, and 23% (PTF23% of tilapia flour. The formulations were assessed for proximate composition, fatty acid and amino acid profile on day 1 whereas, instrumental color parameters (L*, a* and b* values, pH, water activity (aw, and lipid and protein oxidation were evaluated on days 1, 7, 14, and 21 of storage at 25°C. Fortification with tilapia flour increased (p < 0.05 protein, lipid, ash, total essential amino acids, and total polyunsaturated fatty acids contents. In addition, supplementation of pasta with tilapia flour decreased (p < 0.05 lightness and water activity while redness, yellowness, pH values, and lipid oxidation were increased (p < 0.05 in a level-dependent manner. Nevertheless, all formulations were exhibited storage stability at 25°C. In general, protein oxidation was greater (p < 0.05 in the pasta containing 12%, 17%, and 23% of tilapia flour than their counterparts, and the storage promoted an increase (p < 0.05 on the carbonyl content in all formulations. Thus, pasta with 6% of tilapia flour has the potential to be a technological alternative to food industry for the nutritional enrichment of traditional pasta with negligible negative effects on the chemical stability of the final product during 21 days at 25°C.

  3. Low water conductivity increases the effects of copper on the serum parameters in fish (Oreochromis niloticus).

    Science.gov (United States)

    Canli, Esin G; Canli, Mustafa

    2015-03-01

    The conductivity is largely determined by ion levels in water, predominant ion being Ca(2+) in the freshwaters. For this reason, the effects of copper were evaluated as a matter of conductivity of exposure media in the present study. Thus, freshwater fish Oreochromis niloticus were exposed to copper in differing conductivities (77, 163 and 330 μS/cm), using acute (0.3 μM, 3 d) and chronic (0.03 μM, 30 d) exposure protocols. Following the exposure serum parameters of fish were measured. Data showed that there was no significant alteration (P>0.05) in serum parameters of control fish. However, activities of ALP, ALT and AST decreased significantly at the lower conductivities in chronic copper exposure, but not in acute ones. Protein levels did not differ significantly in any of the exposure conditions. However, Cu exposure at the lowest conductivity sharply increased the levels of glucose in the acute exposure, while there was no significant difference in the chronic exposure. Cholesterol levels decreased only at the lower conductivities in chronic exposure, but increased in acute exposure. Similarly, triglyceride levels increased in acute exposures and decreased in chronic exposures at the lowest conductivity. There was no change in Na(+) levels, while there was an increase in K(+) levels and a decrease in Ca(2+) level at the lowest conductivity of acute exposures. However, Cl(-) levels generally decreased at the higher conductivities of chronic exposures. There was a strong negative relationship between significant altered serum parameters and water conductivity. In conclusion, this study showed that copper exposure of fish at lower conductivities caused more toxicities, indicating the protective effect of calcium ions against copper toxicity. Data suggest that conductivity of water may be used in the evaluation of metal data from different waters with different chemical characteristics. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Cathepsin activities and thermal properties of Nile tilapia (Oreochromis niloticus meat during ambient storage

    Directory of Open Access Journals (Sweden)

    Tulakhun Nonthaput

    2017-06-01

    Full Text Available Understanding the postmortem changes at ambient aquatic temperature can be useful for estimating the time of death in environmental forensic studies when little information is available. Muscle degradation was investigated in Nile tilapia (Oreochromis niloticus in terms of the specific activities of cathepsins (B, H and L and the scavenging activities and thermal transition properties of myosin and actin, to assess postmortem changes with time (0, 1, 2, 4, 8, 12, 24 and 48 h after death. The study results are relevant to ambient temperatures in Thailand, (about 30 °C. The specific activities of the three cathepsin enzymes increased significantly with postmortem time (p < 0.05 and had a highly significant positive relationship (r = 0.987−0.997, p < 0.01, n = 32. Cathepsin H had the lowest specific activity and exhibited a different type of time profile. Its lowest specific activity was observed at 8 h, which indicated a significant role at this point in time after death. The radical scavenging activities substantially decreased with the time since death, especially within the first 1 h, while no changes occurred from 2 to 8 h, or from 12 to 24 h. The thermal properties of myosin and actin were observed up to a 24 h delay. The degradation of each protein fluctuated with the delay time; actin was more sensitive to postmortem delay than myosin. Overall, the findings from the current study might be used as primary data to estimate the time of death of an aquatic animal. A potential application is for environmental forensics in relation to fish kill events associated with pollution crimes or the mass death of exported fish under transportation insurance, as well as in animal cruelty investigations.

  5. Five different piscidins from Nile tilapia, Oreochromis niloticus: analysis of their expressions and biological functions.

    Science.gov (United States)

    Peng, Kuan-Chieh; Lee, Shu-Hua; Hour, Ai-Ling; Pan, Chieh-Yu; Lee, Lin-Han; Chen, Jyh-Yih

    2012-01-01

    Piscidins are antimicrobial peptides (AMPs) that play important roles in helping fish resist pathogenic infections. Through comparisons of tilapia EST clones, the coding sequences of five piscidin-like AMPs (named TP1∼5) of Nile tilapia, Oreochromis niloticus, were determined. The complete piscidin coding sequences of TP1, -2, -3, -4, and -5 were respectively composed of 207, 234, 231, 270, and 195 bases, and each contained a translated region of 68, 77, 76, 89, and 64 amino acids. The tissue-specific, Vibrio vulnificus stimulation-specific, and Streptococcus agalactiae stimulation-specific expressions of TP2, -3, and -4 mRNA were determined by a comparative RT-PCR. Results of the tissue distribution analysis revealed high expression levels of TP2 mRNA in the skin, head kidneys, liver, and spleen. To study bacterial stimulation, S. agalactiae (SA47) was injected, and the TP4 transcript was upregulated by >13-fold (compared to the wild-type (WT) control, without injection) and was 60-fold upregulated (compared to the WT control, without injection) 24 h after the S. agalactiae (SA47) injection in the spleen and gills. Synthesized TP3 and TP4 peptides showed antimicrobial activities against several bacteria in this study, while the synthesized TP1, -2, and -5 peptides did not. The synthesized TP2, -3, and -4 peptides showed hemolytic activities and synthesized TP3 and TP4 peptides inhibited tilapia ovary cell proliferation with a dose-dependent effect. In summary, the amphiphilic α-helical cationic peptides of TP3 and TP4 may represent novel and potential antimicrobial agents for further peptide drug development.

  6. Five different piscidins from Nile tilapia, Oreochromis niloticus: analysis of their expressions and biological functions.

    Directory of Open Access Journals (Sweden)

    Kuan-Chieh Peng

    Full Text Available Piscidins are antimicrobial peptides (AMPs that play important roles in helping fish resist pathogenic infections. Through comparisons of tilapia EST clones, the coding sequences of five piscidin-like AMPs (named TP1∼5 of Nile tilapia, Oreochromis niloticus, were determined. The complete piscidin coding sequences of TP1, -2, -3, -4, and -5 were respectively composed of 207, 234, 231, 270, and 195 bases, and each contained a translated region of 68, 77, 76, 89, and 64 amino acids. The tissue-specific, Vibrio vulnificus stimulation-specific, and Streptococcus agalactiae stimulation-specific expressions of TP2, -3, and -4 mRNA were determined by a comparative RT-PCR. Results of the tissue distribution analysis revealed high expression levels of TP2 mRNA in the skin, head kidneys, liver, and spleen. To study bacterial stimulation, S. agalactiae (SA47 was injected, and the TP4 transcript was upregulated by >13-fold (compared to the wild-type (WT control, without injection and was 60-fold upregulated (compared to the WT control, without injection 24 h after the S. agalactiae (SA47 injection in the spleen and gills. Synthesized TP3 and TP4 peptides showed antimicrobial activities against several bacteria in this study, while the synthesized TP1, -2, and -5 peptides did not. The synthesized TP2, -3, and -4 peptides showed hemolytic activities and synthesized TP3 and TP4 peptides inhibited tilapia ovary cell proliferation with a dose-dependent effect. In summary, the amphiphilic α-helical cationic peptides of TP3 and TP4 may represent novel and potential antimicrobial agents for further peptide drug development.

  7. Predation of Piaractus mesopotamicus and Oreochromis niloticus larvae by Pantala flavescens with different length classes - doi: 10.4025/actascibiolsci.v33i4.5470 Predation of Piaractus mesopotamicus and Oreochromis niloticus larvae by Pantala flavescens with different length classes - doi: 10.4025/actascibiolsci.v33i4.5470

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Bento Fernandes

    2011-09-01

    Full Text Available The experiment had as objective to study the survival of Piaractus mesopotamicus and Oreochromis niloticus larvae subject to predation by Pantala flavescens larvae with different length classes. We used 120 larvae of P. mesopotamicus, 120 of O. niloticus, and also 24 larvae of Pantala flavescens, distributed in 24 aquariums with useful volume for 2 L, being placed one Odonate for aquarium. The treatments differed as regard to the prey species and the predator size, being kept a control treatment. An aquarium (2 L containing one larvae of Odonate and 10 larvae of fish were considered an experimental unit. After the beginning, each three hours (18:00, 21:00, 0:00, 3:00, 6:00, 9:00, 12:00, 15:00 and 18:00h, the remnant larvae of fish (alive in each experimental unit was quantified, and we replaced the consumed larvae, so that we always had 10 larvae of fish at each aquarium after each counting. For both fish species, there was a slight increase in consumption by the Odonate with intermediate size, but the values did not differ statistically (p > 0.05. Larvae of Odonate in the treatments with greater length presented a lower consumption (p The experiment had as objective to study the survival of Piaractus mesopotamicus and Oreochromis niloticus larvae subject to predation by Pantala flavescens larvae with different length classes. We used 120 larvae of P. mesopotamicus, 120 of O. niloticus, and also 24 larvae of Pantala flavescens, distributed in 24 aquariums with useful volume for 2 L, being placed one Odonate for aquarium. The treatments differed as regard to the prey species and the predator size, being kept a control treatment. An aquarium (2 L containing one larvae of Odonate and 10 larvae of fish were considered an experimental unit. After the beginning, each three hours (18:00, 21:00, 0:00, 3:00, 6:00, 9:00, 12:00, 15:00 and 18:00h, the remnant larvae of fish (alive in each experimental unit was quantified, and we replaced the consumed larvae

  8. Transcriptome Profiling and Molecular Pathway Analysis of Genes in Association with Salinity Adaptation in Nile Tilapia Oreochromis niloticus.

    Science.gov (United States)

    Xu, Zhixin; Gan, Lei; Li, Tongyu; Xu, Chang; Chen, Ke; Wang, Xiaodan; Qin, Jian G; Chen, Liqiao; Li, Erchao

    2015-01-01

    Nile tilapia Oreochromis niloticus is a freshwater fish but can tolerate a wide range of salinities. The mechanism of salinity adaptation at the molecular level was studied using RNA-Seq to explore the molecular pathways in fish exposed to 0, 8, or 16 (practical salinity unit, psu). Based on the change of gene expressions, the differential genes unions from freshwater to saline water were classified into three categories. In the constant change category (1), steroid biosynthesis, steroid hormone biosynthesis, fat digestion and absorption, complement and coagulation cascades were significantly affected by salinity indicating the pivotal roles of sterol-related pathways in response to salinity stress. In the change-then-stable category (2), ribosomes, oxidative phosphorylation, signaling pathways for peroxisome proliferator activated receptors, and fat digestion and absorption changed significantly with increasing salinity, showing sensitivity to salinity variation in the environment and a responding threshold to salinity change. In the stable-then-change category (3), protein export, protein processing in endoplasmic reticulum, tight junction, thyroid hormone synthesis, antigen processing and presentation, glycolysis/gluconeogenesis and glycosaminoglycan biosynthesis-keratan sulfate were the significantly changed pathways, suggesting that these pathways were less sensitive to salinity variation. This study reveals fundamental mechanism of the molecular response to salinity adaptation in O. niloticus, and provides a general guidance to understand saline acclimation in O. niloticus.

  9. First recording of Shewanella putrefaciens in cultured Oreochromis niloticus and its identification by 16Sr RNA in Egypt

    Directory of Open Access Journals (Sweden)

    Manal I. El-Barbary

    2017-03-01

    Full Text Available A survey to determine the pathogenic bacterial strains of an important commercial capture fish, Oreochromis niloticus in an Egyptian fish farm was conducted. One strain presumptively identified as Shewanella putrefaciens was isolated from the fish and identified by a biochemical test, API20NE system and 16S rRNA gene. Intraperitoneal (I.P challenge by S. putrefaciens revealed its pathogenicity with 50% mortality. The infected fish showed skin hemorrhage, fin rot and shallow necrotizing ulcers on the skin with congestion and enlargement of the liver, spleen and kidneys. The antibiogram of S. putrefaciens revealed its sensitivity to ciprofloxacin, norfloxacin, nalidixic acid, streptomycin, gentamycin, oxytetracyclin and sulfamethoxazole. Complete resistance to cephazolin and fusidic acid was recorded. Histological changes in the liver of infected O. niloticus included hepatocyte degeneration, fatty vacuolation in liver cells, Kupffer cell increase, hemolysis with infiltration in blood vessels, deposition of hemosiderin associated with the liver blood vessels and necrosis hepatocytes in the fatty liver tissue. The results concluded that the S. putrefaciens should be considered as an opportunistic pathogen for fish, which had caused fish infections, diseases with septicemia and mortality in O. niloticus.

  10. Transcriptome Profiling and Molecular Pathway Analysis of Genes in Association with Salinity Adaptation in Nile Tilapia Oreochromis niloticus.

    Directory of Open Access Journals (Sweden)

    Zhixin Xu

    Full Text Available Nile tilapia Oreochromis niloticus is a freshwater fish but can tolerate a wide range of salinities. The mechanism of salinity adaptation at the molecular level was studied using RNA-Seq to explore the molecular pathways in fish exposed to 0, 8, or 16 (practical salinity unit, psu. Based on the change of gene expressions, the differential genes unions from freshwater to saline water were classified into three categories. In the constant change category (1, steroid biosynthesis, steroid hormone biosynthesis, fat digestion and absorption, complement and coagulation cascades were significantly affected by salinity indicating the pivotal roles of sterol-related pathways in response to salinity stress. In the change-then-stable category (2, ribosomes, oxidative phosphorylation, signaling pathways for peroxisome proliferator activated receptors, and fat digestion and absorption changed significantly with increasing salinity, showing sensitivity to salinity variation in the environment and a responding threshold to salinity change. In the stable-then-change category (3, protein export, protein processing in endoplasmic reticulum, tight junction, thyroid hormone synthesis, antigen processing and presentation, glycolysis/gluconeogenesis and glycosaminoglycan biosynthesis-keratan sulfate were the significantly changed pathways, suggesting that these pathways were less sensitive to salinity variation. This study reveals fundamental mechanism of the molecular response to salinity adaptation in O. niloticus, and provides a general guidance to understand saline acclimation in O. niloticus.

  11. Alterações histológicas em brânquias de tilápia nilotica Oreochromis niloticus causadas pelo cádmio Histological alterations in gills of Nile tilapia Oreochromis niloticus caused by cadmium

    Directory of Open Access Journals (Sweden)

    S. Garcia-Santos

    2007-04-01

    Full Text Available Os efeitos histopatológicos do cádmio nas brânquias de tilápia Oreochromis niloticus foram estudados por microscopia óptica, usando 25mgl-1 de CdCl2 durante quatro dias, com o objetivo de identificar seus efeitos agudos na estrutura das brânquias. A morfologia geral das brânquias de O. niloticus é idêntica à de outros teleósteos, apresentando quatro pares de arcos branquiais com filamentos bem desenvolvidos. Situadas lateralmente, encontram-se as lamelas provenientes do eixo central dos filamentos. No epitélio filamentar foi possível identificar células de cloro, pavimentosas e mucosas. Os peixes expostos ao cádmio mostraram sinais de lesões epiteliais; edema intersticial, vasodilatação das lamelas, destacamento do epitélio lamelar e proliferação do epitélio filamentar. As alterações observadas também incluíram fusão nas lamelas como resultado de hiperplasia e hipertrofia epitelial, ruptura do sistema de células pilar, aneurismas e necroses.The histopathogical effects of cadmium on the gills of tilapia Oreochromis niloticus were studied by light microscopy, using 25mgl-1 of CdCl2 during four days to identified the effects of short-term exposure on gills structure. The general morphology of O. niloticus gills is similar to the other teleostean fishes, showing four pairs of gills arches with well developed filaments. Bilaterally situated, secondary lamellae branches are found from the central axis of the filaments. The filamentar epithelium showed the chloride cells, the pavement cells and mucous cells. Fish exposed to cadmium showed signs of epithelial lesion, namely the interstitial edema, swollen of the lamellae, lifting and cellular proliferation of the filamentar epithelium. The changes of the gills also included lamellar fusion as a result of epithelial hyperplasia and hypertrophy, the breakdown of pillar cell system, and aneurisms with some ruptures and necrosis, especially in the filamentar epithelium.

  12. Molecular identification and histopathological study of natural Streptococcus agalactiae infection in hybrid tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Laith Abdul Razzak

    2017-01-01

    Full Text Available Aim: The main objective of this study was to emphasize on histopathological examinations and molecular identification of Streptococcus agalactiae isolated from natural infections in hybrid tilapia (Oreochromis niloticus in Temerloh Pahang, Malaysia, as well as to determine the susceptibility of the pathogen strains to various currently available antimicrobial agents. Materials and Methods: The diseased fishes were observed for variable clinical signs including fin hemorrhages, alterations in behavior associated with erratic swimming, exophthalmia, and mortality. Tissue samples from the eyes, brain, kidney, liver, and spleen were taken for bacterial isolation. Identification of S. agalactiae was screened by biochemical methods and confirmed by VITEK 2 and 16S rRNA gene sequencing. The antibiogram profiling of the isolate was tested against 18 standard antibiotics included nitrofurantoin, flumequine, florfenicol, amoxylin, doxycycline, oleandomycin, tetracycline, ampicillin, lincomycin, colistin sulfate, oxolinic acid, novobiocin, spiramycin, erythromycin, fosfomycin, neomycin, gentamycin, and polymyxin B. The histopathological analysis of eyes, brain, liver, kidney, and spleen was observed for abnormalities related to S. agalactiae infection. Results: The suspected colonies of S. agalactiae identified by biochemical methods was observed as Gram-positive chained cocci, β-hemolytic, and non-motile. The isolate was confirmed as S. agalactiae by VITEK 2 (99% similarity, reconfirmed by 16S rRNA gene sequencing (99% similarity and deposited in GenBank with accession no. KT869025. The isolate was observed to be resistance to neomycin and gentamicin. The most consistent gross findings were marked hemorrhages, erosions of caudal fin, and exophthalmos. Microscopic examination confirmed the presence of marked congestion and infiltration of inflammatory cell in the eye, brain, kidney, liver, and spleen. Eye samples showed damage of the lens capsule

  13. Influence of stocking density on growth performance and welfare of juvenile tilapia ( Oreochromis niloticus in cages

    Directory of Open Access Journals (Sweden)

    Â.A.P. Costa

    Full Text Available RESUMO A intensificação da produção de tilápias pode gerar implicações negativas sobre o desempenho e o bem-estar dos peixes. Assim, é essencial determinar a densidade correta para otimizar a produção. O objetivo deste estudo foi avaliar o desempenho e o bem-estar de tilápias-do-nilo (Oreochromis niloticus juvenis, com peso inicial médio de 30g (± 2,70, criadas em três diferentes densidades de estocagem, em gaiolas de flutuação. Os peixes foram alimentados três vezes/dia, com ração contendo 32% de proteína bruta, durante 74 dias. O desenho experimental foi completamente ao acaso, com três tratamentos (250 peixes/m3, 350 peixes/m3 e 450 peixes/m3 e quatro réplicas. Os parâmetros físico-químicos da água foram monitorados durante o experimento. A elevação da densidade de criação causou redução no peso final dos peixes, no ganho de peso, no ganho de peso diário, no comprimento padrão e na taxa de sobrevivência, bem como elevou a taxa de conversão alimentar. Entretanto, densidades mais elevadas reduziram o efeito na variação de peso. Não houve influência da densidade de criação nos parâmetros de biomassa final, da concentração de glicose sanguínea e de cortisol sérico. Portanto, o aumento na densidade de criação compromete o desenvolvimento e a taxa de sobrevivência dos peixes, mas não influencia os parâmetros fisiológicos de estresse. Assim, o tratamento com 250 peixes/m3 apresentou resultados mais apropriados ao melhor desempenho dos peixes.

  14. Prebiotic (Mannanoligosaccharide- MOS in fish nutrition: effects on nile-tilapia Oreochromis niloticus performance

    Directory of Open Access Journals (Sweden)

    Flávio Endrigo Cechim

    2012-12-01

    Full Text Available World fish production are growing about 10% a year and Brazil presents potential to be the first one in fish production until 2030. However, intensification of aquaculture production systems expose fish to numerous stressors such as poor water quality, crowding, handling and transport which may negatively affect their growth and and limit profitability of aquaculture systems. This current setup favors the use of dietary prebiotics for management of farmed fish as environmentally friendly practice. This study was set out to determine de effects of increasing levels of mannanoligosccharides (MOS on growth of juvenile Nile tilapia (Oreochromis niloticus. Fish (12.62 ± 0.38 were randomly distributed into 16 cages (0.25m3 polyvinyl chloride; 20 fish per cage, inside four 5m3 net-cage at Salto Caxias Hydroeletric water reservoir (Boa Vista da Aparecida, PR. Fish were fed during 60 days with a commercial diet (32%CP supplemented with 0.0 (control; 0.2; 0.4 and 0.8% dietary MOS (n=4. Water quality parameters (temperature, pH and dissolved oxygen were monitored during trial. After 60 days feeding trial, fish were fasted for 24 hours and sedated for biometrical parameters to evaluate growth parameters. It was observed no influence (p>0.05 of MOS supplementation on Nile tilapia growth parameters (weight gain, feed conversion rate, specific growth rate as well as for hepatosomatic index. Fish fed 0.4% dietary MOS showed increased (p<0.05 feed consumption (76.74 ± 3.98 when compared to fish fed control (unsupplemented diet (69.31 ± 1.11. MOS are indigestible glucomannoproteins, which provide mannose substrate upon which pathogenic gut bacteria selectively attach and prevents formation of mixed colonies leading to better gut health by increasing regularity, height and integrity of the gut villi and consequent better utilization and absorption of nutrients. Several authors found positive effects of MOS supplementation on fish growth and at same time, others

  15. Functionality and Antioxidant Properties of Tilapia (Oreochromis niloticus) as Influenced by the Degree of Hydrolysis

    Science.gov (United States)

    Foh, Mohamed Beva Kelfala; Amadou, Issoufou; Foh, Betty Mabel; Kamara, Mohamed Tabita; Xia, Wenshui

    2010-01-01

    Freeze dried protein powders (Fresh minced meat, FMM and Hot water dip, HWD) from tilapia (Oreochromis niloticus) were hydrolyzed by Alcalase 2.4 L (Alc), Flavourzyme (Flav) and Neutrase (Neut), and investigated for antioxidant activity and their functional properties. FMM and HWD hydrolysed by Alc, exhibiting superior antioxidant activity, had estimated degrees of hydrolysis (DH) of 23.40% and 25.43%, respectively. The maximum values of the 1,1-diphenyl-2-picrylhydrazyl (DPPH), 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 3-(2-pyridyl) 5,6-bis(4-phenyl-sulphonic acid)-1,2,4-triazine (ferrozine), radical scavenging activities and metal chelating properties were 86.67%, 91.27% and 82.57%, and 84.67%, 92.60% and 78.00% for FMM and HWD, respectively, with a significant difference (P 8,000 Da. At pH 2, FMM and HWD hydrolysates have varying solubilities above 85% (Alc FMM; 91.33%, Flav FMM; 79.5%, Neut FMM; 83.8% and Alc HWD; 90.45%, Flav HWD; 83.5%, and Neut HWD; 85.8%). They have ‘U’ shaped solubility curves, water holding capacity was in the range of 2.77 and 1.77 mL/g, while oil holding capacity ranged between 3.13 and 2.23 mL/g. FMM and HWD have the highest bulk density of 0.53 and 0.53 for Neutrase and Alcalase 2.4 L, respectively. Foam capacity and stability ranged from 125.5 to 61.4, 138.5 to 45.2, 130.0 to 62.5, and 124.5 to 55.0, 137.5 to 53.3, 129.6 to 62.7 for FMM and HWD hydrolyzed with Alcalase 2.4 L, Flavourzyme and Neutrase, respectively. Tilapia fish protein hydrolysates are thus potential functional food ingredients. PMID:20480046

  16. Functionality and Antioxidant Properties of Tilapia (Oreochromis niloticus as Influenced by the Degree of Hydrolysis

    Directory of Open Access Journals (Sweden)

    Mohamed Tabita Kamara

    2010-04-01

    Full Text Available Freeze dried protein powders (Fresh minced meat, FMM and Hot water dip, HWD from tilapia (Oreochromis niloticus were hydrolyzed by Alcalase 2.4 L (Alc, Flavourzyme (Flav and Neutrase (Neut, and investigated for antioxidant activity and their functional properties. FMM and HWD hydrolysed by Alc, exhibiting superior antioxidant activity, had estimated degrees of hydrolysis (DH of 23.40% and 25.43%, respectively. The maximum values of the 1,1-diphenyl-2-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS, 3-(2-pyridyl 5,6-bis(4-phenyl-sulphonic acid-1,2,4-triazine (ferrozine, radical scavenging activities and metal chelating properties were 86.67%, 91.27% and 82.57%, and 84.67%, 92.60% and 78.00% for FMM and HWD, respectively, with a significant difference (P < 0.05 between the samples. Essential amino acids were above the amounts recommended by the Food and Agricultural Organization/World Health Organization (FAO/WHO/UNU for humans. Lower molecular weight sizes 8,000 Da. At pH 2, FMM and HWD hydrolysates have varying solubilities above 85% (Alc FMM; 91.33%, Flav FMM; 79.5%, Neut FMM; 83.8% and Alc HWD; 90.45%, Flav HWD; 83.5%, and Neut HWD; 85.8%. They have ‘U’ shaped solubility curves, water holding capacity was in the range of 2.77 and 1.77 mL/g, while oil holding capacity ranged between 3.13 and 2.23 mL/g. FMM and HWD have the highest bulk density of 0.53 and 0.53 for Neutrase and Alcalase 2.4 L, respectively. Foam capacity and stability ranged from 125.5 to 61.4, 138.5 to 45.2, 130.0 to 62.5, and 124.5 to 55.0, 137.5 to 53.3, 129.6 to 62.7 for FMM and HWD hydrolyzed with Alcalase 2.4 L, Flavourzyme and Neutrase, respectively. Tilapia fish protein hydrolysates are thus potential functional food ingredients.

  17. Nutritional value of Prosopis juliflora Pods in feeding Nile Tilapia (Oreochromis niloticus) Fries

    International Nuclear Information System (INIS)

    Mabrouk, H.; Hilmi, E.; Abdullah, M.

    2008-01-01

    A feeding experiment was conducted to study the effect of different levels of supplemental Prosopis juliflora on growth performance, feed utilization and chemical composition of Nile tilapia (Oreochromis niloticus) fry (1.36+-0.004). Six isonitrigenous (30.46g 100g-1 crude protein) and isocalorific (0.018 NJ g-1) diets were formulated. Diet 1 (control without supplementing P. juliflora), and diets 2, 3, 4, 5 and 6 were supplemented with different levels (20, 40, 60, 80and 100 g Kg-1) of P. juliflora respectively. The results revealed that harvested gain (g fish-1) was significantly higher (P 0 .05) for fish fed 60g Kg-1 P. juliflora, while the lowest value of harvested gain was achieved with fish fed free. P. juliflora control diet. Despite that the fish fed diet (4) obtained the highest harvesting weight, weight gain, average daily gain and specific growth rate, no significant differences (P<0.05) were observed in an average daily gain (g fish-1 day-1) between fish fed diet 3, 4, 5 and 6 and in specific growth rate (% day-1) when inclusion level of P. juliflora was increased from 20 to 40 g kg-1 in diets 2 and 3 and from 80 to 100g kg-1 in diets 5 and 6, respectively. Feed intake was increased significantly (P<0.05) with in increasing P. juliflora inclusion level in the experimental diets. No significant differences were observed between the experimental fish groups in FCR in spite of the occurrence of a slight decreasing up to 80g kg-1 and PER. Protein productive value (PPV g 100g-1) and energy utilization (EUg 100g-1) were increased significantly (P<0.05) with increasing P. juliflora inclusion level in the experimental diets up to 60g kg-1 and then decreased significantly (P<0.05). Fish whole body composition of dry matter and protein were significantly (P<0.05) affected by using P. juliflora in fish diets. Fish fed diet 4 achieved the highest values of dry matter and crude protein. The results suggested that diet supplemented with 60g kg-1 P. juliflora improved

  18. Impact of replacing fish meal by a mixture of different plant protein sources on the growth performance in Nile Tilapia (Oreochromis niloticus L.) diets

    OpenAIRE

    A. Al-Thobaiti; K. Al-Ghanim; Z. Ahmed; E. M. Suliman; S. Mahboob

    2017-01-01

    Abstract The present study aimed to assess the appropriate level of replacement of fish meal (FM) with alternative plant sources in the feed fed to Oreochromis niloticus to evaluate the growth performance. Three isoproteinious (40% crude protein) diets were prepared from different ingredients viz., fish meal, corn gluten meal, wheat gluten meal, and bagasse kenna meal. O. niloticus showed a maximum increase in weight as 9.70, 11.09, 8.53 and 8.32 g during the 2nd, 2nd, 3rd and 2nd fortnight w...

  19. Análisis técnico de producción de tilapia Oreochromis niloticus y lechuga acrópolis Lactuca sativa en acuaponia

    OpenAIRE

    Rubio Cabrera, Sheila Guadalupe

    2014-01-01

    Se evaluó la producción de tilapia Oreochromis niloticus y lechuga romana acropolis Lactuca sativa en sistemas acuapónicos utilizando dos sistemas: recirculación de agua sin recambio (utilizando biofiltración) y sistema sin recirculación con recambio parcial de agua. El cultivo se realizó en 4 etapas. En la primera se colocaron 800 alevines de O. niloticus de 0.2 g de peso inicial en tinas plásticas de 800 L (1600 organismos/m3de agua) durante 39 días. La segunda etapa con u...

  20. Effect of dietary probiotic dose and duration on immune and oxidative stress parameters in juvenile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Maria Amélia Ramos

    2014-06-01

    Full Text Available Probiotics, “living organisms, which when administered in adequate amounts confer a health benefit to the host”, can contribute to a more sustainable aquaculture. Their administration through the diet or raising water can modulate the host immune status, improving their resistance towards infection. The antioxidant defence system of the organism is strongly related to immune system and previous studies reported enhancement in antioxidant status of shrimps and fish after probiotic administration, contributing to enhanced resistance towards infections. Nevertheless the information on oxidative stress parameters after probiotic administration in fish is still limited. The present work evaluates the effects of dietary probiotics supplementation on innate immune and oxidative stress parameters in juvenile Nile tilapia (Oreochromis niloticus. A standard diet (27.5% CP, 8.2% CL, 19.6MJ.kg-1 DM was supplemented with a commercial multi-species probiotic (Bacillus sp., Pedicoccus sp., Enterococcus sp., Lactobacillus sp. at two concentrations: A1 (3 g.kg-1; 9 × 105 CFU.g-1 and A2 (6 g.kg-1; 2 × 106 CFU.g-1 and tested against an unsupplemented diet (A0. Fish (12.8 g were hand-fed the experimental diets (3 tanks/treatment; 20 animals per tank, 3 times a day, until visual satiation for 8 weeks. Animals were reared at 24ºC in a closed recirculating freshwater system. During the experiment, at 2, 4 and 8 weeks, blood, head-kidney and liver were sampled to study the following immunological and oxidative stress parameters: plasma lysozyme and alternative complement pathway activity (expressed as ACH50, respiratory burst activity and nitric oxide production of head-kidney leucocytes and liver lipid peroxidation (LPO, catalase (CAT, total glutathione (TG, glutathione peroxidase (GPX, and glutathione reductase (GR activities. Respiratory burst activity and nitric oxide production in head-kidney leucocytes were not significantly affected by probiotic treatment

  1. Qualidade do sêmen em tilápia do Nilo (Oreochromis niloticus, alimentadas com dietas contendo diferentes níveis de vitamina C = Semen quality in Nile tilapia (Oreochromis niloticus, fed with diets containing different vitamin C levels

    Directory of Open Access Journals (Sweden)

    Marcela Mataveli

    2010-07-01

    Full Text Available A vitamina C atua na proteção de danos celulares provocados pelos radicais livres, sendo a suplementação considerada essencial para a maioria das espécies de peixes, uma vez que não a sintetizam em função da ausência da enzima L-gulonolactona oxidase. Assim, avaliou-se o efeito da suplementação de 0, 75, 150 e 225 mg de vitamina C kg-1 de ração na qualidade do sêmen em tilápias do Nilo (Oreochromis niloticus. Os parâmetros quali-quantitativos do sêmen não foram influenciados pela suplementação de vitamina C, exceto a motilidade progressiva que aumentou linearmente com adição de vitamina C. Conclui-se que os reprodutores de tilápias do Nilo devem ser suplementados com 225 mg de vitamina C kg-1 de ração.Vitamin C acts as cellular protection from damage by free radicals, and vitamin C supplementation is considered essential for most fish species, as they do not synthesize it due to the absence of enzyme L-gulonolactone oxidase. Thus, the effect of supplementation with 0, 75, 150 and 225 mg of vitamin C kg-1 of ration was evaluated in the semen quality in Nile tilapia (Oreochromis niloticus. Seminal parameters were not influenced by vitamin C supplementation except progressive motility, which increased linearly with the addition of vitamin C. It was concluded that Nile tilapia reproducers should be supplemented with 225 mg vitamin C kg-1 ration.

  2. Bioactivity of crude ethanol extract and fractions of Eugenia uniflora (Myrtaceae) in the hepatopancreas of Oreochromis niloticus L.

    Science.gov (United States)

    Fiuza, Tatiana S; Silva, Paulo C; De Paula, José R; Tresvenzol, Leonice M F; Sabóia-Morais, Simone M T

    2009-01-01

    This study evaluates the bioactivity of the crude ethanol extract and ethyl acetate, hexane and chloroform fractions obtained from Eugenia uniflora leaves using the hepatopancreas of Oreochromis niloticus L. as an experimental model. The ethanol extract and fractions were administered to the fish orally with their feed. Twenty-four hours later, the fish were sacrificed and their livers dissected, fixed in neutral formalin, embedded in paraffin and sectioned. Histological analyses were performed using Masson's trichrome and Haematoxylin-Eosin. Histochemical studies were performed using Feulgen, PAS (Periodic Acid Schiff) and PAS + salivary amylase and Sudan IV stain. The qualitative analysis of the material showed that the crude extract and the ethyl, chloroform and hexane fractions induced vasodilation, vascular congestion and toxicity due to the presence of eosinophilic granular cells, rodlet cells, some leukocytic infiltrate and rare focal necroses. The Nile tilapia proved to be a satisfactory model for screening plant products.

  3. Tissue Alterations in Oreochromis niloticus Following Chronic Exposure to Metal Complex Dark Green Azo Acid Dye and Anionic Surfactant Oil

    Directory of Open Access Journals (Sweden)

    Hilma Rantilla Amwele

    2017-03-01

    Full Text Available Gill, liver and kidney tissues in Oreochromis niloticus underwent histological alterations during a 90-day chronic exposure to metal complex dark green azo acid dye; anionic surfactant oil or mixtures of the two substances. Gill alterations following these chronic exposures included primary lamellae lifting, epithelial hypertrophy, secondary lamellae hyperplasia, secondary lamellae tip fusion, lamellae aneurysm and fusion, edema and blood congestion, all reflective of impaired metabolism and ion exchange. Liver alterations included cytoplasm degeneration, dilated sinusoid blood vessels, pyknotic nuclei, karyolysis, cytoplasm vacuolation and blood congestion suggesting reduced detoxification function. Kidney changes included tubule degeneration, dilation of glomeruli capillaries and Bowman’s space indicating excretory difficulties. Necrotic kidney tissue was found in fish exposed to 6 mg/L metal complex dark green azo acid dye. Histological examination of tissues following chronic exposures to toxic substances facilitates early diagnosis and understanding of the mechanisms by which substances impose harmful effects on organisms.

  4. Induction of micronuclei and nuclear abnormalities in Oreochromis niloticus following exposure to petroleum refinery and chromium processing plant effluents

    Energy Technology Data Exchange (ETDEWEB)

    Cavas, Tolga [Mersin University, Faculty of Sciences and Letters, Department of Biology, 33342 Mersin (Turkey)]. E-mail: tcavas@mersin.edu.tr; Ergene-Goezuekara, Serap [Mersin University, Faculty of Sciences and Letters, Department of Biology, 33342 Mersin (Turkey)

    2005-09-10

    The genotoxic effects of effluents from a petroleum refinery and a chromium processing plant were evaluated in Oreochromis niloticus (Pisces: Perciformes) using the micronucleus test. Fish were exposed to different concentrations (5, 10 and 20%, v/v) of the effluents for 3, 6 and 9 days. Micronucleus analyses were carried out on gill epithelial cells and peripheral blood erythrocytes. Nuclear abnormalities other than micronuclei, considered as genetic damage indicators, were also evaluated on erythrocytes. Cyclophosphamide at a single dose of 4 mg/L was used as a positive control. The results of this study showed that both effluents had genotoxic potential. On the other hand, the level of genetic damage induced by petroleum refinery effluent was considerably higher than that of chromium processing plant effluent. Our results further indicate that nuclear abnormalities other than micronuclei, such as blebbed and lobed nuclei, may also be used as indicators of genotoxic damage.

  5. First report of Streptococcus agalactiae isolated from Oreochromis niloticus in Piura, Peru: Molecular identification and histopathological lesions

    Directory of Open Access Journals (Sweden)

    Yessica Ortega Asencios

    2016-11-01

    Full Text Available The aim of this study was to identify the bacterium Streptococcus agalactiae isolated in farmed Nile tilapia (Oreochromis niloticus from Piura, Peru and to characterize the histopathological lesions caused by this pathogen. Sixteen tilapias were sampled with clinic signs of the disease such as erratic swimming, exophthalmia and haemorrhages on the body and fins. Qualitative PCR in real time and histopathological analysis were performed. Nine fishes positives to S. agalactiae were found. The main histopathological findings were fibrinosuppurative epicarditis, periesplenitis, meninigitis and panophtaltmitis with predominance of mononuclear infiltration in all tissues. The correlation between qPCR and histopathological findings demonstrated nine fish (prevalence of 56.25% with Cq lower than 30, associated to high degree of tissue injuries. This study reports the first isolation of S. agalactiae by PCR in real time in tilapia farmed in Peru and characterizes the major histopathological changes caused by this bacterium.

  6. Risk assessment, bioaccumulation of metals and histopathological alterations in Nile tilapia (Oreochromis niloticus) facing degraded aquatic conditions.

    Science.gov (United States)

    Abdel-Khalek, Amr A

    2015-01-01

    Two sampling sites contaminated with high aqueous metal concentrations in the vicinity of metal-related factories (site2) and 7 km downstream (site3) were selected along river Nile. These sites were compared to reference fish farm (site1) that fed on unpolluted water source. Bioaccumulation of metals (Cu, Zn, Pb, Fe, Mn and Cd) in Oreochromis niloticus showed a tissue-specific pattern with high rate of accumulation in gills, liver and kidney. The lowest concentrations of almost all metals were observed in muscle. The accumulated pattern was confirmed by histopathological examination of gills, liver and kidneys. Tissues from site2 and 3 revealed various histopathological alterations ranging from compensatory histological changes to histological damage. Evaluation of human health hazard using metals hazard index values in skin and muscle showed that all metals were in the safe limits for human intake except in the case of zinc and cadmium in skin at subsistence consumption level.

  7. Parasites of native Cichlidae populations and invasive Oreochromis niloticus (Linnaeus, 1758) in tributary of Amazonas River (Brazil).

    Science.gov (United States)

    Bittencourt, Luana Silva; Pinheiro, Douglas Anadias; Cárdenas, Melissa Querido; Fernandes, Berenice Maria; Tavares-Dias, Marcos

    2014-03-01

    This study provides the first investigation on acquisition of parasites in invasive O. niloticus by parasite species of native Cichlidae from the Igarapé Fortaleza basin, Northern Brazil. There were examined 576 specimens of 16 species of native cichlids and invasive O. niloticus collected in the main channel and the floodplain area of this tributary of Amazon River. The invasive O. niloticus was poorly parasitized having only Ichthyophthirius multifiliis, Trichodina centrostrigeata, Paratrichodina africana, Trichodina nobilis (Protozoa) and Cichlidogyrus tilapiae (Monogenoidea), and this host has not acquired any parasite species common to the native ichthyofauna region. In contrast, species of native cichlids showed rich fauna of parasites with predominance of Monogenoidea species, larvae and adults of Nematoda, Digenea, Cestoidea and Acanthocephala, besides four species of Protozoa and four Crustacea. However, only T. nobilis was acquired by native fish, the Aequidens tetramerus, which is a new host for this exotic Trichodinidae. In O. niloticus, well established in the region, the small number of helminth species may be associated with its rusticity, good adaptation in the new environment and also the presence of native parasites with relative specificity, but without ability to complete its life cycle in this invasive host of this ecosystem.

  8. Parasites of native Cichlidae populations and invasive Oreochromis niloticus (Linnaeus, 1758 in tributary of Amazonas River (Brazil

    Directory of Open Access Journals (Sweden)

    Luana Silva Bittencourt

    Full Text Available This study provides the first investigation on acquisition of parasites in invasive O. niloticus by parasite species of native Cichlidae from the Igarapé Fortaleza basin, Northern Brazil. There were examined 576 specimens of 16 species of native cichlids and invasive O. niloticus collected in the main channel and the floodplain area of this tributary of Amazon River. The invasive O. niloticus was poorly parasitized having only Ichthyophthirius multifiliis, Trichodina centrostrigeata, Paratrichodina africana, Trichodina nobilis (Protozoa and Cichlidogyrus tilapiae (Monogenoidea, and this host has not acquired any parasite species common to the native ichthyofauna region. In contrast, species of native cichlids showed rich fauna of parasites with predominance of Monogenoidea species, larvae and adults of Nematoda, Digenea, Cestoidea and Acanthocephala, besides four species of Protozoa and four Crustacea. However, only T. nobilis was acquired by native fish, the Aequidens tetramerus, which is a new host for this exotic Trichodinidae. In O. niloticus, well established in the region, the small number of helminth species may be associated with its rusticity, good adaptation in the new environment and also the presence of native parasites with relative specificity, but without ability to complete its life cycle in this invasive host of this ecosystem.

  9. Efficacy of oxytetracycline and potentiated sulphonamide oral therapies against Aeromonas hydrophila infection in Nile tilapia Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Thangapalam Jawahar Abraham

    2017-09-01

    Full Text Available Objective: To assess the efficacy of feeds containing approved antibiotics, viz., oxytetracycline (OTC or potentiated sulphonamide [(sulphamethoxazole-trimethoprim SMZ-TMP] at 1 g, 2 g, 3 g and 4 g of respective antibiotics/kg feed at 2% body weight ration in preventing the Aeromonas hydrophila (A. hydrophila infection in Oreochromis niloticus. Methods: Commercial pellet feed was top dressed with respective antibiotics using 5 mL vegetable oil as a binder. Fish were injected intramuscularly with A. hydrophila at ≈ 6.0 × 107 –8.6 × 107 CFU/fish, and fed subsequently with OTC and SMZ-TMP feeds for 10 and 5 days, respectively. Fish mortalities were recorded during the pre-treatment, treatment and post- treatment periods. Results: Highest mortalities (7.42%–8.33% were observed in challenged and untreated fish. The mortalities observed in fish fed with OTC or SMZ-TMP were 0%–6.66% with decreasing concentrations of antibiotics from 4 to 1 g/kg feed. Significant differences existed in the mortalities among fish fed with different doses of antibiotics (P < 0.05. The relative percent survival values were 20, 40, 40 and 60 for 1 g, 2 g, 3 g and 4 g OTC/kg feed groups, respectively; while in SMZ-TMP fed fish, the respective relative percent survival values were 10, 100, 100, and 100. Conclusions: The fish fed with feed containing 2 g antibiotic/kg at 2% body weight was the lowest concentration that recorded significantly lower mortality (P < 0.05, which could be the treatment of choice for the control of A. hydrophila in Oreochromis niloticus in tropical condition.

  10. Effects of dietary inclusions of oilseed meals on physical characteristics and feed intake of diets for the Nile Tilapia, Oreochromis niloticus

    DEFF Research Database (Denmark)

    Obirikorang, Kwasi Adu; Amisah, Stephen; Fialor, Simon Cudjoe

    2015-01-01

    The present study investigated the effects of the inclusion of three oilseed by-products (soybean, copra and palm kernel meals) on some physical characteristics of pelletized feeds as well as on voluntary feed intake and faecal matter production by the Nile tilapia, Oreochromis niloticus. The die......The present study investigated the effects of the inclusion of three oilseed by-products (soybean, copra and palm kernel meals) on some physical characteristics of pelletized feeds as well as on voluntary feed intake and faecal matter production by the Nile tilapia, Oreochromis niloticus......) was significantly higher in the tilapia groups fed the copra and palm kernel meals. The results obtained from this study show that 30% inclusions of unrefined forms of copra and palm kernel meal in Nile tilapia diets is possible, without adversely affecting feed intake or pellet nutrient losses prior to ingestion....

  11. Biosécurité et productivité du tilapia du Nil Oreochromis niloticus (Linnaeus, 1958 élevé en zone rurale ivoirienne

    Directory of Open Access Journals (Sweden)

    Kone, M.

    2012-01-01

    Full Text Available Biosecurity and Productivity of Nile Tilapia Oreochromis niloticus (Linnaeus, 1958 Bred in Ivoirian's Rural Zone. Fingerlings of tilapia Oreochromis niloticus were bred in three types of fish farming of rural zone in Ivory Coast to determine impacts of the compliance of biosecurity measures on zootechnical parameters of these bred fishes. Fish farming were shared out in three types of farming based on the value of biosecurity measures compliance, which were 5%, 55%, and 83%. No significant differences were observed between mean values of physic and chemical parameters of ponds water from three types of fish farming. Concerning mean values of zootechnical parameters, the fish breeding with 83% of rate compliance of biosecurity measures had registered better values of zoo technical performance with significant differences compared with others types of fish farming.

  12. [Centrocestus formosanus (Opisthorchiida: Heterophyidae) as a cause of death in gray tilapia fry Oreochromis niloticus (Perciforme: Cichlidae) in the dry Pacific of Costa Rica].

    Science.gov (United States)

    Arguedas Cortés, Donald; Dolz, Gaby; Romero Zúñiga, Juan J; Jiménez Rocha, Ana E; León Alán, Dennis

    2010-12-01

    Centrocestusformosanus is a zoonotic trematode from Asia and has been mainly associated as cause of death of cultured fish. To identify pathogen trematode species in tilapia fry (Oreochromis niloticus) and to determine mollusks hosting these parasites, freshwater mollusks were collected from tilapia cultured ponds and experimental infections were carried out with tilapia fries and different mollusk species. A total of 907 freshwater mollusks were obtained from tilapia ponds and were identified to species level, four gastropods and one bivalve were determined: Melania tuberculata, Melanoides turricula, Pomacea flagellata, Haitia cubensis and Anodontiles luteola. For the first time, the presence of M. turricula and H. cubensis are reported in Costa Rica. Seven morphotypes of cercariae (Xifiodiocercaria, Equinostoma, Oftalmocercaria, Parapleurolofocercus, Cistocerca, Furcocercaria and Leptocercaria) parasitizing all five species of mollusks were found, all of distome type. Experimental exposure of tilapia fry to M. tuberculata demonstrated that the parapleurolofocercus morphotype found in the mollusk is in accordance with the finding of C. formosanus in tilapia fry. An abundance and mean intensity of 1018-1027 digeneans per gill in each exposed fish was determined. Centrocestus formosanus is reported for the first time in Costa Rica, for which the primary and secondary intermediate hosts were also determined.

  13. Occurrence and antibiotic susceptibility of fish bacteria isolated from Oreochromis niloticus (Nile tilapia and Clarias gariepinus (African catfish in Uganda

    Directory of Open Access Journals (Sweden)

    S. P. Wamala

    2018-02-01

    Full Text Available Abstract The intention of this study was to identify the bacterial pathogens infecting Oreochromis niloticus (Nile tilapia and Clarias gariepinus (African catfish, and to establish the antibiotic susceptibility of fish bacteria in Uganda. A total of 288 fish samples from 40 fish farms (ponds, cages, and tanks and 8 wild water sites were aseptically collected and bacteria isolated from the head kidney, liver, brain and spleen. The isolates were identified by their morphological characteristics, conventional biochemical tests and Analytical Profile Index test kits. Antibiotic susceptibility of selected bacteria was determined by the Kirby-Bauer disc diffusion method. The following well-known fish pathogens were identified at a farm prevalence of; Aeromonas hydrophila (43.8%, Aeromonas sobria (20.8%, Edwardsiella tarda (8.3%, Flavobacterium spp. (4.2% and Streptococcus spp. (6.3%. Other bacteria with varying significance as fish pathogens were also identified including Plesiomonas shigelloides (25.0%, Chryseobacterium indoligenes (12.5%, Pseudomonas fluorescens (10.4%, Pseudomonas aeruginosa (4.2%, Pseudomonas stutzeri (2.1%, Vibrio cholerae (10.4%, Proteus spp. (6.3%, Citrobacter spp. (4.2%, Klebsiella spp. (4.2% Serratia marcescens (4.2%, Burkholderia cepacia (2.1%, Comamonas testosteroni (8.3% and Ralstonia picketti (2.1%. Aeromonas spp., Edwardsiella tarda and Streptococcus spp. were commonly isolated from diseased fish. Aeromonas spp. (n = 82 and Plesiomonas shigelloides (n = 73 were evaluated for antibiotic susceptibility. All isolates tested were susceptible to at-least ten (10 of the fourteen antibiotics evaluated. High levels of resistance were however expressed by all isolates to penicillin, oxacillin and ampicillin. This observed resistance is most probably intrinsic to those bacteria, suggesting minimal levels of acquired antibiotic resistance in fish bacteria from the study area. To our knowledge, this is the first study to

  14. Characterization of the microbiota of the skin and oral cavity of Oreochromis niloticusCaracterização da microbiota da pele e cavidade oral de Oreochromis niloticusdoi:10.12662/2317-3076jhbs.v4i3.767.p193-197.2016

    Directory of Open Access Journals (Sweden)

    Edmar Maciel Lima Junior

    2016-09-01

    Full Text Available Introduction: Fish are usually exposed to higher microbial loads than land or air animals. The microbiota of fish mostly consists of Pseudomonas spp., Aeromonas spp., Shewanella putrefasciens, Acinetobacter spp. and Moraxella spp. The objective of this study was to analyze the oral cavity, and skin tissue microbiota on the Nile tilapia (Oreochromis niloticus, a fish species raised commercially in Brazil. Methods: Samples were collected from the oral cavity and skin of 20 Nile tilapia specimens (Oreochromis niloticus, each weighing approximately 1,000 grams. The samples were cultures for quantitative analysis on sheep blood agar (SBA and chromID™ CPS® agar (CPS. Results: Eleven different bacterial species were identified on CPS and SBA plates. Gram-negative species were the most prevalent, while gram-positive Globicatella spp, Streptococcus spp and Enterococcus faecalis were also found. Pseudomonas aeruginosa species were isolated from all samples. Gram-positive Enterococcus faecalis was found in 70 and 60% of the skin and oral samples, respectively. Conclusion: For all samples studied, the microbial load was less than 100,000 CFU/g of tissue. This value is a cutoff standardized for the American Society of Microbiology to differentiate the causal agent from the colonizers. In light of this result and considering the absence of infectious signs in the fish samples, we conclude that the CFU values found in this study reflect a normal, non-infectious colonization/microbiota.

  15. Determining the safety and suitability of fluorescein dye for characterization of skin ulcerations in cultured Nile tilapia (Oreochromis niloticus and African sharptooth catfish (Clarias gariepinus

    Directory of Open Access Journals (Sweden)

    Mai D. Ibrahem

    2010-10-01

    Full Text Available There is a need to identify the presence of lesions in fish skin as soon as they erupt. Fish skin lesions are either macroscopic (can be visualized by the naked eye or microscopic (difficult to detect with the naked eye. Skin wounds resulting in loss of the epithelium (superficial or deep ulcers are serious as they may interfere with osmoregulation and open portals for opportunistic pathogens. Herein, we report on the use of a fluorescein dye for the detection of skin ulcers that cannot be seen by the naked eye. Due to their importance in aquaculture endeavors in Egypt, this study focused on two indigenous species, the Nile tilapia (Oreochromis niloticus and the scale-less African sharptooth catfish (Clarias gariepinus. Fluorescein dye was tested for safety to fish without interfering with microbiological analysis. Parallel to the use of the flourescein dye, the detected ulcers were examined for the presence of bacteria or tissue alterations. Further, we experimentally induced the formation of skin ulcers in O. niloticus physically or by injecting Aeromons hydrophila, and then assessed the utility of fluorescein dye in detecting the induced skin lesions. Results obtained in this study demonstrated that fluorescein dye application is harmless to Nile tilapia at concentrations up to 0.5 mg fluorescein/ml water for up to 15 min. Indeed, a low dose of fluorescein (0.10 mg/ml for 5 min could identify very minute skin abrasions. We highly recommend the use of fluorescein dye for the evaluation of skin health in farmed fish species and the visualization of minute skin abrasions.

  16. Características morfológicas do desenvolvimento ovariano de duas linhagens de tilápia-do-nilo (Oreochromis niloticus), em sistemas de cultivo misto

    OpenAIRE

    Neves, P.R.; Natali, M.R.M.; Ribeiro, R.P.; Vargas, L.; Maehana, K.R.; Marengoni, N.G.

    2009-01-01

    This study was carried out to morphologically characterize and classify the stages of gonad development in different Nile tilapia strains (Oreochromis niloticus). Eighty-four and ninety-two ovaries from Bouaké and Chitralada strains, respectively, were evaluated at different ovarian developmental phases: initial (104 days of culture), intermediate (152 days of culture), and the final (279 days of culture). The ovaries were microscopically evaluated and submitted to histological processing and...

  17. Mixtures of diflubenzuron and p-chloroaniline changes the activities of enzymes biomarkers on tilapia fish (Oreochromis niloticus) in the presence and absence of soil.

    Science.gov (United States)

    Dantzger, Darlene D; Jonsson, Claudio M; Aoyama, Hiroshi

    2018-02-01

    The insecticide Diflubenzuron (DFB), used by many fish farming, when metabolized or degraded produces the extremely toxic compound p-chloroaniline (PCA). Once in the aquatic environment, these compounds can form mixtures and their bioavailability depends on factors such as the presence of soil. The toxic effects of the isolated compounds and their mixtures in the proportions: 75%, 50%, and 25% of PCA were analyzed in tilapia (Oreochromis niloticus) in the presence and absence of soil after 96h. The enzymes catalase (CAT), acid (AcP) and alkaline (AlP) phosphatases and alanine (ALT) and aspartate (AST) aminotransferases of the liver of the tilapia (Oreochromis niloticus) were used as biomarkers. DFB and the mixture containing 75% of this compound did not present high toxicity to fish; however, 25mg/L of PCA alone and 15mg/L of the mixture with 75% of this compound promoted 50% mortality of tilapia (Oreochromis niloticus). In the presence of soil, these toxicity values decreased to 37 and 25mg/L, respectively. Independent of the presence of soil, a synergistic effect was observed when the proportion of PCA was 75% and to the mixture, with 25% PCA was observed the antagonistic effect. Different concentrations of the compounds and their mixtures induced CAT activity independently of the presence of soil. Additionally, increases in phosphatases and transaminases activities were observed. In some cases, the enzymes also had their activities decreased and the dose-dependence effects were not observed. This research showed that the presence of soil influenced the toxicity of the compounds but not altered interaction type among them. Diflubenzuron, p-chloroaniline, and mixtures thereof caused disorders in enzymes important for the health of tilapia (Oreochromis niloticus). Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Predation Efficiency of Nile Catfish, Clarias gariepinus (Burchell, 1822) on Fry Nile Tilapia, Oreochromis niloticus (Linnaeus, 1758): Effect of Prey Density, Predator Size, Feed Supplementation and Submerged Vegetation

    OpenAIRE

    *(1), Mohsen Abdel-Tawwab

    2014-01-01

    The overpopulation of tilapia in confined ponds is an obvious problem, and causes stunted growth due to the shortage of natural food, particularly in semi-intensive culture. However, the control of tilapias population by predator culture has been practiced worldwide. The factors affecting predation efficiency of Nile catfish, Clarias gariepinus (B.) for controlling the overpopulation of Nile tilapia, Oreochromis niloticus (L.) were studied in four indoor experiments. Nile catfish with differe...

  19. Genetic characterization of a betanodavirus isolated from a clinical disease outbreak in farm-raised tilapia Oreochromis niloticus (L.) in Thailand.

    Science.gov (United States)

    Keawcharoen, J; Techangamsuwan, S; Ponpornpisit, A; Lombardini, E D; Patchimasiri, T; Pirarat, N

    2015-01-01

    Betanodavirus infection was diagnosed in larvae of farm-raised tilapia Oreochromis niloticus (L.), in central Thailand. Extensive vacuolar degeneration and neuronal necrosis were observed in histological sections with positive immunohistochemical staining for betanodavirus. Molecular phylogenetic analysis was performed based on the nucleotide sequences (1333 bases) of the capsid protein gene. The virus strain was highly homologous (93.07-93.88%) and closely related to red-spotted grouper nervous necrosis virus (RGNNV). © 2013 John Wiley & Sons Ltd.

  20. Hydroyeast Aquaculture® as a reproductive enhancer agent for the adult Nile tilapia (Oreochromis niloticus Linnaeus, 1758).

    Science.gov (United States)

    Mehrim, Ahmed I; Khalil, Fathy F; Hassan, Montaha E

    2015-04-01

    Tilapias are becoming increasingly popular culture fish because of their superior culture adaptability. In recent years, there has been a great interest in the use of probiotics in fish aquaculture. The objectives of the present study were to evaluate the effect of dietary graded levels (0, 5, 10, and 15 g/kg commercial diet, referred to treatments numbers T1, T2, T3, and T4, for males and T5, T6, T7, and T8 treatments for females) of a new probiotic Hydroyeast Aquaculture(®) on hematological and biochemical parameters, serum sex hormones, and the reproductive efficiency parameters of the adult Nile tilapia Oreochromis niloticus for 8 weeks. Results revealed that high levels of probiotics diet, 15 g (T4, ♂) and 10 g (T7, ♀) probiotic/kg diet, significantly (P ≤ 0.05) enhanced the physiological responses (hematological as well as serum biochemical parameters) together with, reproductive performances (sex hormones, testes and sperm quality parameters, absolute and relative fecundity, and ovarian measurements). Therefore, it could be conclude that Hydroyeast Aquaculture(®) is useful at levels of 15 g (T4) and 10 g (T7)/kg diet in improving the reproductive efficiency of adult O. niloticus males and females, respectively. Thus, the use of Hydroyeast Aquaculture(®) may be economically important for fish hatcheries.

  1. Integrated multi-trophic culture of Nile tilapia (Oreochromis niloticus and Amazon river prawn (Macrobrachium amazonicum in brackish water

    Directory of Open Access Journals (Sweden)

    G.G. Henry-Silva

    2015-02-01

    Full Text Available The aim of this study was to assess the feasibility of integrated multi-trophic culture of Nile tilapia (Oreochromis niloticus and Amazon River prawn (Macrobrachium amazonicum in brackish water by evaluating its limnological characteristics and economic performance. The experiment was completely randomized with four treatments and four repetitions: control treatment with Nile tilapia only, stocked with 2 tilapias/m² (P2C0 and three integrated multi-trophic culture treatments stocked with 2 tilapias/m² and prawns at densities of 4, 8 and 16 prawns/m² (P2C04, P2C08 and P2C16, respectively. The limnological variables of temperature, pH, dissolved oxygen, turbidity, ammonia, orthophosphate and chlorophyll "a" were evaluated and throughout the experiment remained within the limits recommended for culture. The experiment lasted 150 days with monthly animal sampling. No significant differences were observed for total fish biomass or for fish and prawn total survival rates. However, prawn individual weight decreased as stocking density increased. Gross revenue was not significantly different between treatments, as well as profitability. The profitability was 40.1% (P2C0, 36.7% (P2C04, 41.2% (P2C08 and 50.1% (P2C16. It is concluded that although feasible from the view point of husbandry, the integrated multi-tropic culture of M. amazonicum and O. niloticus did not influence significantly profitability compared to the monoculture system.

  2. Neurotoxic effects, molecular responses and oxidative stress biomarkers in Nile tilapia, Oreochromis niloticus (Linnaeus, 1758) exposed to verapamil.

    Science.gov (United States)

    Ajima, Malachy N O; Pandey, Pramod K; Kumar, Kundan; Poojary, Nalini

    2017-06-01

    Pharmaceutical drugs and their metabolites are detected in aquatic ecosystems and have been reported to cause ecotoxicological consequences to resident aquatic organisms. The study investigated the effects of acute and long-term exposure to verapamil on activities of acetylcholinesterase and antioxidant enzymes as well as mRNA expression of stress-related genes in brain and muscle tissues of Nile tilapia, Oreochromis niloticus. The 96h LC 50 of verapamil to O. niloticus was 2.29mgL -1 . Exposure to sub-lethal concentrations of verapamil (0.14, 0.29 and 0.57mgL -1 ) for period of 15, 30, 45 and 60days, led to inhibition of acetylcholinesterase activities in the brain and muscle of the fish. The activities of the oxidative enzymes such as the catalase, superoxide dismutase and glutathione peroxidase were also inhibited in both the tissues while there was an increase in the activities of glutathione-S-transferase and reduced glutathione in the muscle after 15 days at 0.29mgL -1 . Lipid peroxidation and carbonyl protein showed elevated level, indicating a positive correlation with both time and concentration. The activities of energy-related biomarker (Na + -K + -ATPase) in both the tissues were significantly inhibited (pproteins 70 (hsp70) were up-regulated in both the tissues after the study period. Prolonged exposure to sub-lethal verapamil can result in oxidative stress, up-regulation of stress-related genes and neurotoxicity in O. niloticus. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Mapping and validation of the major sex-determining region in Nile tilapia (Oreochromis niloticus L. Using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Christos Palaiokostas

    Full Text Available Sex in Oreochromis niloticus (Nile tilapia is principally determined by an XX/XY locus but other genetic and environmental factors also influence sex ratio. Restriction Associated DNA (RAD sequencing was used in two families derived from crossing XY males with females from an isogenic clonal line, in order to identify Single Nucleotide Polymorphisms (SNPs and map the sex-determining region(s. We constructed a linkage map with 3,802 SNPs, which corresponded to 3,280 informative markers, and identified a major sex-determining region on linkage group 1, explaining nearly 96% of the phenotypic variance. This sex-determining region was mapped in a 2 cM interval, corresponding to approximately 1.2 Mb in the O. niloticus draft genome. In order to validate this, a diverse family (4 families; 96 individuals in total and population (40 broodstock individuals test panel were genotyped for five of the SNPs showing the highest association with phenotypic sex. From the expanded data set, SNPs Oni23063 and Oni28137 showed the highest association, which persisted both in the case of family and population data. Across the entire dataset all females were found to be homozygous for these two SNPs. Males were heterozygous, with the exception of five individuals in the population and two in the family dataset. These fish possessed the homozygous genotype expected of females. Progeny sex ratios (over 95% females from two of the males with the "female" genotype indicated that they were neomales (XX males. Sex reversal induced by elevated temperature during sexual differentiation also resulted in phenotypic males with the "female" genotype. This study narrows down the region containing the main sex-determining locus, and provides genetic markers tightly linked to this locus, with an association that persisted across the population. These markers will be of use in refining the production of genetically male O. niloticus for aquaculture.

  4. Efeito da cor do ambiente sobre o estresse social em tilápias do Nilo (Oreochromis niloticus Effect of background color on the social stress of Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Giovana Krempel Fonseca Merighe

    2004-08-01

    ão recomendadas à manutenção da espécie, por amenizarem as interações agonísticas e o estresse, enquanto a marrom e azul devem ser evitadas por estimularem estas respostas.It was studied the behavior and physiologic answers of juvenile of Nile tilapia, Oreochromis niloticus, submitted the different backgrounds colors and social situations. The animals were maintained isolated in fishbowls covered with colored paper-card, composing five treatments (black, green, brown, blue and white. Through weekly filmings and in different and alternate stages (isolation and presence of a mirror, it enrolled the following parameters: distribution in the column of water, coloration, motility, agonistic behaviors, position of the dorsal fin and posture. For quantification of the glucose, triglycerides, total proteins and cortisol levels, were collected samples of blood after each filming. The obtained averages were analyzed statistically through the no-parametric Kruskal-Wallis method. The fish maintained in the black and green background presented low frequencies of agonistic behaviors, while those maintained in the white background, high frequencies, even so with low numbers of the alert pattern and not altering its motility. Animals submitted to the brown and blue colors presented the highest frequencies of agonistic behaviors, and larger motility. The fish stayed in all the treatments with the clear coloration, occupying, with larger frequency, the bottom of the column of water. Significant differences were not observed for the glucose, triglycerides and total proteins concentrations among the treatments, even so it was obtained a high level of cortisol for the animals maintained in the blue and brown backgrounds when submitted to the reflection of the own image in mirror. These results showed that there is influence of the background color on the social stress, in particular in the agonistic interactions among individuals of the same specie and in the concentration of the hormone

  5. The potential effects of Spirulina platensis (Arthrospira platensis on tissue protection of Nile tilapia (Oreochromis niloticus through estimation of P53 level

    Directory of Open Access Journals (Sweden)

    Mai D. Ibrahem

    2014-01-01

    Full Text Available The current study was designed to investigate the potential effect of Spirulina platensis, Arthrospira platensis, (SP on tissue protection of Nile tilapia (Oreochromis niloticus through estimation of P53 level. Five isonitrogenous and isocaloric rations containing graded levels of dried SP 5, 7.5,10, 15, and 20 g/kg diet were fed separately to five equal groups of O. niloticus fingerlings, additional control group was assigned for 3 months. Liver samples were separately collected from each group by the end of each month. The expression level of P53 showed a substantial decrease among the treated groups in a time-dependent manner. It is therefore advisable to incorporate SP in diets for tissue protection and antioxidant effects in cultured O. niloticus.

  6. TÉCNICA SIMPLES DE MARCAÇÃO EXTERNA DE REPRODUTORES DE TILÁPIA NILÓTICA (Oreochromis niloticus SIMPLE TECNIQUE FOR EXTERNAL MARKING OF NILE TILAPIA'S BROODSTOCK (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Ema Magalhães Leboute

    2002-02-01

    Full Text Available Com a finalidade de organizar um programa de controle da reprodução de tilápia nilótica (Oreochromis niloticus em laboratório, foi desenvolvida uma técnica na qual foi utilizada pérolas de cerâmica presas à musculatura dorsal do animal por transfixação com um fio sintético flexível. Foram usados 60 peixes com peso médio de 12g e 60 com peso médio de 19g. A marcação foi feita em três posições: frontal (F, mediana (M e caudal (C. Diferentes combinações de três pérolas coloridas foram fixadas do lado direito (definindo o número, e eram ligadas a uma única pérola do lado esquerdo (definido o sexo, deixando-se cerca de 1,5cm de folga no fio para não causar prejuízo ao crescimento. Os animais foram identificados e pesados individualmente aos 30, 60 e 130 dias após a cirurgia de transfixação. Os resultados indicaram que as posições F e M permitiram crescimento e comportamento reprodutivo normais, e na posição C houve mortalidade e perda do marcador. Recomenda-se como melhor posição a M, ou então a intermediária entre F e M.With the goal of organizing a control program of Nile tilapia (Oreochromis niloticus reproduction in laboratory, a tecnique with ceramic pearls held on dorsal musculature by transfixion with flexible sintetic string was developed. Sixty fishes with 12g average weight and 60 with 19g average weight were used. Marking was done on three positions: frontal (F, median (M, and caudal (C. Different combinations of three collored pearls were fixed on the right side (defining number, and were linked to only one pearl in the left side (defining sex, with a slack of about 1.5cm to prevent growth damage. The animals were individually identified and weigthed at 30, 60 and 130 days after surgery. Results showed that both F and M positions allowed normal growth and reproductive behavior, whereas the C position induced mortality and loss of marker in some specimens. The M position is recomended as the best, or

  7. Densidade de estocagem no desempenho de larvas de tilápia-do-Nilo (Oreochromis niloticus L., durante a reversão sexual Stocking density effect on Nile tilapia (Oreochromis niloticus L. fry performance during sex reversal

    Directory of Open Access Journals (Sweden)

    Luís Eduardo Ferrari Sanches

    1999-11-01

    Full Text Available Para estudar os efeitos da densidade de estocagem no desempenho de larvas de tilápia-do-Nilo, Oreochromis niloticus, durante a fase de reversão sexual em águas verdes, foram estocadas 1.500 larvas com peso médio de 12,41mg e comprimento total médio de 9,38mm em tanques-rede de 12,5 litros, nas densidades de 2, 4, 6, 8 e 10 larvas/litro, em delineamento totalmente aleatório com 4 repetições. Essas foram tratadas com ração comercial fina com 43% de PB, contendo 60mg de metiltestosterona/kg, 6 vezes por dia, durante 28 dias. O aumento da densidade resultou em menor peso e comprimento médios finais, definidos por modelos de regressão. O efeito da densidade sobre a diminuição do crescimento se evidenciou a partir da terceira semana de criação. A biomassa total e a conversão alimentar mostraram-se incrementadas com o aumento da densidade. A sobrevivência, o fator de condição e o coeficiente de variação foram independentes da densidade. Conclui-se que 2 larvas/litro devem ser usadas, quando se objetiva produção de alevinos maiores; mas densidades maiores podem ser utilizadas, obtendo-se alevinos menores, porém incrementando a biomassa total.To study the effects of stocking density on the performance of newborn fries of Nile tilapia Oreochromis niloticus, during sex reversal stage in green waters, 1500 fries were stocked with 12.41mg of average weight and 9.38mm of total average length in hapas of 12,5 litres, at densities of 2, 4, 6, 8 and 10 fries/litre, in a completely randomized design with 4 replications. They were fed with a fine commercial diet containing 43% CP, and 60mg of methyltestosterone/kg, six times a day, during 28 days. The density increase resulted in lower final average weight and length defined by regression models. The effect of density on the growth decrease started to be significative on the second week of rearing, while the total biomass and feed conversion were increased with the density increase

  8. Digestibilidade aparente da energia e nutrientes do farelo de canola pela tilápia do Nilo (Oreochromis niloticus Apparent nutrient and energy digestibility of canola meal for Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Wilson Massamitu Furuya

    2001-06-01

    Full Text Available Este estudo foi realizado para determinar a energia digestível e a digestibilidade aparente de nutrientes do farelo de canola pela tilápia do Nilo (Oreochromis niloticus. O óxido de crômio (0,1% foi utilizado como indicador inerte em dieta semi-purificada, com coleta de fezes pelo sistema Guelph. Os peixes foram alimentados até saciedade aparente. O farelo de canola apresentou valores de energia e nutrientes digestíveis de: 77,84; 71,99; 86,92; 88,19; 67,16 e 29,86% para a matéria seca, energia, proteína, lipídios, cálcio e fósforo, respectivamente, correspondendo a 2969,98 (kcal/kg; 69,97; 32,6; 1,2; 0,41 e 0,28%, de energia digestível, matéria seca, proteína e lipídios digestíveis e cálcio e fósforo disponíveis, respectivamente. Os resultados obtidos neste trabalho evidenciam que a tilápia do Nilo pode utilizar eficientemente o farelo de canola.This study was carried out to determine the digestible energy and apparent nutrient digestibility of canola meal for Nile tilapia (Oreochromis niloticus. The chromic oxide (0.1% was used as an inert indicador in the semi-purified diet and faeces were collected by Guelph system. Fish were fed to apparent satiation. The apparent nutrient and energy digestibility of canola meal were: 77.84, 71.99, 86.92, 88.19, 67.16, and 29.86% for dry matter, energy, protein, lipids, calcium and phosphorus, respectively, corresponding to 2969,98 (kcal/kg; 69.97, 32.6, 1.2, 0.41, and 0.28% of, digestible energy, dry matter, protein and lipids and available calcium and phosphorus, respectively. The results obtained in this experiment evidence that Nile tilapia may be able to utilize canola meal eficiently.

  9. Starch digestion in tropical fishes: isolation, structural studies and inhibition kinetics of alpha-amylases from two tilapias Oreochromis niloticus and Sarotherodon melanotheron.

    Science.gov (United States)

    Moreau, Y; Desseaux, V; Koukiekolo, R; Marchis-Mouren, G; Santimone, M

    2001-03-01

    alpha-Amylases from the intestinal cavity of two tilapia species, Oreochromis niloticus (ONI-AMY) and Sarotherodon melanotheron (SME-AMY), were purified using ammonium sulfate precipitation, affinity chromatography and chromatofocusing procedures. The purification was approximately 100-fold. The amylolytic activity, specific activity, product distribution, pH and temperature profile of ONI-AMY and SME-AMY are quite similar. The molecular mass differs slightly: 56600 (ONI-AMY) vs. 55500 (SME-AMY). As shown by isoelectric focusing analysis, both amylases contain two isoforms A and B with distinct pI: 7.2 (A) and 7.8 (B), vs. 8.3 (A) and 8.8 (B), respectively. It was not possible to isolate B, since B converts into A with time. The kinetics of the inhibition of ONI-AMY and SME-AMY activity by alpha-, beta- and gamma-cyclodextrin (alpha-, beta- and gamma-CD) were investigated using amylose as the substrate. Statistical analysis of the kinetic data expressed using a general velocity equation and assuming rapid equilibrium showed that the inhibition is of the mixed noncompetitive type. Similar results were obtained with ONI-AMY and SME-AMY. beta- and gamma-CD are stronger inhibitors than alpha-CD. ONI-AMY and SME-AMY are then closely related and show the general features common to the members of the alpha-amylase class (family 13). They enable ONI and SME tilapias to digest starch in food.

  10. The effects of increased freshwater salinity in the biodisponibility of metals (Cr, Pb) and effects on antioxidant systems of Oreochromis niloticus.

    Science.gov (United States)

    Baysoy, E; Atli, G; Gürler, C Ö; Dogan, Z; Eroglu, A; Kocalar, K; Canli, M

    2012-10-01

    Anthropogenic activities can increase the salinity of freshwaters and this may cause stress for fish and affect metal bioavailability. Oxidative stress biomarkers are of great interest due to their responses to environmental stressors which provide valuable data for biological monitoring of aquatic pollution. Thus, the individual and combined effects of salinity and metals (Cr, Pb) were investigated in the liver of freshwater fish Oreochromis niloticus in the present study. Fish were exposed to salinity (2 and 8 ppt) alone and salinity+metal (1 μg/mL Pb and Cr) combination exposures for 0, 1, 7 and 14 days and subsequently antioxidant enzymes (superoxide dismutase, SOD; glutathione peroxidase, GPX; glutathione reductase, GR and glutathione S-transferase, GST) activities and glutathione (GSH) levels in the liver were measured. Data showed that all the parameters varied in relation to metal species, exposure durations and salinity levels. Profound alterations on the measured parameters were detected at the lower salinity compared to the higher one. Salinity increase effectively stimulated the antioxidant parameters. The effects of salinity and metals on the measured parameters increased as the exposure duration prolonged. SOD was the most affected antioxidant parameter from both salinity and metals. Because metal and salinity stresses affect fish antioxidant system, this work suggests that the chemistry of freshwaters should be taken into account in natural monitoring for metal contamination in the field. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Pharmacodynamic interaction of Spirulina platensis and deltamethrin in freshwater fish Nile tilapia, Oreochromis niloticus: impact on lipid peroxidation and oxidative stress.

    Science.gov (United States)

    Abdelkhalek, Nevien K M; Ghazy, Emad W; Abdel-Daim, Mohamed M

    2015-02-01

    Spirulina platensis (SP) is one of the most commonly used dietary supplements in human and many animal species, including fish. Recently, it has gained more attention in fish not only for its growth-promoting and immunomodulatory effects but also for its antioxidant potential. The present study was conducted to investigate the protective role of two different dietary levels of SP on freshwater Nile tilapia; Oreochromis niloticus exposed to subacute deltamethrin (DLM) intoxication. Spirulina was supplemented at levels of 0.5 and 1 % in the diet along with DLM at a concentration of 1.46 μg/l for 28 days. Serum biochemical parameters, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein, albumin, cholesterol, urea, uric acid and creatinine, were estimated. In addition, the level of malondialdehyde (MDA) was analysed as a lipid peroxidation marker. Reduced glutathione (GSH) content and glutathione peroxidase (GSH-Px), superoxide dismutase (SOD) and catalase (CAT) activities were analysed as antioxidant biomarkers in liver, kidney and gills. The results revealed that DLM intoxication increased serum AST, ALT, ALP, cholesterol, urea, uric acid, creatinine and tissue MDA, while decreased serum total protein and albumin as well as tissue GSH level and GSH-Px, SOD and CAT activities. SP supplementation at the two tested levels enhanced all altered serum biochemical parameters as well as tissue lipid peroxidation and antioxidant biomarkers. Therefore, it could be concluded that SP administration could minimize DLM-induced toxic effects by its free radical scavenging and potent antioxidant activity.

  12. Expression of the prolactin receptor (tiPRL-R) gene in tilapia Oreochromis niloticus: tissue distribution and cellular localization in osmoregulatory organs.

    Science.gov (United States)

    Sandra, O; Le Rouzic, P; Cauty, C; Edery, M; Prunet, P

    2000-04-01

    The expression of the prolactin receptor (PRL-R) gene has been investigated in various tissues of tilapia (Oreochromis niloticus) reared in fresh or brackish water. Using a cDNA probe spanning the extracellular domain of the tilapia PRL-R and Northern blot analysis, the presence of tilapia PRL-R mRNA has been confirmed in the osmoregulatory organs and has been detected in other tissues, including the skin, the brain, the reproductive organs, and the two major hematopoietic organs (spleen and head kidney), as well as circulating lymphocytes. These findings suggest a conservation of the physiological processes regulated by prolactin throughout the vertebrates, including immunity and central nervous activity. A non-radioactive in situ hybridization procedure has allowed us to detect the expression of the tilapia PRL-R in the branchial chloride cells and the intestinal mucosal layer of fresh water animals, confirming the direct control exerted by prolactin on the water and ionic exchanges in tilapia. In all the tissues examined one unique PRL-R transcript has been detected with a similar size (3.2 kb) whatever the salinity conditions. Thus, the transcriptional expression of the tilapia PRL-R strongly differs from the complex RNA pattern reported for the higher vertebrates PRL-R and provides an additional argument for the existence of a single PRL-R for both prolactin isoforms in this fish species.

  13. Four new species of Cichlidogyrus Paperna, 1960 (Monogenea, Ancyrocephalidae), all gill parasites from African mouthbreeder tilapias of the genera Sarotherodon and Oreochromis (Pisces, Cichlidae), with a redescription of C. thurstonae Ergens, 1981.

    Science.gov (United States)

    Pariselle, Antoine; Bilong Bilong, Charles F; Euzet, Louis

    2003-11-01

    A study of Oreochromis niloticus (Linnaeus), O. aureus (Steindachner), Sarotherodon caudomarginatus (Boulenger), S. galilaeus (Linnaeus) and S. galilaeus sanagaensis (Thys van den Audenaerde) (Teleostei, Cichlidae) from different locations in Africa (Burkina Faso, Cameroon, Guinea, Niger and Senegal) revealed the presence of 11 species of monogenean gill parasites. Four, belonging to Cichlidogyrus Paperna, 1960 and considered as new species, are described: C. rognoni n. sp., C. douellouae n. sp., C. giostrai n. sp. and C. njinei n. sp. They are distinguished by the shape and/or size of the sclerotised parts of the haptoral and copulatory complexes. C. thurstonae Ergens, 1981 from O. niloticus is redescribed.

  14. Evaluation of marking efficiency of different alizarin red S concentrations on body fish structures in Oreochromis niloticus (Perciformes: Cichlidae juveniles

    Directory of Open Access Journals (Sweden)

    Ana L. Ibáñez

    2013-03-01

    Full Text Available The use of alizarin red S (ARS marked tilapias could provide valuable fisheries management information to evaluate fish stocking events and may facilitate aquaculture management practices. As a new technique in fishes, the aim of this study was to compare and evaluate the chemical marks produced in tilapia juveniles by ARS through two treatments: 1 12 hours of immersion and 2 immersion after osmotic induction. This was analyzed at three concentrations: 50, 75 and 100mg/l, and in three structures: otoliths, fish scales and caudal fin rays of Oreochromis niloticus juveniles. After three culture months 80% of specimens were analyzed and significant differences (pEl uso de alizarina roja S (ARS para marcar tilapias podría proporcionar información valiosa para el manejo de su pesquería. Para evaluar pesquerías acuaculturales manejadas con siembras o repoblamientos de peces se comparó y evaluó la marca producida por la alizarina roja S, empleando dos tratamientos: 1 Inmersión en ARS durante 12h; e 2 Inmersión en ARS después de un choque osmótico. El análisis se realizó a tres concentraciones: 50, 75 y 100mg/l y en tres estructuras: otolitos, escamas y radios de la aleta caudal de Oreochromis niloticus. Ochenta por ciento de los ejemplares fueron cultivados durante tres meses y analizados posteriormente. Los resultados mostraron diferencias entre las concentraciones de la marca para el tratamiento de 12h de inmersión mientras que no hubo diferencias entre las concentraciones para el tratamiento con inducción osmótica. Se encontraron diferencias en la intensidad de la marca entre los tratamientos para otolitos y radios de las aletas pero para las escamas no hubo diferencias significativas. Todas las concentraciones produjeron marcas (desde débiles a intensas, sin embargo la concentración de 100mg/l no produjo marcas débiles. El tratamiento por inducción osmótica presentó mayores niveles de mortalidad. Después de ocho meses de

  15. Species-specific content of As, Pb, and other elements in pangas (Pangasianodon hypophthalmus) and tilapia (Oreochromis niloticus) from aquaculture ponds in southern Bangladesh

    DEFF Research Database (Denmark)

    Marcussen, Helle; Alam, Md. Ariful; Rahman, Md. Mizanur

    2014-01-01

    bacteria) and final depuration in groundwater for up to 48 h had no effect on content of the elements. For As, consumption of 100 g fresh fish per day contained 1.3% (pangas) and 5% (tilapia) of the maximum tolerable daily intake according to FAO recommendations. Relative to whole tilapia froma lake near...... by different feeding habits of the two fish. The other elements had similar concentrations in both species. Content of As in tilapia and pangas was 0.37 and 0.11 μg g−1, respectively, while Pb made up 0.056 and 0.051 μg g−1, respectively. Water treatment during the farming period (sand filtration and probiotic...

  16. Modulation of genotoxicity and endocrine disruptive effects of malathion by dietary honeybee pollen and propolis in Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Mohamed M.M. Kandiel

    2014-11-01

    Full Text Available The present study aimed at verifying the usefulness of dietary 2.5% bee-pollen (BP or propolis (PROP to overcome the genotoxic and endocrine disruptive effects of malathion polluted water in Oreochromis niloticus (O. niloticus. The acute toxicity test was conducted in O. niloticus in various concentrations (0–8 ppm; mortality rate was assessed daily for 96 h. The 96 h-LC50 was 5 ppm and therefore 1/5 of the median lethal concentration (1 ppm was used for chronic toxicity assessment. In experiment (1, fish (n = 8/group were kept on a diet (BP/PROP or without additive (control and exposed daily to malathion in water at concentration of 5 ppm for 96 h “acute toxicity experiment”. Protective efficiency against the malathion was verified through chromosomal aberrations (CA, micronucleus (MN and DNA-fragmentation assessment. Survival rate in control, BP and PROP groups was 37.5%, 50.0% and 100.0%, respectively. Fish in BP and PROP groups showed a significant (P < 0.05 reduction in the frequency of CA (57.14% and 40.66%, MN (53.13% and 40.63% and DNA-fragmentation (53.08% and 30.00%. In experiment (2, fish (10 males and 5 females/group were kept on a diet with/without BP for 21 days before malathion-exposure in water at concentration of 0 ppm (control or 1 ppm (Exposed for further 10 days “chronic toxicity experiment”. BP significantly (P < 0.05 reduced CA (86.33%, MN (82.22% and DNA-fragmentation (93.11%, prolonged the sperm motility when exposed to 0.01 ppm of pollutant in vitro and increased the estradiol level in females comparing to control. In conclusion, BP can be used as a feed additive for fish prone to be raised in integrated fish farms or cage culture due to its potency to chemo-protect against genotoxicity and sperm-teratogenicity persuaded by malathion-exposure.

  17. Rendimento do processamento da tilápia do Nilo (Oreochromis niloticus Linnaeus, 1757 e do pacu (Piaractus mesopotamicus Holmberg, 1887 - DOI: 10.4025/actascianimsci.v25i1.2068 Processing yield of Nile tilapia (Oreochromis niloticus Linnaeus, 1757 and pacu (Piaractus mesopotamicus Holmberg, 1887 - DOI: 10.4025/actascianimsci.v25i1.2068

    Directory of Open Access Journals (Sweden)

    Petra Maria Wagner

    2003-04-01

    Full Text Available Analisou-se o rendimento do processamento da tilápia (Oreochromis niloticus e do pacu (Piaractus mesopotamicus, sendo um total de 20 exemplares de cada espécie, com peso médio de 816,0 ± 74,0g e 1958,0 ±164,0g, e comprimento total médio de 33,6 ± 1,1cm e 42,4 ± 1,2cm, respectivamente. Estes foram abatidos por meio de choque térmico, pesados, medidos, eviscerados e filetados. O pacu apresentou um rendimento de filé superior (p It has been analysed the processing yield of Oreochromis niloticus and Piaractus mesopotamicus. A total of 20 individuals from each species, presenting a mean weight of 816,0 ± 74,0g and 1958,0 ± 164,0g, and total length of 33.6 ± 1,1cm and 42.4 ± 1,2cm, respectively, for tilapia and pacu. They were killed with thermical shock, weighed, measured, then extracted internal organs and fillets. The fillet yield was higher in pacu (p < 0,01 than those observed in tilapia. These values for pacu were superior (p < 0.01 to tilapia’s. These values were 51.60% for fillet with skin and 46.73% without skin, while for tilapia they were 39.21% and 36.44%, respectively. There were no significant difference for the yield on the visceral carcass and skin between the two species. The percentage for the tilapia’s head (28.34% was significantly superior (p < 0.01 to pacu’s (16.57%. Individuals with big and long head promoted low fillet yield, as verified for tilapia, and those with small head as pacu, the yield ranges higher values, evidencing the existence of a inverse relationship between the size of the head and fillet yield.

  18. Evaluation of marking efficiency of different alizarin red S concentrations on body fish structures in Oreochromis niloticus (Perciformes: Cichlidae) juveniles.

    Science.gov (United States)

    Ibáñez, Ana L; Rodríguez-Canto, Antonio; Cortés-Martínez, Jasmín; García-Calderón, José L

    2013-03-01

    The use of alizarin red S (ARS) marked tilapias could provide valuable fisheries management information to evaluate fish stocking events and may facilitate aquaculture management practices. As a new technique in fishes, the aim of this study was to compare and evaluate the chemical marks produced in tilapia juveniles by ARS through two treatments: 1) 12 hours of immersion and 2) immersion after osmotic induction. This was analyzed at three concentrations: 50, 75 and 100mg/l, and in three structures: otoliths, fish scales and caudal fin rays of Oreochromis niloticus juveniles. After three culture months 80% of specimens were analyzed and significant differences (p<0.05) in mark intensity were detected between treatments for otoliths and fin rays, but not for fish scales. Significant differences between concentrations were found for the 12h immersion treatment, while no significant differences were detected with osmotic induction. Our results showed that marks appeared at all concentrations, and none of the concentrations produced weak marks. Osmotic induction had a greater mortality than the 12h immersion procedure. After eight culture months the rest of the specimens were analyzed and the mark permanence was observed in all cases. According to the present results we recommend the marking process of 12h immersion treatment at 100mg/L concentration.

  19. Acanthocephalan Parasites (Acanthogyrus sp.) of Nile Tilapia (Oreochromis niloticus) as Biosink of Lead (Pb) Contamination in a Philippine Freshwater Lake.

    Science.gov (United States)

    Paller, Vachel Gay V; Resurreccion, Dan Jacob B; de la Cruz, Christian Paul P; Bandal, Modesto Z

    2016-06-01

    The potential use of acanthocephalans as bioindicators of Lead (Pb) pollution in Sampaloc Lake, Laguna, Philippines was investigated. Nile tilapias (Oreochromis niloticus) were collected and Pb concentrations were determined in fish tissues and in their acanthocephalan parasites, Acanthogyrus sp. Significantly higher levels of Pb were detected in the parasites relative to the fish host tissues (p = 0.001). Bioaccumulation capacity of the parasites against fish tissues were 102, 119, and 147 times higher than the fish intestine, liver, and muscles, respectively. Pb sensitivity of the parasites was quantified by exact logistic analysis showing higher odds of Pb detection ranging from 18 to 45 folds (p = 0.001-0.009). Interestingly, infected fish showed significantly lower Pb concentration in their tissues compared to uninfected fish (p = 0.001), suggesting parasites were able to sequester Pb and served as active biosinks. The Pb levels in the parasites were also hundred folds higher (988 times) relative to the ambient waters, indicating a potential role of fish parasites as metal biosinks in aquatic ecosystems.

  20. Evaluation of marking efficiency of different alizarin red S concentrations on body fish structures in Oreochromis niloticus (Perciformes: Cichlidae juveniles

    Directory of Open Access Journals (Sweden)

    Ana L. Ibáñez

    2013-03-01

    Full Text Available The use of alizarin red S (ARS marked tilapias could provide valuable fisheries management information to evaluate fish stocking events and may facilitate aquaculture management practices. As a new technique in fishes, the aim of this study was to compare and evaluate the chemical marks produced in tilapia juveniles by ARS through two treatments: 1 12 hours of immersion and 2 immersion after osmotic induction. This was analyzed at three concentrations: 50, 75 and 100mg/l, and in three structures: otoliths, fish scales and caudal fin rays of Oreochromis niloticus juveniles. After three culture months 80% of specimens were analyzed and significant differences (p<0.05 in mark intensity were detected between treatments for otoliths and fin rays, but not for fish scales. Significant differences between concentrations were found for the 12h immersion treatment, while no significant differences were detected with osmotic induction. Our results showed that marks appeared at all concentrations, and none of the concentrations produced weak marks. Osmotic induction had a greater mortality than the 12h immersion procedure. After eight culture months the rest of the specimens were analyzed and the mark permanence was observed in all cases. According to the present results we recommend the marking process of 12h immersion treatment at 100mg/L concentration.

  1. Histopathological Effects on Gills of Nile Tilapia (Oreochromis niloticus, Linnaeus, 1758) Exposed to Pb and Carbon Nanotubes.

    Science.gov (United States)

    Barbieri, Edison; Campos-Garcia, Janaína; Martinez, Diego S T; da Silva, José Roberto M C; Alves, Oswaldo Luiz; Rezende, Karina F O

    2016-12-01

    The effect of heavy metal in fish has been the focus of extensive research for many years. However, the combined effect of heavy metals and nanomaterials is still a new subject that needs to be studied. The aim of this study was to examine histopathologic alterations in the gills of Nile tilapia (Oreochromis niloticus) to determine possible effects of lead (Pb), carbon nanotubes, and Pb+carbon nanotubes on their histological integrity, and if this biological system can be used as a tool for evaluating water quality in monitoring programs. For this, tilapia were exposed to Pb, carbon nanotubes and Pb+carbon nanotubes for 4 days. The main alterations observed were epithelial structure, hyperplasia and displacement of epithelial cells, and alterations of the structure and occurrence of aneurysms in the secondary lamella. The most severe alterations were related to the Pb+carbon nanotubes. We conclude that the oxidized multi-walled carbon nanotubes enhanced the acute lead toxicity in Nile tilapias. This work draws attention to the implications of carbon nanomaterials released in the aquatic environment and their interaction with classical pollutants.

  2. Response of antioxidant system of tilapia (Oreochromis niloticus) following exposure to chromium and copper in differing hardness.

    Science.gov (United States)

    Dogan, Zehra; Eroglu, Ali; Kanak, Esin G; Atli, Gülüzar; Canli, Mustafa

    2014-06-01

    Tilapias (Oreochromis niloticus) were exposed to copper or chromium in soft water (SW) (~80 mg CaCO3/L, conductivity 1.77 mS/cm) or hard water (HW) (~320 mg CaCO3/L, conductivity 5.80 mS/cm) using 2 exposure protocols (20 μM for 48 h and 10 μM for 144 h). Following the exposures, antioxidant enzyme activities [superoxide dismutase (SOD); catalase (CAT); glutathione peroxidase; glutathione reductase; and glutathione S-transferase (GST)] and glutathione (GSH) levels were measured in the liver of fish. SOD and CAT activities of control fish kept in SW were significantly lower than control fish kept in HW. However, the other antioxidant indices (glutathione metabolism) of both control fish were unaffected from water hardness. Acute metal exposures did not alter the glutathione metabolism, whereas SOD activity in SW and CAT activity in both waters changed significantly. In subchronic duration, Cu exposure caused significant decreases in measured parameters, except for GST activity and GSH level. Similarly, GST activity and GSH level were unaffected from Cr exposure. This study showed that SOD and CAT were the most sensitive antioxidant indices, and that glutathione metabolism, in general, was not altered following metal exposures in different waters.

  3. Effects of replacing fishmeal with wastes derived from local fisheries on the growth of juvenile tilapia, Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Chanagun Chitmanat

    2009-01-01

    Full Text Available A feeding trial was conducted to investigate the effects of partially and totally replacing fishmeal with by-product derived from local fisheries on growth performances of tilapia (Oreochromis niloticus. Tilapia fingerlings (average initialweight 0.38±0.05 g were fed with 5 different diet formulas composing of fish meal protein replacement levels of 0%, 25%,50%, 75, and 100%. Tilapia were raised in 80 x 80 x 80 cm3 hapa in an earthen pond for 8 weeks. Each treatment contained3 replications. No feeding trial was applied as negative control. The result showed that fish by-product powder could substitute for fishmeal on a crude protein basis at a level of not more than 25%. As a result, feed cost can only be cut down approximately 3 US cents/kg. Specific growth rate, weight gain, survival rate and feed conversion ratio were not significantly different between the fish fed with the 75% and 100% fishmeal containing diets (P>0.05. The outcome would beapplied to reduce the solid wastes from fish processing and partially replace the imported fishmeal. This can also be used as guideline for farmers in small communities to produce their own tilapia feed.

  4. Shelf life of air and modified atmosphere-packaged fresh tilapia (Oreochromis niloticus) fillets stored under chilled and superchilled conditions

    Science.gov (United States)

    Cyprian, Odoli; Lauzon, Hélène L; Jóhannsson, Ragnar; Sveinsdóttir, Kolbrún; Arason, Sigurjón; Martinsdóttir, Emilía

    2013-01-01

    Optimal packaging and storage conditions for fresh tilapia fillets were established by evaluating sensory and microbiological changes, as well as monitoring physicochemical properties. Nile tilapia (Oreochromis niloticus) farmed in recirculation aquaculture system was filleted, deskinned, and packaged in air and 50% CO2/50% N2 prior to chilling and superchilling storage at 1°C and −1°C. Sensory analysis of cooked samples revealed a shelf life of 13–15 days for air-packaged fillets during storage at 1°C and 20 days at −1°C. At the end of shelf life in air-packaged fillets, total viable counts (TVC) and pseudomonads counts reached log 8 colony-forming units (CFU) g−1. In 50% CO2/50% N2-packaged fillets, the lag phase and generation time of bacteria were extended and recorded counts were below the limit for consumption (modified atmosphere (MA) packaging negatively affected color characteristics of the fillets soon after packaging (day 6). Color is an important indicator of tilapia fillets quality and a major factor in influencing retail purchase decisions. In view of that, air packaged at −1°C storage temperature was the optimal condition for fresh tilapia fillets. Total volatile basic nitrogen (TVB-N) and trimethylamine (TMA) were not good indicators of spoilage of tilapia fillets in this study. PMID:24804022

  5. Recycling of sewage sludge: Feeding Nile tilapia, Oreochromis niloticus (Linn.), with irradiated and dried sludge from beer industry

    International Nuclear Information System (INIS)

    Chuapoehuk, W.; Piadang, S.; Tinnungwattana, W.

    1998-01-01

    Recycling of sewage sludge from wastewater treatment plant of beer industry as supplemental feed for fish was conducted. Industrial biosludge from wastewater treatment plant of beer industry was irradiated at 3.32 kGy gamma irradiator, carrier type, model JS 8900, 60 Co activity at 187,088.121 Ci on 6 June 1995. For fish production study, it is needed to change the wet sludge to dry powder form by Rotadics dryer, type Stord TST 3.4 C, Stord (Thailand) Co. Ltd., at the maximum capacity of 15 T/24 h. The moisture content of finished product is at 8-10%. Fish control diet was then replaced at 60% by weight with irradiated and dried sludge to become as test diet. Nile tilapia, Oreochromis niloticus (Linn.), fingerlings averaging 0.67 g. in body weight was stocked into earthern ponds of 400 square meters at the density of 5 fishes per square metre. Fish were fed with two diets, control diet and test diet, for 154 days. There are no statistical differences in specific growth rate, quality of the fish flesh (Cd and Pb concentration, edible portion and off flavour) and pond water quality. Survival rate and feed conversion efficiency of the fish fed test diet are higher than control diet (P<0.05). Replacement of irradiated sludge can decrease the cost of fish production and results in better benefit than that of control diet

  6. Kaftas prepared with V-shaped filleting chips of the Nile tilapia (Oreochromis niloticus exposed to smoking techniques

    Directory of Open Access Journals (Sweden)

    Maria Luiza Rodrigues de Souza

    2015-05-01

    Full Text Available Kaftas with V-shaped filleting chips of the Nile tilapia (Oreochromis niloticus were developed and the effects of the smoking technique on the characteristics of chemical composition, microbiological, sensory and benzo(apyrene were investigated. The filleting chips were ground and filleting included condiments and bacon. Kaftas were molded, frozen and distributed in a completely randomized design with three treatments (T 1 = baked in a grid; T 2 = smoked by friction and T 3 = smoked by liquid smoke with 10 replications. The kaftas subjected to hot smoke had lower moisture content (13.97%, whereas the no-smoking kaftas had the highest content (20.49%. Kaftas with liquid smoke had high crude protein content (48.06% and ash (9.49%, whereas the ash content was different only from no-smoking kaftas (8.79%. There was no significant difference in sensory parameters, except for flavor; smoked kaftas with liquid smoke were more accepted by the judges and the worst kaftas were no-smoked kaftas. Microbiological analysis showed that kaftas developed were appropriate to feed human beings within the required standards. Chips filleting is an alternative for the development of kaftas and those subjected to liquid smoke were considered the best.

  7. Aprovechamiento de semillas de hule (Hevea brasiliensis L. para alimentación de tilapia (Oreochromis niloticus L.

    Directory of Open Access Journals (Sweden)

    Gustavo Adolfo Elías-Ogaldez

    2017-03-01

    Full Text Available Se elaboró un concentrado artesanal para tilapia (Oreochromis niloticus L. con la finalidad de contribuir al aprovechamiento de los subproductos del cultivo de hule (Hevea brasiliensis Müll. Arg y de reducir los costos de producción de la tilapia. La investigación fue tipo aplicada y experimental, realizándose en la zona costera del Pacifico guatemalteco. Se concluyó que la harina de semilla de hule es un insumo apropiado para sustituir parcial o totalmente la harina de semilla de soya, en la formulación de concentrados artesanales para tilapia. Todos los tratamientos donde se utilizó harina de semilla de hule presentaron una mejor supervivencia y FCA frente al testigo. El tratamiento T3 presentó la mejor tasa de retorno marginal frente al testigo y los demás tratamientos. Por último, se recomienda continuar la investigación tomando en cuenta que la semilla de hule es deficiente en aminoácidos esenciales, los cuales se pueden adicionar para mejorar su rendimiento nutricional.

  8. ANALISIS KANDUNGAN MERKURI (Hg PADA IKAN NILA (Oreochromis niloticus L. BUDIDAYA KERAMBA DI SEKITAR WADUK RIAM KANAN KECAMATAN ARANIO

    Directory of Open Access Journals (Sweden)

    Aditya Rahman

    2017-10-01

    Full Text Available ABSTRACTThis study aims to determine the content of heavy metals mercury contained in the fish Tilapia (Oreochromis niloticus L. aquaculture cages around the Riam Kanan reservoir and compare it with quality standards based on the Decree of the Head of BPOM No. HK.00.06.1.52.4011 about the maximum limit of metal contamination in food, especially in fish. This study was conducted from September to December 2011. Sampling was conducted at three stations covering the village of Tiwingan Baru, Tiwingan Lama dan Aranio in the Aranio district. Sampling was done by purposive sampling method or sampling intentionally with certain considerations that are considered important. Mercury analysis performed using Atomic Absorption Spectrophotometer (AAS instrument. Result showed that the average content of mercury in sediment samples at the first station of 0,0262 mg/kg; the second station of 0,1489 mg/kg and not detected at the third station, the content is still below the set threshold. The content of mercury in water samples of Riam Kanan reservoir at all stations are still below the threshold of water quality standards according to Government Regulation No. 82 of 2001. Result on the mercury content of Tilapia fish meat samples at all stations are still below the standards threshold based on the Decree of the Head of BPOM about the maximum limit of metal contamination in food, especially in fish.

  9. Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress.

    Science.gov (United States)

    Yang, ChangGeng; Wu, Fan; Lu, Xing; Jiang, Ming; Liu, Wei; Yu, Lijuan; Tian, Juan; Wen, Hua

    2017-07-17

    Growth arrest specific 2 (gas2) gene is a component of the microfilament system that plays a major role in the cell cycle, regulation of microfilaments, and cell morphology during apoptotic processes. However, little information is available on fish gas2. In this study, the tilapia (Oreochromis niloticus) gas2 gene was cloned and characterized for the first time. The open reading frame was 1020 bp, encoding 340 amino acids; the 5'-untranslated region (UTR) was 140 bp and the 3'-UTR was 70 bp, with a poly (A) tail. The highest promoter activity occurred in the regulatory region (-3000 to -2400 bp). The Gas2-GFP fusion protein was distributed within the cytoplasm. Quantitative reverse transcription-polymerase chain reaction and western blot analyses revealed that gas2 gene expression levels in the liver, muscle, and brain were clearly affected by low temperature stress. The results of gas2 RNAi showed decreased expression of the gas2 and P53 genes. These results suggest that the tilapia gas2 gene may be involved in low temperature stress-induced apoptosis.

  10. Comparative toxicity of copper oxide bulk and nano particles in Nile Tilapia; Oreochromis niloticus: Biochemical and oxidative stress

    Directory of Open Access Journals (Sweden)

    Amr A. Abdel-Khalek

    2015-10-01

    Full Text Available Nile Tilapia; Oreochromis niloticus are commonly used in the assessment of aquatic environment quality and also considered as useful bio-indicators during environmental pollution monitoring. The LC50/96 h of copper oxide (bulk & nano particles [CuO (BPs & NPs] were 2205 & 150 mg/l, respectively. Two tested concentrations of CuO (BPs & NPs were selected: the first concentration was equivalent to (1/10 (220.5 & 15 mg/l, and the second was equivalent to (1/20 (110.25 & 7.5 mg/l LC50/96 h·CuO (BPs & NPs, respectively. While serum glucose, liver function tests (AST, ALT and ALP and kidney function tests (creatinine and uric acid showed a significant increase, serum total proteins, albumin, globulin and total lipids showed a significant decrease. Both liver and gill tissues of the studied fish showed a reduction in GSH content and an elevation in MDA and GPx activities. The present study also showed an elevation in liver CAT & SOD activities when exposed to both concentrations of CuO BPs and in the case of gills when exposed to both concentrations of CuO (BPs & NPs, although activity of these enzymes showed an inhibition in the liver when exposed to both concentrations of CuO NPs. The present study investigated whether CuO NPs are more toxic than CuO BPs.

  11. Novel IFNγ homologue identified in Nile tilapia (Oreochromis niloticus) links with immune response in gills under different stimuli.

    Science.gov (United States)

    Velázquez, Janet; Acosta, Jannel; Herrera, Naylin; Morales, Antonio; González, Osmany; Herrera, Fidel; Estrada, Mario Pablo; Carpio, Yamila

    2017-12-01

    Interferon gamma (IFN-γ) has important roles in both innate and adaptive immune responses. This cytokine plays a very important role in defining Th1 immune response in all vertebrates. In the present study, we identified and isolated for the first time the gene coding for Nile tilapia (Oreochromis niloticus) IFNγ from spleen lymphocytes. The isolated tilapia IFNγ has between 24 and 62% of amino acid identity as compared to reported sequences for other teleost fishes. It has close phylogenetic relationships with IFNγ molecules belonging to the group of Perciforms and presents the typical structural characteristics of gamma interferon molecules. The tissue expression analysis showed that IFNγ is expressed constitutively in head kidney, skin, intestine, muscle and brain. Its expression was not detected in gills by conventional RT-PCR. However, under conditions of stimulation with Poly I:C and LPS, IFNγ expression was up-regulated in gills after 24 h post-stimulation. IFNγ expression was also induced in gills 24 h after Edwardsiella tarda infection suggesting its important role in immunity against intracellular bacteria. The recombinant protein produced in Escherichia coli induced Mx gene transcription in head kidney primary culture cells. These results are the first steps to characterize the role of tilapia IFNγ in the defense against pathogens in tilapia. Furthermore, the isolation of this molecule provides a new tool to characterize the cellular immune response to various stimuli in this organism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Comparison of characteristics and fibril-forming ability of skin collagen from barramundi (Lates calcarifer) and tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Liao, Wei; Guanghua, Xia; Li, Yongcheng; Shen, Xuan Ri; Li, Chuan

    2018-02-01

    The present study isolated and characterized the barramundi (Lates calcarifer) skin collagen (BC) and tilapia (Oreochromis niloticus) skin collagen (TC). The yields of BC and TC by enzymatic extraction were 47.3±3.7% and 52.6±6.1% respectively, dry weight. The SDS-PAGE profile indicated both collagens were mainly type I with two different α chains. FTIR spectra and X-ray diffraction confirmed that the triple helical structure of both collagens was not affected by pepsin digestion. The denaturation (T d ) and melting temperature (T m ) were 36.8 and 109.6°C for BC, 37.6 and 113.7°C for TC, measured by rheometer and DSC. This high thermal stability could be attributed to the high imino acid content (205.9 and 210.9 residues/1000 residues) of BC and TC. Fibril-forming studies indicated BC exhibited higher ability than (ptilapia skin collagen with high thermal stability and good fibril-forming ability may be suitable for use as an alternative to mammalian-derived collagen in biomaterials, pharmaceuticals and cosmetics. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Characterization of acid- and pepsin-soluble collagen extracted from the skin of Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Sun, Leilei; Hou, Hu; Li, Bafang; Zhang, Yan

    2017-06-01

    Acid-soluble (ASC) and pepsin-soluble (PSC) collagen were extracted from the skin of Nile tilapia (Oreochromis niloticus), purified and physicochemically examined. Amino acid content analyses revealed that glycine accounted for approximately one-third of the total amino acid residues. The proline and hydroxyproline contents of Nile tilapia ASC and PSC were 189 residues and 205 residues/1000 residues, respectively, and the rate of proline hydroxylation was found to be 41.8% and 42.0%, respectively. Denaturation temperatures (Td), as measured by an Ubbelohde viscometer, were 35.2°C and 34.5°C, respectively, 6°C lower than that of the type I collagen found in calf skin. In this study, we measured the intrinsic viscosity, circular dichroism (CD) and, X-ray diffraction (XRD), and employed Fourier transform infrared spectroscopy (FTIR) analyses to confirm that the ASC and PSC samples from Nile tilapia skin were native and undenatured, and therefore, maintained their original, intact triple helical structure. Our SDS-PAGE results showed that the extracted ASC and PSC peptides were in their native molecular form; (α 1 ) 2 α 2 (type I collagen). Furthermore, the loose, fibrous, and porous structures, shown in the cross-sections of ASC and PSC, indicate that Nile tilapia skin collagen represents a powerful physical foundation for further use in biomaterial applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Growth performance and nutrient composition of juvenile Nile tilapia (Oreochromis niloticus) fed Spirulina flakes, rice bran and mustard oil cake.

    Science.gov (United States)

    Sultana, N; Noor, P; Abdullah, A T M; Hasan, M R; Ahmed, K M; Naser, M N

    2012-08-01

    Tilapia (Oreochromis niloticus) is an important cultured fish that is widely distributed in Bangladesh. This study was conducted to improve the growth performance and nutrient contents of the fish using five different types of feeds. Tilapia fingerlings were fed two types of commercial fish feeds (Feed-1 and Feed-2), Spirulina flakes (Feed-3), Feed-2 mixed with Spirulina flakes (Feed-4) and manually mixed feed made from a mixture of mustard oil cake and rice bran (Feed-5). After 4 weeks of being fed with the diets, growth parameters and meat nutrient composition of the tilapia fingerlings were recorded. Significant growth in length and weight was observed in juvenile tilapia fish fed with commercial Feed-1 only, while growth performance varied significantly among fingerlings fed other types of feeds. Body tissue calcium (92.8 mg/100 g), iron (1.29 mg/100 g) was higher in fishes fed with dry Spirulina flakes (Feed 3), while the highest amount of zinc (2.09 mg/100 g) was recorded in fishes fed Feed-5. Protein (13.32%) content was highest in fish fed Feed-2 mixed with Spirulina flakes (Feed-4). Meat nutritional quality of tilapia can be improved by combining commercial feeds with Spirulina flakes, compared with feeding commercial feeds in isolation.

  15. Use of Cassia alata aqueous extract as a bath treatment to control Pseudomonas anguilliseptica infection in tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Phumkhachorn Parichat

    2015-01-01

    Full Text Available The aqueous extracts of six plants, Andrographis paniculata, Cassia alata, Centella asiatica, Garcinia mangostana, Punica granatum and Psidium guajava, were investigated for their antimicrobial activity and mode of action against Pseudomonas anguilliseptica, an important fish pathogenic bacterium, which is responsible for economic losses in aquaculture worldwide. Among the tested plant extracts, the C. alata aqueous extract had the strongest inhibitory effect and exhibited a bactericidal mode of action against the pathogenic bacterium. When an infection of tilapia (Oreochromis niloticus with P. anguilliseptica was induced by intraperitoneal, the median lethal dose (LD50 was determined to be 1.59 x 105 CFU/ml. For the in vivo trial, four different concentrations (25, 50, 75 and 100 ppm of C. alata aqueous extract were used as bath treatment to remedy the infection. The effect of the extract on the infection was dose-dependent and an extract with the concentration of 100 ppm eliminated mortality of the infected fish without producing any adverse effects on the animals. This study suggests that C. alata aqueous extract has the potential to control fish disease caused by P. anguilliseptica.

  16. EFECTO DE TILAPIA Oreochromis niloticus SOBRE LA PRODUCCIÓN PESQUERA DEL EMBALSE EL GUÁJARO ATLÁNTICO - COLOMBIA

    Directory of Open Access Journals (Sweden)

    Pedro Caraballo G, M.Sc.

    2009-12-01

    Full Text Available Objetivo. Evaluar el efecto de tilapia Oreochromis niloticus sobre la producción pesquera en el embalse de El Guájaro, departamento del Atlántico, Colombia. Materiales y métodos. El embalse tiene un área aproximada de 14.000 ha y allí pescan diariamente 2.500 pescadores provenientes de ocho municipios que rodean el ecosistema. Por medio de evaluaciones mensuales del desembarco durante 48 horas en todos los puertos, fue evaluada la composición y abundancia de las capturas en 1988 y 2002. Los resultados de la evaluación hecha en 2002 fueron comparados con los obtenidos en 1988. Resultados. 38 especies de peces, perteneciendo a 14 familias fueron identificadas. Sólo las dos especies que dominan las capturas, presentaron una variación en su participación global. La producción durante 2002 fue de 431 ton/mes, superior a las 84 ton/mes evaluadas en el año 1988. Durante 2002, las capturas fueron dominadas por tilapia Oreochromis niloticus (53% y arenca Triportheus magdalenae (36% lo que representa una variación en la composición de las capturas que, durante 1988 fueron respectivamente de 13% y 73%. Esta variación no afectó la proporción de herbívoros y carnívoros que se mantuvo en 90-10%. Conclusiones. La variación en la composición y abundancia de la producción total implica el desplazamiento de una especie nativa (Triportheus magdalenae por una exótica (Oreochromis niloticus, hecho que viene siendo observado en toda la cuenca del Magdalena en esta década.

  17. Metals concentrations in Nile tilapia Oreochromis niloticus () from illegal fish farm in Al-Minufiya Province, Egypt, and their effects on some tissues structures.

    Science.gov (United States)

    Authman, Mohammad M N; Abbas, Wafaa T; Gaafar, Alkhateib Y

    2012-10-01

    This study clarified the suitability of fishes caught from illegal fish farms to human consumption and their hazards to public health. For this purpose, the concentrations of some metals (Al, Cd, Pb, Hg and Ni) in water and Nile tilapia (Oreochromis niloticus) fish samples collected from an illegal fish farm, in addition to pathological conditions of the fish tissues, were examined. The illegal farm water was found to be heavily polluted with metals which far exceeded the permissible limits. It was found that metals accumulated in tissues of O. niloticus in concentrations higher than those of farm water. Kidney of O. niloticus contained the highest concentrations of the detected metals, while muscle and skin contained the lowest concentrations. The examination of fish tissues revealed various histopathological lesions which related directly to the pollution of the illegal farm water. Moreover, metals levels in O. niloticus muscle were higher than the maximum permissible levels for human consumption. Consequently, the flesh of fishes from the illegal farms could be considered hazardous to human health. Therefore, warning against eating fish caught from the illegal fish farms should be announced. Moreover, removal of such illegal fish farms is necessary for the public health protection. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Determination of some heavy metals in oreochromis niloticus, clarias gariepinus and synodontis spp from the coastal water of Ondo State, Nigeria

    International Nuclear Information System (INIS)

    Asaolu, S.S.

    2002-01-01

    Some heavy metals (Pb, Ni, Fe, Cu, Zn, Cd, Co, Mn, and Cr) were determined in Oreochromis niloticus, Clarias graiepinus and Synodontis spp obtained from the coastal water of Ondo State. All metals examined and detected in all fish samples. Iron, manganese and cadmium were found to be the most abundant metals in the fish samples with an average values of 35.8, 31.3, and 12.5 mg kg-1 respectively. Except for manganese, iron and cadmium, Syndrontis spp has the highest concentration for virtually all the metals under examination. (author)

  19. Cambios en el perfil de ácidos grasos de filete de tilapia nilótica Oreochromis niloticus en respuesta a diferentes fuentes lipídicas

    OpenAIRE

    Moreno Poveda, Jenny Marcela

    2013-01-01

    Con el objetivo de modificar el perfil de ácidos grasos (AG) en el filete de tilapia nilótica (Oreochromis niloticus), se fabricaron cuatro dietas con: aceite de pescado (AP), aceite de palma (APL), semilla de chía (SC) o semilla de lino (SL). El experimento fue realizado durante 45 días en la represa de Betania (Huila), en 20 jaulas flotantes, cada una con 504 peces de 557±16,87g, distribuidos bajo un diseño completamente al azar. Al finalizar el periodo experimental fueron muestreados 21 pe...

  20. Vitellogenin induction and increased plasma 17beta-estradiol concentrations in male Nile tilapia, Oreochromis niloticus, exposed to organochlorine pollutants and polycyclic aromatics hydrocarbons.

    Science.gov (United States)

    Rodas-Ortíz, Juan Pablo; Ceja-Moreno, Victor; Chan-Cocom, Maria Eulalia; Gold-Bouchot, Gerardo

    2008-12-01

    Vitellogenin (Vtg), 17beta-estradiol (E2) and testosterone (T) were used as biomarkers of endocrine disruption in mature male nile tilapia (Oreochromis niloticus) from three lakes (Rio, Enmedio and Limon) in Chiapas, Mexico. Vitellogenesis induction was found in tilapias from Rio and Limon, moderately high E(2) levels in Rio and Limon tilapias, compared with controls (cultured tilapias). Significant correlations between benzo(a)pyrene (BaP) metabolites and hexachlorobenzene (HCB) with Vtg and E(2) were found. The results of this study indicate that endocrine disruption exists in tilapias from Rio and Limon lakes, and that exposure to HCB and BaP could be causing these alterations.

  1. Digestibilidade de nutrientes em ração com complexo enzimático para tilápia-do-Nilo (Oreochromis niloticus).

    OpenAIRE

    Oliveira, Giovanni Resende de

    2014-01-01

    Um ensaio de digestibilidade foi conduzido na Estação de Piscicultura da Universidade Federal de Lavras (UFLA) para avaliar os efeitos da suplementação de ração com um complexo enzimático contendo celulase, protease e amilase sobre a digestibilidade dos nutrientes, em juvenis de tilápia-do-Nilo (Oreochromis niloticus). As rações experimentais foram à base de farelo de soja e milho, isoprotéicas (30% PB), isoenergéticas (4.243 kcal/kg de EB) e suplementadas com um complexo enzimático comercial...

  2. Centrocestus formosanus (Opisthorchiida: Heterophyidae como causa de muerte de alevines de tilapia gris Oreochromis niloticus (Perciforme: Cichlidae en el Pacífico seco de Costa Rica

    Directory of Open Access Journals (Sweden)

    Donald Arguedas Cortés

    2010-12-01

    Full Text Available Centrocestus formosanus es un parásito trematodo zoonótico originario de Asia asociado con muertes de peces principalmente de cultivo. 907 moluscos provenientes de estanques sembrados con tilapias, seleccionados uno por provincia fueron identificados al nivel taxonómico especifico. Se identificaron cuatro gastrópodos y un bivalvo: M. tuberculata, M. turricula, P. flagellata, H. cubensis y A. luteola. Se reporta, por primera vez, la presencia de dos especies de moluscos en Costa Rica. Se identificaron siete morfotipos de cercarias parasitando las cinco especies de moluscos encontradas. En la segunda exposición experimental se demostró que el morfotipo parapleurolofocercus encontrado en M. tuberculata concuerda con el hallazgo de C. formosanus en alevines de tilapia, después del examen clínico, anatomopatológico y parasitológico realizado a los alevines expuestos. Las metacercarias fueron extraídas del quiste utilizando microagujas y micropinzas lavadas en solución salina fisiológica (0.65%, fijadas en formol caliente al 4% y después esquematizadas con una cámara clara adaptada a un microscopio fotónico, estimándose una abundancia e intensidad media de 1018-1027 digeneos por branquia en cada pez parasitado, determinándose así el hospedador intermediario primario y secundario del parásito. En el presente trabajo se reporta por primera vez Centrocestus formosanus en Costa Rica.Centrocestus formosanus (Opisthorchiida: Heterophyidae as a cause of death in gray tilapia fry Oreochromis niloticus (Perciforme: Cichlidae in the dry Pacific of Costa Rica. Centrocestus formosanus is a zoonotic trematode from Asia and has been mainly associated as cause of death of cultured fish. To identify pathogen trematode species in tilapia fry (Oreochromis niloticus and to determine mollusks hosting these parasites, freshwater mollusks were collected from tilapia cultured ponds and experimental infections were carried out with tilapia fries and

  3. Depletion of florfenicol amine, marker residue of florfenicol, from the edible fillet of tilapia (Oreochromis niloticus x O. niloticus and O. niloticus x O. aureus) following florfenicol administration in feed

    Science.gov (United States)

    Gaikowski, M.P.; Mushtaq, M.; Cassidy, P.; Meinertz, J.R.; Schleis, S.M.; Sweeney, D.; Endris, R.G.

    2010-01-01

    Aquaflor??, a 50% feed premix containing the broad spectrum antibacterial agent florfenicol is available globally to control mortality associated with economically significant systemic bacterial diseases of fish. Florfenicol (FFC) is effective in controlling mortality associated with Streptococcus iniae in tilapia Oreochromis sp. when administered in medicated feed at a dose of 15 mg/kg bodyweight (BW)/d for 10 consecutive days. Our objective was to characterize the depletion of the FFC marker residue, florfenicol amine (FFA), from the edible tissue of market-weight Nile tilapia O. niloticus x O. niloticus and hybrid tilapia O. niloticus x O. aureus offered feed medicated with FFC at a nominal dose rate of 15 mg/kg BW/d for 12 days. Near market-weight tilapia were obtained from a commercial tilapia farm, distributed to 2 single pass (one for Nile tilapia and one for hybrid tilapia), flow-through systems and maintained at 27 ??C under a 15 h light:9 h dark photoperiod over a 41-d pre-dosing period. During the dosing period, tilapia were offered feed medicated with FFC at a concentration of 1.479 g/kg at 1% BW daily divided in three equal offerings. The initial 10-d dosing period was extended to 12 d because one tank did not consume > 75% of the feed offered during the first two dosing days. The total dose consumed by fish in each of the 2 tanks ranged from 147 to 167 mg/kg. Once during the pre-dose period and on days 1, 2, 4, 7, 14, 21, and 28 of the post-dose period, groups of fish were indiscriminately removed from each tank, measured for weight and length, scaled, filleted, and the skin-on fillets stored at tilapia fillet after withdrawal from medication and depletion followed first-order kinetics with an estimated half-life of 2.32 d. The FFA tolerance limit, calculated as the 99th percentile of the potential residue level at 95% confidence, had depleted to less than the 1 ??g/g maximum residue level by 6.14 d after the dosing period.

  4. Energia digestível para larvas de tilápia-do-nilo (Oreochromis niloticus na fase de reversão sexual Digestible energy for nile tilapia (Oreochromis niloticus larvae in the sexual reversion phase

    Directory of Open Access Journals (Sweden)

    Wilson Rogério Boscolo

    2005-12-01

    Full Text Available Este trabalho foi realizado com o objetivo de se avaliar o efeito de diferentes níveis de energia digestível na ração sobre o desempenho de larvas de tilápia-do-nilo (Oreochromis niloticus, durante a fase de reversão sexual. Foram utilizadas 375 larvas com peso e comprimento inicial de 21,0 ± 4,0 mg e 11,9 ± 7,2 mm, respectivamente, distribuídos em 25 aquários com capacidade de 30 L, em um delineamento experimental inteiramente casualizado, composto por cinco tratamentos e cinco repetições, em que a unidade experimental foi considerada como um aquário contendo 15 larvas. As rações foram formuladas de modo a conterem 3.300; 3.525; 3.750; 3.975 e 4.200 kcal/kg de energia digestível e serem isoprotéicas (38,6% de proteína digestível. Os animais foram alimentados ad libitum cinco vezes ao dia. Ao final do experimento, foram analisadas as médias de peso final (PF, sobrevivência (SO, fator de condição (FC e comprimento final (CF. O aumento de ED nas rações proporcionou redução linear no PF e CF dos peixes. Não foram observadas diferenças na SO e FC dos peixes nos diferentes tratamentos. Conclui-se que o aumento nos níveis de energia digestível em rações para larvas de tilápia-do-nilo durante a reversão sexual proporciona redução no desempenho.This experiment was conducted to evaluate different levels of digestible energy on the performance of Nile tilapia larvae (Oreochromis niloticus during the sexual reversion phase. Three hundred and seventy-five larvae with initial average length and weight of 21.0±4.0 mg and 1.19±0.72 cm, respectively, were allotted to 25 30L-aquarium. A completely randomized design with five treatments and five replicates was used. The aquarium with 15 larvae was the experimental unit. The diets were formulated to contain levels of 3,300, 3,525, 3,750, 3,975, and 4,200 kcal/kg of digestible energy and to be isoprotein (38.6% digestible protein. The animals were fed ad libitum five times a

  5. Apparent phosphorus availability in food for the Nile tilapia (Oreochromis niloticus Disponibilidade aparente de fósforo em ingredientes pela tilápia-do-nilo (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Edma Carvalho de Miranda

    2000-05-01

    Full Text Available Apparent availability of phosphorus from various foodstuffs for sexually reversed Nile tilapia (Oreochromis niloticus was provided. Fish with an average weight of 16.0  0.5g were randomly stocked in 21 aquariums equipped with feces collector (Guelf system, at the rate of five fish per aquarium. Each set of three aquariums was provided with a biological filter, aeration and flowing water (0.75 L/min discharge. An egg albumin-gelatin purified diet containing 0.1% chromic oxide was used as reference and basal diet. Dicalcium phosphate, bone and fish meals, soybean and wheat bran and middlings were added to the basal diet at 3.5, 6.0, 21.67, 40.0, 12.0 and 10.62% respectively, at the expense of albumin, gelatin and dextrose. Dicalcium phosphate was the best phosphorus source (apparent availability of 74.23% for tilapia fingerlings. In decreasing order it was followed by bone and soybean meals (54.59 and 35.13%, wheat middlings (30.49%, fish meal (27.15% and corn meal (7.33%. Whereas fish meal had the lowest apparent phosphorus availability among animal foodstuff, soybean meal was the best among plant foodstuffs.Foi determinada a disponibilidade aparente do fósforo de ingredientes alimentares para a tilápia-do-nilo (Oreochromis niloticus. Foram utilizados 105 alevinos, revertidos, com peso vivo inicial médio de 16,0  0,5g. Foram distribuídas, cinco por aquário em 21 unidades de fibra de vidro (80L e sistema Guelf para coleta de fezes. Cada conjunto, constituído de três aquários, foi dotado de aeração, filtro biológico e fluxo contínuo (vazão de 0,75 L/mim. Foram avaliados o fosfato bicálcico, as farinhas de osso e de peixe, os farelos de soja e de trigo e fubá de milho, os quais substituíram parte de uma dieta purificada, usada como referência, marcada com óxido de crômio. Ao final, pode-se concluir: o fosfato bicálcico, disponibilidade aparente de 74,24%, deve ser a fonte preferencial de fósforo nas rações; a farinha de

  6. Determination of selenium toxicity to Oreochromis niloticus based on hematological parameters=Determinação da toxicidade do Selênio por meio de análises hematológicas em Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Silmara Regina Siqueira

    2012-04-01

    Full Text Available Selenium (Se is described as an essential micronutrient and participates in different biological functions, as the antioxidant defense systems maintenance and regulation. However, when in high concentrations, Se may cause toxic effects as well as hematological changes in fish. The aim of the present study was to determine the toxicity of selenium in the form of sodium selenate (Na2Se6+O4 in Oreochromis niloticus based on hematological parameters, after exposure to different concentrations (0.01, 0.14 and 1.4 mg Se6+ L-1. The erythrocytic and leukocytic series were examined over 14 days at intervals of 0, 3, 5, 7,10 and 14 days. The erythrocytic series showed significant alterations in the first 7 days, including the control group. Neutrophils and monocytes showed variations in the first 3 days at a concentration of 1.40 mgSe6+ L-1 characterizing an acute response. The total number of leukocytes was different in relation to time zero on all Se concentrations. The thrombocyte count also differed statistically from time zero and control in the first 3 days at 0.14 mgSe6+ L-1. These results indicate that different concentrations induce an acute response with diminution of total leukocytes, neutrophilia, monocytosis and thrombocytosis.O selênio (Se é descrito como um micronutriente essencial e participa de diversas funções biológicas. No entanto, quando em concentrações elevadas, o Se pode causar efeitos tóxicos, bem como alterações hematológicas em peixes. O objetivo do presente estudo foi determinar a toxicidade do selênio na forma de Selenato de sódio (Na2Se6+O4 em Oreochromis niloticus com base em parâmetros hematológicos, após a exposição a diferentes concentrações (0,01, 0,14 e 1,4 mg + Se6+ L-1. A série eritrocitária e leucocitária foram examinadas por 14 dias, em intervalos de 0, 3, 5, 7,10 e 14 dias. A série eritrocítica mostrou alterações significativas nos primeiros 7 dias, incluindo o grupo controle. Neutr

  7. Triguilho na alimentação da tilápia do nilo (Oreochromis niloticus L.: digestibilidade e desempenho Wheat midlings in the nile tilapia feeding (Oreochromis niloticus L.: digestibility and performance

    Directory of Open Access Journals (Sweden)

    Arcangelo Augusto Signor

    2007-08-01

    Full Text Available No presente experimento objetivou-se determinar os coeficientes de digestibilidade aparente (CDa da proteína bruta (PB e da energia bruta (EB do triguilho para a tilápia do Nilo (Oreochromis niloticus e avaliar a inclusão do triguilho sobre o desempenho de alevinos de tilápia do Nilo. Para a determinação dos CDa, foram utilizadas 40 tilápias com peso e comprimento médios de 80,00g e 15,9cm, respectivamente, submetidas à coleta das fezes por sedimentação. Para a avaliação do desempenho, foram utilizados 125 alevinos de tilápia do Nilo, com peso inicial médio de 0,80g, distribuídos em 25 aquários com capacidade de 30L, em um delineamento inteiramente casualizado, com cinco tratamentos e cinco repetições. As rações experimentais continham níveis de inclusão de 0,00; 7,97; 14,94; 23,91 e 31,88% de triguilho substituindo até 100% do milho. Os CDas da PB e EB do triguilho foram de 91,03 e 78,72%, respectivamente, apresentando 11,92% de proteína digestível e 3134Kcal kg-1 de energia digestível. Não foi observada diferença (P>0,05 no desempenho dos peixes alimentados com as rações contendo os diferentes níveis de inclusão do triguilho. O triguilho é um alimento com bons CDa da PB e EB e pode ser incluído em até 31,88% em rações para alevinos de tilápia do Nilo sem causar prejuízo no desempenho.This experiment was aimed at determining the apparent digestibility coefficients (ADC of the raw protein (RP and of raw energy (RE of the wheat middling given to the Nile tilapia (Oreochromis niloticus and evaluating the inclusion of wheat middling on the performance of Nile tilapia fingerlings. In order to determine the ADC, 40 tilapias with the average weight and length of 80g and 15.9cm, respectively, were used and submitted to the collection of the excrements by sedimentation. To the evaluation of the performance 125 fingerlings of Nile tilapia were used, with an initial average weight of 0.80g, distributed into 25

  8. Antagonism of Aeromonas hydrophila by propolis and its effect on the performance of Nile tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Abd-El-Rhman, Azza M M

    2009-09-01

    Propolis, a resinous substance collected by Apis mellifera bees from various plant sources and mixed with secreted beeswax, is a multifunctional material used by bees in the construction, maintenance, and protection of their hives. The collected propolis sample, from High Egypt, was dark-green with olive-odor. The minimal inhibition concentration (MIC) of propolis-ethanolic-extract, against Aeromonas hydrophila, was 80 microg Propolis-ethanolic-extract and crude propolis (1%) were added to artificial basal diet with (30% crude protein) to evaluate their efficacy on the fish growth-performance, immunostimulation and resistance to A. hydrophila. Two hundred and twenty-five Oreochromis niloticus (8 +/- 0.45 g/fish) were divided into three equal treatments (T) of triplet replicates. The fish of T(1) were fed on basal diet (control). The fish of T(2) were given the basal diet, containing propolis-ethanolic-extract. The fish of T(3) were given the basal diet containing crude propolis for 28 day. The fish were intraperitoneally challenged by A. hydrophila (0.2 x 10(7) cells ml(-1)) at the end of the feeding period and kept for 15 more days. The best growth rate and feed conversion ratio were obtained with T(2.) The increase in the average daily gain, specific growth rate and feed efficiency ratio were highly significances in T(2) followed by T(3) when compared with the control group. The HCT-level and monocyte-counts were increased (T(2)). No significant change, in the large lymphocytic-count was found among the three treatments (28-27-28%), while the neutrophil-count was significantly decreased (7%) with T(2) and increased (13.11%) with the control. A significant increase in serum lysozyme and serum bactericidal activities was found with T(2). The RLP against A. hydrophila was high with T(2) and T(3). The propolis-ethanolic-extract enhanced the growth, immunity and resistance of O. niloticus against A. hydrophila more than the crude propolis. 2009 Elsevier Ltd.

  9. Genetic studies on sex determination and colouration in Nile tilapia (Oreochromis niloticus L.)

    International Nuclear Information System (INIS)

    Karayuecel, I.

    1999-05-01

    The present study was undertaken to investigate colour and sex determination mechanisms through the application of androgenesis, gynogenesis and controlled breeding programme with the objective of producing all red males in O. niloticus. The highest yield of androgenetic haploid to pigmentation stage was 24.6±3.5% (relative to controls) with optimal UV irradiation dose of 450JM -2 for 5 minutes. The highest survival rate of diploid androgens was 0.07±0.07% (relative to controls) to yolk sac stage using a heat shock of 42.5 deg. C for 3 minutes 30 seconds applied at 25 minutes after fertilisation. All paternal inheritance of diploid androgenetic tilapia was verified using DNA fingerprinting. The mean recombination frequency of the red skin colour gene in meiotic gynogens was 0.12±0.04. All maternal inheritance of meiotic gynogens was verified using the isozyme locus ADA*. Analyses of sex ratios of meiotic gynogens suggested that male progenies were produced by an epistatic sex determining locus (SDL-2 with two alleles SR and sr) causing female to male sex reversal in the homozygous phase (srsr) but with limited penetrance. A close linkage was found between a sex determining locus (SDL-2) and the red gene. No significant difference was found between colour genotypes (namely homozygous red, heterozygous red and wild type) in terms of total fecundity, ISI (inter spawning interval), egg size and survival rate. Overall mean ISI was 26.3±1.0 days. Mean total fecundity was 1096 eggs. Fecundity varied over successive spawns but this variation did not appear to be related to spawning periodicity. Hormonal and thermal feminization were compared on all YY male progeny of O. niloticus. While similar female percentages of 32.0±5.2 and 33.8±1.5% were produced, significantly higher intersex percentages of 18.5±2.5 and 1.6±0.8 were observed in heat and DES treated groups, respectively. Heat treatment groups showed the lowest survival rate of 62.6±9.8% compared to the

  10. Genetic studies on sex determination and colouration in Nile tilapia (Oreochromis niloticus L.)

    Energy Technology Data Exchange (ETDEWEB)

    Karayuecel, I

    1999-05-01

    The present study was undertaken to investigate colour and sex determination mechanisms through the application of androgenesis, gynogenesis and controlled breeding programme with the objective of producing all red males in O. niloticus. The highest yield of androgenetic haploid to pigmentation stage was 24.6{+-}3.5% (relative to controls) with optimal UV irradiation dose of 450JM{sup -2} for 5 minutes. The highest survival rate of diploid androgens was 0.07{+-}0.07% (relative to controls) to yolk sac stage using a heat shock of 42.5 deg. C for 3 minutes 30 seconds applied at 25 minutes after fertilisation. All paternal inheritance of diploid androgenetic tilapia was verified using DNA fingerprinting. The mean recombination frequency of the red skin colour gene in meiotic gynogens was 0.12{+-}0.04. All maternal inheritance of meiotic gynogens was verified using the isozyme locus ADA*. Analyses of sex ratios of meiotic gynogens suggested that male progenies were produced by an epistatic sex determining locus (SDL-2 with two alleles SR and sr) causing female to male sex reversal in the homozygous phase (srsr) but with limited penetrance. A close linkage was found between a sex determining locus (SDL-2) and the red gene. No significant difference was found between colour genotypes (namely homozygous red, heterozygous red and wild type) in terms of total fecundity, ISI (inter spawning interval), egg size and survival rate. Overall mean ISI was 26.3{+-}1.0 days. Mean total fecundity was 1096 eggs. Fecundity varied over successive spawns but this variation did not appear to be related to spawning periodicity. Hormonal and thermal feminization were compared on all YY male progeny of O. niloticus. While similar female percentages of 32.0{+-}5.2 and 33.8{+-}1.5% were produced, significantly higher intersex percentages of 18.5{+-}2.5 and 1.6{+-}0.8 were observed in heat and DES treated groups, respectively. Heat treatment groups showed the lowest survival rate of 62

  11. Potential use of green algae Caulerpa lentillifera as feed ingredient in the diet of Nile tilapia Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Nadisa Theresia Putri

    2017-07-01

    Full Text Available ABSTRACT The high composition of import raw material of fish diet in Indonesia causes feed price expensively and should be replaced using local materials such as green macro algae. It is, therefore, this study aimed to evaluate effect of diet containing the Caulerpa lentillifera, as feed ingredient in the diet of Nile tilapia Oreochromis niloticus. This study consisted of two experiments which were C. lentillifera digestibility test for raw material feed for tilapia and growth performance test of tilapia. C. lentillifera digestibility test was done by using Cr2O3 as indicators and analysis of faecal tilapia. The second experiment is growth performance test using a completely randomised design with four diets were formulated at variuos rates of C. lentillifera meal of 0 (control, 10, 20, and 30%. A number of 240 tilapia fingerlings of 3.41±0.10 g in mean weight were randomly stocked in 12 aquaria and fed on diet test for growth performanced of rearing period. C. lentillifera digestiility test result showed a good value as a raw material feed tilapia, the digestibility of C. lentiliifera and protein digestibility amounted to 68.81% and 86.31%. Growth performance parameters showed the use of 10% and 20% is not significantly different from the control (P>0.05, to the final body weight, protein efficiency ratio, protein retention, specific growth rate, and feed efficiency. But, the diet test at 30% performed the lowest growth performance and feed utilization as well of tilapia fingerlings. This study, therefore, concludes that C. lentillifera meal could be used up to 20% in the tilapia diet. Keywords: Caulerpa lentillifera, Nile tilapia, feed utilization, growth performance  ABSTRAK Tingginya jumlah bahan baku impor dalam pakan ikan di Indonesia menyebabkan harga pakan yang tinggi dan harus diganti menggunakan bahan alternatif lokal seperti makro alga. Penelitian ini bertujuan untuk mengkaji pengunaan dari pakan yang mengandung Caulerpa

  12. Qualidade do sêmen em tilápia do Nilo (Oreochromis niloticus, alimentadas com dietas contendo diferentes níveis de vitamina C - doi: 10.4025/actascianimsci.v32i3.7836 Semen quality in Nile tilapia (Oreochromis niloticus, fed with diets containing different vitamin C levels - doi: 10.4025/actascianimsci.v32i3.7836

    Directory of Open Access Journals (Sweden)

    Gentil Vanini de Moraes

    2010-09-01

    Full Text Available A vitamina C atua na proteção de danos celulares provocados pelos radicais livres, sendo a suplementação considerada essencial para a maioria das espécies de peixes, uma vez que não a sintetizam em função da ausência da enzima L-gulonolactona oxidase. Assim, avaliou-se o efeito da suplementação de 0, 75, 150 e 225 mg de vitamina C kg-1 de ração na qualidade do sêmen em tilápias do Nilo (Oreochromis niloticus. Os parâmetros quali-quantitativos do sêmen não foram influenciados pela suplementação de vitamina C, exceto a motilidade progressiva que aumentou linearmente com adição de vitamina C. Conclui-se que os reprodutores de tilápias do Nilo devem ser suplementados com 225 mg de vitamina C kg-1 de ração.Vitamin C acts as cellular protection from damage by free radicals, and vitamin C supplementation is considered essential for most fish species, as they do not synthesize it due to the absence of enzyme L-gulonolactone oxidase. Thus, the effect of supplementation with 0, 75, 150 and 225 mg of vitamin C kg-1 of ration was evaluated in the semen quality in Nile tilapia (Oreochromis niloticus. Seminal parameters were not influenced by vitamin C supplementation except progressive motility, which increased linearly with the addition of vitamin C. It was concluded that Nile tilapia reproducers should be supplemented with 225 mg vitamin C kg-1 ration.

  13. Comparing salinities of 0, 10 and 20 in biofloc genetically improved farmed tilapia (Oreochromis niloticus production systems

    Directory of Open Access Journals (Sweden)

    Guozhi Luo

    2017-09-01

    Full Text Available A 150 days (150-d experiment was carried out to investigate the production efficiency, inorganic nitrogen syndrome and bacteria community of indoor biofloc technology (BFT systems used to rear genetically improved farmed tilapia (Oreochromis niloticus under 0 (S-0, 10 (S-10, and 20 salinities (S-20. The start-up period for BFT was 50, 60 and 80 d for S-0, S-10 and S-20 groups, respectively. At steady state, the total ammonium nitrogen (NH4+-N and nitrite nitrogen (NO2−-N were lower than 3.0 mg/L and 0.34 mg/L, respectively and no nitrate-nitrogen (NO3−-N accumulation was observed. The fish survival rate was above 95% for all the groups. The final fish biomass of the S-10 group (35.83 ± 1.08 kg/m3 was not significantly different from the S-0 (34.79 ± 1.33 kg/m3 group but was significantly higher than S-20 (32.6 ± 1.04 kg/m3. The feed conversion ratio for the tilapia in S-20 was 1.46, which was higher than the ratio in S-0 (1.40 and S-10 (1.39 tilapia. There was no significant difference in the crude protein content of the back muscle from tilapia of the three experimental groups. No significant difference in blood parameters, except for aspartate aminotransferase and alkaline phosphatase was observed between the three groups. Evaluation of microorganisms in the three BFT systems revealed that Proteobacteria, Bacteroidetes, and Fusobacteria were the top three at the phylum level in all groups. However, a significant difference was observed at the genus level in the bacteria of the three BFTs at different salinity (P < 0.05.

  14. Effect of the establishment of dominance relationships on cortisol and other metabolic parameters in Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Corrêa S.A.

    2003-01-01

    Full Text Available The objective of the present study was to investigate the influence of the establishment of dominance relationships and social stress on plasma cortisol and metabolite levels in Nile tilapia (Oreochromis niloticus. During the 30-day experiment, the fish weighing 236 ± 29 g were kept in individual aquaria, except for two pairings lasting 6 h each. Blood samples were taken from the animals before and after pairing. Display, approach, attack, rebuff, chase flight, and coloration were carried out on days 16 and 30. Activities and behaviors characteristic of the establishment of dominance relationships were described. It was possible to classify all experimental fish (N = 30 as dominant or subordinate. No differences were detected between dominant (N = 15 and subordinate (N = 15 fish during isolation or after pairing in cortisol (isolated: 5.76 ± 0.98 vs 5.42 ± 0.63; paired: 10.94 ± 1.62 vs 11.21 ± 2.45 µg/dl, glucose (isolated: 60.02 ± 4.9 vs 67.85 ± 16.16; paired: 110.44 ± 15.72 vs 136.26 ± 22.46 mg/dl, triglyceride (isolated: 167.87 ± 5.06 vs 185.68 ± 7.24; paired: 210.85 ± 13.40 vs 221.82 ± 12.70 mg/dl or total protein levels (isolated: 7.01 ± 0.42 vs 6.69 ± 0.59; paired: 9.21 ± 0.62 vs 9.51 ± 0.66 g/dl. However, when isolated (N = 30 and paired (N = 30 tilapia were compared, there were significant differences in cortisol and metabolite levels. The similar response presented by dominant and subordinate tilapia indicates that establishment of dominance relationships was a stressor for both groups.

  15. An Overview of Vaccination Strategies and Antigen Delivery Systems for Streptococcus agalactiae Vaccines in Nile Tilapia (Oreochromis niloticus)

    Science.gov (United States)

    Munang’andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein

    2016-01-01

    Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia (Niloticus oreochromis) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy. PMID:27983591

  16. Effect of dietary genistein on growth performance, digestive enzyme activity, and body composition of Nile tilapia Oreochromis niloticus

    Science.gov (United States)

    Chen, Dong; Wang, Wei; Ru, Shaoguo

    2015-01-01

    An 8-week feeding experiment was performed to evaluate the effect of dietary genistein on growth performance, body composition, and digestive enzymes activity of juvenile Nile tilapia ( Oreochromis niloticus). Four isonitrogenous and isoenergetic diets were formulated containing four graded supplements of genistein: 0, 30, 300, and 3 000 μg/g. Each diet was randomly assigned in triplicate to tanks stocked with 15 juvenile tilapia (10.47±1.24 g). The results show that 30 and 300 μg/g dietary genistein had no significant effect on growth performance of Nile tilapia, but the higher level of genistein (3 000 μg/g) significantly depressed the final body weight and specific growth rate. There was no significant difference in survival rate, feed intake, feed efficiency ratio or whole body composition among all dietary treatments. An assay of digestive enzymes showed that the diet containing 3 000 μg/ggenistein decreased stomach and hepatopancreas protease activity, and amylase activity in the liver and intestine, while a dietary level of 300 μg/g genistein depressed stomach protease and intestine amylase activities. However, no significant difference in stomach amylase activity was found among dietary treatments. Overall, the results of the present study indicate that a high level of dietary genistein (3 000 μg/g, or above) would significantly reduce the growth of Nile tilapia, partly because of its inhibitory effect on the activity of major digestive enzymes. Accordingly, the detrimental effects of genistein, as found in soybean products, should not be ignored when applied as an alternative ingredient source in aquaculture.

  17. Depletion study, withdrawal period calculation and bioaccumulation of sulfamethazine in tilapia (Oreochromis niloticus) treated with medicated feed.

    Science.gov (United States)

    Nunes, Kátia S D; Vallim, José H; Assalin, Márcia R; Queiroz, Sonia C N; Paraíba, Lourival C; Jonsson, Claudio M; Reyes, Felix G R

    2018-04-01

    The residue depletion of sulfamethazine (SMZ) was evaluated in tilapia (Oreochromis niloticus) after 11 days of administration of medicated feed containing SMZ, at the dose of 422 mg/kg body weight (bw). The determination of SMZ in feed and tilapia fillet was carried out using the QuEChERS approach for sample preparation, and high performance liquid chromatography with diode array detector (HPLC-DAD) and ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-QToF-MS) for quantitation, respectively. Both methods were validated based on international and Brazilian guidelines and shown to be suitable for the intended purposes. The withdrawal period to reach the maximum residue level (MRL) of 100 μg/kg, according to the European Union (EU) legislative framework to all substances belonging to the sulfonamide (SA) group (EU, 2010), was 10 days (260 °C-day). After treatment, the maximum level of SMZ accumulation in the tilapia muscle was 1.6 mg/kg. SMZ was shown to be quickly excreted by tilapia. Thus, considering the acceptable daily intake of SMZ established by the Codex Commission (0-0.05 mg/kg bw), and a factor of 5 times the upper amount of fish consumption in Brazil (38 kg/year), this study showed that there is a low risk of adverse effects to consumers. This study offers subsidies not only for the establishment of public policies with regard to the use of veterinary drugs currently not allowed in a country by their legal legislative framework for fish farming, but also to fish producers for the proper handling to ensure safe fish fillets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. KUALITAS PAKAN FERMENTATIF BERBAHAN KULIT UBI KAYU DENGAN INOKULAN MEP+ UNTUK KULTUR IKAN NILA GESIT (Oreochromis niloticus L.

    Directory of Open Access Journals (Sweden)

    Cahiadir Ali Akbar

    2014-06-01

    Full Text Available Feed is a major component in fish farming. However, the relatively high price of feed is very burdensome for fish farmers. Therefore a relatively low-cost solution is needed to address that problem. The use of local materials such as bran, waste mushroom, tofu, onggok starch, and skin cassava can be utilized as an alternative to reduce the needs of imported materials. However, the local materials have constraints regarding nutrition and digestibility, so an appropriate technology is required to overcome this. Improving the quality of the feed can be done by fermentation. Fermentation works by breaking macromolecules such as carbohydrates and amino acids into micromolecules, so the absorption of feed nutrients in the fish intestines become more efficient. The use of inoculants MEP+ aimed to improve the digestibility of feed, detoxification and increased the productivity of tilapia GESIT (Oreochromis niloticus. This study aimed to determine the effect of fermentation on enhancing the quality of feed nutrients made from cassava skin chips by the application of inoculant MEP+. The study was carried out experimentally using a complete randomized design. The independent variable in this study was the type of feed. Observed dependent variable was feed quality. The main parameter measured was the proximate level. Supporting parameter was the growth of tilapia GESIT. The results showed a progressive increase in the levels of nutrients of feed fermented in each treatment. The increments were recorded in treatment A from 16.15 became 21.64, in B from 13.21 became 15.46, in C from 9.66 became 11.53, and in D from 8.34 became 9.87. This result implies that the use of MEP+ fermentation inoculants could boost the nutritional content of food, with an average of the increment value of 11-15%. The increment of nutrient contents in each treatment was also affected the weight gain of fish although no significant difference were observed.

  19. Β-defensin in Nile tilapia (Oreochromis niloticus): Sequence, tissue expression, and anti-bacterial activity of synthetic peptides.

    Science.gov (United States)

    Dong, Jun-Jian; Wu, Fang; Ye, Xing; Sun, Cheng-Fei; Tian, Yuan-Yuan; Lu, Mai-Xin; Zhang, Rui; Chen, Zhi-Hang

    2015-07-15

    Beta-defensins (β-defensins) are small cationic amphiphilic peptides that are widely distributed in plants, insects, and vertebrates, and are important for their antimicrobial properties. In this study, the β-defensin (Onβ-defensin) gene of the Nile tilapia (Oreochromis niloticus) was cloned from spleen tissue. Onβ-defensin has a genomic DNA sequence of 674 bp and produces a cDNA of 454 bp. Sequence alignments showed that Onβ-defensin contains three exons and two introns. Sequence analysis of the cDNA identified an open reading frame of 201 bp, encoding 66 amino acids. Bioinformatic analysis showed that Onβ-defensin encodes a cytoplasmic protein molecule containing a signal peptide. The deduced amino acid sequence of this peptide contains six conserved cysteine residues and two conserved glycine residues, and shows 81.82% and 78.33% sequence similarities with β-defensin-1 of fugu (Takifugu rubripes) and rainbow trout (Oncorhynchus mykiss), respectively. Real-time quantitative PCR showed that the level of Onβ-defensin expression was highest in the skin (307.1-fold), followed by the spleen (77.3-fold), kidney (17.8-fold), and muscle (16.5-fold) compared to controls. By contrast, low levels of expression were found in the liver, heart, intestine, stomach, and gill (tilapia with Streptococcus agalactiae (group B streptococcus [GBS] strain) resulted in a significantly upregulated expression of Onβ-defensin in the skin, muscle, kidney, and gill. In vitro antimicrobial experiments showed that a synthetic Onβ-defensin polypeptide had a certain degree of inhibitory effect on the growth of Escherichia coli DH5α and S. agalactiae. The results indicate that Onβ-defensin plays a role in immune responses that suppress or kill pathogens. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Toxicity evaluation of copper oxide bulk and nanoparticles in Nile tilapia, Oreochromis niloticus, using hematological, bioaccumulation and histological biomarkers.

    Science.gov (United States)

    Abdel-Khalek, Amr A; Badran, Shereen R; Marie, Mohamed-Assem S

    2016-08-01

    The increased industrial applications of nanoparticles (NPs) augment the possibility of their deposition into aquatic ecosystems and threatening the aquatic life. So, this study aimed to provide a comparable toxicological effects of nano-CuO and bulk CuO on a common freshwater fish, Oreochromis niloticus. Fish were exposed to two selected doses (1/10 and 1/20 of the LC50/96 h) of both nano-/bulk CuO for 30 days. Based on the studied hematological parameters (RBCs count, hemoglobin content and hematocrit%), the two selected concentrations of CuO in their nano- and bulk sizes were found to induce significant decrease in all studied parameters. But, nano-CuO-treated fish showed the maximum decrease in all recorded parameters among the all studied groups especially at the low concentration of 1/20 LC50/96 h. Hematological status was also confirmed using the calculated blood indices (MCV, MHC and MCHC). In case of bulk CuO-treated groups, the significant decrease in the studied hematological parameters was not followed by any change in MCV and MCH (normocytic anemia), while fish that exposed to NPs showed a significant increase in all calculated blood parameters reflecting erythrocytes swelling which is related to the intracellular osmotic disorders (macrocytic anemia). Regarding metal bioaccumulation factor, the results showed that CuO NPs had more efficiency to internalize fish tissues (liver, kidneys, gills, skin and muscle). The accumulation pattern of Cu metal was ensured by histopathological investigation of liver, kidneys and gills. The histopathological analysis revealed various alterations that varied between adaptation responses and permanent tissue damage.

  1. Selected Haematological and Biochemical Indices of Nile Tilapia (Oreochromis niloticus Reared in the Environment with Cyanobacterial Water Bloom

    Directory of Open Access Journals (Sweden)

    Miroslava Palíková

    2010-01-01

    Full Text Available The aim of this study was to evaluate the influence of toxic cyanobacterial water blooms on blood indices in the Nile tilapia (Oreochromis niloticus. Experimental fish were exposed to natural cyanobacterial water blooms (consisting mainly of Microcystis aeruginosa and M. ichthyoblabe which contained microcystins (total concentration 1187 - 1211 μg g-1 of dry weight and 17.4 - 25.4 μg l-1 of water for 28 days without additional feeding. Control groups of fish were kept in another pond without apparent cyanobacterial bloom formation. Experimental and control rearing ponds had the same water source. After exposure, fish were placed in dechlorinated potable water for the same period. Statistical evaluation of the influence of cyanobacterial water bloom on biochemical indices of experimental fish showed a distinct increase of alkaline phosphatase (p ⪬ 0.05, total bilirubin (p ⪬ 0.001, creatinine (p ⪬ 0.01, lactate (p ⪬ 0.01 and urea (p ⪬ 0.01 when compared to controls. After transfer to the dechlorinated potable water the experimental group showed significantly lower values of phosphorus (p ⪬ 0.001, urea (p ⪬ 0.01 and cholinesterase (p ⪬ 0.05 and higher values of lactate (p ⪬ 0.05 and iron (p ⪬ 0.05 compared to controls. It may be concluded that the exposure of the Nile tilapia to the environment containing cyanobacterial water bloom influenced only some biochemical indices. However, this modulation is to a much lower degree compared to the common carp and silver carp.

  2. EFEITO DO LACTOBACILLUS PLANTARUM NO TRATO INTESTINAL DE ALEVINOS DE OREOCHROMIS NILOTICUS

    Directory of Open Access Journals (Sweden)

    José Luís Pedreira Mouriño

    2015-01-01

    Full Text Available The objective of this study was to evaluate alterations in the intestinal tract microbiota and growth performance of Nile tilapia (Orechromis niloticus fed diets supplemented with Lactobacillus plantarum. One hundred and twenty sexually reversed fingerlings were stocked in six aquaria and divided into two treatments, in triplicate: fingerlings fed diet supplement with L. plantarum and fingerlings fed control diet. After 42 days, tilapia fed the diet supplemented with L. plantarum had higher amount of lactic acid bacteria, 3,5x104 CFU and 1,1x102 CFU per g tract, and lower total bacteria, 5,8x106 CFU and 5,2x107 CFU per g tract, than the fish fed the control diet. Furthermore, probiotics increased 3,9% the weekly weight gain, 15,6% final biomass and 15,5% feed efficiency. The use of probiotics in tilapia hatcheries boosts productivity.

  3. Abundance, food habits, and breeding season of exotic T ilapia zillii and native O reochromis niloticus L. fish species in Lake Zwai , Ethiopia

    Directory of Open Access Journals (Sweden)

    Padanillay C. Prabu

    2008-05-01

    Full Text Available Relative abundance, diet and breeding season overlap in the reproduction of exotic Tilapia zillii and native Oreochromis niloticus in Lake Zwai were studied from samples collected over 12 months. Younger fish of both species collected were also evaluated for food composition.Food items from stomachs of both species were collected and analysed using the frequency of occurrence method. In terms of number, T. zillii dominated O. niloticus at the sampling sites. In both species, macrophytes, detritus, blue green algae, diatoms, green algae, Ceratium, Euglena,and Phacus constituted foods of plant origin, whereas chironomid larvae, Copepoda, Cladocera,Rotifera, Nematoda, fish eggs, and fish scales constituted foods of animal origin. Foods of the latter type such as Ephemeroptera and mollusks were also noted in the diet of adult T. zillii.Despite the extensive overlap in food habits of the two species, however, the food items were found in the diet of the species with different average percentage frequencies of occurrence. The level of gonad maturation and gonadosomatic index (GSI values showed that in Lake Zwai breeding was year-round for both T. zillii and O. niloticus, with a peak during April-September and February-August respectively, indicating extended breeding season overlap in reproduction. The two species were always found together in the catches from the sampling sites, which indicated some niche overlap between them.

  4. Impact of replacing fish meal by a mixture of different plant protein sources on the growth performance in Nile Tilapia (Oreochromis niloticus L.) diets.

    Science.gov (United States)

    Al-Thobaiti, A; Al-Ghanim, K; Ahmed, Z; Suliman, E M; Mahboob, S

    2017-10-23

    The present study aimed to assess the appropriate level of replacement of fish meal (FM) with alternative plant sources in the feed fed to Oreochromis niloticus to evaluate the growth performance. Three isoproteinious (40% crude protein) diets were prepared from different ingredients viz., fish meal, corn gluten meal, wheat gluten meal, and bagasse kenna meal. O. niloticus showed a maximum increase in weight as 9.70, 11.09, 8.53 and 8.32 g during the 2nd, 2nd, 3rd and 2nd fortnight with feeding treatment A, B, C and D, respectively. The growth performance of the fish in terms of weight gain, specific growth rate, feed conversion ratio and protein efficiency ratio were found to be significantly (P replacement of fishmeal in diet B. The worst growth performance was observed in fish fed with commercial diet, designated as diet D. It was concluded that the fish meal can be replaced up to 20 percent with other plant protein sources without any negative impact on fish health. The replacement of fish meal with local plant sources (corn gluten meal, wheat gluten meal, soybean meal and bagasse kenna mix) will not only be beneficial to achieve better growth performance in O. niloticus, it will be a value addition as well.

  5. Flora bacteriana de tilápia do Nilo, Oreochromis niloticus, cultivada em sistema semi-intensivo - DOI: 10.4025/actascibiolsci.v25i2.2007 Bacterial microflora in the gastrointestinal tract of Nile tilapia, Oreochromis niloticus, cultured in a semi-intensive system- DOI: 10.4025/actascibiolsci.v25i2.2007

    Directory of Open Access Journals (Sweden)

    Benetido Prado Dias Filho

    2003-04-01

    Full Text Available A flora bacteriana de diferentes partes do trato gastrintestinal de tilápia Oreochomis niloticus L. (Cichlidae foi determinada. O número médio de bactérias foi maior no intestino anterior e posterior quando comparado ao estômago. A porcentagem total de espécies bacterianas isoladas e a porcentagem de espécies isoladas em uma espécie particular variaram significativamente entre as regiões do trato gastrintestinal. Aeromonas hydrophila, Aeromonas veronii, Burkholderia cepacia, Chromobacterium violaceum, Citrobacter freundii, Escherichia coli, Flavimonas oryzihabitans e Plesiomonas shigelloides foram os bacilos Gram-negativos encontrados com maior freqüência. Destas espécies, somente Plesiomonas shigelloides esteve presente em cada região do trato gastrintestinal, apresentando maior número no intestino posterior (76%, quando comparado com o intestino anterior (4.8% e o estômago (0.6%. Aeromonas hydrophila (0.6%, Escherichia coli (7.4%, e Flavimonas oryzihabitans foram isoladas somente do estômago, e Citrobacter freundii e Burkholderia cepacia foram encontradas somente no intestino posterior. Chromobacterium violaceum foi a espécie dominante isolada do estômago e do intestino anterior com 90% e 55%, respectivamente. Organismos não identificados compreendem 0 – 39.3% da microbiota gastrintestinalThis experiment measured total bacterial numbers in the gastrointestinal regions of semi-intensively cultured tilapia, Oreochromis niloticus L. (Cichlidae. Mean bacterial numbers were higher in both anterior and posterior gut than in stomach. The percentage of isolated species and the percentage of isolates from any particular species varied significantly among gastrointestinal tract regions. Aeromonas hydrophila, Aeromonas veronii, Burkholderia cepacia, Chromobacterium violaceum, Citrobacter freundii, Escherichia coli, Flavimonas oryzihabitans and Plesiomonas shigelloides were the most frequently isolated Gram-negative bacilli. From

  6. COMPENSATORY GROWTH OF Oreochromis niloticus SELECTED STRAIN FROM BOGOR, WEST JAVA

    Directory of Open Access Journals (Sweden)

    Vitas Atmadi Prakoso

    2017-12-01

    Full Text Available In efficient feed management strategy in aquaculture will increase the fish production cost. One of the most effective strategies to solve this problem is through a better understanding of the compensatory growth of cultured fish. O. niloticus BEST tilapia strain (total length: 7.23 ± 0.11 cm mean ± SD; Body weight: 7.04 ± 0.08 g mean ± SD were reared in aquariums at 26.3 ± 1.4oC for 10 weeks. During the experiment, the control group was fed twice a day. The other two groups were deprived of food for one and two weeks and then fed twice a day during refeeding period. At the end of the experiment, the fish deprived for one week had a body weight, biomass and specific growth rate that were not significantly different from the control group. The body weight, biomass and specific growth rate of fish deprived for two weeks were significantly lower than the other groups. This study revealed that concentrations of ash and lower concentrations of protein and lipid on the deprived groups were higher compared to those without feed deprivation. Mortality of fish was lower than 9% and not significantly different among the treatments. Fish aggressive behavior was the main reason for injuries and death. Given the results, BEST tilapia strain was only able to reach complete growth compensation not longer than one week deprivation period. The results of the present study could be applied as basic information for further research on feeding management of BEST tilapia strain.

  7. Comparison of the growth of males and females of tilapia Oreochromis Niloticus cultured in cages

    Directory of Open Access Journals (Sweden)

    Carlos Alvarado-Ruiz

    2015-01-01

    Full Text Available With the purpose of evaluating productive performance and potential weight gain capacity of snapper O. Niloticus without reversing, we evaluated the growth of males and females raised in floating cages in captivity grouped by gender. The experiment was conducted for a term of 150 days.  We used a simple 4 836 alevins of 26.2±19.7g, fish that were nourished until they visibly reached sexual differentiation to 119.3±56.5 g to be separated by sex and nourished in floating cages to a final average weight of 387.0±128.9g (harvestto determine differences in growth. The weight distribution of the undefined gender sample showed a decrease in the coefficient of variation (CV of 75.13% to 31.49 and 30.22 for males and females respectively. This indicates that the distribution of sizes of the samples tended to become normal during the cycle of harvest. Significant differences (P=0.05 for the weight of harvest 429.2±135.1g and 339.65±102.64 g.   For the growth rate 2.74±0.86g day y 2.18±0.68 g day were determined between males and females respectively. The standard error of the estimation of the difference of average weight between males and females was 89.62±7.23g for an accuracy level of 95%. Males displayed  better growth rate and weight gain for harvest.

  8. Effects of Garlic (Alliumsativum and chloramphenicol on growth performance, physiological parameters and survival of Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    A. M. Shalaby

    2006-04-01

    Full Text Available We studied and compared the effects of chloramphenicol antibiotic and garlic (Allium sativum, used as immunostimulants and growth promoters, on some physiological parameters, growth performance, survival rate, and bacteriological characteristics of Nile tilapia (Oreochromis niloticus. Fish (7±1g/fish were assigned to eight treatments, with three replicates each. Treatment groups had a different level of Allium sativum (10, 20, 30, and 40g/kg diet and chloramphenicol (15, 30, and 45mg/kg diet added to their diets; the control group diet was free from garlic and antibiotic. Diets also contained 32% crude protein (CP and were administered at a rate of 3% live body weight twice daily for 90 days. Results showed that the final weight and specific growth rate (SGR of O. niloticus increased significantly with increasing levels of Allium sativum and chloramphenicol. The highest growth performance was verified with 30g Allium sativum / kg diet and 30mg chloramphenicol / kg diet. The lowest feed conversion ratio (FCR was observed with 30g Allium sativum / kg diet and 30mg chloramphenicol / kg diet. There were significant differences in the protein efficiency ratio (PER with all treatments, except with 45mg chloramphenicol / kg diet. No changes in the hepatosomatic index and survival rate were observed. Crude protein content in whole fish increased significantly in the group fed on 30g Allium sativum / kg diet, while total lipids decreased significantly in the same group. Ash of whole fish showed significantly high values with 30g Allium sativum and 15mg chloramphenicol / kg diet while the lowest value was observed in the control group. Blood parameters, erythrocyte count (RBC, and hemoglobin content in fish fed on diets containing 40g Allium sativum and all levels of chloramphenicol were significantly higher than in control. Significantly higher hematocrit values were seen with 30 and 45mg chloramphenicol / kg diet. There were no significant differences

  9. Relação parasito-hospedeiro em peixes de pisciculturas da região de Assis, Estado de São Paulo, Brasil. 1. Oreochromis niloticus (Linnaeus, 1757 = Host-parasite relationship in fish from fish farms in the Assis region, São Paulo State, Brazil. 1. Oreochromis niloticus (Linnaeus, 1757

    Directory of Open Access Journals (Sweden)

    Maria de los Angeles Perez Lizama

    2007-04-01

    Full Text Available Um total de 90 espécimes de Oreochromis niloticus foi coletado bimestralmente entre os meses de fevereiro a dezembro de 2004, em três pisciculturas do Estado de São Paulo. Do total, 82,2% estavam parasitados por pelo menos uma espécie de parasito. Os parâmetros físicos e químicos da água foram utilizados para caracterizar a qualidade da água em cada propriedade. Sete espécies de ectoparasitos foram registradas. Foi possível observar que as pisciculturas apresentam a mesma parasitofauna, porém cada propriedade apresentauma estrutura da comunidade peculiar. Cichlidogyrus sclerosus e Cichlidogyrus sp. 1 apresentaram correlação negativa significativa da abundância com o comprimento padrão do hospedeiro somente em Palmital. A espécie Cichlidogyrus sp. 2 e o copépode Lamproglena sp.apresentaram correlação positiva significativa da abundância com o comprimento padrão nas pisciculturas de Tarumã e Cândido Mota, respectivamente. Em relação ao fator de condição relativo, somente a espécie Cichlidogyrus sp. 1 apresentou correlação significativa negativa com a abundância de parasitismo. Lamproglena sp. apresentou correlação positiva significativa com a relação hepatossomática (RHS das tilápias em Palmital, e o ergasilídeo apresentou correlação significativa negativa da abundância de parasitismo e a relaçãoesplenossomática (RES dos hospedeiros em Cândido Mota.A total of ninety specimens of Oreochromis niloticus were collected every other month between February and December of 2004 at three fish farms in São Paulo State. 82.2% were parasitized by at least one species of parasite. Physical and chemical water parameters were used to characterize water quality in each fish farm. Seven species of ectoparasites were registered. It was possible to observe that all fish farms presented the same parasite fauna; however, each farmfeatured its own peculiar community structure. Cichlidogyrus sclerosus and Cichlidogyrus sp.1

  10. Improvement of immunity and disease resistance in the Nile tilapia, Oreochromis niloticus, by dietary supplementation with Bacillus amyloliquefaciens.

    Science.gov (United States)

    Selim, Khaled M; Reda, Rasha M

    2015-06-01

    Probiotics can be used as immunostimulants in aquaculture. The aim of this study was to evaluate the immune responses of Nile tilapia Oreochromis niloticus following feeding with Bacillus amyloliquefaciens spores at concentrations of 1 × 10(6) (G3) and 1 × 10(4) (G2) colony-forming units per gram (CFU/g) of feed compared with a basal diet with no probiotics (G1). A total of 180 fingerlings (27.7 ± 0.22 g) were divided into three groups (G1-G3 of 20 fish per group) in triplicate. Innate immunities were measured every two weeks based on serum bactericidal activity, lysozyme activity, a nitric oxide assay (mmo/l) and phagocytic activity, and the expressions of interleukin-1 (IL-1) and tumor necrosis factor alpha (TNF α) were examined after one month. Moreover, the survival of tilapia upon challenge with Yersinia ruckeri or Clostridium perfringens type D was determined at the end of feeding trial. After 15 d, the serum killing percentages and phagocytic activities were significantly higher in G3 than in G1 and G2, whereas the same parameters had significantly higher values in G3 and G2 than in G1 after 30 d. After both 15 d and 30 d, the lysozyme activities and nitric oxide assay results (mmo/l) were significantly higher in G3 than G2, and the lowest values were observed in G1. The percentage of serum killing, serum nitric oxide and serum lysozyme activity were significantly increased by the time of B. amyloliquefaciens administration independently of the probiotic dose, and the phagocytic activity percentage was significantly decreased at the end of the experiment. Dietary B. amyloliquefaciens caused significant increases in IL-1 and TNF α mRNA levels in the kidneys in the following pattern: G3 > G2 > G1. Fish that were fed B. amyloliquefaciens exhibited better relative survival percentages than the controls when challenged by Y. ruckeri or C. perfringens type D. Dietary supplementation with B. amyloliquefaciens improves immune status and disease

  11. Processing yield of Nile tilapia (Oreochromis niloticus: head cut types and two weight classes Rendimento do processamento da tilápia-do-nilo (Oreochromis niloticus: tipos de corte da cabeça em duas categorias de peso

    Directory of Open Access Journals (Sweden)

    Maria Luiza Rodrigues de Souza

    2000-05-01

    Full Text Available The aim of this study was to evaluate the best type of head cut of Nile tilapia (Oreochromis niloticus resulting in better fillet processing yields. The experiment was carried out at the Pisciculture Station of UEM/Codapar, Maringá, Paraná, Brazil. One hundred and twenty specimens were slaughtered, head cut, eviscerated, and had their fin, skin and fillet removed. The fillet processing was undertaken by a single person. Plotting was completely randomized by a 2x3 factorial scheme. Treatments consisted of two weight categories ( W1=250-400g and W2=401-550g and three types of head cut (C1=oblique, OB; C2=Contour, CO, and C3=strainght, ST, with 20 replicates. Each fish was considered an experimental unit. Mean values of yield were expressed in relation to fish body weight. There was an influence of head cut types and weight categories on the dressed out and fillet yield. The yields in W2 (OB=50.42%, 35.27%; CO=50.70%, 35.18% and ST=48.50%, 33.82% were higher (p O objetivo do presente estudo foi avaliar o melhor tipo de corte de cabeça para decapitação da tilápia-do-nilo (Oreochromis niloticus, que resulte em melhores rendimentos de filetagem. O experimento foi conduzido na Estação de Piscicultura da UEM/Codapar, Maringá, PR. Foram abatidos 120 exemplares cortadas as cabeças, eviscerados, removidas as nadadeiras, pele e filés. O processo de filetagem foi realizado por uma única pessoa. O delineamento foi inteiramente casualizado, em esquema fatorial 2x3. Os tratamentos foram: duas categorias de peso (P1= 250-400 g e P2= 401-550 g e três tipos de corte de cabeça (C1=oblíquo, OB; C2=contornado, CO e C3=reto, RE, com 20 repetições. Cada peixe foi considerado a unidade experimental. Os valores médios de rendimento foram expressos em relação ao peso corporal do peixe. Houve influência do tipo de corte e categoria de peso sobre o rendimento do tronco limpo e filé. Os rendimentos em P2 (OB=50,42%, 35,27%; CO=50,70%, 35,18% e RE=48

  12. Farinha de vísceras de aves em rações para alevinos de tilápia do Nilo,Oreochromis niloticus (L. Poultry by-product meal in Nile tilapia (Oreochromis niloticus fingerlings diets

    Directory of Open Access Journals (Sweden)

    Anna Christina Esper Amaro de Faria

    2002-04-01

    Full Text Available Este estudo foi conduzido com o objetivo de avaliar o desempenho e as características de carcaças de alevinos de tilápia do Nilo (Oreochromis niloticus submetidos a rações com níveis de inclusão de farinha de vísceras (FV, assim como os coeficientes de digestibilidade aparente (CDA dos nutrientes deste alimento. Para o experimento de desempenho, foram utilizados 300 alevinos, com peso inicial médio de 0,35 ± 0,01 g, distribuídos em trinta tanques-rede (120 L, instalados em cinco tanques (1000 L. Foram utilizados seis níveis de inclusão de FV nas rações (0,00; 4,00; 8,00; 12,00; 16,00 e 20,00%, em um delineamento experimental, em blocos casualizados com seis tratamentos e cinco repetições. Realizou-se um ensaio de digestibilidade, com rações contendo 0,00 e 20,00% de FV, fornecidas a peixes com peso médio de 47,81 ± 9,97 g. Observou-se aumento linear da porcentagem de ganho de peso e taxas de eficiência protéica e de retenção de nitrogênio, com o aumento nos teores de FV nas rações, e efeito quadrático para conversão alimentar, taxa de retenção de extrato etéreo e porcentagens de proteína bruta e extrato etéreo na carcaça. Em relação à digestibilidade, a ração com 20,00% de FV apresentou menores CDA para a matéria seca, proteína bruta e energia bruta e maiores para extrato etéreo. Entretanto, maiores valores de extrato etéreo e energia digestíveis foram obtidos na ração com 20,00% de FV, embora a proteína digestível tenha sido inferior com 0,00% de FV. Os CDA do extrato etéreo, proteína bruta e energia bruta da farinha de vísceras foram de 70,45; 63,93 e 55,89%, respectivamente. A inclusão de 20,00% de FV na ração promoveu melhor desempenho, porém aumentou o teor de extrato etéreo e reduziu o de proteína bruta na carcaça, ocorrendo, ainda, diminuição dos CDA da matéria seca, proteína e energia bruta das rações.Performance, carcass characteristics and coefficients of apparent

  13. Desidratação osmotica, secagem e defumação liquida de files de tilapia do nilo (Oreochromis niloticus), variedade Tailandesa.

    OpenAIRE

    Marica Regina Simões

    2007-01-01

    Resumo: Foi estudada a influência de dois tratamentos na secagem convectiva de filé de Tilápia do Nilo (Oreochromis niloticus), variedade Tailandesa. No primeiro tratamento foi realizado o estudo do processo de desidratação osmótica utilizando solução binária (água + NaCl) e ternária (água + NaCl + sacarose). Foram verificadas as influências dos fatores: temperatura, concentração da solução osmótica e tempo de imersão, nas respostas, ganho de sólidos, perda de água, GS/PA e atividade de água ...

  14. Biochemical and cellularchanges in Oreochromis niloticus related to the water pollution of a degraded river - doi: 10.4025/actascibiolsci.v35i3.13207

    Directory of Open Access Journals (Sweden)

    Ary Gomes da Silva

    2013-08-01

    Full Text Available The effects of polluted water at three sites in the Marinho River, Brazil, on Oreochromis niloticus (Nile tilápia were investigated using histological, hematological and biochemical approaches. Fish exposed to the impacted water demonstrated that histological changes in gills were accompanied by nuclear and micronuclei abnormalities in cells. The activity of liver and plasma biomarkers (alkaline phosphatase (ALP, acid phosphatase (ACP, alanine aminotransferase (ALT, aspartate aminotransferase (AST and liver glutathione S-transferase (GST showed an expressive change due to the. The results were also correlated with the highest levels of Cu+2, Zn+2 and Mn+2 in the water. The data of this study evidenced the importance of using a set of biomarkers to quantify pollution in lentic ecosystems. Additionally, histological analyses of gills and erythrocytes have proven to be an important instrument for signaling the impact of pollutants in rivers.  

  15. Effects of dietary supplementation with green tea waste on growth, digestive enzyme and lipid metabolism of juvenile hybrid tilapia, Oreochromis niloticus × O. aureus.

    Science.gov (United States)

    Zheng, Qingmei; Han, Chunyan; Zhong, Yanmei; Wen, Rushu; Zhong, Ming

    2017-04-01

    An 8-week feeding trial was conducted to evaluate the effects of dietary supplementation with green tea waste (GTW) on growth, digestive enzyme and lipid metabolism of juvenile hybrid tilapia, Oreochromis niloticus × O. aureus. The fish (initial mean body weight, 12.63 ± 0.75 g) were fed five experimental diets that included 0 (control), 0.8, 1.6, 3.2 or 6.4 % of GTW in triplicate aquaria, twice daily. Growth performance, plasma metabolites content and liver and intestine digestive enzyme activities were determined. Fish accepted well all experimental diets during the trial, and no mortality was observed. The weight gain increased (P tilapia to improve growth performance, digestion efficacy and fat metabolism.

  16. Effects of dietary Astragalus polysaccharides (APS) on growth performance, immunological parameters, digestive enzymes, and intestinal morphology of Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Zahran, Eman; Risha, Engy; Abdelhamid, Fatma; Mahgoub, Hebata Allah; Ibrahim, Tarek

    2014-05-01

    This work investigated the potential immunomodulatory and growth-promoting effects of Astragalus polysaccharides (APS) in Nile tilapia (Oreochromis niloticus). The dietary supplementation with APS (1500 mg/kg of diet) caused a significant increase in growth parameters (initial and final weight, weight gain (WG), specific growth rate (SGR), feed conversion ratio (FCR) and feed intake (FI), when compared to non-supplemented control basal diet. In addition, APS upregulated the phagocytic activity, the respiratory burst activity, plasma lysozyme, the bactericidal activity, superoxide dismutase (SOD), glutathione peroxidase (GPx), and amylase activity. However, it had no effect on serum nitric oxide (NO) or Malondialdehyde (MDA) levels. While APS had no effect of intestinal histology, a slight increase in the villi length was recorded. Collectively, our results indicate that dietary APS supplementation could improve the growth performance and the immune parameters of cultured tilapia fish. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Coeficientes de digestibilidade e valores de aminoácidos digestíveis de alguns ingredientes para tilápia do Nilo (Oreochromis niloticus)

    OpenAIRE

    Furuya,Wilson Massamitu; Pezzato,Luiz Edivaldo; Pezzato,Antônio Celso; Barros,Margarida Maria; Miranda,Edma Carvalho de

    2001-01-01

    O objetivo deste estudo foi determinar o coeficiente de digestibilidade aparente (CDA) dos aminoácidos do milho, farelo de trigo, farelo de soja e da farinha de peixe. Empregaram-se juvenis de tilápia do Nilo (Oreochromis niloticus) (25,24 ± 3,88 g) alimentados com ração referência peletizada contendo 0,10% de óxido de crômio (indicador) e 33,78% de proteína bruta. O CDA médio dos aminoácidos foi de: 88,31; 77,40; 91,78 e 82,58% para o milho, farelo de trigo, farelo de soja e farinha de peixe...

  18. Acute toxicity, behavioral changes, and histopathological effects of deltamethrin on tissues (gills, liver, brain, spleen, kidney, muscle, skin) of Nile tilapia (Oreochromis niloticus L.) fingerlings.

    Science.gov (United States)

    Yildirim, M Ziynet; Benli, A Cağlan Karasu; Selvi, Mahmut; Ozkul, Ayhan; Erkoç, Figen; Koçak, Oner

    2006-12-01

    Deltamethrin, a synthetic pyrethroid contaminating aquatic ecosystems as a potential toxic pollutant, was investigated in the present study for acute toxicity. The purpose of this study was to evaluate LC(50) values of deltamethrin on Nile tilapia (Oreochromis niloticus L.) fingerlings and investigate histopathological responses of fish exposed to deltamethrin. The 48 h LC(50) value for Nile tilapia fingerlings was estimated as 4.85 microg/L using static test system. In addition, behavioral changes at each deltamethrin concentration were observed closely. All fish, exposed to 5 microg/L deltamethrin revealed severe morphological alterations in the gills and liver. In the gills hyperemia, fusion of secondary lamellae and telangiectasis were observed; whereas hydropic degenerations in liver were observed in all examined fish. The results are significant for reporting acute deltamethrin toxicity in terms of behavioral and histopathological changes: Deltamethrin is highly toxic to fingerlings. (c) 2006 Wiley Periodicals, Inc.

  19. Somatic growth effects of intramuscular injection of growth hormone in androgen-treated juvenile Nile tilapia, Oreochromis niloticus (Perciformes: Cichlidae

    Directory of Open Access Journals (Sweden)

    Marco A. Liñán-Cabello

    2013-03-01

    Full Text Available Little is known about the effects of the interaction of growth hormone (GH with 17 a-methyltestosterone (17-MT during fish growth. We evaluated this in the present study to assess the effect on fish growth. Fish in two batches of juvenile tilapia (Oreochromis niloticus (approximately 5.0cm in length were randomly assigned in triplicate to three treatments and a control group, distributed among 12 fiberglass tanks of 1 000L capacity (50 fish per tank in an experiment covering a period of six weeks. The experimental groups were: a fish treated with 17-MT and GH in mineral oil (RGH; b fish treated with 17-MT and mineral oil without the addition of GH (R; c fish treated with GH in mineral oil but not 17-MT (NGH; and d fish of the control group, which were treated with mineral oil but not 17-MT or GH (N. The GH was injected into the fish at a rate of 0.625mg/g body weight. Morphometric data were recorded at the beginning of the experiment (T and at 15, 30 and 45 days (T, T and T, and various indicators of growth were assessed: condition factor (K; survival percentage (S, feed conversion rate (FCR, percentage weight gain (WG and (v daily weight gain. The optimum dietary level was calculated assuming 5% food conversion to total weight in each group. During the experiment, the fish were provided with a commercial food containing 45% protein. The data showed that GH injection resulted in a greater weight gain in fish treated with 17-MT (the RGH treatment group, being particularly significant increase in weight during T and T (pActualmente, durante el crecimiento de los peces existe poco conocimiento sobre los efectos de la interacción de la hormona del crecimiento (HC con 17 α-metiltestosterona (17-MT. En el presente estudio los peces en dos lotes de tilapia (Oreochromis niloticus (5.0cm de longitud, fueron asignados al azar por triplicado a tres tratamientos y un grupo control, distribuidos en 12 tanques de fibra de vidrio de 1 000 litros (50 peces

  20. Digestibilidade aparente de macrófitas aquáticas pela tilápia-do-nilo (Oreochromis niloticus e qualidade da água em relação às concentrações de nutrientes Apparent digestibility of aquatic macrophytes by Nile tilapia (Oreochromis niloticus and water quality in relation nutrients concentrations

    Directory of Open Access Journals (Sweden)

    Gustavo Gonzaga Henry-Silva

    2006-06-01

    Full Text Available Objetivou-se com este estudo determinar os coeficientes de digestibilidade aparente (CDA da proteína bruta e dos aminoácidos de duas espécies de macrófitas aquáticas flutuantes (Eichhornia crassipes e Pistia stratiotes pela tilápia-do-nilo (Oreochromis niloticus e verificar a qualidade da água dos aquários de digestibilidade em relação às concentrações de nitrogênio e fósforo. Foram elaboradas três rações, marcadas com 0,10% de óxido de cromo-III, sendo uma ração-referência (purificada e as demais contendo 30% de cada uma das macrófitas aquáticas. As tilápias-do-nilo (58,8 + 18,5 g foram alimentadas até a saciedade aparente e a coleta de fezes foi feita pelo sistema Guelph modificado. Os CDA médios da proteína e dos aminoácidos foram, respectivamente, 93,17 e 93,32% para a ração-referência; 59,23 e 60,35% para E. crassipes; e 52,24 e 57,40% para P. stratiotes. Não foram constatadas diferenças significativas entre os valores de CDA da proteína e dos aminoácidos dos ingredientes vegetais. Os resultados obtidos demonstraram reduzida eficiência da tilápia-do-nilo em assimilar a maioria dos aminoácidos de E. crassipes e P. stratiotes. As excretas das tilápias-do-nilo contribuíram para o aumento das concentrações de nitrogênio e fósforo na água dos aquários, independentemente da ração fornecida.The objectives of this trial were to determine the apparent digestibility coefficients (ADC of crude protein and amino acids for two species of free floating aquatic macrophytes (Eichhornia crassipes and Pistia stratiotes by Nile tilapia (Oreochromis niloticus and to determine the water quality of digestibility aquariums in relation nitrogen and phosphorus concentrations. Tree feeds were developments, containing 0.10% of chromic oxide - III, one being the reference diet (purified and the others containing 30% of aquatic macrophytes. The Nile tilapias (58.8 + 18.5 g were fed to apparent satiation and the faeces

  1. Influence of water temperature and waterborne cadmium toxicity on growth performance and metallothionein-cadmium distribution in different organs of Nile tilapia, Oreochromis niloticus (L.).

    Science.gov (United States)

    Abdel-Tawwab, Mohsen; Wafeek, Mohammed

    2014-10-01

    Cadmium (Cd) is believed to be one of the most abundant and ubiquitously distributed toxins in the aquatic system. This metal is released to the aquatic environment from both anthropogenic sources, such as industrial, agricultural and urban effluents as well as natural sources, such as rocks and soils. Otherwise, the temperature increase of water bodies, which has been observed due to global climatic changes, has been shown to increase Cd toxicity for several aquatic animal species including fish. In the present study, Nile tilapia, Oreochromis niloticus (L.), (26.0 ± 0.38 g) were reared at 20, 24, 28, or 32 °C and exposed to 0.0 or 0.5mg Cd/L for 8 weeks to investigate effects of water temperature, Cd toxicity and their interaction on fish performance as well as metallothionein (MT) and Cd distribution in different fish organs. It was found that fish reared in Cd-free group at 28 °C showed the optimum growth and feed intake, while Cd-exposed fish showed low growth and feed intake irrespective to water temperature. A synergetic relationship between water temperature and Cd toxicity was observed where Cd toxicity increased as water temperature increased and the worse growth was obtained in Cd-exposed fish reared at 32 °C. Additionally, the highest Cd residues in different fish organs were detected in Cd-exposed fish reared at 32 °C. Similarly, MT concentrations in different fish organs increased as water temperature increased especially in Cd-exposed fish groups. A high positive correlation between MT and Cd concentrations in fish organs was detected. The distribution of MT and Cd levels was in the order of liver>kidney>gills>muscles. The present study revealed that the optimum water temperature suitable for Nile tilapia growth is 28 °C. Additionally, Cd exposure had a deteriorate effect on the growth and health of Nile tilapia. This hazardous effect increased as water temperature increased. Further, liver and kidney were the prime sites of Cd accumulation

  2. Protocolo para criação intensiva de juvenis de tilápias oreochromis niloticus em tanques rede em um reservatório subtropical

    Directory of Open Access Journals (Sweden)

    Aldi Feiden

    2016-11-01

    Full Text Available The formation of juvenile tilapia Oreochromis niloticus in cages in subtropical reservoirs is an alternative to optimize the annual rearing cycles. The aim of this study was to propose a production protocol for juvenile tilapia O. niloticus reared in cages in a reservoir of a hydroelectric dam on the Iguaçu river during winter - spring. The experimental period was from April to October 2013, and 150,000 fingerlings were used with an average weight of 3.0 ± 0.5 g, distributed in 8 cages with volume of 27 m³. The water temperature was 21.1 ± 1.8 ° C. Sampling was done every 15 days to calculate and adjust the amount of feed offered to the animals. The diets were offered: mash diet with 45% crude protein (CP, then extruded diet with 38% CP (2 mm and diet with 32% CP (3 mm. The survival of juveniles was 76.42 ± 7.2%. The final mean weight was 142.37 ± 12.6 g, and the cost per kg of fish was R$ 4.54 reais. The proposed protocol optimizes the aquaculture production of tilapia in the reservoir, indicating the period from May to October for training of youth and the period from November to April for fattening of fish in order to reduce the negative impacts caused by seasonal temperature reduction water.

  3. Efecto Genotóxico del Dicromato de Potasio EnEritrocitos de sangre periférica de OreochromisNiloticus (Tilapia

    Directory of Open Access Journals (Sweden)

    Zulita Prieto

    2008-01-01

    Full Text Available Existen múltiples reportes del efecto genotóxico y cancerígeno del cromo VI, los seres humanos tenemos una permanente exposición a este elemento. Objetivos. Evidencias la genotoxicidad del dicromato de potasio utilizando como sistema biológico a Oreochromis niloticus "tilapia", mediante el test de micronúcleos y la cuantificación de nuclear buds, en eritrocitos de sangre periférica. Materiales y métodos. Los individuos fueron expuestos a concentraciones crecientes (0,0, 0,2, 0,4 y 0,8 ppm de dicromato de potasio. Se obtuvieron muestras de sangre periférica, del arco branquial de cada individuo (cuatro por grupo, a los tres y siete días de tratamiento, las cuales fueron procesadas y coloreadas con Giemsa 5% y se cuantificaron eritrocitos con micronúcleos y nuclear buds en sangre periférica. Resultados. Se encontró un incremento significativo de las frecuencias de micronúcleos y nuclear buds directamente proporcional a la concentración del dicromato de potasio en los individuos expuestos (p<0,05. Conclusiones. El dicromato de potasio produce daño genético en los eritrocitos de O. niloticus.

  4. Effect of dietary supplementation of inulin and vitamin C on the growth, hematology, innate immunity, and resistance of Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Ibrahem, Mai D; Fathi, Mohamed; Mesalhy, Salah; Abd El-Aty, A M

    2010-08-01

    The in vivo activities of inulin and ascorbic acid were evaluated experimentally via using 450 Nile tilapia (Oreochromis niloticus) that were distributed into 3 equal groups (each of three replicates). Fish of the first group served as a control and received a balanced diet free from inulin and vitamin C. The second fed on balanced diet supplemented with inulin (5 g kg(-1)), whereas, the third one received a balanced diet supplemented with vitamin C (500 mg kg(-1)). The survival and growth performances were evaluated. Blood samples were collected from the experimented tilapia, one and two months from the onset of the experiment to measure the hematocrit (HCT) values, nitroblue tetrazolium (NBT), and lysozyme activity. The protective effect of the two compounds was evaluated via challenge infection using pathogenic Aeromonas hydrophila. The body weight gain (g); specific growth rate (%), and survival (%) were significantly increased (p inulin and vitamin C after one and two months of exposures vs. the control. The HCT values showed non-significant changes in both supplemented groups after one and two months. The NBT was significantly increased (p inulin that would positively affect growth, hematology, innate immunity, and resistance of Nile tilapia (O. niloticus) in aquaculture. Copyright 2010 Elsevier Ltd. All rights reserved.

  5. Assessment of mutagenic, hematological and oxidative stress biomarkers in liver of Nile tilapia, Oreochromis niloticus (Linnaeus, 1758) in response to sublethal verapamil exposure.

    Science.gov (United States)

    Ajima, Malachy N O; Pandey, Pramod K; Kumar, Kundan; Poojary, Nalini

    2017-07-01

    The influx of pharmaceutical drugs and their metabolites have been reported to cause negative impact on aquatic biota. In this study, effects of long-term exposure of verapamil on mutagenic, hematological parameters and activities of the oxidative enzymes of Nile tilapia, Oreochromis niloticus were investigated for 60 days exposure at the concentrations of 0.29, 0.58 and 1.15 mg L -1 in the fish liver. The exposure resulted in significantly high (p biomarkers (lipid peroxidation and carbonyl protein) showed elevated level, depicting a positive correlation with both time and concentration. More so, the activity of energy-related parameter (Na +  -K + - ATPase) in the tissue was significantly inhibited (p < 0.05) at the end of 60 days exposure period. Further, the activity of catalase (CAT) was inhibited while reduced glutathione (GSH) level was decreased in the liver tissue. There was increase in the activities of superoxide dismutase (SOD), glutathione peroxidase (GPx) and glutathione-S-transferase (GST) after 30 days at 0.29 mg L -1 . The study demonstrated that prolonged exposure to verapamil at sublethal concentration can result in mutagenic effects and oxidative dysfunctions in O. niloticus.

  6. Growth and Survival Rate of Tilapia (Oreochromis niloticus Larvae Fed by Daphnia magna Cultured With Organic Fertilizer Resulted From Probiotic Bacteria Fermentation

    Directory of Open Access Journals (Sweden)

    Vivi Endar Herawati

    2015-10-01

    Full Text Available Daphnia magna is a potential feed for fish. The aim of this research was to find the best treatment and effect of D. magna culture addition from fermented organic fertilizer, to growth and survival rate of Oreochromis niloticus larvae. There were five treatments, each with three repetitions used in the study. All treatments used chicken dung, and different combinations of rice bran, coconut oilcake waste and tilapia larvae. Feeding on tilapia was given by ad libitum method for five times a day until 14 days. Water quality during the research was maintained at temperature 28–29°C, DO 0.3 ppm and pH 8.1–8.2. Observed variables include relative growth rate, survival rate, food consumption rate and water quality. Our results showed that D. magna cultured by fermented organic fertilizer for tilapia larvae (O. niloticus had high significant effect (p < 0.01 on the relative growth rate and survival rate. Treatment of D. magna cultured by 1.2 g/L chicken manure, 0.9 g/L rice bran and 0.3 g/L coconut oilcake showed the highest value on the relative growth rate (10.86%; survival rate (98.46% and food consumption at first week (106.43% and second week (152.76%.

  7. Effects of replacing fish meal with rubber seed meal on growth, nutrient utilization, and cholesterol metabolism of tilapia (Oreochromis niloticus × O. aureus).

    Science.gov (United States)

    Deng, Junming; Wang, Kun; Mai, Kangsen; Chen, Liqiao; Zhang, Lu; Mi, Haifeng

    2017-08-01

    A feeding trial was conducted to evaluate the effects of replacing fish meal with rubber seed meal (RSM) on growth, nutrient utilization, and cholesterol metabolism of tilapia (Oreochromis niloticus × Oreochromis aureus). Five experimental diets were formulated with 0, 150, 300, 450, and 600 g kg -1 RSM replacing graded levels of fish meal, respectively. Each diet was randomly assigned to triplicate groups of 25 fish (initial average weight 65.3 g) per aquarium in a rearing system maintained at 29 ± 1 °C for 8 weeks. Dietary 150 g kg -1 RSM inclusion did not affect the weight gain and daily growth coefficient, whereas these were depressed by a further inclusion. Additionally, feed efficiency ratio and protein efficiency ratio were not affected by dietary RSM inclusion regardless of inclusion level. However, the inclusion of 450 and 600 g kg -1 RSM decreased the mid-intestinal trypsin, lipase, and amylase activities; the hepatic acyl-CoA/cholesterol acyl transferase; low-density lipoprotein receptor; and 3-hydroxy-3-methyl-glutaryl-CoA reductase activities. Similarly, dietary 600 g kg -1 RSM inclusion inhibited the plasma catalase and hepatic glutathione peroxidase activities. These results indicated that 150 g kg -1 RSM can be included in tilapia diets, whereas higher inclusion of RSM inhibited the growth rate, digestive enzyme activity, antioxidant capacity, and cholesterol metabolism.

  8. Effect of synbiotics between Bacillus licheniformis and yeast extract on growth, hematological and biochemical indices of the Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    M.S. Hassaan

    2014-01-01

    Full Text Available Twelve practical diets were formulated to contain four levels of Bacillus licheniformis (0.0, 0.24 × 106, 0.48 × 106 and 0.96 × 106 CFU g−1, respectively, with three yeast extract levels (0%, 0.5% and 1%, respectively. Each diet was randomly assigned to duplicate groups of 50 Nile tilapia (Oreochromis niloticus (5.99 ± 0.03 g in 24 concrete ponds (0.5 m3 and 1.25 m depth for 12 weeks. Increasing dietary B. licheniformis levels in O. niloticus and yeast extract levels significantly (P < 0.01 improved growth performance and nutrient utilization. Supplementation of the experimental diets with, 0.48 × 106 CFU/g−1 and 1.0% yeast extract showed the best nutrient utilization compared to other treatments. All probiotic levels significantly (P < 0.01 increased chemical composition (P < 0.05 compared to the control group, while increasing yeast extract did not significantly alter chemical composition. Hematological indices, total protein and albumin of O. niloticus significantly increased while aspartate aminotransferase and alanine aminotransferase significantly (P < 0.01 decreased with an increase in B. licheniformis level up to 0.48 × 106 CFU g−1. Increasing levels of yeast extract had no effect on hematological parameters and the diets supplemented with 0.48 × 106 CFU g−1 and 0.5% yeast extract showed the highest hematological values.

  9. Toxicidade aguda e risco ambiental do antibiótico oxitetraciclina para tilápia ( Oreochromis niloticus , Daphnia magna e Lemna minor

    Directory of Open Access Journals (Sweden)

    A.A. Machado

    Full Text Available RESUMO O objetivo deste estudo foi classificar o antibiótico Terramicina(r de acordo com a toxicidade aguda e o risco de intoxicação ambiental para Oreochromis niloticus, Daphnia magna e Lemna minor, com base no seu ingrediente ativo oxitetraciclina (OTC. Além disso, observou-se a ocorrência de sinais de intoxicação aguda em peixes e o efeito da diluição do antibiótico sobre as variáveis de qualidade de água. Alevinos, neonatos e frondes foram expostos a concentrações de OTC. De acordo com os resultados dos testes de toxicidade aguda, a Terramicina(r foi classificada pela toxicidade aguda e pelo risco de intoxicação ambiental. Para O. niloticus, a CL(I50; 48h calculada foi de 6,92 mg L-1, para D. magna a CE(I50; 48h foi de 0,17mg.L-1, enquanto para L. minor a CI(I50;7d foi de 0,68 mg L-1. A Terramicina(r foi classificada como muito tóxica para O. niloticus e extremamente tóxica para D. magna e L. minor e causa risco de intoxicação ambiental para os três organismos testados. Concentrações de 7,5 e 8,0 mg L-1 de OTC reduziram a concentração de oxigênio dissolvido na água. De acordo com este estudo, a Terramicina(r não deve ser utilizada na aquicultura, pois é altamente tóxica e causa risco de intoxicação ambiental aos organismos teste.

  10. The role of vitamins A, C, E and selenium as antioxidants against genotoxicity and cytotoxicity of cadmium, copper, lead and zinc on erythrocytes of Nile tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Harabawy, Ahmed S A; Mosleh, Yahia Y I

    2014-06-01

    This study was carried out to investigate the genotoxic and cytotoxic potentials of sublethal concentration (5mg L(-1)) of combined metals including Cd, Cu, Pb and Zn (1.25mg L(-1) of each) on erythrocytes of Nile tilapia, Oreochromis niloticus after exposure for five and seven days; and to evaluate the protective role of vitamin E alone and a combination of selenium (Se) with vitamins A, C and E which was added to the diet as antioxidants against the genotoxicity and cytotoxicity of these metals. This was accomplished by application of micronuclei (MN), binuclei (BN), nuclear abnormalities (NAs) assays in addition to morphological erythrocyte alteration (MAEs) assay. The results revealed that, exposure of O. niloticus to Cd, Cu, Pb and Zn induced the formation of nine genotoxic endpoints including MN, BN and seven patterns of NAs, kidney-shaped nuclei, blebbed nuclei, lobed nuclei, bilobed nuclei, notched nuclei, hook-shaped nuclei and vacuolated nuclei; and five patterns of morphological malformations were recorded as cytotoxic endpoints including echinocytes, acanthocytes, teardrop-like erythrocytes, microcytes and fused erythrocytes. Frequencies of these abnormalities were significantly different (pmetals-treated fish. But, addition of a combination of Se with vitamins A, C and E in the diet resulted in more significant decrease (pmetals only and fish treated with metals and supplied with vitamin E alone in the diet. Therefore, this study confirms the powerful protective potential of the vitamin E alone and a combination of SE with vitamins A, C and E as antioxidants against the genotoxicity and cytotoxicity of Cd, Cu, Pb and Zn in erythrocytes of O. niloticus. Also, confirmed on the validity of MN test and NAs in addition to MAEs as effective indicators and valuable sensitive monitoring tools for detecting genotoxic and cytotoxic agents in the aquatic environment. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Comparative physical maps derived from BAC end sequences of tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Lindblad-Toh Kerstin

    2010-11-01

    Full Text Available Abstract Background The Nile tilapia is the second most important fish in aquaculture. It is an excellent laboratory model, and is closely related to the African lake cichlids famous for their rapid rates of speciation. A suite of genomic resources has been developed for this species, including genetic maps and ESTs. Here we analyze BAC end-sequences to develop comparative physical maps, and estimate the number of genome rearrangements, between tilapia and other model fish species. Results We obtained sequence from one or both ends of 106,259 tilapia BACs. BLAST analysis against the genome assemblies of stickleback, medaka and pufferfish allowed identification of homologies for approximately 25,000 BACs for each species. We calculate that rearrangement breakpoints between tilapia and these species occur about every 3 Mb across the genome. Analysis of 35,000 clones previously assembled into contigs by restriction fingerprints allowed identification of longer-range syntenies. Conclusions Our data suggest that chromosomal evolution in recent teleosts is dominated by alternate loss of gene duplicates, and by intra-chromosomal rearrangements (~one per million years. These physical maps are a useful resource for comparative positional cloning of traits in cichlid fishes. The paired BAC end sequences from these clones will be an important resource for scaffolding forthcoming shotgun sequence assemblies of the tilapia genome.

  12. Lake Victoria wetlands and the ecology of the Nile Tilapia, Oreochromis Niloticus Linné

    NARCIS (Netherlands)

    Balirwa, J.S.

    1998-01-01

    The importance of Lalspecies were

  13. SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Angela Mariana Lusiastuti

    2009-12-01

    Full Text Available Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA and the result was read by Sequence Navigator program (Applied Biosystem. Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish

  14. Molecular characterization and functional analysis of IRF3 in tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Gu, Yi-Feng; Wei, Qun; Tang, Shou-Jie; Chen, Xiao-Wu; Zhao, Jin-Liang

    2016-02-01

    Interferon regulatory factor 3 (IRF3) plays a key role in interferon (IFN) response and binding to the IFN stimulatory response elements (ISREs) within the promoter of IFN and IFN-stimulated genes followed by virus infection. In the current study, we discovered one IRF3 homologue in tilapia genome and analyzed the characterizations and functions of tilapia IRF3. Tilapia IRF3 contains 1368 bp with an ORF of 455 aa. Structurally, tilapia IRF3 protein typically shares the conserved characterizations with other species' IRF3 homologues, displaying conserved DNA-binding domain, IRF association domain, serine-rich C terminal domain, and tryptophan residue cluster. Phylogenetic analysis illustrated that tilapia IRF3 belongs to the IRF3 subfamily. Real-time PCR revealed a broad expression pattern of tilapia IRF3 in various tissues. Subcellular localization analysis showed that tilapia IRF3 mainly resides in the cytoplasm, Western blot demonstrated that IRF3 was distributed in the cytoplasmic fraction. Functionally, IRF3 was found to be transcriptionally up-regulated by the poly I:C stimulation. Moreover, reporter assay elucidated that tilapia IRF3 serves as a regulator in mediating IFN response by increasing the activity of IFN-β and ISRE-containing promoter. These data supported the view that tilapia IRF3 is a potential molecule in IFN immune defense system against viral infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Molecular cloning, functional identification and expressional analyses of FasL in Tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Ma, Tai-yang; Wu, Jin-ying; Gao, Xiao-ke; Wang, Jing-yuan; Zhan, Xu-liang; Li, Wen-sheng

    2014-10-01

    FasL is the most extensively studied apoptosis ligand. In 2000, tilapia FasL was identified using anti-human FasL monoclonal antibody by Evans's research group. Recently, a tilapia FasL-like protein of smaller molecule weight was predicted in Genbank (XM_003445156.2). Based on several clues drawn from previous studies, we cast doubt on the authenticity of the formerly identified tilapia FasL. Conversely, using reverse transcription polymerase chain reaction (RT-PCR), the existence of the predicted FasL-like was verified at the mRNA level (The Genbank accession number of the FasL mRNA sequence we cloned is KM008610). Through multiple alignments, this FasL-like protein was found to be highly similar to the FasL of the Japanese flounder. Moreover, we artificially expressed the functional region of the predicted protein and later confirmed its apoptosis-inducing activity using a methyl thiazolyl tetrazolium (MTT) assay, Annexin-V/Propidium iodide (PI) double staining, and DNA fragment detection. Supported by these evidences, we suggest that the predicted protein is the authentic tilapia FasL. To advance this research further, tilapia FasL mRNA and its protein across different tissues were quantified. High expression levels were identified in the tilapia immune system and sites where active cell turnover conservatively occurs. In this regard, FasL may assume an active role in the immune system and cell homeostasis maintenance in tilapia, similar to that shown in other species. In addition, because the distribution pattern of FasL mRNA did not synchronize with that of the protein, post-transcriptional expression regulation is suggested. Such regulation may be dominated by potential adenylate- and uridylate-rich elements (AREs) featuring AUUUA repeats found in the 3' untranslated region (UTR) of tilapia FasL mRNA. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Ecotoxicity of natural insecticide based on tobacco plant extract and hematological effects on the Nile tilapia (Oreochromis niloticus. Ecotoxicity and hematological effects of a natural insecticide based on tobacco (Nicotiana tabacum extract on Nile tilapia (Oreochromis niloticus - doi: 10.4025/actascibiolsci.v35i2.14131

    Directory of Open Access Journals (Sweden)

    Marisa Narciso Fernandes

    2013-05-01

    Full Text Available Natural insecticides derived from plant extracts have been used as an alternative to synthetic products in order to reduce environmental contamination. The present study aimed to examine the effects of Fumydro®, a natural insecticide based in the tobacco plant Nicotiana tabacum, on the Nile tilapia (Oreochromis niloticus by determining the 48-h LC50 and evaluating their effects on hematological variables. Adult specimens of O. niloticus were exposed to four Fumydro® concentrations (200, 300, 400 and 500 μL L-1. The 48-h LC50 of Fumydro® was determined as 370 ± 50 μL L-1. Surviving fish showed increasing in the red blood cells, hemoglobin concentration, mean corpuscular hemoglobin and mean corpuscular hemoglobin concentration. The thrombocytes did not change but the percentage of neutrophils increased. These results indicated that the insecticide Fumydro® is toxic to Nile tilapia and the changes of the erythrocyte variables suggested hypoxemia induction with low effect on the immune system.Natural insecticides from plant extracts represent an alternative to the highly toxic synthetic products in order to reduce environmental contamination; however some might also be toxic for non-target organisms. The present study determined the 50% lethal concentration (48h; LC50 for adults Nile tilapia (Oreochromis niloticus exposed to the natural insecticide Fumydro®, based on the tobacco plant (Nicotiana tabacum, and evaluated its effect on hematological variables. After preliminary tests, adult specimens of O. niloticus were exposed to four Fumydro® concentrations (200, 300, 400 and 500 μL L-1. The 48h; LC50 of Fumydro® was determined at 370 ± 50 μL L-1. The surviving fish after exposure to Fumydro® showed an increase in the number of red blood cells, hemoglobin concentration, mean corpuscular hemoglobin and mean corpuscular hemoglobin concentration. The number of thrombocytes and leukocytes has not changed, unlike the differential leukocyte

  17. Caracterização da mitocôndria isolada de fígado de tilápia-do-nilo (Oreochromis niloticus e alterações da bioenergética mitocondrial causadas pela exposição herbicida oxifluorfena Characterization of liver mitochondria from Nile tilapia (Oreochromis niloticus and mitochondrial bioenergetics alterations caused by exposure to oxyfluorfen herbicide

    Directory of Open Access Journals (Sweden)

    F.P. Peixoto

    2009-04-01

    Full Text Available Descreve-se um método de isolamento de mitocôndrias acopladas de tilápia-do-nilo Oreochromis niloticus, isoladas de células hepáticas de peixes adultos. As mitocôndrias estavam metabolicamente ativas, sendo capazes de realizarem fosforilação oxidativa, de acordo com os valores do quociente de controle respiratório. Os valores de controle respiratório obtidos com malato/piruvato (complexo I e com succinato (complexo II foram de 5,8±0,8 e 3,38±0,4, respectivamente. O potencial de membrana exibiu o valor de 197±4mV, quer se utilizasse malato/piruvato ou succinato como substrato. O procedimento de isolamento de mitocôndrias de O. niloticus permite o estudo do efeito de xenobióticos na bioenergética mitocondrial, tendo sido avaliada a ação da oxifluorfena (0,6mgL-1 na bioenergética mitocondrial. Os resultados demonstram que o tratamento com oxifluorfena influencia a capacidade fosforilativa dos peixes, interferindo na sua carga energética, o que poderá levar à sua morte.A method for isolation of coupled mitochondria isolated from the liver of adult Nile tilapia Oreochromis niloticus is described for the first time. They were metabolically active, able to sustain oxidative phosphorylation, as shown by respiratory control ratio values, which were about 5.8±0.8 and 3.3±0.4 when respiring on malate/piruvate (complex I or succinate (complex II, respectively, as substrate. Membrane potential exhibited a value of approximately 197±4mV for malate/piruvate or succinate. The procedure now described for the isolation of O. niloticus mitochondria is an important new tool, allowing the study about the effect of xenobiotics on mitochondrial bioenergetic, being evaluated the effect of oxyfluorfen (0.6mgL-1 in the liver mitocondrial bioenergetic. These results showed that phosphorylation was significantly affected by oxyfluorfen which contributed to the decrease on the liver cell energy charge and consequently led to the fish dead.

  18. Coeficientes de digestibilidade e valores de aminoácidos digestíveis de alguns ingredientes para tilápia do Nilo (Oreochromis niloticus) Digestibility coefficients and digestible amino acids values of some ingredients for Nile tilapia (Oreochromis niloticus)

    OpenAIRE

    Wilson Massamitu Furuya; Luiz Edivaldo Pezzato; Antônio Celso Pezzato; Margarida Maria Barros; Edma Carvalho de Miranda

    2001-01-01

    O objetivo deste estudo foi determinar o coeficiente de digestibilidade aparente (CDA) dos aminoácidos do milho, farelo de trigo, farelo de soja e da farinha de peixe. Empregaram-se juvenis de tilápia do Nilo (Oreochromis niloticus) (25,24 ± 3,88 g) alimentados com ração referência peletizada contendo 0,10% de óxido de crômio (indicador) e 33,78% de proteína bruta. O CDA médio dos aminoácidos foi de: 88,31; 77,40; 91,78 e 82,58% para o milho, farelo de trigo, farelo de soja e farinha de peixe...

  19. Digestibilidade aparente pela tilápia do Nilo (Oreochromis niloticus L.) de rações contendo sorgo (alto e baixo tanino) e metionina Nile tilapia (Oreochromis niloticus L.) apparent digestibility of diets containing (high and low) tannin sorghum and methionine

    OpenAIRE

    Giovani Sampaio Gonçalves; Hamilton Hisano; Margarida Maria Barros; Luiz Edivaldo Pezzato; Edson de Souza Freire; Jeisson Emerson Casimiro Ferrari

    2002-01-01

    Esse estudo teve por objetivo avaliar os efeitos da inclusão de duas variedades de sorgo (alto e baixo tanino) e da metionina em rações para tilápia do Nilo, Oreochromis niloticus L. (Perciformes, Cichlidae). Foi avaliada a digestibilidade aparente da matéria seca, proteína bruta e energia bruta. Empregaram-se 100 peixes distribuídos em 10 grupos, os quais receberam rações contendo sorgo alto e baixo tanino e 0,0%; 0,60% e 0,90% de metionina. Após um período de aclimação de três dias, foram c...

  20. Dietary supplementation with Bacillus subtilis, Saccharomyces cerevisiae and Aspergillus oryzae enhance immunity and disease resistance against Aeromonas hydrophila and Streptococcus iniae infection in juvenile tilapia Oreochromis niloticus.

    Science.gov (United States)

    Iwashita, Marina Keiko P; Nakandakare, Ivan B; Terhune, Jeffery S; Wood, Theresa; Ranzani-Paiva, Maria José T

    2015-03-01

    A feeding trial was conducted to investigate the effects of dietary administration of probiotic with Bacillus subtilis, Aspergillus oryzae and Saccharomyces cerevisiae on growth, innate immune response, Hemato-immunological parameters and disease resistance of Nile tilapia, Oreochromis niloticus. Animals were distributed in three equal groups, each of five replicates and received one of the following experimental diets for four weeks: Control, non-supplemented diet; 5 g kg(-1) probiotic mixture (B. subtilis 1.5 × 10(9) CFU g(-1), S. cerevisiae 10(9) CFU g(-1) and A. oryzae 2 × 10(9) CFU g(-1)); and 10 g kg(-1) probiotic mixture (B. subtilis 3.0 × 10(9) CFU g(-1), S. cerevisiae 2.0 × 10(9) CFU g(-1) and A. oryzae 4.0 × 10(9) CFU g(-1)). The respiratory burst activity, white blood cells and hematological parameters were evaluated after four, five and six weeks of feeding. At the end of the growth trial, fish were sampled for intestinal microbiology and challenged by intraperitoneal injection of LD50 concentration of Aeromonas hydrophila and Streptococcus iniae. Mortality was recorded for the following 3 weeks. Results showed that administration of the probiotic had no significant effect on the growth rates of Nile tilapias, although the fish fed probiotics had better feed conversion. Respiratory burst activity, erythrocyte fragility and levels of white blood cells were significantly improved in tilapias fed diet supplemented with probiotic levels (P tilapia immune parameters. The cumulative mortality after A. hydrophila and S. iniae challenge decreased in tilapias fed with probiotic (P < 0.05). The present study demonstrated the potential of B. subtilis, S. cerevisiae and A. oryzae combined as beneficial dietary probiotic in juvenile O. niloticus. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Isolated and mixed effects of diuron and its metabolites on biotransformation enzymes and oxidative stress response of Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Felício, Andréia Arantes; Freitas, Juliane Silberschmidt; Scarin, Jéssica Bolpeti; de Souza Ondei, Luciana; Teresa, Fabrício Barreto; Schlenk, Daniel; de Almeida, Eduardo Alves

    2018-03-01

    Diuron is one of the most used herbicide in the world, and its field application has been particularly increased in Brazil due to the expansion of sugarcane crops. Diuron has often been detected in freshwater ecosystems and it can be biodegraded into three main metabolites in the environment, the 3,4-dichloroaniline (DCA), 3,4-dichlorophenylurea (DCPU) and 3,4-dichlorophenyl-N-methylurea (DCPMU). Negative effects under aquatic biota are still not well established for diuron, especially when considering its presence in mixture with its different metabolites. In this study, we evaluated the effects of diuron alone or in combination with its metabolites, DCPMU, DCPU and 3,4-DCA on biochemical stress responses and biotransformation activity of the fish Oreochromis niloticus. Results showed that diuron and its metabolites caused significant but dispersed alterations in oxidative stress markers and biotransformation enzymes, except for ethoxyresorufin-O-deethylase (EROD) activity, that presented a dose-dependent increase after exposure to either diuron or its metabolites. Glutathione S-transferase (GST) activity was significant lower in gills after exposure to diuron metabolites, but not diuron. Diuron, DCPMU and DCA also decreased the multixenobiotic resistance (MXR) activity. Lipid peroxidation levels were increased in gill after exposure to all compounds, indicating that the original compound and diuron metabolites can induce oxidative stress in fish. The integration of all biochemical responses by the Integrated Biomarker Response (IBR) model indicated that all compounds caused significant alterations in O. niloticus, but DCPMU caused the higher alterations in both liver and gill. Our findings imply that diuron and its metabolites may impair the physiological response related to biotransformation and antioxidant activity in fish at field concentrations. Such alterations could interfere with the ability of aquatic animals to adapt to environments contaminated by

  2. Alteration in DNA structure, molecular responses and Na+ -K+ -ATPase activities in the gill of Nile tilapia, Oreochromis niloticus (Linnaeus, 1758) in response to sub-lethal verapamil.

    Science.gov (United States)

    Ajima, Malachy N O; Pandey, Pramod K; Kumar, Kundan; Poojary, Nalini

    2018-01-01

    The ecotoxicological consequences of residues from pharmaceutical drugs on aquatic biota have necessitated the development of sensitive and reliable techniques to assess the impact of these xenobiotics on aquatic organisms. This study investigated the alteration in DNA structure, molecular responses and the activities of Na + -K + -ATPase and antioxidant enzymes in the gill of Nile tilapia, Oreochromis niloticus, exposed to long-term effects at the concentrations (0.14, 0.28 and 0.57mgL -1 ) of verapamil in static renewal system for 15, 30, 45 and 60 days. Evaluation of DNA structure, using single cell gel electrophoresis, revealed certain degree of DNA damages in the gill in a time and concentration-dependent relationship. Transcription of mRNA of superoxide dismutase (sod), catalase (cat) and heat shock protein (hsp70) genes in the gill of the fish showed the genes were up-regulated. Na + -K + -ATPase activity was inhibited in a concentration and time dependent manner. The indices of oxidative stress biomarkers (lipid peroxidation and carbonyl protein) as well as superoxide dismutase, glutathione peroxidase, glutathione-S-transferase were elevated in the treated fish in comparison to the control. Further, the level of reduced glutathione and catalase activity were inhibited at 0.28mgL -1 after day 30. Long-term exposure to sub-lethal concentration of verapamil can cause DNA damages, molecular effects and oxidative stress in O. niloticus. The biomarkers analysed can be used as early warning signals in environmental biomonitoring and assessment of drug contamination in aquatic ecosystem. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Characterization of type IV antifreeze gene in Nile tilapia (Oreochromis niloticus) and influence of cold and hot weather on its expression and some immune-related genes.

    Science.gov (United States)

    Ammar, Asmma Y; El Nahas, Abeer F; Mahmoud, Shawky; Barakat, Mohamed E; Hassan, Asmaa M

    2018-04-01

    The aim of this work is to study the effect of the thermal stress of ambient temperature during winter and summer on the expression of type IV antifreeze gene (ANF IV) in different tissues of Nile tilapia (Oreochromis niloticus) as well as some immune-related genes. At first, genomic ANF IV gene was characterized from one fish; 124 amino acids were identified with 92.7% similarity with that on the gene bank. Expression of ANF IV and immune-related genes were done twice, once at the end of December (winter sample, temperature 14 °C) and the other at August (summer sample, temperature 36 °C). Assessment of ANF IV gene expression in different organs of fish was done; splenic mRNA was used for assessment of immune-related gene transcripts (CXCl2 chemokine, cc-chemokine, INF-3A, and MHC IIβ). Winter expression analysis of AFP IV in O. niloticus revealed significant upregulation of mRNA transcript levels in the intestine, gills, skin, spleen, liver, and brain with 324.03-, 170.06-, 107.63-, 97.61-, 94.35-, and 27.85-folds, respectively. Furthermore, upregulation in the gene was observed in some organs during summer: in the liver, gills, skin, intestine, and brain with lower levels compared with winter. The level of expression of immune-related genes in winter is significantly higher than summer in all assessed genes. Cc-chemokine gene expression was the most affected in both winter and summer. Variable expression profile of ANF IV in different organs and in different seasons together with its amino acid similarity of N-terminal and C-terminal with apolipoprotein (lipid binder) and form of high-density lipoprotein (HDL) suggests a different role for this protein which may be related to lipid metabolism.

  4. Acute salinity tolerance and the control of two prolactins and their receptors in the Nile tilapia (Oreochromis niloticus) and Mozambique tilapia (O. mossambicus): A comparative study.

    Science.gov (United States)

    Yamaguchi, Yoko; Breves, Jason P; Haws, Maria C; Lerner, Darren T; Grau, E Gordon; Seale, Andre P

    2018-02-01

    Osmoregulation in vertebrates is largely controlled by the neuroendocrine system. Prolactin (PRL) is critical for the survival of euryhaline teleosts in fresh water by promoting ion retention. In the euryhaline Mozambique tilapia (Oreochromis mossambicus), pituitary PRL cells release two PRL isoforms, PRL 188 and PRL 177 , in response to a fall in extracellular osmolality. Both PRLs function via two PRL receptors (PRLRs) denoted PRLR1 and PRLR2. We conducted a comparative study using the Nile tilapia (O. niloticus), a close relative of Mozambique tilapia that is less tolerant to increases in environmental salinity, to investigate the regulation of PRLs and PRLRs upon acute hyperosmotic challenges in vivo and in vitro. We hypothesized that differences in the regulation of PRLs and PRLRs underlie the variation in salinity tolerance of tilapias within the genus Oreochromis. When transferred from fresh water to brackish water (20‰), Nile tilapia increased plasma osmolality and decreased circulating PRLs, especially PRL 177 , to a greater extent than Mozambique tilapia. In dispersed PRL cell incubations, the release of both PRLs was less sensitive to variations in medium osmolality in Nile tilapia than in Mozambique tilapia. By contrast, increases in pituitary and branchial prlr2 gene expression in response to a rise in extracellular osmolality were more pronounced in Nile tilapia relative to its congener, both in vitro and in vivo. Together, these results support the conclusion that inter-specific differences in salinity tolerance between the two tilapia congeners are tied, at least in part, to the distinct responses of both PRLs and their receptors to osmotic stimuli. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus iniae and S. agalatiae Ib is heritable but not correlated

    Science.gov (United States)

    Tilapia (Oreochromis sp.) are an important source of protein with an ecomonic value approaching US $8 billion yearly. Streptococcal disease, caused by Streptococcus iniae and S. agalactiae (both Gram positive bacteria), is an emerging or re-emerging disease negatively affecting tilapia aquaculture w...

  6. Resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus iniae and S. agalactiae Ib is heritable but not correlated

    Science.gov (United States)

    Tilapia (Oreochromis sp.) are an important source of protein with an economic value approaching US $8 billion yearly. Streptococcal disease, caused by Streptococcus iniae and S. agalactiae (both Gram positive bacteria), is an emerging or re-emerging disease negatively affecting tilapia aquaculture w...

  7. [Ectoparasites of the Nile tilapia (Oreochromis niloticus) bred in net-tanks in the Corvo and Guairacá rivers, state of Paraná, Brazil].

    Science.gov (United States)

    Braccini, Graciela L; Vargas, Lauro; Ribeiro, Ricardo P; Alexandre Filho, Luiz; Digmayer, Melanie

    2008-09-01

    Current experiment estimates the prevalence of ectoparasites of the Nile s tilapia (Oreochromis niloticus), strain Chitralada, bred in net-tanks during 130 days, from April to August 2006, and reports on the water's physical and chemical parameters. Three hundred and eighty-seven samples of tegumentary scrapes and branchia of post-reversed males were analyzed. Experiment was conducted in thirty 6.8 m-3 net-tanks (2.0m x 2.0m x 1.7m), filled with 6.0 m-3 water, of which 15 were placed in the Corvo river and 15 in the Guairacá river, with three stocking densities (100, 150, 200 fish per m-3) and five repetitions each. At the start of experiment, total ectoparasites prevalence in 105 fish, average weight 35.4 +/- 19.3g and total length 11.7 +/- 2.1cm, was 87.6%. Prevalence was higher for Monogenoidea (40.0%), followed by mixed parasitism (33.3%) and Tricodinids (14.3%). Whereas in the Corvo river total ectoparasites prevalence in the four collections reached 38.2%, with predominance for Monogenoidea (19.4%), in the Guairacá river prevalence reached 44.2%, with predominance for Tricodinids (17.4%). Water's physical and chemical parameters, with the exception of temperature, fitted conditions for Nile s tilapia breeding.

  8. Short-term exposure of Nile Tilapia (Oreochromis niloticus) to mercury: histopathological changes, mercury bioaccumulation, and protective role of metallothioneins in different exposure routes.

    Science.gov (United States)

    Kaewamatawong, Theerayuth; Rattanapinyopituk, Kasem; Ponpornpisit, Aranya; Pirarat, Nopadon; Ruangwises, Suthep; Rungsipipat, Anudep

    2013-01-01

    To investigate effects of short-term mercury (Hg) exposure in tilapia (Oreochromis niloticus) including histopathological changes, Hg bioaccumulation, and protective role of metallothionein (MT) in different exposure routes, adult tilapias were intraperitoneally injected, orally intubated, or semistatically exposed to 0.5, 1, 2, 5 µg/g mercuric chloride. Histopathology, autometallography (AMG), inductive coupled plasma-atomic emission spectrometry (ICP-AES), and MT immunohistochemistry were determined at 0, 3, 6, 9, 12, and 15 days postexposure. Microscopic lesions were observed in the kidney, hepatopancreas, spleen, and intestine. AMG positive grains were found in renal tubule epithelium, melanomacrophage centers (MMCs), and intestinal epithelium of treated tilapias. Hg concentrations measured by ICP-AES in abdominal visceral organs were significantly higher than in other organs. All exposure routes caused lesions of increasing severity and Hg accumulations in a dose-dependent manner. Semistatic groups produced the highest intensity of lesions, AMG positive staining, as well as total Hg concentrations. Positive MT expression in renal tubule epithelium, pancreatic acini, and splenic MMCs was observed only in semistatic groups. The semistatic exposure route demonstrated the most significant microscopic lesions, Hg bioaccumulation, and MT expression.

  9. Effects of different temperatures on testis structure and function, with emphasis on somatic cells, in sexually mature Nile tilapias (Oreochromis niloticus).

    Science.gov (United States)

    de Alvarenga, Erika Ramos; de França, Luiz Renato

    2009-03-01

    The Nile tilapia (Oreochromis niloticus) is economically one of the most important freshwater fish and is an excellent model for studies under laboratory conditions. Temperature is considered a very important modulator of reproductive activity in fish, although few studies have specifically addressed the effects of this key factor on morphological and functional aspects of teleost testes. Therefore, our main objectives in the present study were to analyze the effects of different temperatures (20, 25, 30, and 35 degrees C) on testicular somatic and germ cells in sexually mature Nile tilapias. Compared with fish kept at other temperatures, tilapias maintained at 20 degrees C demonstrated increased (P tilapias are nonseasonal breeders, we suggest a model for temperature action on tilapia testes in which lower temperature (20 degrees C) would favor type A spermatogonial renewal, Sertoli cell and Leydig cell proliferation, and germ cell apoptosis, whereas higher temperatures (30-35 degrees C) would trigger rapid germ cell differentiation. Thus, tilapias could potentially be utilized in studies involving hormones and factors related to Sertoli cell and Leydig cell proliferation and spermatogonial self-renewal or differentiation.

  10. Ecological Risk Assessment of Metal Pollution along Greater Cairo Sector of the River Nile, Egypt, Using Nile Tilapia, Oreochromis niloticus, as Bioindicator

    Directory of Open Access Journals (Sweden)

    Wael A. Omar

    2015-01-01

    Full Text Available The present work aims to evaluate seasonal metal pollution along Greater Cairo sector of the River Nile, Egypt, using wild Nile tilapia, Oreochromis niloticus, as bioindicator and to conduct a risk assessment for human consumers. Greater Cairo is the largest populated area along the whole course of River Nile with a wide range of anthropogenic activities. Effects of metal pollution on fish body indices were studied using condition factor (CF and scaled mass index (SMI. Metal pollution index (MPI showed that the total metal load in fish organs followed the follwoing order: kidney > liver > gill > muscle which gives a better idea about the target organs for metal accumulation. Metal concentrations in fish muscle (edible tissue showed the following arrangement: Fe > Zn > Cu > Mn > Pb > Cd. Metal’s bioaccumulation factor (BAF in fish muscle showed the following arrangement: Zn > Cu > Fe > Mn > Cd and Pb. The hazard index (HI as an indicator of human health risks associated with fish consumption showed that adverse health effects are not expected to occur in most cases. However, the metals’ cumulative risk effects gave an alarming sign specifically at high fish consumption rates.

  11. Effects of dietary inclusions of oilseed meals on physical characteristics and feed intake of diets for the Nile Tilapia, Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Kwasi Adu Obirikorang

    2015-05-01

    Full Text Available The present study investigated the effects of the inclusion of three oilseed by-products (soybean, copra and palm kernel meals on some physical characteristics of pelletized feeds as well as on voluntary feed intake and faecal matter production by the Nile tilapia, Oreochromis niloticus. The dietary inclusion of soybean meal resulted in a significantly higher feed bulk density relative to the fishmeal control diet. The inclusions of copra and palm kernel meals, however, resulted in lower feed bulk densities. Sinking rates, water stabilities and nutrient retention efficiencies of feed pellets were directly related to feed bulk densities. The soybean meal diet had the fastest sinking velocities, greatest water stability and highest nutrient retention rates. The dietary inclusion of soybean meal, however, significantly impaired feed intake compared to the other three diets. Mean daily feed intakes of the control, palm kernel meal and copra meal diets corresponded to 28.88, 27.01 and 28.31 g during the experimental period and varied significantly from the mean daily intake of the soybean meal diet which corresponded to 20.01 g. Faecal matter production (g dry mass kg−1 ingested feed was significantly higher in the tilapia groups fed the copra and palm kernel meals. The results obtained from this study show that 30% inclusions of unrefined forms of copra and palm kernel meal in Nile tilapia diets is possible, without adversely affecting feed intake or pellet nutrient losses prior to ingestion.

  12. The use of lactic acid bacteria isolated from intestinal tract of Nile tilapia (Oreochromis niloticus, as growth promoters in fish fed low protein diets

    Directory of Open Access Journals (Sweden)

    Maurilio Lara-Flores

    2013-07-01

    Full Text Available In this study, the effect as growth promoter of five lactic acid strains (Enterococcus faecium, E. durans, Leuconostoc sp., Streptococcus sp. I and Streptococcus sp. II, isolated from intestinal tract of Nile tilapia (Oreochromis niloticus, was evaluated. Eight isocaloric diets were formulated: one containing 40% of protein as positive control, and seven with 27% protein. Five diets with 27% protein were supplemented with one of the isolated lactic acid bacteria in a concentration of 2.5x10(6 cfu g-1 of diet. A commercial probiotic based on S. faecium and Lactobacillus acidophilus was added at the same concentration to one 27% protein diet as a comparative diet, and the last diet was not supplemented with bacteria (negative control. Tilapia fry (280 mg basal weight stocked in 15 L aquaria at a density of two per liter were fed for 12 weeks with experimental diets. Results showed that fry fed with native bacteria supplemented diets presented significantly higher growth and feeding performance than those fed with control diet. Treatment with Streptococcus sp. I isolated from the intestine of Tilapia produced the best growth and feeding efficiency, suggesting that this bacteria is an appropriate native growth promoter.

  13. Influence of good manufacturing practices on the shelf life of refrigerated fillets of tilapia (Oreochromis niloticus) packed in modified atmosphere and gamma-irradiated

    Science.gov (United States)

    Monteiro, Maria Lúcia Guerra; Mársico, Eliane Teixeira; Mano, Sérgio Borges; Teixeira, Claudia Emília; da Cruz Silva Canto, Anna Carolina Vilhena; de Carvalho Vital, Helio; Conte-Júnior, Carlos Adam

    2013-01-01

    This study evaluated the influence of good manufacturing practices (GMP) on the shelf life of refrigerated fillets of Nile tilapia (Oreochromis niloticus) packed in modified atmosphere packaging (MAP) and irradiated. In a first series of experiments, 120 tilapia fillets kept under controlled sanitary conditions were purchased from a fish market managed by a cooperative. A second lot totaling 200 tilapia fillets was obtained under controlled storage conditions from a pilot plant. The combined effects of MAP (40% CO2 and 60% N2) and irradiation (1.5 kGy) were investigated by monitoring physical and chemical (total volatile bases and pH), bacteriological (aerobic heterotrophic mesophilic and psychrophilic bacteria) and sensory (acceptance test) changes in the samples. The quality of samples decreased with storage time regardless of the treatment, remaining higher in fillets produced in the pilot plant in comparison with the commercially produced fillets. The observed shelf life of nonirradiated commercially produced fillets was only 3 days, compared to 8 days for those produced in the pilot plant, probably due to GMP in the latter. It was concluded that, even with a combination of proven conservation methods for meats, the adoption of good manufacturing practices still remains essential before, during, and after the filleting process in order to ensure the effectiveness of the entire treatment. PMID:24804034

  14. The effects of dietary kefir and low molecular weight sodium alginate on serum immune parameters, resistance against Streptococcus agalactiae and growth performance in Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Van Doan, Hien; Hoseinifar, Seyed Hossein; Tapingkae, Wanaporn; Khamtavee, Pimporn

    2017-03-01

    The present study evaluates the effects of dietary kefir and low molecular weight sodium alginate (LWMSA) (singular or combined) on non-specific immune response, disease resistance and growth performance of Nile tilapia (Oreochromis niloticus). Fish with average weight of 18.60 ± 0.04 g were supplied and randomly stocked in sixteen glass tanks (150 L) at density of 20 fish per tank. Fish were fed experimental diets as follows: 0 g kg -1 LMWSA (Control, Diet 1), 10 g kg -1 LMWSA (Diet 2), 40 g kg -1 kefir (Diet 3), and 10 g kg -1 LMWSA + 40 g kg -1 kefir (Diet 4) for 50 days. At the end of the feeding trial, serum lysozyme (SL), phagocytosis (PI), respiratory burst (RB), and alternative complement (ACH50) activities as well as growth performance were measured. Singular and combined administration of kefir and low molecular weight sodium alginate (LMWSA) significantly increased serum SL, PI, RB, and ACH50 activities compared control group (P kefir + LMWSA) (P kefir and LMWSA can be considered for improving immune response, disease resistance and growth performance of Nile tilapia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Detection of tilapia lake virus (TiLV) infection by PCR in farmed and wild Nile tilapia (Oreochromis niloticus) from Lake Victoria.

    Science.gov (United States)

    Mugimba, K K; Chengula, A A; Wamala, S; Mwega, E D; Kasanga, C J; Byarugaba, D K; Mdegela, R H; Tal, S; Bornstein, B; Dishon, A; Mutoloki, S; David, L; Evensen, Ø; Munang'andu, H M

    2018-02-23

    Tilapia lake virus disease (TiLVD) has emerged to be an important viral disease of farmed Nile tilapia (Oreochromis niloticus) having the potential to impede expansion of aquaculture production. There is a need for rapid diagnostic tools to identify infected fish to limit the spread in individual farms. We report the first detection of TiLV infection by PCR in farmed and wild Nile tilapia from Lake Victoria. There was no difference in prevalence between farmed and wild fish samples (p = .65), and of the 442 samples examined from 191 fish, 28 were positive for TiLV by PCR. In terms of tissue distribution, the head kidney (7.69%, N = 65) and spleen (10.99%, N = 191), samples had the highest prevalence (p < .0028) followed by heart samples (3.45%, N = 29). Conversely, the prevalence was low in the liver (0.71%, N = 140) and absent in brain samples (0.0%, N = 17), which have previously been shown to be target organs during acute infections. Phylogenetic analysis showed homology between our sequences and those from recent outbreaks in Israel and Thailand. Given that these findings were based on nucleic acid detection by PCR, future studies should seek to isolate the virus from fish in Lake Victoria and show its ability to cause disease and virulence in susceptible fish. © 2018 John Wiley & Sons Ltd.

  16. Determination of selenium toxicity to Oreochromis niloticus based on hematological parameters - doi: 10.4025/actascibiolsci.v34i2.8755

    Directory of Open Access Journals (Sweden)

    Julio Vicente Lombardi

    2012-03-01

    Full Text Available Selenium (Se is described as an essential micronutrient and participates in different biological functions, as the antioxidant defense systems maintenance and regulation. However, when in high concentrations, Se may cause toxic effects as well as hematological changes in fish. The aim of the present study was to determine the toxicity of selenium in the form of sodium selenate (Na2Se6+O4 in Oreochromis niloticus based on hematological parameters, after exposure to different concentrations (0.01, 0.14 and 1.4 mg Se6+ L-1. The erythrocytic and leukocytic series were examined over 14 days at intervals of 0, 3, 5, 7,10 and 14 days. The erythrocytic series showed significant alterations in the first 7 days, including the control group. Neutrophils and monocytes showed variations in the first 3 days at a concentration of 1.40 mgSe6+ L-1 characterizing an acute response. The total number of leukocytes was different in relation to time zero on all Se concentrations. The thrombocyte count also differed statistically from time zero and control in the first 3 days at 0.14 mgSe6+ L-1. These results indicate that different concentrations induce an acute response with diminution of total leukocytes, neutrophilia, monocytosis and thrombocytosis. 

  17. Development of the lateral plate mesoderm in medaka Oryzias latipes and Nile tilapia Oreochromis niloticus: insight into the diversification of pelvic fin position

    Science.gov (United States)

    Kaneko, Hiroki; Nakatani, Yuki; Fujimura, Koji; Tanaka, Mikiko

    2014-01-01

    The position of the pelvic fins among teleost fishes has tended to shift rostrally during evolution. This positional shift seems to have led to the diversification of feeding behavior and allowed adaptation to new environments. To understand the developmental basis of this shift in pelvic fin position among teleosts, we investigated the embryonic development of the lateral plate mesoderm, which gives rise to the pelvic fins, at histological levels in the medaka Oryzias latipes (abdominal pelvic fins) and Nile tilapia Oreochromis niloticus (thoracic pelvic fins). Our histological analyses revealed that the lateral plate mesodermal cells expand not only ventrally but also rostrally to cover the yolk during embryogenesis of both medaka and Nile tilapia. In medaka, we also found that the lateral plate mesoderm completely covered the yolk prior to the initiation of the pelvic fin buds, whereas in Nile tilapia the pelvic fin buds appeared in the body wall from the lateral plate mesoderm at the thoracic level when the lateral plate mesodermal cells only covered one-third of the yolk. We discuss the relevance of such differences in the rate of the lateral plate mesoderm expansion on the yolk surface and the position of the pelvic fins. PMID:25345789

  18. Replacement of Fishmeal by Single Cell Protein Derived from Yeast Grown on Date (Phoenix dactylifera) Industry Waste in the Diet of Nile Tilapia (Oreochromis niloticus) Fingerlings

    KAUST Repository

    Al-Hafedh, Yousef S.

    2013-10-02

    Isonitrogenous and isocaloric diets (32% protein, 4.3 Kcal/g) were formulated to replace fishmeal by single cell protein (SCP) from two yeasts, Saccharomyces cerevisiae and Candida utilis, grown on date (Phoenix dactylifera) processing waste in diets for two size groups (avg 15.39 g and 25.14 g) of juvenile Nile tilapia (Oreochromis niloticus). A control diet (T1) with fishmeal and six experimental diets (S1, S2, and S3 with S. cerevisiae, and C1, C2, and C3 with C. utilis) each containing 11.6%, 23.2%, and 34.2% yeast as SCP were prepared to replace 25%, 50%, and 75% of fishmeal, respectively. Tilapia fed on the control and experimental diets (S1, S2, C1, C2) with 25% and 50% replacement of fishmeal showed better growth and feed utilization. Fish fed on diets S3 and C3 (75% fishmeal replacement) had significantly (p < 0.05) poorer growth suggesting that yeast SCP can replace up to 50% of fishmeal in juvenile tilapia diets. © 2013 Copyright Taylor and Francis Group, LLC.

  19. Isolation and characterization of Streptococcus spp. group B in Nile tilapias (Oreochromis niloticus reared in hapas nets and earth nurseries in the northern region of Parana State, Brazil

    Directory of Open Access Journals (Sweden)

    Salvador Rogério

    2005-01-01

    Full Text Available The objective of this study was to isolate and characterize Streptococcus spp. in Nile tilapias (Oreochromis niloticus reared in net-pens and earth nurseries. Eight intensive tilapia-rearing farms were investigated in north Paraná, Brazil from April 1st 2001 to April 30th 2002. The fish were reared in a system of hapas nets on four farms and in earth nurseries on other four farms. A total of 370 samples were analyzed of material collected from 120 fish (brain, liver, kidney, skin scrapes, ascites liquid and eye that were sown on BHI agar (Brain Heart Infusion supplemented with 1% yeast extract and sheep blood. Streptococcus spp. was isolated in 36 of the samples (18 brain, eight liver, eight kidney and two ascites liquid from 25 fish. Streptococci were isolated in both systems, almost in the same proportion. First the streptococci were characterized by the catalase and esculin test, growth in methylene blue and sodium chloride at 6.5%. They were classified in groups by the Slidex Strepto-Kit (BioMerieux, France. The phenotypic characteristics were determined by the Api 20 Strep microtest system (BioMerieux, France. The 36 Streptococcus spp. samples did not present hemolysis and were classified as Lancefield group B. Further 16 samples were identified as Streptococcus agalactiae and 20 were not identified by the Api 20 Strep, but presented the same biochemical profile described for the reference strain of Streptococcus difficile (ND-2-22.

  20. Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou

    2016-02-23

    The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

  1. Survival, growth and reproduction of non-indigenous Nile tilapia, Oreochromis niloticus (Linnaeus 1758). I. Physiological capabilities in various temperatures and salinities

    Science.gov (United States)

    Schofield, Pamela J.; Peterson, Mark S.; Lowe, Michael R.; Brown-Peterson, Nancy J.; Slack, William T.

    2011-01-01

    The physiological tolerances of non-native fishes is an integral component of assessing potential invasive risk. Salinity and temperature are environmental variables that limit the spread of many non-native fishes. We hypothesised that combinations of temperature and salinity will interact to affect survival, growth, and reproduction of Nile tilapia, Oreochromis niloticus, introduced into Mississippi, USA. Tilapia withstood acute transfer from fresh water up to a salinity of 20 and survived gradual transfer up to 60 at typical summertime (30°C) temperatures. However, cold temperature (14°C) reduced survival of fish in saline waters ≥10 and increased the incidence of disease in freshwater controls. Although fish were able to equilibrate to saline waters in warm temperatures, reproductive parameters were reduced at salinities ≥30. These integrated responses suggest that Nile tilapia can invade coastal areas beyond their point of introduction. However, successful invasion is subject to two caveats: (1) wintertime survival depends on finding thermal refugia, and (2) reproduction is hampered in regions where salinities are ≥30. These data are vital to predicting the invasion of non-native fishes into coastal watersheds. This is particularly important given the predicted changes in coastal landscapes due to global climate change and sea-level rise.

  2. Histopathological alterations in the liver and intestine of Nile tilapia Oreochromis niloticus exposed to long-term sublethal concentrations of cadmium chloride

    Science.gov (United States)

    Younis, Elsayed; Abdel-Warith, Abdel-Wahab; Al-Asgah, Nasser; Ebaid, Hossam

    2015-07-01

    Fingerlings of Nile tilapia Oreochromis niloticus were exposed to 1.68, 3.36, and 5.04 mg/L cadmium (as CdCl2), which represent 10%, 20%, and 30% of their previously determined 96-h LC50. After exposure for 20 days, sections of the liver and intestine of treated fish were examined histologically. Histopathological changes varied from slight to severe structural modification, depending on the exposure concentration. The hepatic tissues of fish exposed to 10% LC50 showed markedly increased vacuolation of the hepatocytes and coarse granulation of their cytoplasm. Abundant erythrocytic infiltration among the hepatocytes was observed in fish exposed to 20% LC50. In the intestinal tissues of fish exposed to all doses, goblet cells proliferated and were greatly increased in size, the longitudinal muscularis mucosa was disturbed and, in the crypts of the sub-mucosal layer, apoptosis increased, indicated by large numbers of degenerated nuclei. Large numbers of inflammatory cells and dilated blood vessels were observed in the intestine of the group treated with 30% LC50.

  3. Effects of Cordyceps militaris spent mushroom substrate on mucosal and serum immune parameters, disease resistance and growth performance of Nile tilapia, (Oreochromis niloticus).

    Science.gov (United States)

    Doan, Hien Van; Hoseinifar, Seyed Hossein; Tapingkae, Wanaporn; Chitmanat, Chanagun; Mekchay, Supamit

    2017-08-01

    The aim of present study was determination effects of dietary administration of C. militaris spent mushroom substrate (SMS) on mucosal and serum immune parameters, disease resistance, and growth performance of Nile tilapia (Oreochromis niloticus). Two hundred twenty five fish of similar weight (37.28 ± 0.10 g) were assigned to the following diets [0 (T1- Control), 5 (T2), 10 (T3), 20 (T4) and 40 g kg -1 (T5) SMS]. After 60 days of feeding trial, growth performance, skin mucus lysozyme and peroxidase activities as well as serum innate immune were measured. In addition, survival rate and innate immune responses were calculated after challenge test (15 days) against Streptococcus agalactiae. The results revealed that regardless of inclusion levels, feeding Nile tilapia with SMS supplemented diets significantly increased skin mucus lysozyme and peroxidase activities as well as serum immune parameters (SL, ACH50, PI, RB, and RB) compared control group (P health status. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Ling Wei

    2016-02-01

    Full Text Available The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus, and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

  5. Coeficientes de digestibilidade e valores de aminoácidos digestíveis de alguns ingredientes para tilápia do Nilo (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Furuya Wilson Massamitu

    2001-01-01

    Full Text Available O objetivo deste estudo foi determinar o coeficiente de digestibilidade aparente (CDA dos aminoácidos do milho, farelo de trigo, farelo de soja e da farinha de peixe. Empregaram-se juvenis de tilápia do Nilo (Oreochromis niloticus (25,24 ± 3,88 g alimentados com ração referência peletizada contendo 0,10% de óxido de crômio (indicador e 33,78% de proteína bruta. O CDA médio dos aminoácidos foi de: 88,31; 77,40; 91,78 e 82,58% para o milho, farelo de trigo, farelo de soja e farinha de peixe, respectivamente. Ainda que os resultados sugiram que o CDA da proteína possa ser indicativo do CDA dos aminoácidos, seus valores individuais variaram dentre e entre os ingredientes avaliados. Os resultados obtidos demonstram que os valores de aminoácidos digestíveis devem ser usados na formulação de rações completas (precisas e econômicas.

  6. Effects of the pharmaceuticals diclofenac and metoprolol on gene expression levels of enzymes of biotransformation, excretion pathways and estrogenicity in primary hepatocytes of Nile tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Gröner, Frederike; Ziková, Andrea; Kloas, Werner

    2015-01-01

    The expression levels of key enzymes of the xenobiotic metabolism and excretion pathways concerning biotransformation phases I (cytochrome P4501A), II (glutathione S-transferase) and III (multidrug resistance protein) and of the estrogenic biomarker vitellogenin (vtg) were investigated in primary hepatocytes isolated from male Nile tilapia (Oreochromis niloticus) after exposure to diclofenac and metoprolol, two pharmaceuticals prevalent in the aquatic environment worldwide. The lowest test concentration (4×10(-9) M) was chosen to reflect an environmentally relevant exposure situation. Furthermore concentration dependent effects were investigated. Therefore a series of concentrations higher than the environmentally relevant range were used (10- and 100-fold). Diclofenac significantly induced all chosen biomarkers already at the environmentally relevant concentration indicating that biotransformation and elimination occur via the pathways under investigation. Estrogenic potential of this substance was demonstrated by VTG up-regulation as well. Metoprolol was either less effective than diclofenac or metabolized using different pathways. Key enzymes of the xenobiotic metabolism were less (CYP1A, GST) or not (MDRP) induced and a mild increase in vtg mRNA was detected only for 4×10(-8) M. No concentration-dependency for metoprolol was found. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. The Evaluation of Synergistic Effect of Hippophae rhamnoides and Vitamin E on Growth Performance and Oxidative Stress at Oreochromis niloticus - Linnaeus, 1758

    Directory of Open Access Journals (Sweden)

    Alina Antache

    2014-10-01

    Full Text Available The aim of this research is to evaluate the influence of sea buckthorn (Hippophae rhamnoides and vitamin E on growth performance indicators and oxidative stress at Nile tilapia juvenile, reared in a recirculating aquaculture system. The experiment was conducted six weeks, in triplicate. The experimental variants were: V1 – control, V2 – 1% sea buckthorn / kg feed, V3 – 500mg vitamin E / kg feed and V4 – 1% sea buckthorn supplemented with 500 mg vitamin E / kg feed. During the experiment was performed an intermediary biometric measurement. Oxidative stress analysis consisted in determination of lipid peroxidation (MDA-malondialdehide and total antioxidant capacity (TAC from liver, tissue and gut. Results showed a good evolution of GR, FCR and SGR, during the experiment, in V4 – in which feed was supplemented with sea buckthorn and vitamin E. Based on the results obtained in variant V4, in liver and tissue, the oxidative stress was reduced. Regarding MDA and TAC, between experimental variants, were registered significant differences (p<0.05 at the level of tissue and gut. In conclusion, the research shows that sea buckthorn (1%/kg feed in combination with Vitamin E (500mg/kg feed has a synergistic effect on growth performance indicators and oxidative stress, at Oreochromis niloticus juvenile.

  8. Dietary administration of Bacillus subtilis HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Liu, Haitian; Wang, Shifeng; Cai, Yan; Guo, Xiaohui; Cao, Zhenjie; Zhang, Yongzheng; Liu, Shubin; Yuan, Wei; Zhu, Weiwei; Zheng, Yu; Xie, Zhenyu; Guo, Weiliang; Zhou, Yongcan

    2017-01-01

    The probiotic properties of Bacillus subtilis HAINUP40 isolated from the aquatic environment, and the effects of dietary administration of B. subtilis HAINUP40 on the growth performance, intestinal probiotic recovery, digestive enzyme activities, innate immunity and disease resistance of tilapia (Oreochromis niloticus) were evaluated. The probiotic properties investigated include tolerance to simulated gastrointestinal stress, auto-aggregation, cell surface hydrophobicity and extracellular enzyme production. The cell number of B. subtilis changed little after 4 h in simulated gastric fluid at pH = 2.0, 3.0, 4.0 and simulated intestinal fluid at pH = 6.8.B.subtilis HAINUP40 revealed strong auto-aggregation property (34.6-87.0%) after 24 h incubation period. It exhibited significant cell surface hydrophobicity in xylene (28.8%) and chloroform (41.3%) and produced extracellular proteases and amylase. After tilapia (mean weight = 95 ± 8 g) were fed with a diet containing 10 8  cfu/g B. subtilis HAINUP40, their final body weight, percent weight gain (PWG), specific growth rate (SGR), total antioxidant capacity (T-AOC) and serum superoxide dismutase (SOD) increased significantly (p subtilis HAINUP40 can effectively enhances the growth performance, immune response, and disease resistance of Nile tilapia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Desempeño productivo, composición y biodisponibilidad relativa de selenio en tilapia nilótica (oreochromis niloticus) suplementada con selenio orgánico e inorgánico

    OpenAIRE

    Vinchira, J. E.; Wills, G. A.; Muñoz, A. P.

    2014-01-01

    Se evaluó el desempeño productivo, la composición corporal y la biodisponibilidad relativa de selenio en tilapia nilótica ( Oreochromis niloticus ) suplementada con selenio dietario. Una dieta basal fue suplementada con selenio en forma de selenito de sodio o seleno-levadura en niveles crecientes de suplementación (0.00, 0.10, 0.20, 0.40, 0.80 y 1.60 mg/kg de dieta). Un total de 336 individuos de tilapia nilótica, con un peso inicial de 13.41±0.12 g, fueron distribuidos de forma aleatori...

  10. Effect of probiotic and sand filtration treatments on water quality and growth of tilapia (Oreochromis niloticus) and pangas (Pangasianodon hypophthalmus) in earthen ponds of southern Bangladesh

    DEFF Research Database (Denmark)

    Mahmud, Sultan; Ali, Mohammad Lokman; Alam, Md Ariful

    2016-01-01

    . The fish were stocked at a density of 20,000 fish ha−1 and reared for 7 months. Compared to untreated ponds, treatments of probiotic products or sand filtration in earthen ponds resulted in a higher O2 content, higher water transparency, less ammonium, and fewer cyanobacteria. Weight gain for individual......Effects of water treatment by two probiotic products (PondPlus® and AquaPhoto®) and sand filtration were studied on growth performance of tilapia (Oreochromis niloticus) and pangas (Pangasianodon hypophthalmus) stocked at tilapia:pangas ratio of 5:3 in traditional earthen ponds in Bangladesh...

  11. Digestibilidade e desempenho de alevinos de tilápia do nilo (Oreochromis Niloticus) alimentados com dietas contendo diferentes níveis de silagem ácida de pescado

    OpenAIRE

    Oliveira,Marinez Moraes de; Pimenta,Maria Emília de Sousa Gomes; Pimenta,Carlos José; Camargo,Antonio Cleber da Silva; Fiorini,João Evangelista; Logato,Priscila Vieira Rosa

    2006-01-01

    Os experimentos foram conduzidos para avaliar os coeficientes de digestibilidade aparente dos nutrientes e da energia bruta da silagem ácida de resíduos da filetagem de tilápia do Nilo (Oreochromis niloticus) para alevinos de tilápia nilótica e o desempenho dos alevinos recebendo níveis crescentes (0, 10, 20, 30, 40 %) da silagem ácida em substituição à farinha de peixe na ração. Na digestibilidade foram utilizados 200 alevinos revertidos sexualmente, com peso médio de 2,0 g e acondicionados ...

  12. Reflexos da utilização de farelo de coco na alimentação de tilápia do nilo (Oreochromis niloticus Linnaeus, 1857) sobre o valor nutricional do filé.

    OpenAIRE

    Omena, Cristhiane Maria Bazílio de

    2008-01-01

    The fish diet exerts a great influence on its centesimal composition as well as the content of cholesterol and fatty acids. The use of coconut meal may represent alternative source in the fish diet in view of the cost and the availability in the Northeast of Brazil. The purpose of this work was to assess the impact of the use of coconut meal in feed for Nile tilapia (Oreochromis niloticus Linnaeus, 1857) on the nutritional value of fillet. 120 fingerlings of fish reversed we...

  13. Relação parasito-hospedeiro em peixes de pisciculturas da região de Assis, Estado de São Paulo, Brasil. 1. Oreochromis niloticus (Linnaeus, 1757 - DOI: 10.4025/actascibiolsci.v29i2.594 Host-parasite relationship in fish from fish farms in the Assis region, São Paulo State, Brazil. 1. Oreochromis niloticus (Linnaeus, 1757

    Directory of Open Access Journals (Sweden)

    Maria José Tavares Ranzani-Paiva

    2007-12-01

    Full Text Available Um total de 90 espécimes de Oreochromis niloticus foi coletado bimestralmente entre os meses de fevereiro a dezembro de 2004, em três pisciculturas do Estado de São Paulo. Do total, 82,2% estavam parasitados por pelo menos uma espécie de parasito. Os parâmetros físicos e químicos da água foram utilizados para caracterizar a qualidade da água em cada propriedade. Sete espécies de ectoparasitos foram registradas. Foi possível observar que as pisciculturas apresentam a mesma parasitofauna, porém cada propriedade apresenta uma estrutura da comunidade peculiar. Cichlidogyrus sclerosus e Cichlidogyrus sp. 1 apresentaram correlação negativa significativa da abundância com o comprimento padrão do hospedeiro somente em Palmital. A espécie Cichlidogyrus sp. 2 e o copépode Lamproglena sp. apresentaram correlação positiva significativa da abundância com o comprimento padrão nas pisciculturas de Tarumã e Cândido Mota, respectivamente. Em relação ao fator de condição relativo, somente a espécie Cichlidogyrus sp. 1 apresentou correlação significativa negativa com a abundância de parasitismo. Lamproglena sp. apresentou correlação positiva significativa com a relação hepatossomática (RHS das tilápias em Palmital, e o ergasilídeo apresentou correlação significativa negativa da abundância de parasitismo e a relação esplenossomática (RES dos hospedeiros em Cândido Mota.A total of ninety specimens of Oreochromis niloticus were collected every other month between February and December of 2004 at three fish farms in São Paulo State. 82.2% were parasitized by at least one species of parasite. Physical and chemical water parameters were used to characterize water quality in each fish farm. Seven species of ectoparasites were registered. It was possible to observe that all fish farms presented the same parasite fauna; however, each farm featured its own peculiar community structure. Cichlidogyrus sclerosus and Cichlidogyrus

  14. Effect of acute exposure to nonylphenol on biochemical, hormonal, and hematological parameters and muscle tissues residues of Nile tilapia; Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Hager Tarek H. Ismail

    2016-06-01

    Full Text Available Aim: This study is aimed to evaluate some biochemical, hormonal, hematological, and histopathological changes in Nile tilapia, Oreochromis niloticus, after acute exposure to nonylphenol (NP. In addition to detection of NP residues in the fish, muscle tissues for human health concern. Materials and Methods: A total of 90 apparently healthy Nile tilapia, O. niloticus, were randomly divided into three equal groups; each containing 30 fish (three replicates. Groups 1 and 2 kept as a control and solvent control (acetone, respectively, and Group 3 exposed to NP at a dose level of 500 μg/L water for 7 successive days. Blood and tissue samples were collected 2 times randomly from each group after 7 days from fish exposure to NP and 10 days from exposure stopping. Results: Fish exposed to NP Group 3 showed anorexia, sluggish movement, erythema of the skin, areas of scales loss, and hemorrhagic ulcers in some areas of body region leading to exposing the viscera. Biochemical results revealed a significant increase in serum total proteins and globulins levels, a highly significant increase in serum alanine aminotransferase and aspartate aminotransferase activities, triglycerides, cholesterol, and creatinine levels, insignificant increase in serum uric acid level, and a highly significant decrease in serum testosterone and estradiol-β17 levels in Group 3 in compare with the control group. Histopathological finding confirms these results. While hematological results of the same group revealed a significant increase in red blood cells count and packed cell volume value, insignificant increase in hemoglobin concentration, leukopenia, lymphopenia, and monocytopenia in compared with the control group. All of these changes appeared after 7 days from fish exposure to NP. Most of these alterations returned toward the normal level after 10 days from stopping exposure to NP. NP residues detected in fish muscle tissues of Group 3 during exposure and after stopping

  15. Effect of acute exposure to nonylphenol on biochemical, hormonal, and hematological parameters and muscle tissues residues of Nile tilapia; Oreochromis niloticus.

    Science.gov (United States)

    Ismail, Hager Tarek H; Mahboub, Heba Hassan H

    2016-06-01

    This study was aimed to evaluate some biochemical, hormonal, hematological, and histopathological changes in Nile tilapia, Oreochromis niloticus, after acute exposure to nonylphenol (NP). In addition to detection of NP residues in the fish, muscle tissues for human health concern. A total of 90 apparently healthy Nile tilapia, O. niloticus, were randomly divided into three equal groups; each containing 30 fish (three replicates). Groups 1 and 2 kept as a control and solvent control (acetone), respectively, and Group 3 exposed to NP at a dose level of 500 µg/L water for 7 successive days. Blood and tissue samples were collected 2 times randomly from each group after 7 days from fish exposure to NP and 10 days from exposure stopping. Fish exposed to NP Group 3 showed anorexia, sluggish movement, erythema of the skin, areas of scales loss, and hemorrhagic ulcers in some areas of body region leading to exposing the viscera. Biochemical results revealed a significant increase in serum total proteins and globulins levels, a highly significant increase in serum alanine aminotransferase and aspartate aminotransferase activities, triglycerides, cholesterol, and creatinine levels, insignificant increase in serum uric acid level, and a highly significant decrease in serum testosterone and estradiol-β17 levels in Group 3 in compare with the control group. Histopathological finding confirms these results. While hematological results of the same group revealed a significant increase in red blood cells count and packed cell volume value, insignificant increase in hemoglobin concentration, leukopenia, lymphopenia, and monocytopenia in compared with the control group. All of these changes appeared after 7 days from fish exposure to NP. Most of these alterations returned toward the normal level after 10 days from stopping exposure to NP. NP residues detected in fish muscle tissues of Group 3 during exposure and after stopping exposure to it. It is concluded that NP is a toxic

  16. Tilapia by-product meal in rations for Nile tilapia (Oreochromis niloticus fingerlings/ Farinha de resíduos da filetagem de tilápia em rações para alevinos de tilápia do Nilo (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Adilson Reidel

    2005-06-01

    Full Text Available Objectifying to evaluate the inclusion of tilapia processing residues (FT in the feeding of Nile tilapia (Oreochromis niloticus fingerlings, 125 Nile tilapia fingerlings (with average initial weight of 0.72±0.19g were distributed in a completely randomized design with five treatments and five repetitions in 25 aquariums (30L. The rations were formulated to contain 0, 5, 10, 15% of FT and 0% FT plus methionine (0+met. Isoproteics, isocalcitics, isophosphorics and isoenergetics diets were used. After 28 days of experiment, final weight (PF, weight gain (GP, feed conversion ratio (CA and survival (SO, were evaluated. No differences were observed (P>0.05 for the studied parameters. It was concluded that the FT can be used up to 15% in substitution to the soybean meal in the diet of nile tilapia fingerlings.Objetivando avaliar a inclusão de farinha de resíduos da filetagem de tilápias (FT na alimentação de alevinos de tilápia do Nilo (Oreochromis niloticus, foram utilizados 125 alevinos de tilápia do Nilo com peso inicial médio de 0,72±0,19g, distribuídos em um delineamento inteiramente casualizado com cinco tratamentos e cinco repetições, em 25 aquários (30L cada. As rações foram formuladas de forma a conterem 0, 5, 10, 15% de FT e 0% de FT mais metionina (0+met, sendo as mesmas isoenergéticas isoprotéicas, isocalcíticas e isofosfóricas. Após 28 dias de experimento foram avaliados as médias de peso final (PF, ganho de peso (GP, conversão alimentar aparente (CA e sobrevivência (SO. Não foram observadas diferenças (P>0,05 entre os parâmetros avaliados. Conclui-se que a FT pode ser utilizada em até 15% em substituição ao farelo de soja em rações para alevinos de tilápia sem causar prejuízo ao seu desempenho.

  17. Effect of cortisol on some osmoregulatory parameters of the teleost, Oreochromis niloticus L., after transference from freshwater to seawater Efeito do cortisol sobre parâmetros de osmorregulação do teleósteo, Oreochromis niloticus L., após a transferência de água doce para água salgada

    Directory of Open Access Journals (Sweden)

    A. Fontaínhas-Fernandes

    2003-10-01

    Full Text Available This trial was conducted in order to determine the effects of cortisol on salt water acclimation of tilapia Oreochromis niloticus (L.. Tilapia (n=42 were injected intraperitoneally with cortisol and then were directly transferred from freshwater (FW to 15‰ salt water (SW. Changes in plasma osmolality, chloride ion concentration (Cl-, plasma level of cortisol and gill Na+, K+-ATPase activity were measured at 6, 12, 24, 48, 72 and 168 hours after transference to 15‰ SW. Plasma osmolality and Cl- increased immediately after transference until 12-24 h. The fish injected with cortisol (F showed higher plasma levels of cortisol than those from control group (C that maintained the initial levels during the experiment. Gill Na+, K+-ATPase activity of C fish began to increase at first hours after transference and peak at 48h. The differences between gill Na+, K+-ATPase activity of F and C groups were significant (PEste estudo foi realizado com o objectivo de testar os efeitos do cortisol na aclimatação da tilápia Oreochromis niloticus (L. à água salgada. As tilápias (n=42 foram injectadas intraperitonealmente com cortisol e directamente transferidas de água doce para água salobra (15‰. As alterações da osmolaridade, concentração em cloretos (Cl-, os níveis plasmáticos de cortisol e a actividade branquial da Na+, K+-ATPase foram medidas (6, 12, 24, 48, 72 e 168 horas após a transferência para água salobra. A osmolaridade e a concentração em Cl- aumentou imediatamente após a transferência até às 12-24h. O grupo injectado com cortisol (F mostrou níveis plasmáticos de cortisol mais elevados do que o grupo controlo (C que manteve os níveis iniciais durante a experiência. A actividade branquial da Na+, K+-ATPase dos peixes do grupo C começou às primeiras horas após a transferência e teve um pico às 48h. As diferenças entre a actividade enzimática da Na+, K+-ATPase dos grupos F e C foram significativas (P<0,05 em

  18. Morphometrics, fillet yield and fillet composition in Nile tilapia, Oreochromis niloticus, strains thai chitralada, Brazil local and their hybrid/ Características morfométricas, rendimento e composição do filé de tilápia do Nilo, Oreochromis niloticus, da linhagem tailandesa, local e do cruzamento de ambas

    Directory of Open Access Journals (Sweden)

    Aleksey Machado Moreno

    2006-06-01

    Full Text Available Morphometrics, fillet yield and fillet composition differences were researched in Nile tilapia, Oreochromis niloticus, strain thai-chitralada (Tai, Brazil (Local Northern Paraná and their hybrid (Hbr, male Thailand x Brazilians female . The experiment was designed entirely randomly with three treatments (strains andthree repetitions per treatment in hapa nets in ponds. The initial weights were 0.39 ± 0.20, 0.45 ± 0.22 and 0.41 ± 0.15 g for the strains Tai, Bras and Hbr, respectively. At the end of the experiment, the weights were 650.67, 534.25 and 360.00 g for the same previous sequence, with statistically significant differencesbetween groups (P0.05. The strain Hbr produced (P0.05. Considering fillet composition, Local strain had the least crude lipid content of (1.88 %, as compared to Hbr (2.44 % and Tai (2.96 % which were significantly different (P 0.05.As características morfométricas, rendimento e a composição do filé foram pesquisadas em tilápia do Nilo Oreochromis niloticus, das linhagens tailandesa chitralada (Tai, local (Local, Norte do Paraná, Brasil, e da proveniente do cruzamento de ambas (Hbr, macho tailandesa x fêmea local. Ao início do experimento os peixes (n: 900 apresentavam peso de 0,39 ± 0,20; 0,41 ± 0,22 e 0,45 ± 0,15 g e ao final 650,67; 534,25 e 360,00 g para as variedades Tai, Local e Hbr, respectivamente. Foram estabelecidas quatro razões morfométricas, sendo que a razão entre a altura da cabeça/ comprimento da cabeça da variedade Tai foi maior (P 0,05. A composição centesimal do filé da linhagem Local apresentou menor teor de lipídeos (1,88% (P 0,05 entre as variedades.

  19. Quality index method (QIM application on shef life estimation of skinned fillets of Nile tilapia (Oreochromis niloticus kept in iceAplicação do método do índice de qualidade (MIQ para o estudo da vida útil de filés de tilápia do Nilo (Oreochromis niloticus sem pele, armazenados em gelo

    Directory of Open Access Journals (Sweden)

    Karoline Mikaelle de Paiva Soares

    2012-12-01

    Full Text Available The objective of this study was to develop the Quality Index Method (QIM for skinned fillets from farmed Nile tilapia (Oreochromis niloticus, and apply it in the establishment of its shelf life. The skinned fillets (120 g in average were kept in boxes with ice in the proportion of 1:1 (fillet:ice under average temperature of 0°C and stored at refrigeration chamber (4°C during 18 days. To evaluate the freshness during storage time sensory analysis (QIM and physicochemical (pH and TVB-N were performed every 72 hours from time zero, in triplicate. The maximum life of the Nile tilapia fillet in ice was estimated at 15 days. The MIQ was considered effective in evaluating the freshness of the Nile tilapia, since the sensory rejection by MIQ was determinant in the shelf life establishment. O objetivo do presente trabalho foi desenvolver o Método do Índice de Qualidade (MIQ para filé sem pele de tilápia do Nilo (Oreochromis niloticus, cultivada, e aplicá-lo no estabelecimento da sua vida útil. Os filés (média de 120 g cada foram mantidos em caixas com gelo na proporção de 1:1 (filé:gelo na temperatura média de 0°C e armazenados em câmaras de refrigeração (4°C por 18 dias. Para avaliar o frescor durante o armazenamento, realizaram-se análises sensoriais (MIQ e físico-químicas (pH e Nitrogênio das Bases Voláteis Totais a cada 72 horas, a partir do tempo zero, em triplicata. A vida útil máxima do filé sem pele de tilápia do Nilo, em gelo, foi estimada em 15 dias. O MIQ foi considerado eficiente na avaliação do frescor da tilápia do Nilo, já que a rejeição sensorial pelo MIQ foi determinante no estabelecimento da vida de prateleira.

  20. Estimativa da variabilidade genética em linhagens de tilápia do Nilo (Oreochromis niloticus com a técnica de RAPD - DOI: 10.4025/actascianimsci.v27i1.1236 Genetic variability estimation of Nile tilapia strains (Oreochromis niloticus using the RAPD technique - DOI: 10.4025/actascianimsci.v27i1.1236

    Directory of Open Access Journals (Sweden)

    Lauro Vargas

    2005-03-01

    Full Text Available A variabilidade genética é essencial para que se possa obter melhoramento genético e, portanto, é de grande importância a sua estimação. Desta forma, o objetivo do presente experimento foi estimar, pela técnica Random Amplified Polymorphic DNA (RAPD, a divergência e a variabilidade genética nas linhagens de tilápias do Nilo (Oreochromis niloticus Bouaké e Chitralada em duas gerações de reprodutores do rio Nilo. Foram utilizados 20 animais de cada linhagem. A matriz de coeficientes de similaridade de Jaccard entre indivíduos foi utilizada para a construção de um dendrograma e para a determinação, com o teste de Mantel, da divergência genética entre linhagens. A variabilidade genética foi estimada pelo índice de Shannon e pela porcentagem de loci polimórficos. As linhagens Bouaké e Chitralada formaram grupos distintos. A primeira apresentou menor divergência e variabilidade genética em relação à segunda. A variabilidade genética foi semelhante entre as duas gerações de reprodutores em ambas as linhagensGenetic variability estimation is highly important in order to achieve genetic improvement. The present experiment aims at estimating the genetic divergence and variability of the Nile tilapia strains (Oreochromis niloticus, Bouaké and Chitralada, in two breeders offsprings, using the Random Amplified Polymorphic DNA (RAPD. Twenty animals from each strain were used. The Jaccard similarity coefficients matrix was used for both designing a dendrogram and determining the genetic divergence of the strains, using Mantel’s test. The genetic variability was estimated by Shannon’s index and the percentage of polymorphic loci. Bouaké and Chitralada’s strains formed different groups. The former strain showed lower genetic divergence and variability in relation to the latter one. The two breeders offsprings had similar genetic variability in both strains

  1. Efeito da freqüência de alimentação no desempenho de larvas de tilápia do nilo, Oreochromis niloticus (L., durante a reversão sexual em tanques rede Effect of feeding frequency on Nile tilapia, Oreochromis niloticus (L. fries performance during sex reversal in hapas

    Directory of Open Access Journals (Sweden)

    Carmino Hayashi

    2001-05-01

    Full Text Available Com o objetivo de testar a freqüência da alimentação necessária para o melhor desempenho de larvas de tilápia do Nilo, Oreochromis niloticus (Perciformes, Cichlidae, durante o período de reversão sexual em águas verdes, 1.600 larvas, com idade aproximada de 7 dias, pesando 9,77 mg e medindo 9,03 mm, na quantidade de 80 larvas/tanque rede, essas larvas foram alimentadas com ração de 43% PB, contendo 60 mg de metil testosterona/kg de ração, nas freqüências de 2, 3, 4, 5, e 6 alimentações/dia, divididas uniformemente, durante o período diurno, por 28 dias. Foram medidos os parâmetros de crescimento, sobrevivência, uniformidade, conversão alimentar e biomassa total produzida. O crescimento foi reduzido (P Research aimed at verifying the necessary feeding frequency for the best performance of Nile tilapia, Oreochromis niloticus (Perciformes, Cichlidae fries during sex reversal period in green waters. Approximately 1,600 seven-day-old fries, measuring 9.03mm and weighting 9.77mg, in a distribution of 80 fries/hapa, were fed on diet containing 43% of CP and 60mg of methyltestosterone/kg of diet at frequencies of 2, 3, 4, 5 and 6 feedings/day, divided equally over the light period, for 28 days. Parameters of growth, survival, uniformity, feed conversion and total biomass produced were measured. Growth was significantly (p < 0.05 reduced at the frequency of 2 times per day. Regression models were used to measure the effects of feeding frequency on total biomass, and on final average weight and length. Frequency of 4-to-5 feedings/day was the most adequate. Survival, variation coefficient, uniformity condition factor, feed conversion and cost variables were not affected by the feeding regimen. The results recommend the feeding of tilapia fries at least at 4 equally spaced times during the day during the sex reversal period in order to attain best performance.

  2. Influence of diets enriched with different vegetable oils on the performance and fatty acid profile of Nile tilapia (Oreochromis niloticus fingerlings = Influência das dietas contendo diferentes óleos vegetais na performance e perfil em ácidos graxos de alevinos de tilápia do Nilo (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Nilson Evelázio de Souza

    2006-07-01

    Full Text Available The fatty acid profile of the carcass of Nile tilapia (Oreochromis niloticus fingerlings fed diets enriched with different soybean, canola, sunflower, flaxseed, rice, and corn oils was examined. The results showed that palmitic (16:0, stearic (18:0, oleic (18:1n-9, linoleic (18:2 n-6, and linolenic (18:3 n-3 acids were the predominant fatty acids in all vegetable oil, diet, and fish carcass samples analyzed. Flaxseed oil presented the highest amount of linolenic acid (45.63%, while the other vegetable oils had percentages lower than 5.0%. Neither of the vegetable oils used affected the performance of tilapia fingerlings and they can be utilized in Nile tilapia fingerling diets. However, in relation to the carcass fatty acid profile, the use of flaxseed oil in Nile tilapia fingerling diet is recommended. Foram examinados o perfil de ácidos graxos nas carcaças de alevinos de tilápia do Nilo (Oreochromis niloticus alimentados com dietas enriquecidas com diferentes óleos vegetais (soja, canola, girassol, linhaça, arroz e milho. Os resultados indicaram que o ácido palmítico (16:0, esteárico (18:0, oléico (18:1n-9, linoleico (18;2n-6 e linolênico (18:3n-3 foram os ácidos predominantes em todas as frações analisadas (no óleo vegetal, dietas e carcaças dos peixes. O óleo de linhaça apresentou o maior valor de ácido linolênico (45,63%, quanto aos outros óleos vegetais tiveram uma percentagem menor que 5,0%. Todos os óleos vegetais não afetaram a performance dos alevinos e podem ser utilizados nas dietas, entretanto, em relação a qualidade nutricional o uso do óleo de linhaça é recomendado em dietas de alevinos de tilápia.

  3. Efeito da temperatura da água sobre desempenho e perfil de ácidos graxos de tilápia do Nilo (Oreochromis niloticus - DOI: 10.4025/actascianimsci.v27i4.1184 Effect of environmental temperature on fatty acids profile of Oreochromis niloticus (Nile tilapia - DOI: 10.4025/actascianimsci.v27i4.1184

    Directory of Open Access Journals (Sweden)

    Nilson Evelázio de Souza

    2005-03-01

    Full Text Available Neste estudo foram analisados o perfil em ácidos graxos de alevinos de tilápia do Nilo (Oreochromis niloticus, submetidos a dietas enriquecidas com óleo de linhaça a diferentes temperaturas (23, 26, 29 e 32oC. Tilápias em fase inicial de desenvolvimento não apresentaram diferenças significativas (P > 0,05 em sua composição físico-química e lipídica, nas diferentes temperaturas estudadas. O perfil de ácidos graxos, analisados por cromatografia gasosa equipada com coluna capilar, mostrou aproximadamente 15% de ácidos graxos n-3 com valores em torno de 0,12 a 0,18% para o ácido eicosapentaenóico (EPA e de 1,21 a 2,10% para o ácido docosahexaenóico (DHA. Os resultados mostraram que a temperaturas mais baixas 23 e 26oC, as tilápias do Nilo cresceram menos que em temperaturas mais altas 29 e 32oC, mas a variação de temperatura entre 23 a 32oC não influenciou no perfil em ácidos graxos dos alevinosIn this study the fatty acid profile in tilápia Oreochromis niloticus alevins carcass, fed with enriched diets from flaxseed oil, was examined at different temperatures (23, 26, 29 and 32oC. Tilapia in its initial phase of development did not present differences (P >0.05 on physical-chemical and lipids compositions, at the different temperatures studied. The fatty acids profile, analyzed by gas chromatography using a capillary column, showed approximately 15% of n-3 fatty acids, with values around 0.12 to 0.18% for the eicosapentaenoic acid (EPA, and from 1.21 to 2.10% for the docosahexaenoic acid (DHA. Results showed that at lower temperatures 23 and 26oC, Nile tilapia grows less than at higher temperatures around 29 and 32oC. Temperature variation from 23 to 32oC did not influence on fatty acids profile of the alevins

  4. Desempenho produtivo da tilápia do Nilo (Oreochromis niloticus L. em diferentes densidades e trocas de água em “raceway” Productive performance of the nile tilapia (Oreochromis niloticus L. in tanks with different water exchanges and stocking density in raceway

    Directory of Open Access Journals (Sweden)

    Paulo César Silva

    2002-04-01

    Full Text Available Avaliou-se o desempenho produtivo dos alevinos de tilápia do Nilo, (Oreochromis niloticus L. (Perciformes Cichlidae estocados nas densidades de 90, 120 e 150 peixes/tanque, em 24 tanques circulares com 0,5 m³, em duas trocas totais de água (30 e 60 minutos, no sistema “raceway”. Utilizou-se o delineamento inteiramente casualizado, em esquema fatorial 3x2, para análise dos dados. Após 128 dias, o peso final e o ganho de peso foram superiores na maior troca de água e menor densidade; a conversão alimentar não alterou significativamente; a biomassa total aumentou com o aumento da renovação de água e densidade de estocagem de 120 e 150 peixes/m³; a taxa de crescimento específico aumentou na maior renovação da água; os rendimentos de filé e de carcaça diminuíram com a menor troca de água nas maiores densidades de estocagem. Os melhores resultados ocorreram com troca total de água em 30 minutos, nas densidades de estocagem de 120 e 150 peixes/m³.Nile tilapia, Oreochromis niloticus L. (Perciformes Cichlidae fingerlings were stocked at 90, 120 and 150 fishes in 24 circular tanks (0,5 m³, submitted to two full water exchanges, in a 30 and 60 minutes, in raceway system, to evaluate productive performance. The performance results were analyzed through a completely randomized design, in a 3x2 factorial scheme. After 128 days, the final weight and the weight gain were higher in larger water exchange and lower stocking density. The feed conversion ratio with non-significant statistical differences. The total biomass increased with the water exchange and stocking density increasing for 120 and 150 fishes/m³; the specific growth ratio increased with water exchange increasing; the fillet yield and the carcass yield decreased significantly with lower water exchange and bigger stocking density. In this research, it was concluded that the best performance parameters were obtained with full water exchange in 30 minutes, at bigger stocking

  5. Avaliação de dois métodos de determinação do coeficiente de digestibilidade aparente com a tilápia do Nilo (Oreochromis niloticus L. Evaluation of two methods to determine the digestibility apparent coefficients in Nile tilapia (Oreochromis niloticus L.

    Directory of Open Access Journals (Sweden)

    Margarida Maria Barros

    2002-04-01

    Full Text Available O presente estudo teve por objetivo, no primeiro experimento, avaliar a digestibilidade aparente da matéria seca (MS, proteína bruta (PB e extrato etéreo (EE, de uma ração purificada marcada com o indicador externo Cr2O3, nos três terços do intestino (proximal, intermédio e distal da tilápia do Nilo, Oreochromis niloticus L (Perciformes Cichlidae. No segundo, objetivou-se comparar os coeficientes de digestibilidade obtidos pelos métodos da excreção natural em aquário de digestibilidade e os coeficientes resultantes da técnica da dissecação intestinal. Concluiu-se que na porção distal do intestino ocorre um incremento na absorção da ração, que o método da dissecação subestima a digestibilidade do material colhido (MS=41,79%a; PB=48,98a; EE=35,10%b, que são mais confiáveis e reais os coeficientes de digestibilidade medidos pelo método indireto, com fezes colhidas nos aquários de coleta (MS=63,99%b; PB=85,62b; EE=73,60%b.The objective of this study was, in the first experiment, to evaluate the apparent digestibility of dry matter (DM, crude protein (CP and ether extract (EE of purified diet using chromic oxide as inert marker, in the three parts of intestine (proximal, middle and distal of Nile tilapia, Oreochromis niloticus L (Perciformes Cichlidae. In the second experiment, the aim was to compare the digestibility coefficients obtained by natural excretion in the digestibility aquarium and by intestine dissection. The results showed that in the distal portion there was an increase in the absorption, the dissection method underestimates the digestibility of collected material (DM=41.79%a, CP=48.98a, EE=35.10%b and that the digestibility coefficients obtained by indirect method with feces collected in the digestibility aquariums are more reliable and real (DM=63.99%b, CP=85.62b, EE=73.60%b.

  6. Digestibilidade aparente pela tilápia do Nilo (Oreochromis niloticus L. de rações contendo sorgo (alto e baixo tanino e metionina Nile tilapia (Oreochromis niloticus L. apparent digestibility of diets containing (high and low tannin sorghum and methionine

    Directory of Open Access Journals (Sweden)

    Giovani Sampaio Gonçalves

    2002-04-01

    Full Text Available Esse estudo teve por objetivo avaliar os efeitos da inclusão de duas variedades de sorgo (alto e baixo tanino e da metionina em rações para tilápia do Nilo, Oreochromis niloticus L. (Perciformes, Cichlidae. Foi avaliada a digestibilidade aparente da matéria seca, proteína bruta e energia bruta. Empregaram-se 100 peixes distribuídos em 10 grupos, os quais receberam rações contendo sorgo alto e baixo tanino e 0,0%; 0,60% e 0,90% de metionina. Após um período de aclimação de três dias, foram colhidas amostras representativas das fezes produzidas diariamente até completar seis repetições de cada tratamento. A partir das análises químicas das rações e das fezes e utilizando-se o óxido de crômio como marcador inerte, foram calculados os coeficientes de digestibilidade aparente. Pode-se concluir que para tilápia do Nilo, o sorgo variedade baixo tanino apresenta coeficientes de digestibilidade aparente que podem ser considerados semelhantes aos do milho; que a variedade alto tanino apresenta coeficientes de digestibilidade aparente significativamente inferiores aos do milho e da variedade baixo tanino e; que a suplementação de metionina não é suficiente para controlar a ação antinutricional do tanino.This study was carried out in order to evaluate the effects of two sorghum varieties (high and low tannin and levels of methionine (0.0%, 0.60% and 0.90% in Nile tilapia, Oreochromis niloticus L. (Perciformes, Cichlidae, diets on apparent digestibility of dry matter, crude protein and crude energy. 100 fish were distributed in ten aquarium (250L. After a climatization period of three days, representative samples of feces were obtained daily until reach six replicates each treatment. The apparent digestibility coefficient was calculated based in chemical analysis of diets and feces to determine chemical composition and chromic oxide. It was concluded that for Nile tilapia the low tannin sorghum has similar apparent digestibility

  7. Coeficientes de digestibilidade aparente da energia e proteína da silagem de sorgo com alto e baixo tanino pela tilápia do nilo (Oreochromis niloticus Apparent digestibility coefficients of energy and protein of low and high tannin silage sorghum for nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Wilson Massamitu Furuya

    2004-08-01

    Full Text Available Este estudo foi realizado para determinar o coeficiente de digestibilidade aparente (CDA da energia bruta e proteína bruta da silagem de sorgo de baixo tanino (SSBT e da silagem de sorgo de alto tanino (SSAT para a tilápia do Nilo (Oreochromis niloticus. A ração referência foi misturada aos ingredientes-teste na proporção de 60:40. Os peixes (53,26 ± 12,94g foram alimentados até a saciedade aparente e as fezes foram coletadas após sedimentação. A fibra em detergente neutro foi utilizada como indicador endógeno. Os CDA da energia bruta e proteína bruta da SSBT e SSAT variaram entre 70,17 e 68,37% e 84,94 e 82,40%, respectivamente. Os valores de energia digestível foram de 3049,81 e 2954,74kcal kg-1 para SSBT e SSAT, respectivamente. A SSBT apresentou valores significa-tivamente (PThis study was carried out to determine the apparent digestibility coefficients (ADC of gross energy and crude protein of low tannin silage sorghum (LTSS and high tannin silage sorghum (HTSS for Nile tilapia (Oreochromis niloticus. The reference diet was mixed with test ingredients in a 60:40 ratio. Fish (53.26 ± 12.94g were fed to apparent satiation and faeces were collected other sedimentation The neutral detergent fiber was used as an endogenous indicator. ADC for gross energy and crude protein of LTSS and HTSS varied between 70.17 and 68.37% and 84.94 and 82.40%, respectively. Digestible energy values were 3,049.81 and 2,954.74kcal kg-1 for LTSS and HTSS, respectively. LTSS produced significantly (P<0.05 higher energy and protein digestibilities than HTSS. Results indicated that Nile tilapia can utilize the gross energy and crude protein of sorghum silage efficiently.

  8. Effects of bamboo substrate and supplemental feeding on growth and production of hybrid red tilapia fingerlings (Oreochromis mossambicusxOrechromis niloticus)

    NARCIS (Netherlands)

    Keshavanath, P.; Gangadhar, B.; Ramesh, T.J.; Dam, van A.A.; Beveridge, M.C.M.; Verdegem, M.C.J.

    2004-01-01

    Periphyton growing on artificial substrates can increase the production of herbivorous fish in aquaculture ponds. Periphyton may be an alternative or a complement for supplemental feed in fingerling production. Growth and production of hybrid red tilapia (Oreochromis mossambicus x Oreochromis

  9. Ameliorative effect of propolis supplementation on alleviating bisphenol-A toxicity: Growth performance, biochemical variables, and oxidative stress biomarkers of Nile tilapia, Oreochromis niloticus (L.) fingerlings.

    Science.gov (United States)

    Hamed, Heba S; Abdel-Tawwab, Mohsen

    2017-11-01

    Bisphenol-A (BPA) is one of the important pollutants in aquatic ecosystems and its detrimental effect on fish has a great concern. Propolis is a natural immune-stimulant that has various biological and pharmacological activities. Thus, its capability to alleviate the toxic effect of BPA on Nile tilapia, Oreochromis niloticus (L.) performance was assessed in a study based on a 2×2 factorial design with two levels of ethanolic extract of propolis (EEP) and two waterborne BPA concentrations in triplicates. Fish (33.9±0.55g) were exposed to 0.0 or 1.64μgBPA/L for 6weeks during which fish were fed on diets containing 0.0 or 9.0gEEP/kg diet. Fish performance, biochemical variables, and oxidative stress enzymes were significantly affected by propolis supplementation, BPA exposure, and their interaction. Propolis supplementation significantly improved fish growth and feed intake, which were significantly retarded by BPA exposure. Additionally, total protein, albumin, globulin, and acetylcholine esterase (AChE) decreased significantly. Meanwhile aspartate transferase (AST), alanine transferase (ALT), alkaline phosphatase (ALP), creatinine, and uric acid increased significantly with exposure to BPA. Levels of malondialdehyde (MDA) as well as superoxide dismutase (SOD) and catalase (CAT) activities increased significantly due to BPA exposure, whereas significant reductions in the activity of glutathione peroxidase (GPx) and glutathione S-transferase (GST) were also recorded compared to the control fish. It is noticed that EEP co-administration ameliorated these parameters. The present results evoked that propolis administration improves fish growth and alleviated BPA-induced toxicity. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Capability of some agricultural wastes for removing some heavy metals from polluted water stocked in combination with Nile tilapia, Oreochromis niloticus (L.

    Directory of Open Access Journals (Sweden)

    Mohsen Abdel-Tawwab

    2017-04-01

    Full Text Available Abstract Heavy metal (HM pollution is one of the major problems that adversely affect the aquatic ecosystem and inhabiting biota. Heavy metals adsorption by low-cost adsorbents is one of the techniques used for HM removing from polluted water. In the present study, agricultural wastes (AW, i.e., rice straw, sugarcane bagasse, and maize stalks, were washed with distilled water, dried in a dry-oven, cut into small pieces (<0.5 cm long, and immersed at 1.0 g/L in aquaria containing synthetic mixture of lead (Pb, cadmium (Cd, copper (Cu, and zinc (Zn. Nile tilapia, Oreochromis niloticus (L., fingerlings (25.2 ± 0.88 g were stocked at a density of ten fish per 100-L aquarium for 72 h, during which fish were fed on a fish diet containing 25% crude protein ad libitum twice daily. Samples of water, AW, and fish were collected at different times to determine HM concentrations. The HM removal from polluted water was depending on the type of the metal ions, AW, and the contact time. However, HM concentrations in aquaria waters of all AW treatments decreased significantly by increasing contact time up to 24 h after which their concentrations were almost the same. Concentrations of waterborne Pb, Cd, Cu, and Zn in AW-containing aquaria were significantly lower than those of AW-free aquaria. The presence of any AW reduced significantly HM concentrations. In AW-free aquaria, HM-exposed fish accumulated more HM in their body than those reared in AW-containing aquaria. The results of this experiment showed that all AW had the capability to remove HM levels from the polluted water and reduce their bioaccumulation in fish body. However, rice straw was the more efficient adsorbent for all metals.

  11. CARACTERÍSTICAS FÍSICO-QUÍMICAS DO PATÊ DE TILÁPIA DO NILO (Oreochromis niloticus, COMPARADO A PRODUTOS SIMILARES COMERCIAIS

    Directory of Open Access Journals (Sweden)

    M. G. MINOZZO

    2008-09-01

    Full Text Available

    Patê é um produto cozido, com tradições gastronômicas importantes e com características sensoriais bastante apreciadas. Os primeiros patês foram feitos com fígado de ganso (“foie-grass” e fígado de porco. Porém, novos produtos foram lançados no mercado, inclusive o patê de peixe, devido às vantagens nutricionais que estes produtos detêm. Este trabalho teve como objetivo a elaboração e caracterização de patê de filé de tilápia do Nilo (Oreochromis niloticus e sua comparação à produtos similares. O presente trabalho foi desenvolvido no Laboratório de Tecnologia de Alimentos da UFPR - Universidade Federal do Paraná. O patê de tilápia e os de marcas comerciais, patê de atum e de presunto, foram submetidos às análises bromatológicas, onde se obteve os seguintes valores: umidade 59,47%, 76,30%, e 52,13% respectivamente, cinzas 2,20%, 2,96%, e 2,53%, proteínas 8,53%, 6,83% e 9,05%, lipídios 27,41%, 3,49% e 17,72% e carboidratos 2,39%, 10,22% e 18,57% para os patês de tilápia atum e presunto respectivamente.

  12. Effect of dietary fish meal replacement by red algae, Gracilaria arcuata, on growth performance and body composition of Nile tilapia Oreochromis niloticus.

    Science.gov (United States)

    Younis, El-Sayed M; Al-Quffail, Abdullah S; Al-Asgah, Nasser A; Abdel-Warith, Abdel-Wahab A; Al-Hafedh, Yousef S

    2018-02-01

    A 12-week long feeding experiment was initiated to evaluate the effect of dietary supplementation of red algae, Gracilaria arcuata , on the growth performance, feed utilization and body composition of Nile tilapia Oreochromis niloticus (Linnaeus, 1758). The fish were fed with an algae-free control diet (C) and three experimental diets which replaced conventional fish meal with varying levels of dried G. arcuata (20%, 40% and 60%, represented as G20, G40 and G60, respectively). The growth parameters of final weight (FW), weight gain (WG), percentage of weight gain (WG%), daily growth rate (DGR) and specific growth rate (SGR) were significantly reduced (P algae incorporation compared to the control diet. Moreover, the negative impact of Gracilaria meal on the growth performance of Nile tilapia increased as the proportion of algae in the diet increased, with fish on diet G20 exhibiting a significantly higher growth performance than the fish on either of the G40 and G60 diets. On the other hand, the feed utilization parameters feed conversion ratio (FCR) and protein efficiency ratio (PER) did not show significant differences between the fish in the control group and those on diet G20, although poorer FCR and PER outcomes were achieved in the case of fish on diet G60. The content of moisture, protein and ash in muscle and carcass increased as the proportion of Gracilaria meal in the diets increased, but the reverse was true for lipid level. These results indicate that incorporation of less than 20% red algae, Gracilaria arcuata , could be feasible in the diet of Nile tilapia and further studies are recommended to optimize the level of algae to improve growth performance.

  13. Determinación y prevalencia de Mycobacterium spp., en tilapia nilótica (Oreochromis niloticus cultivada en Campeche, México

    Directory of Open Access Journals (Sweden)

    Maurilio Lara-Flores

    2013-03-01

    Full Text Available Objetivo. Determinar la presencia y prevalencia de Mycobacterium spp., en granjas de tilapia nilótica (Oreochromis niloticus en el Municipio de Champotón, Campeche, México. Materiales y métodos. La colecta de organismos se realizó en tres granjas de cultivo de tilapia nilótica del municipio de Champotón, Campeche, México. Los organismos se examinaron externa e internamente y se tomó una muestra de riñón la cual fue sembrada en forma de estría en medios de cultivo: Löwesntein-Jensen, TCBS, KF y en TSA; las placas fueron incubadas a 35°C de 24 a 48 horas, los órganos fueron fijados en formalina tamponada al 10% para ser procesados para histología de rutina para análisis posteriores. Asimismo, muestras de cultivo bacteriológico y de tejido fueron teñidas con la técnica de Ziel-Neelsen con el fin de observar la presencia de bacilos ácido-alcohol resistentes. Resultados. Los resultados obtenidos sugieren que la presencia de Mycobacterium spp., es constante y en alta prevalencia y puede ser un factor que este mermando la rentabilidad del cultivo. Conclusiones. La presencia de Mycobacterium spp., representa un riesgo para el cultivo de tilapia en el municipio de Champotón, por ser una enfermedad muy persistente y difícil de erradicar una vez ocurrido e brote de infección, por lo cual es importante llevar estudios más detallados de la presencia de este género bacteriano, así como, medidas de prevención y dispersión de este patógeno en los cultivos adyacentes.

  14. Apparent digestibility coefficient of chickpea, maize, high-quality protein maize, and beans diets in juvenile and adult Nile tilapia ( Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Magnolia Montoya-Mejía

    Full Text Available ABSTRACT The objective of our study was to assess the apparent digestibility of plant ingredients in diets for juvenile (50 g and adult (220 g Nile tilapia (Oreochromis niloticus. Dietary dry matter and protein apparent digestibility coefficients of four plant-derived feedstuffs (chickpea, maize, high-quality maize protein, and beans were tested. The beans diet had the lowest apparent digestibility coefficient of dry matter (ADCDM (69.41%, while no significant differences were detected in ADCDM among the other diets; ADCDM was significantly higher in adults compared with juveniles (77.02 vs. 73.76%. Apparent dry matter digestibility coefficient of ingredients (ADCI was significantly higher in the chickpea (70.48% and high-quality protein maize (71.09% ingredients, and lower in the beans (52.79% ingredient. Apparent dry matter digestibility coefficient of ingredients was significantly higher in juveniles compared with adults (72.56 vs. 56.80%. The protein digestibility of diet (ADCCP was significantly higher in the reference diet (93.68%, while the lowest corresponded to the maize (87.86% and beans (87.29% diets. Significantly lower apparent digestibility coefficient of protein (ADCICP was obtained with the high-quality maize protein (59.11% and maize (49.48% ingredients, while higher ADCICP was obtained with the chickpea and beans ingredients (71.31 and 63.89%, respectively. The apparent digestibility coefficient of ingredient crude protein ADCICP was significantly higher in juveniles compared with adults (67.35 vs. 53.46. Digestibility is generally higher in juveniles, and we recommend using chickpea as an ingredient in diets for Nile tilapia.

  15. The use of nile tilapia ( Oreochromis niloticus) cultivation wastewater for the production of romaine lettuce ( Lactuca sativa L. var. longifolia) in water recirculation system

    Science.gov (United States)

    Effendi, Hefni; Wahyuningsih, Sri; Wardiatno, Yusli

    2017-10-01

    In the recirculation aquaponic system (RAS), fish farming waste was utilized as a nutrient for plant, minimizing the water need, reducing the waste disposal into the environment, and producing the fish and plant as well. The study aimed to examine the growth of romaine lettuce ( Lactuca sativa L. var. Longifolia) in aquaponic system without the addition of artificial nutrient. The nutrient relies solely on wastewater of nile tilapia ( Oreochromis niloticus) cultivation circulated continuously on the aquaponic system. The results showed that tilapia weight reached 48.49 ± 3.92 g of T3 (tilapia, romaine lettuce, and inoculated bacteria), followed by T2 (tilapia and romaine lettuce) and T1 (tilapia) of 47.80 ± 1.97 and 45.89 ± 1.10 g after 35 days of experiment. Tilapia best performance in terms of growth and production occurred at T3 of 3.96 ± 0.44 g/day, 12.10 ± 0.63 %/day, 96.11 ± 1.44 % and 1.60 ± 0.07 for GR, SGR, SR, and FCR, respectively. It is also indicated by better water quality characteristic in this treatment. Romaine lettuce harvests of T2 and T3 showed no significant difference, with the final weight of 61.87 ± 5.59 and 57.74 ± 4.35 g. Overall, the integration of tilapia fish farming and romaine lettuce is potentially a promising aquaponic system for sustainable fish and horticulture plant production.

  16. Effects of dietary grape seed proanthocyanidins on growth performance, some serum biochemical parameters and body composition of tilapia (Oreochromis niloticus fingerlings

    Directory of Open Access Journals (Sweden)

    Shao Wei Zhai

    2014-07-01

    Full Text Available The present study was performed with tilapia (Oreochromis niloticus to evaluate the effects of diet supplementation with grape seed proanthocyanidins (GSPs on fish growth performance, some serum parameters and body composition. Three hundred tilapia fingerlings with the initial average body weight of 9.50±1.25 g were randomly divided into five treatment groups with four replicates in each group and 15 fish in each replicate. The dietary GSPs levels of five treatment groups were 0 (control group, 200, 400, 600, and 800 mg/kg, respectively. The trial period was 49 days. Growth performance parameters were significantly improved by GSPs supplementation (P<0.05, while survival rates were similar among all groups (P>0.05. Serum parameter results showed that activities of aminotransferase aspartate in 200 and 400 mg/kg GSPs groups and alanine aminotransferase in 400 mg/kg GSPs group were lowered significantly (P<0.05. Levels of triglyceride and total cholesterol (except 200 mg/kg GSPs group were significantly lowered, while lysozyme activity and albumin level were significantly higher in fish of GSPs supplemented groups, independently from the level of supplementation. The highest crude protein level and lowest crude lipid level were found in fish of all GSPs supplemented groups, while levels of moisture and ash in fish of all groups were similar (P>0.05. The results indicated that dietary 200 mg/kg GSPs could exert beneficial effects on growth and body composition of tilapia fingerlings, and ameliorate serum biochemistry parameters related to health status.

  17. Protective effect of hydroferrate fluid, MRN-100, against lethality and hematopoietic tissue damage in γ-radiated Nile tilapia, Oreochromis niloticus

    International Nuclear Information System (INIS)

    Ghoneum, Mamdooh; Elbaghdady, Heba Allah M.; El-Shebly, Abdallah A.; Pan, Deyu; Assanah, Edward; Lawson, Greg

    2013-01-01

    Hydroferrate fluid, MRN-100, an iron-based compound derived from bivalent and trivalent ferrates, is a potent antioxidant compound. Therefore, we examined the protective effect of MRN-100 against γ-radiation-induced lethality and damage to hematopoietic tissues in fish. A total of 216 Nile tilapia fish (Oreochromis niloticus) were randomly divided into four groups. Group 1 served as a control that was administered no radiation and no MRN-100 treatment. Group 2 was exposed only to γ-radiation (15 Gy). Groups 3 and 4 were pre-treated with MRN-100 at doses of either 1 ml/l or 3 ml/l in water for 1 week, and subsequently exposed to radiation while continuing to receive MRN-100 for 27 days. The survival rate was measured, and biochemical and histopathological analyses of hematopoietic tissues were performed for the different treatment groups at 1 and 4 weeks post-radiation. Exposure to radiation reduced the survival rate to 27.7%, while treatment with MRN-100 maintained the survival rate at 87.2%. In addition, fish exposed to γ-radiation for 1 week showed a significant decrease in the total number of white blood cells (WBCs) and red blood cells (RBCs) series. However, treatment with MRN-100 protected the total WBC count and the RBCs series when compared with irradiated fish. Furthermore, significant histological lesions were observed in the hepatopancreas, spleen and gills of irradiated fish. However, treatment with MRN-100 protected the histopathology of various organs. We conclude that MRN-100 is a radioprotective agent in fish and may be useful as an adjuvant treatment to counteract the adverse side effects associated with radiation exposure. (author)

  18. Effects of Olea europaea L. Leaf Metabolites on the Tilapia (Oreochromis niloticus and Three Stored Pests, Sitophilus granarius, Tribolium confusum and Acanthoscelides obtectus

    Directory of Open Access Journals (Sweden)

    Ahmet Kısa

    2018-05-01

    Full Text Available Olea europea L. emerged as a good source of traditional medicine for the treatment of various ailments of various countries of the world, in particular Mediterranean countries. In this study, oleuropein (1, oleanolic acid (2, maslinic acid (3, a mixture of erythrodiol and uvaol (4 and 5 isolated from the leaves of olive were added at two concentrations (1g/100g feed and 4g/100 g feed into fish feed. Oreochromis niloticus (Nile tilapia were fed twice a day with the feed during 96 hours. The levels of alanine aminotransferase (ALT, aspartate aminotransferase (AST, alkaline phosphatase (ALP enzymes and glucose levels in the serums of fishes fed with pure compounds were found to be higher as compared with the control group. Pure metabolites affect the liver metabolism of Nile tilapia. These results suggested that the compounds tested affect the liver metabolism of Nile tilapia. Compounds 1, 2, 3 and 4+5 (2.5, 5.0 and 7.5 mg/Petri dish concentrations were also tested for contact toxic effects against three important stored pests, Sitophilus granarius (weevil, Tribolium confusum (confused flour beetle and Acanthoscelides obtectus (bean weevil. The toxic effects of the metabolites were lower than those of the insecticide, dichlorvos (DDVP. DDVP caused complete mortality of the insects after 48 hours of treatments, the metabolites caused the mortality rates 16.7-63.3 %, 13.3-67.0 % and 26.7-59.0 % of S. granarius, T. confusum and A. obtectus, respectively. Maslinic acid (3 has the most toxic compound with the lowest LC 50 values (0.66 mg/Petri, 0.61 mg/Petri and 1.71 mg/Petri for S. granarius, T. confusum and A. obtectus, respectively. These results show that maslinic acid (3 as well as other substances can be used as natural insecticides against these pests.

  19. Effects of palm kernel cake (PKC on growth performance, blood components and liver histopathology of sex reversed red tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Sukasem, N.

    2007-09-01

    Full Text Available Effects of Palm Kernel Cake (PKC on growth performance, blood components and liver histopathology of sex- reversed red tilapia Oreochromis niloticus were studied using seven isocaloric diets (3400 kCal/ kg containing different levels of protein and PKC. Diet 1, 2 and 3 contained 20% protein with the supplementation of 15, 30 and 45% PKC, respectively. Diets 4, 5 and 6 contained 24% protein in combinationwith the same PKC supplemention levels mentioned above, and diet 7 was commercial feed containing 20% protein as a control diet. Experimental diets were fed to experimental fish of 48.65 g initial average body weight cultured in floating cages (3 cages/diet for 10 weeks. Fish fed diets containing higher protein (24%; diets 4, 5 and 6 had significantly better growth performance (p<0.05 than those fed lower protein (20%; diets 1, 2 and 3. Considering the effect of PKC, fish fed diet 5 (Prot. 24%, PKC 30% gave the greatest growth performance (p<0.05 and all the PKC-fed groups had significantly higher growth than fish fed control diet. There was evidence that supplementation of PKC in fish feed ranging from 15 to 45% had no effect to the survival rate, blood components, or hepatocytic cells of tilapia. However, liver tissue showed higher numbers of lipid droplets in fish fed diet contained 45% PKC (diets 3 and 6. For the production cost, all test diets with PKC supplementation had significantly higher price (p<0.05 than commercial feed. However, when considering the feeding cost per unit of fish production, fish reared with PKC supplemented diets had significantly lower cost (p<0.05 than fish fed commercial feed.

  20. In vitro evaluation of the efficacy of hemodialysate (Solcoseryl® as a wound healing agent in Nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    A.E. Eissa

    2013-12-01

    Full Text Available Skin wounds are the most prevalent daily affections intruding fishes in an aquaculture facility. Such skin affections are considered to be the most common portals of entry for disease agents affecting fishes. This persistent phenomenon necessitates a comprehensive search for an efficient healing therapy to combat the ongoing dermal damage and its pathological consequences. In the current study, the core hypothesis has been vigorously tested through the experimental application of hemodialysate (Solcoseryl® solution in several exposure methods including bath, intraperitoneal (I.P., intramuscular (I.M., and local infiltration routes. All tested routes were capable of inducing different degrees of healing in Nile tilapia (Oreochromis niloticus. The core hypothesis of the current research has been experimentally accomplished through assessing the resultant healing degrees based on both gross as well as tissue alteration dynamics among total of 5 experimental groups. Each group consisted of 10 fishes/aquarium. The swift tissue healing of the induced wounds in Nile tilapia were completely achieved 4 days post I.M. injection of the Solcoseryl® solution (10 μl/50 g fish as a single dose with an excellent healing grade (+++++. However, bath treatment (1 ml/Lwater as a single dose and local infiltration (10 μl/50 g fish as a single dose have proved to be second on the race (complete healing was achieved 6 days post treatment with very good grade (+++. This study demonstrates the clinical value of fish models in establishment of new approach for combating prevalent invasive skin affections in aquaculture.

  1. Effects of shrimp head meal in the diets on growth, feed efficiency and pigmentation of sex-reversed red tilapia, Oreochromis niloticus x O. mossambicus

    Directory of Open Access Journals (Sweden)

    Pimolrat, P.

    2006-09-01

    Full Text Available Shrimp head meal (SHM was used to replace fish meal as a protein source in practical diets for sexreversed red tilapia (Oreochromis niloticus x O. mossambicus at 0, 25, 50, 75 and 100% of fish meal protein or 0, 6.92, 13.84, 20.76 and 27.68% by weight of diet respectively. Catfish feed that contained protein content 37.22±0.10% was included as a reference diet. The experimental diets were fed to the fish with mean initial weight of 3.13±0.05 g for 8 weeks in 70 l aquaria. The results showed that weight gain and specific growth rate of fish fed 50% of fishmeal protein replacement or diet 3 was not significant by different from those of fish on control diet (p>0.05. The data of feed intake, feed conversion ratio and productive protein value of fish fed diet 3 were equal to those fed control diet (p>0.05. The lowest growth rate and feed efficiency showed on fish fed 100% of fishmeal protein replacement. The production cost of fish fed diet 3 was equal to those fed the control diet and the reference diet (p>0.05. Total carotenoid content in fish skin was significantly highest (p<0.05 in fish fed 100% of fishmeal protein replacement diet. The result indicates that the use of SHM at the level of 50% replacement or 13.84% by weight of diet is a potential protein source in sex-reversed red tilapia diet.

  2. Dietary administration of Bacillus subtilis on hematology and non-specific immunity of Nile tilapia Oreochromis niloticus raised at different stocking densities.

    Science.gov (United States)

    Telli, Guilherme Silveira; Ranzani-Paiva, Maria José Tavares; Dias, Danielle de Carla; Sussel, Fabio Rosa; Ishikawa, Carlos Massatoshi; Tachibana, Leonardo

    2014-08-01

    An 84-day feeding trial was conducted to evaluate the effect of the dietary administration of Bacillus subtilis on the growth performance, body composition, intestinal probiotic recovery, hematology, and non-specific immunity of Nile tilapia (Oreochromis niloticus) raised at two stocking densities. Five hundred twenty male Nile tilapias (32.63 ± 1.25 g) were distributed in 16,800-L tanks. The experimental design was completely randomized using four replications and a 2 × 2 factorial scheme with two stocking densities (18.75 fish m(-3) 62.50 fish m(-3)) and two diets (control and with probiotic). The probiotic-supplemented diet included 5 × 10(6) CFU g feed(-1). There were no significant differences (P > 0.05) in the growth performance, body composition, and levels of cortisol and glucose between the animals fed with the control diet and the animals fed with the probiotic-supplemented diet. Differences in the growth performance were observed between the fish reared at different stocking densities; in particular, the fish raised at the high stocking density exhibited reduced weight gain, feed intake, and specific growth rate compared with those raised at the low stocking density. The B. subtilis remained viable after its inclusion in the feed, storage, and passage through the stomach, which demonstrations the feasibility of using this bacteria as a probiotic. Higher values (P immune system of Nile tilapia by decreasing the stress associated with exposure to a high stocking density, increasing the mean corpuscular hemoglobin, and improving the innate immune system (lysozyme and phagocytic activities of macrophages). Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Dietary lipid content influences the activity of lipogenic enzymes in the liver and on whole body delta13C values of Nile tilapia, Oreochromis niloticus (L.).

    Science.gov (United States)

    Gaye-Siessegger, Julia; Focken, Ulfert; Abel, Hansjörg; Becker, Klaus

    2004-09-01

    The use of stable isotope techniques for the reconstruction of diets has increased over the last decade. However, isotopic ratios in an animal are not only affected by the composition of the feed, but also by the amount of feed consumed. An uncertainty of up to 1 per thousand for both delta13C and delta15N values has been observed when the feeding level is unknown. This may have substantial effects on the results of back-calculation. As the feeding level of animals is unknown in nature, an additional indicator for their nutritional status is needed. High feeding levels and a consequent surfeit of dietary energy lead to the synthesis of lipids. In order to test whether the level of lipogenesis could be used as an indicator, Nile tilapia (Oreochromis niloticus) were fed four isonitrogenous and isoenergetic wheat-based semi-synthetic diets with different lipid contents (2.0 %, 4.5 %, 9.5 % and 13.3 %) for eight weeks. Body composition, gross energy content and delta13C values in the lipids and the lipid-free material were determined in diets and fish bodies. The livers of three fish per feeding group were assayed for the activity of two lipogenic enzymes, ATP-citrate lyase and malic enzyme. There was a strong negative correlation between delta13C values in the lipids of the individual fish and the apparent lipid conversion. The activities of lipogenic enzymes decreased with rising lipid content in the diet. The delta13C values in the lipids decreased significantly with increasing specific activity for both enzymes. In this experiment where lipogenesis was influenced by the composition of the diet, it was possible to determine the exact value for the trophic shift in relation to the enzyme activities. Further experiments to investigate the use of enzyme activities in situations where the feeding level of an animal is unknown are recommended.

  4. Genetic differentiation of red and gray tilapia (Oreochromis niloticus using microsatellites and SCAR markers as indicators of genetic sex

    Directory of Open Access Journals (Sweden)

    Monica Arqueros

    2017-10-01

    Full Text Available The aims of this work was to develop a standardized molecular protocols, to differentiate red and gray tilapia lineages using DNA microsatellites and to evaluate SCAR-5F-X/5R and SCAR-5F/5R-Y markers associated with the phenotypic sex of O. niloticus. The UNH106 microsatellite allowed differentiating genetically the lineages of red tilapia from gray. The markers UNH136, UNH115 and UNH995 presented monomorphic loci in both the red and gray tilapia in the population stock of the Centro Experimental de Genética of the Universidad Nacional de Trujillo. Fragment sizes for microsatellites and the reference gene β actin are described. The effectiveness of SCAR markers as informative in the determination of the genetic sex in XX and YY females and XY y YY males of red tilapia and XX females and XY males of gray tilapia was also confirmed.

  5. Quantification of fatty acids in tilapia fingerlings (Oreochromis niloticus fed with different sources of vegetable oilsQuantificação de ácidos graxos de alevinos de tilápia do Nilo (Oreochromis niloticus alimentados com diferentes fontes de óleos vegetais

    Directory of Open Access Journals (Sweden)

    Leticia Hayashi Higuchi

    2013-09-01

    Full Text Available The present work aimed to quantify the fatty acids in total lipids of Nile tilapia fingerlings (Oreochromis niloticus fed with different sources of vegetable oils mechanically extracted. Were used 320 tilapias (O. niloticus with average initial weight and average total initial length of 2.55±0.57 g and 5.59±0.43 cm, respectively, fed for a period of 60 days, in a randomized block design with eight treatments and four replications. The diets were prepared with 320 g/kg crude protein and 3.500 kcal of digestible energy per kg of feed enriched with eight different oils: sunflower, canola, sesame, linseed, peanut, Para’s nut soy and macadamia, with an addition of 4%. Among the major fatty acids the oleic, palmitic, linolenic and linoleic were obtained in higher concentration (mg/g of LT in fish from all treatments. The sums of polyunsaturated fatty acids after 60 days of cultivation had increased in all treatments compared to the 30 days of the experiment. This is due to the addition of oils with high contents of n-6 and n-3 fatty acids. The fatty acids in the carcass are a reflection of the energy source of oil used. As a conclusion it is recommended the use of linseed oil in the diet of tilapia fingerlings due to great improvement in the relationship between n-6/n-3. O presente trabalho teve como objetivo quantificar os ácidos graxos nos alevinos de tilápias do Nilo (Oreochromis niloticus alimentadas com diferentes fontes de óleos vegetais extraídos mecanicamente. Foram utilizadas 320 tilápias com peso inicial médio e comprimento total inicial médio de 2,55±0,57 g e 5,59±0,43 cm, respectivamente, alimentados por um período de 60 dias, num delineamento em blocos casualizados com oito tratamentos e quatro repetições. As rações foram elaboradas com 320 g/ kg proteína bruta (PB e 3.500 kcal de energia digestível (ED por kg de ração, enriquecidas com oito diferentes óleos: girassol, canola, gergelim, linhaça, amendoim, castanha

  6. Efecto del probiótico Bacillus subtilis sobre el crecimiento y alimentación de tilapia (Oreochromis niloticus y langostino (Macrobrachium rosenbergii en laboratorio

    Directory of Open Access Journals (Sweden)

    Jorge Günther

    2004-12-01

    ífica de crecimiento y en el factor de conversión alimenticiay por ello difícil de detectar.Los informes sobre la acción benéfica de los probióticos sobre el crecimiento se han realizado generalmente en estanques o en cultivos masivos y nuestros datos no contradicen directamente una posible acción benéfica de B.subtilis en cultivos a nivel de estanques.Como el efecto sobre el sistema digestivo aparenta ser relativamente modesto,en aquellos ambientes podría ser compensado por otros efectos benéficos sobre la calidad del agua y el efecto bactericida sobre otras bacterias exógenas de naturaleza patogénica.Effect of the probiotic Bacillus subtilis on the growth and food utilization of tilapia (Oreochromis niloticus and prawn (Macrobrachium rosenbergii under laboratory conditions.Three experiments were conducted to analyze the effect of the probiotic Bacillus subtilis on the growth of juvenile tilapia (Oreochromis niloticus and freshwater prawn (Macrobrachium rosenbergii .The experiments were conducted under laboratory conditions,minimizing the indirect effects of the probiotic on the water quality and leaving only the possible bactericidal and digestion-support effects.A model of stress was also designed in tilapia to compare the effect with tilapia under normal conditions.The dose in the food was 0.1 %of the probiotic (5x10 8 CFU/g and 99.9 %maltrinein the dry diet.Every 14 days the animals were weighed in group (tilapias ±0.1 g,prawns ±0.001 gto estimate average body weight.In the first experiment (tilapiathe specific growth rate (SGRand the feed conversion ratio (FCRwere bad in relation with the factor probiotic,but the differences were not significant. In the second experiment (tilapiaboth the SGR and the FCR deteriorated with the addition of B.subtilis to the diet;the difference was significant to 94%.The stress factor,on the contrary,caused a notable worsening of both the growth and the food utilization.In the experiment with prawns the addition of B

  7. miR-122 promotes hepatic antioxidant defense of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium by directly targeting a metallothionein gene

    Energy Technology Data Exchange (ETDEWEB)

    Qiang, Jun, E-mail: Qiangj@ffrc.cn [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China); Tao, Yi-Fan [Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081 (China); He, Jie [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China); Xu, Pao, E-mail: Xup@ffrc.cn [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China); Bao, Jin-Wen [Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081 (China); Sun, Yi-Lan [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China)

    2017-01-15

    Highlights: • MiR-122 regulated tilapia MT by directly targeting MT 3′UTR. • MiR-122 level was negatively related to MT level under Cd stress. • MiR-122 silencing caused up-regulation of MT expression. • MiR-122 loss relieved liver stress and stimulated antioxidant enzymes. - Abastract: MicroRNAs (miRNAs) are small, non-coding RNAs that regulate target gene expression by binding to the 3′untranslated region (3′UTR) of the target mRNA. MiRNAs regulate a large variety of genes, including those involved in liver homeostasis and energy metabolism. Down-regulated levels of hepatic miR-122 were found in genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium (Cd) stress. Here, we report for the first time that reduction of miR-122 post-transcriptionally increased metallothionein (MT) mRNA levels by binding to its 3′UTR, as shown by a 3′ UTR luciferase reporter assay. The expression levels of miR-122 were negatively related to MT levels in GIFT under Cd stress. We performed in vivo functional analysis of miR-122 by injecting the fish with a miR-122 antagomir. Inhibition of miR-122 levels in GIFT liver caused a significant increase in MT expression, affected white blood cell and red blood cell counts, and serum alanine and aspartate aminotransferase activities, and glucose levels, all of which may help to relieve Cd stress-related liver stress. miR-122 silencing modulated oxidative stress and stimulated the activity of antioxidant enzymes. Our findings indicate that miR-122 regulated MT levels by binding to the 3′UTR of MT mRNA, and this interaction affected Cd stress induction and the resistance response in GIFT. We concluded that miR-122 plays an important role in regulating the stress response in GIFT liver. Our findings may contribute to understanding the mechanisms of miRNA-mediated gene regulation in tilapia in response to environmental stresses.

  8. Effects of exposure to Streptococcus iniae on microRNA expression in the head kidney of genetically improved farmed tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Qiang, Jun; Tao, Fanyi; He, Jie; Sun, Lanyi; Xu, Pao; Bao, Wenjin

    2017-02-20

    Genetically improved farmed tilapia (GIFT, Oreochromis niloticus) are susceptible to infection by Streptococcus iniae when maintained in modern intensive culture systems. GIFT are commercially important fishes that are cultured widely in southern China. The role of microRNAs (miRNAs) in the regulatory response of GIFT to S. iniae infection has been underestimated and has not yet been well studied. Head kidney has an important immune function in teleost fishes. The main aim of this study was to determine the possible function of miRNAs in head kidney of S. iniae-infected GIFT. MiRNAs are small, non-coding RNAs that regulate gene expression by binding to the 3'-untranslated regions of their target mRNAs. MiRNAs are known to regulate immune-regulated signaling and inflammatory response pathways. High-throughput deep sequencing of two libraries (control group [CO] and infected group [IN]) of RNA extracted from GIFT head kidney tissues generated 12,089,630 (CO) and 12,624,975 (IN) clean reads. Bioinformatics analysis identified 1736 and 1729 conserved miRNAs and 164 and 165 novel miRNAs in the CO and IN libraries, respectively. Three miRNAs (miR-310-3p, miR-92, and miR-127) were found to be up-regulated and four miRNAs (miR-92d-3p, miR-375-5p, miR-146-3p, and miR-694) were found to be down-regulated in the S. iniae-infected GIFT. The expressions of these miRNAs were verified by quantitative real-time PCR. RNAhybrid and TargetScan were used to identify complementary miRNA and mRNA target sites, and the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases were used to annotate and predict potential downstream regulation of biological pathways. Seven target genes, which encode immune-related proteins (complement C3, cytidine deaminase, regulator of G-protein Rgs22, mitogen-activated protein kinase Mapk1, metabotropic glutamate receptorm GluR8, calcium-sensing receptor CaSR, and microtubule-associated protein Map1S) were predicted to play crucial roles in the

  9. miR-122 promotes hepatic antioxidant defense of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium by directly targeting a metallothionein gene

    International Nuclear Information System (INIS)

    Qiang, Jun; Tao, Yi-Fan; He, Jie; Xu, Pao; Bao, Jin-Wen; Sun, Yi-Lan

    2017-01-01

    Highlights: • MiR-122 regulated tilapia MT by directly targeting MT 3′UTR. • MiR-122 level was negatively related to MT level under Cd stress. • MiR-122 silencing caused up-regulation of MT expression. • MiR-122 loss relieved liver stress and stimulated antioxidant enzymes. - Abastract: MicroRNAs (miRNAs) are small, non-coding RNAs that regulate target gene expression by binding to the 3′untranslated region (3′UTR) of the target mRNA. MiRNAs regulate a large variety of genes, including those involved in liver homeostasis and energy metabolism. Down-regulated levels of hepatic miR-122 were found in genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium (Cd) stress. Here, we report for the first time that reduction of miR-122 post-transcriptionally increased metallothionein (MT) mRNA levels by binding to its 3′UTR, as shown by a 3′ UTR luciferase reporter assay. The expression levels of miR-122 were negatively related to MT levels in GIFT under Cd stress. We performed in vivo functional analysis of miR-122 by injecting the fish with a miR-122 antagomir. Inhibition of miR-122 levels in GIFT liver caused a significant increase in MT expression, affected white blood cell and red blood cell counts, and serum alanine and aspartate aminotransferase activities, and glucose levels, all of which may help to relieve Cd stress-related liver stress. miR-122 silencing modulated oxidative stress and stimulated the activity of antioxidant enzymes. Our findings indicate that miR-122 regulated MT levels by binding to the 3′UTR of MT mRNA, and this interaction affected Cd stress induction and the resistance response in GIFT. We concluded that miR-122 plays an important role in regulating the stress response in GIFT liver. Our findings may contribute to understanding the mechanisms of miRNA-mediated gene regulation in tilapia in response to environmental stresses.

  10. Growth, immune responses and protection of Nile tilapia Oreochromis niloticus immunized with formalin-killed Streptococcus agalactiae serotype Ia and III vaccines

    Directory of Open Access Journals (Sweden)

    Atchariya Suwannasang

    2017-08-01

    Full Text Available The protective efficacy of formalin-killed Streptococcus agalactiae (Group B Streptococcus, GBS serotype Ia (GBS-Ia and III (GBS-III vaccines were assessed in Nile tilapia (Oreochromis niloticus. The fish with an average weight of 34.45± 0.08 g were immunized by intraperitoneal (i.p. injection with 4 different formalin-killed vaccines prepared from GBS-Ia (1x1010 CFU/mL, GBS-III (1x1010 CFU/mL, and combined GBS-Ia and GBS-III in an equal volume at final concentrations 1x1010 CFU/mL and 2x1010 CFU/mL in comparison with the non-immunized control group. At 2 and 4 weeks post vaccination, no significant differences were observed (p>0.05 among treatments in growth performance or haemato-immunological parameters, except the increased red blood cell at 2 weeks. Significantly increased antibody titers (p<0.05 against GBS-Ia and GBS-III antigens were noted in the groups immunized with homologous GBS vaccines, whereas the group reacted with heterologous GBS antigen showed less antibody titer as compared with the control group. The vaccination experiment indicated that i.p. injection of Nile tilapia with formalin-killed cells prepared from GBS-Ia or GBS-III provides significant protection, with relative percent survival (RPS value of 52.17 to 71.42%, against a challenge with the homologous serotype isolate, whereas the RPS in fish challenged with a heterologous serotype isolate varied from 20.00 to 53.57%. These results suggested that vaccines from either GBS-Ia or GBS-III have insufficient cross-protective efficacy against the other serotypes. However, a mixed vaccine produced from both GBS serotypes Ia and III provided significant protection with 65.00 to 95.66% RPS which could be an excellent vaccine to protect fish against streptococcosis caused by both GBS serotypes Ia and III.

  11. Isolation of Streptococcus spp from nile tilapia (Oreochromis niloticus and quality of water in hapas nets in North Region of Parana State, Brazil/ Isolamento de Streptococcus spp de tilápias do nilo (Oreochromis niloticus e qualidade da água de tanques rede na Região Norte do Estado do Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Aleksey Machado Moreno

    2003-05-01

    Full Text Available This study evaluated 12 intensive breed of Nile tilapia (Oreochromis niloticus in four properties localized in the north of Parana State, Brazil. In the period of 13 months, 71 fishes were collected and analyzed of hapas nets that presenting morbidity and mortality of tilapias. Parallel, to evaluate the quality of the water of these hapas nets, there was measured the temperature, dissolved oxygen, pH, alkalinity, nitrite and ammonia. Of the 71 fishes, were collected 220 biological samples. 17 (23.94% fishes were positive for Streptococcus spp. Of the 53 biological samples from 17 fishes, in 24 (45.28% were isolated streptococci. The main clinical signs and macroscopic lesions in the fishes with isolation of Streptococcus spp. were hepatomegaly and splenomegaly, skin lesion and base of the fins and exoftalmia with cornea opacity. The higher incidence of infections caused by streptococci happened in the months with higher temperatures, mainly in the transition period winter for spring. The values of dissolved oxygen, pH, alkalinity, nitrite and ammonia of the water were normal.Foram estudados doze tanques-rede de quatro propriedades de criação intensiva de tilápia do Nilo (Oreochomis niloticus da região Norte do Paraná, Brasil. No período de 13 meses foram analisados 71 peixes provenientes de tanques apresentando morbidade e mortalidade de tilápias. Paralelamente, para avaliar a qualidade da água destes tanques, foi medida a temperatura, oxigênio dissolvido, pH, alcalinidade, nitrito e amônia. Dos 71 peixes, foram coletadas 220 materiais biológicos. Em 17 (23.94% peixes foram isolados Streptococcus spp e dos 53 materiais biológicos provenientes destes peixes, 24 (45.28% apresentaram Streptococcus spp. Os principais sinais clínicos e lesões macroscópicas nos peixes com isolamento de Streptococcus spp foram hepatomegalia e esplenomegalia, lesão de pele e base das nadadeiras e exoftalmia com opacidade de córnea. O maior número de

  12. ReavaliaÃÃo da faixa ideal de pH e da tolerÃncia de juvenis de tilÃpia do nilo, Oreochromis niloticus, Ã acidez elevada da Ãgua de cultivo

    OpenAIRE

    Vanessa Tomaz RebouÃas

    2015-01-01

    Dois estudos consecutivos foram realizados para reavaliar a faixa ideal de pH e a tolerÃncia de juvenis de tilÃpia do Nilo, Oreochromis niloticus, Ã acidez elevada da Ãgua de cultivo, em condiÃÃes eutrÃficas de cultivo. Os pesos iniciais dos animais eram semelhantes em ambas as fases. No primeiro trabalho, foram adotadas quatro condiÃÃes distintas de pH da Ãgua de cultivo: pH = 5,56 Â 1,21 (pH 5); pH = 6,59 Â 0,77 (pH 6); pH = 8,25 Â 0,39 (pH 8); pH = 9,21 Â 0,37 (pH 9), obtidas pelas aplicaÃ...

  13. Características microbiológicas, físico-químicas e sensoriais de filés de tilápias (Oreochromis niloticus) conservados em atmosferas modificadas sob refrigeração

    OpenAIRE

    Sarmiento, Amada Maria Landa

    2006-01-01

    Estudou-se o efeito de diferentes atmosferas (vácuo, 100% CO + vácuo, 1% CO + 99% CO2) sobre a qualidade microbiológica, química, cor objetiva no sitema CIELab e sensorial de filés de tilápias (Oreochromis niloticus) estocados a 2 ± 1 ºC. Os resultados foram contrastados com aqueles de filés embalados em ar atmosférico (controle). A análise microbiológica dos filés indicou: ausência de Salmonella em 25 g, número de clostrídiossulfito redutores inferior a 102 UFC.g-1 e que o NMP de coliformes ...

  14. Utilização de quitosana no revestimento de filés de tilápia do Nilo (Oreochromis niloticus) e na preparação de filmes incorporados com óleos essenciais

    OpenAIRE

    SANTOS, Fábio Marcel da Silva

    2014-01-01

    Tilápia do Nilo (Oreochromis niloticus), uma das espécies de peixe mais cultivadas no mundo, é uma importante fonte de proteínas de alta qualidade para os seres humanos. No entanto, assim como o pescado de um modo geral, é altamente susceptível à deterioração microbiológica e química. Dentre os processos de conservação de alimentos desenvolvidos, a defumação é um dos mais antigos meios utilizados para conservação de pescado ou produtos de origem animal. A defumação líquida é um...

  15. Análise de parabenos em amostras de água de cultivo de tilápia do Nilo (Oreochromis niloticus) e efeitos em biomarcadores bioquímicos

    OpenAIRE

    Daniele Caetano da Silva

    2015-01-01

    Os parabenos utilizados como conservantes nas indústrias de cosméticos, alimentos e fármacos não são removidos por completo nas estações de tratamento de água e esgoto, além disso, podem causar danos a biota aquática. O presente estudo teve como finalidade aplicar um método analítico novo para quantificar o metil (MP), etil (EP), propil (PP), butil (BP), benzilparabeno (BzP) e a mistura (metil e propilparabeno) em amostras de água dos aquários com tilápias do Nilo (Oreochromis niloticus). A t...

  16. AVALIAÇÃO DE COMPOSTOS PUROS E MISTO DE ÓLEO DE CRAVO E MELALEUCA, NA SEDAÇÃO DE TILÁPIA DO NILO (Oreochromis niloticus).

    OpenAIRE

    Freitas, Rafael Alves de

    2015-01-01

    O objetivo deste trabalho foi verificar as alterações dos parâmetros hematológicos de tilápia do Nilo (Oreochromis niloticus ) em função da sedação com diferentes combinações de óleo de cravo e melaleuca. Foram utilizados 230 peixes com 66 g ± 18,56 g, submetidos a soluções de óleo de cravo com 0%, 20%, 40%, 60%, 80% e 100% de óleo de melaleuca, a uma concentração de 100 mg-L, totalizando 6 tratamentos e o grupo controle. Assim, foram utilizados 20 baldes plásticos transpare...

  17. Influência da adição de silagem ácida de despesca da tilápia do Nilo (Oreochromis niloticus, L.), integral e desengordurada, no valor nutritivo da caseína

    OpenAIRE

    Sales, Ronaldo de Oliveira; Universidade Federal do Ceará; Oliveira, Admar Costa de; Universidade Estadual de Campinas - UNICAMP - S.P.

    2014-01-01

    Avaliou-se o efeito da inclusão de silagem ácida de despesca da tilapia do Nilo (Oreochromis niloticus, L.), integral e desengordurada no valor nutritivo da caseína.  Durante 10 dias e 5 de adaptação com balanço de nitrogênio nos últimos 5 dias e pesagens a cada 5 dias, com água e dieta "ad libitum", 48 ratos machos, com peso médio de 44,27 ± 2,03 g, foram alojados em gaiolas de metabolismo, seguindo-se o delineamento experimental inteiramente casualizado. Utilizou-se 8 tratamentos com 6 ra...

  18. Morphological characteristics of ovarian development of two Nile tilapia (Oreochromis niloticus strains in mixed-culture systems Características morfológicas do desenvolvimento ovariano de duas linhagens de tilápia-do-nilo (Oreochromis niloticus, em sistemas de cultivo misto

    Directory of Open Access Journals (Sweden)

    P.R. Neves

    2009-10-01

    Full Text Available This study was carried out to morphologically characterize and classify the stages of gonad development in different Nile tilapia strains (Oreochromis niloticus. Eighty-four and ninety-two ovaries from Bouaké and Chitralada strains, respectively, were evaluated at different ovarian developmental phases: initial (104 days of culture, intermediate (152 days of culture, and the final (279 days of culture. The ovaries were microscopically evaluated and submitted to histological processing and hematoxylin-eosin staining to determine their characteristics and be classified. No morphological differences in ovaries between strains were observed during the initial phase (stage A - immature. During the intermediate growing phase, higher gonad development was observed for Chitralada strain (stage B - maturation in comparison with Bouaké strain (stage A - immature. During the final growing phase, no differences between strains were observed for morphological characteristics (stage C - mature. Despite the similarities in reproductive behavior of the Bouaké and Chitralada females at the end of the final growing phase (gain weight phase, differences for macroscopic and microscopic aspects and oocytes during the initial and intermediate growing phases of the strains were observed.Este trabalho teve como objetivo caracterizar morfologicamente e classificar os estádios de desenvolvimento gonadal de tilápias do Nilo (Oreochromis niloticus de linhagens distintas. Foram avaliados 84 ovários da linhagem Bouaké e 92 da linhagem Chitralada, em diferentes fases de desenvolvimento: inicial (imatura - 104 dias de cultivo, intermediária (crescimento - 152 dias de cultivo e final (ganho de peso - 279 dias de cultivo. Os ovários foram analisados macroscopicamente e submetidos a procedimento histológico, corados com hematoxilina-eosina, para determinação das características microscópicas e subsequente classificação. Não foram observadas diferenças morfol

  19. Custos de produção de tilápias (Oreochromis niloticus em um modelo de propriedade da região oeste do Estado do Paraná, Brasil Nile tilapia (Oreochromis niloticus production costs in a farm model of the west region of the State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Rafael Luiz Barboza de Andrade

    2005-02-01

    Full Text Available O objetivo do estudo foi analisar os custos de produção da piscicultura praticada na região oeste do Paraná. Os custos são apurados mensalmente pela equipe do GEPEC/Piscicultura. Em linhas gerais, os custos referem-se à exploração comercial de uma área de 24.000m², em oito tanques, o que proporciona a produção de 14,4t de tilápia (Oreochromis niloticus por ciclo de produção, com o peso unitário médio de 0,4kg. Para o custo total de implantação, a taxa de crescimento foi de 0,47% am (ao mês e para os custos de terraplanagem, 0,63% am, sendo que o último representa em torno de 70% dos investimentos iniciais. Os custos fixos apresentaram uma taxa de crescimento de 0,032% am, o custo variável representou 70,18% do custo total de produção e uma taxa de crescimento de 0,32% am, o que exige a necessidade de se verificar alternativas para diminuir esses custos, que são bastante sensíveis às variações nos preços das matérias-primas. Ficou evidenciada a necessidade do estabelecimento de um agente responsável pela governança da cadeia, para garantir sua sobrevivência.The objective of this research was to analyze the production cost of fish production in the western region of Paraná, Brazil. The costs were obtained monthly by the GEPEC/Pisciculture group. In general, the costs refer to the commercial exploration of a 24,000m² area, in eight tanks, which enable the production of 14.4t of Nile Tilapia (Oreochromis niloticus per production cycle, with an average unit weight of 0.4kg. For the total cost of the implantation, the growth rate was of 0.47% pm (per month and for the earthwork costs, 0.63% pm, representing around 70% of the initial investments. The fixed costs represented a growth rate of 0.032% pm, the variable cost represented 70.18% of the total production cost and a growth rate of 0.32% pm which demands the necessity of verifying alternatives to decrease these costs, which are very sensitive to the variation of

  20. Análise tecidual e celular das brânquias de Oreochromis niloticus L. tratadas com extrato etanólico bruto e frações das folhas da pitanga (Eugenia uniflora L. - Myrtaceae Tissue and cell analysis of Oreochromis niloticus L. gill treated with crude ethanol extract and fractions from pitanga (Eugenia uniflora L. leaves Myrtaceae

    Directory of Open Access Journals (Sweden)

    T.S. Fiuza

    2011-01-01

    Full Text Available Eugenia uniflora L. (Myrtaceae é uma planta que ocorre no bioma Cerrado e é utilizada popularmente no tratamento de diarréias, inflamações, hiperglicemia e hipertensão. Estudos prévios revelaram atividade antimicrobiana da E. uniflora in vitro. Tendo em vista o uso popular, este trabalho objetivou avaliar as possíveis atividades celulares e teciduais sistêmicas do extrato bruto e das frações das folhas dessa planta em brânquias de Oreochromis niloticus L. (tilápia nilótica. Para isso, o extrato etanólico e as frações das folhas dessa planta foram administrados no peixe, por via oral, adicionadas à ração. Após um período de 24 horas, os peixes foram sacrificados e o segundo arco branquial de cada peixe foi dissecado, fixado em formalina neutra, desidratado, incluído em parafina e cortado. Nas análises histológicas, utilizaram-se tricômico de Masson e hematoxilina e eosina (HE. Pelas análises qualitativas na microscopia de luz, concluiu-se que o extrato etanólico bruto e as frações das folhas da E. uniflora apresentaram efeito sistêmico nas tilápias nilóticas atingindo as brânquias. As ações tóxicas como destacamento e descamação do epitélio respiratório e hiperplasia das células do epitélio interlamelar, foram mais pronunciadas nas tilápias que ingeriram maiores concentrações. Este trabalho colaborou para identificar o efeito vasodilatador dessa planta, e contribuiu para estabelecer a tilápia nilótica como sistema-modelo para testes com princípios ativos de plantas. Espera-se, com esses testes, viabilizar o uso de plantas como medicamentos para tratamentos de peixes, a manutenção da saúde de animais em cultivo intensivo e extensivo, a partir do qual se possibilite emprego alternativo aos medicamentos sintéticos.Eugenia uniflora L. (Myrtaceae is a plant found in the Cerrado biome and traditionally used in the treatment of diarrheas, inflammations, hyperglycemia and hypertension. Previous studies

  1. Técnicas de controle de qualidade utilizadas na criação de tilápia do Nilo (Oreochromis niloticus - DOI: 10.4025/actascibiolsci.v20i0.4471 Quality control techniques used in the breeding of Nile tilapia (Oreochromis niloticus - DOI: 10.4025/actascibiolsci.v20i0.4471

    Directory of Open Access Journals (Sweden)

    Júlio Hermann Leonhardt

    1998-07-01

    Full Text Available Foram utilizados 240 alevinos de tilápia do Nilo (Oreochromis niloticus, de 45 dias, sexualmente revertidos com peso médio inicial de 1,25 ± 0,14g, distribuídos num delineamento inteiramente casualizado, durante 180 dias. Foram avaliados os efeitos da substituição de 10%, 20% e 30% da ração por levedura de destilaria alcooleira. Os resultados médios obtidos para os parâmetros limnológicos no controle da qualidade da água através de análises físico-químicas e gráficos de controle foram normais durante todo o período experimental. Os valores da temperatura média mensal revelaram estar “fora de controle estatístico”, e mostraram, através da aplicação dos índices de capacidade (Cp e Cpk, que 35,20% estão abaixo do limite inferior de especificação (LIE. A análise dos resultados obtidos, através da aplicação das técnicas de Pareto e Problema da Mochila, evidenciou a solução ótima para resolver os problemas de predadores, biometrias e doenças com a função objetivo Z* maximizada. A utilização das técnicas de controle de qualidade permite um aumento da taxa de estocagem nos tanques sem redução da taxa de crescimento individual e com obtenção de altas produções de peixes de boa qualidade.Two hundred and forty Nile tilapia fry (Oreochromis niloticus, 45 days old, sexually reverted, with initial average weight of 1.25 ± 0.14g, distributed in a totally randomized design during 180 days, were used in this experiment. Effects of substitutions of 10%, 20% and 30% of the rations by yeast obtained from alcohol distillery were evaluated. Average results obtained for the limnological parameters in water quality control by means of chemical analyses and control graphs were considered normal during the entire experimental period. Values of monthly average temperature were statistically out of control and by the application of the capacity rates (Cp and Cpk showed that 35.20% were below the lowest specification limit

  2. Desempenho de diferentes linhagens de tilápia do Nilo (Oreochromis niloticus na fase de reversão sexual - DOI: 10.4025/actascianimsci.v26i3.1794 Performance of different Nile tilapia (Oreochromis niloticus strains, during sex reversal phase - DOI: 10.4025/actascianimsci.v26i3.1794

    Directory of Open Access Journals (Sweden)

    Margarida Maria Barros

    2004-04-01

    Full Text Available O experimento utilizou 4 linhagens de tilápias do Nilo (Oreochromis niloticus chamadas de CESP, Pernambuco, Santa Catarina e Tailandesa. O objetivo do projeto foi comparar o desempenho e a sobrevivência dessas diferentes linhagens de tilápia do Nilo na fase de reversão sexual. As pós-larvas foram estocadas em aquários de 4,5L em sistema de recirculação e com temperatura constante. Os peixes foram alimentados com ração contendo 60mg/kg de 17 alfa-metiltestosterona, fornecida 6 vezes ao dia, por período de 30 dias. O delineamento foi inteiramente casualizado com 4 tratamentos (linhagens e 7 repetições. Os parâmetros avaliados foram: comprimento total, ganho de peso, taxa de crescimento específico, taxa de sobrevivência e eficiência de reversão sexual. Os dados foram submetidos à análise de variância e as médias comparadas pelo teste de Tukey. A análise de reversão foi submetida ao teste de qui-quadrado. O resultado demonstra que houve maior eficiência na taxa de reversão sexual nas linhagens Santa Catarina e Pernambuco quando comparados com a CESP e a Tailandesa. As linhagens Tailandesa e Santa Catarina obtiveram maior taxa de sobrevivência e desempenho satisfatório durante a fase de reversão sexual, portanto, apresentam-se como as mais propícias para a criação em sistema de recirculação na fase de reversão sexual.This experiment aimed at comparing growth performance and survival of four Nile tilapia (Oreochromis niloticus strains called CESP, Pernambuco, Santa Catarina and Thailand in sex reversal phase. Thirty Nile tilapia fries were stocked in 4.5L aquaria (6.66 fries/L with recirculation system and water temperature control. The fishes were fed with ration containing 60mg/kg of 17 alpha-methyltestosterone, six times a day during 30 days. The experimental design was randomized with four treatments (strains and seven replications. Total length, weight gain, specific growth rate, survival rate and sexual

  3. Efeito da vitamina C sobre o hematócrito e glicemia de alevinos de tilápia-do-nilo (Oreochromis niloticus em transporte simulado Effect of vitamin C over the haematocrit and glycemia of nile tilapia (Oreochromis niloticus alevins in simulated transport

    Directory of Open Access Journals (Sweden)

    D. Okamura

    2007-08-01

    Full Text Available Avaliou-se o efeito do ascorbato sobre o hematócrito e glicemia em alevinos de tilápia nilótica (Oreochromis niloticus submetidos à simulação de práticas relacionadas ao transporte. Foram utilizadas três dietas experimentais com diferentes níveis de vitamina C (16, 500 e 1000mg de vitamina C/kg, fornecidas durante os 14 dias anteriores à simulação do transporte que se estendeu por 14 horas. O tratamento que continha 16mg de vitamina C/kg foi o que apresentou a glicemia mais elevada logo após a simulação, 108,5mg/dl imediatamente após a simulação e 91mg/dl 12 horas após a simulação. A concentração de 1000mg de vitamina C/kg foi a mais eficiente no controle do aumento da glicemia, 94,6mg/dl imediatamente após a simulação e 74,4mg/dl 12 horas após a simulação. Para a concentração de 500mg de vitamina C/kg foram observados os níveis de 91,4mg/dl imediatamente após a simulação e 103,8mg/dl 12 horas após a simulação. Os valores do hematócrito não apresentaram variação significativa (P>0,05. A suplementação com 1000mg de vitamina C/kg por 14 dias anteriores ao transporte pode ser utilizada de forma profilática em alevinos de tilápia nilótica para amenizar o aumento da glicemia relacionado ao estresse.The effects of ascorbate on the haematocrit and blood glucose level were evaluated in Nile tilapia alevins (Oreochromis niloticus submitted to a transport simulation. Three experimental diets with different levels of vitamin C (16, 500 and 1000mg/kg were given for 14 days before the simulation of the transport. The treatment containing 16mg of vitamin C showed the highest level of glucose after the simulation (108.5mg/dl immediately after the transport and 91mg/dl 12 hours after the transport. The vitamin C concentration of 1000mg/kg was the most efficient treatment to control glycemia increases (94.6mg/dl immediately after the simulation and 74.4mg/dl 12 hour after simulation. In the 500mg/kg treatment, the

  4. Toxicidade aguda e efeitos histopatológicos do herbicida diquat na brânquia e no fígado da tilápia nilótica (Oreochromis niloticus = Acute toxicity and histopathologic effects of diquat herbicide on the gill and liver of nile tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Matheus Nicolino Peixoto Henares

    2008-01-01

    Full Text Available A concentração letal 50% e os efeitos histopatológicos do herbicida diquat para a tilápia nilótica (Oreochromis niloticus foram avaliados em três experimentos. Os peixes foram expostos às concentrações de 0; 25; 30; 35; 40; 45; 50; 55; e 60 mg de diquat L-1 e a histologia da brânquia e do fígado foi avaliada nos peixes sobreviventes. A CL (I 50-96h do diquat estimada foi de 37,28 mg L-1, com limite inferior de 33,12 mg L-1 e superior de 41,44mg L-1. No tratamento com 30, 35 e 40 mg L-1, ocorreram início de fusão apical das lamelas secundárias; com 45 e 50 mg L-1 ocorreram congestão nas lamelas primárias e no tratamento com 55 mg L-1, ocorreu congestão sangüínea nas lamelas secundárias. O fígado dos peixes dos tratamentos controle, 30 e 35 mg L-1 estavam com organização cordonal dos hepatócitos. Nos tratamentos com 40 e 45 mg L-1, ocorreram hipertrofia dos hepatócitos; com 50 e 55 mg L-1 ocorreram fusão celular e presença de vacúolos. O diquat apresentoubaixo risco de intoxicação à tilápia nilótica e as alterações histopatológicas mais severas ocorreram somente nas concentrações mais elevadas.The lethal concentration of 50% (LC (I 50-96h and the histopathologic effects of diquat herbicide on Nile tilapia (Oreochromis niloticus fish were evaluated in three experiments. The fishes were exposed to concentrations of 0, 25, 30, 35, 40, 45, 50, 55 and 60 mg diquat L-1, and gill and liver histology were evaluated in the surviving fishes. The estimated LC (I (50-96h of diquat was37.28 mg L-1, with lower limits of 33.12 mg L-1 and upper limits of 41.44 mg L-1. In the treatment with 30, 35 and 40 mg L-1, signs of apical fusion of the secondary lamellae were observed; with 45 and 50 mg L-1, congestion of the primary lamellae was observed; in thetreatment with 55 mg L-1, congestion of blood vessels on secondary lamellae took place. The livers of fishes in treatments with 0, 25, 30 and 35 mg L-1 showed cordonal

  5. Efeito do tanino na digestibilidade dos nutrientes da ração pela tilápia do Nilo, Oreochromis niloticus - DOI: 10.4025/actascianimsci.v26i2.1863 Effect of tannin on apparent digestibility of Nile tilapia, Oreochromis niloticus - DOI: 10.4025/actascianimsci.v26i2.1863

    Directory of Open Access Journals (Sweden)

    Edma Carvalho de Miranda

    2004-04-01

    Full Text Available Este estudo teve por objetivo avaliar o efeito do tanino de barbatimão (Dimorphandra mollis, Benth adicionado a rações balanceadas para peixes. Foi avaliada a digestibilidade aparente da matéria seca, proteína bruta e extrato etéreo em juvenis de tilápia do Nilo, Oreochromis niloticus L.. Empregaram-se 80 peixes distribuídos em 5 grupos, os quais receberam rações contendo 0,0%; 0,23%; 0,46%; 0,69%; 0,92%; 1,37% e 1,82% de taninos totais, a partir do extrato de barbatimão. Após o período de aclimação de 3 dias, foram colhidas amostras representativas das fezes produzidas diariamente até completar 5 repetições de cada tratamento. A partir das análises químicas das rações e das fezes e utilizando-se óxido de crômio como marcador inerte, foram calculados os coeficientes de digestibilidade aparente da matéria seca, proteína bruta e extrato etéreo. Através dos resultados obtidos pode-se concluir que, para tilápia do Nilo na fase juvenil, a presença de tanino em concentração igual ou maior que 0,46% na ração interfere na digestibilidade aparente da matéria seca e proteína bruta, e que os taninos prejudicam significativamente a digestibilidade aparente do extrato etéreo de ração, quando presentes a partir de 0,23%.This study was carried out in order to evaluate the effect of tannin (Dimorphandra mollis, Benth on the apparent digestibility coefficient (ADC of fish diets. It was analyzed the apparent digestibility of dry matter, crude protein and ether extract by Nile tilapia, Oreochromis niloticus L.. It were utilized 80 fish distributed in 5 groups, which were fed diets containing 0.0%; 0.23%; 0.46%; 0.69%; 0.92%; 1.37% and 1.82% of total tannin. After a acclimatization period of three days, representative samples of feces were obtained daily until reach five replicates each treatment. The ADC was calculated based on chemical analysis of diets and feces to determine chemical composition and chromic oxide. It was

  6. Zinco e levedura desidratada de álcool como pró-nutrientes para alevinos de tilápia do Nilo (Oreochromis niloticus L. - DOI: 10.4025/actascianimsci.v26i2.1862 Zinc and spray dried alcohol yeast as pronutrient for Nile tilapia fingerlings (Oreochromis niloticus L. - DOI: 10.4025/actascianimsci.v26i2.1862

    Directory of Open Access Journals (Sweden)

    Giovani Sampaio Gonçalves

    2004-04-01

    Full Text Available Este trabalho teve como objetivo avaliar a levedura desidratada de álcool (Saccharomyces cerevisiae e o zinco (óxido de zinco como pró-nutrientes em ração inicial para tilápia do Nilo (Oreochromis niloticus L.. As rações experimentais, isoprotéicas (30,00%PD e isoenergéticas (3200kcal ED/kg dieta foram suplementadas com 3 níveis de levedura (0,5%; 1% e 2% e 3 níveis de óxido de zinco (150, 300 e 600mg/kg. Utilizou-se, ainda, uma ração controle sem esses pró-nutrientes. Adotou-se o delineamento em blocos inteiramente casualizados em esquema fatorial 3 x 3 (níveis de levedura e zinco com tratamento adicional (controle e 4 repetições. Avaliou-se o ganho de peso, conversão alimentar aparente, taxa de crescimento específico, taxa de eficiência protéica e os coeficientes de digestibilidade aparente para matéria seca, proteína bruta, lipídio total e energia bruta das rações experimentais. A levedura desidratada de álcool e o zinco atuam como pró-nutrientes para alevinos de tilápia do Nilo, sendo que os níveis de 1% de levedura e 300mg Zn/kg dieta proporcionaram melhores respostas no desempenho produtivo e nos coeficientes de digestibilidade aparente. Houve interação positiva entre os níveis de levedura e zinco para o ganho de peso, conversão alimentar aparente e coeficientes de digestibilidade aparente da matéria seca, lipídio total e energia bruta.This research aimed to evaluate spray dried alcohol yeast (Saccharomyces cerevisiae and zinc (zinc oxide as pronutrient in initial diet for Nile tilapia (Oreochromis niloticus L.. The experimental diets, isoproteic (30.00%DP and isoenergetic (3200kcal DE/kg diet, were supplemented with three yeast levels (0.50, 1.00 and 2.00% and three zinc levels (150, 300 and 600mg/kg. An additional diet with no pronutrient was used. The experiment was a factorial 3 x 3 (yeast levels and zinc plus an additional treatment (control and four replications in completely randomized block

  7. Effect of core homeopathic homeopatila 100® in productive efficiency of fingerlings reverted from nile tilapia (Oreochromis niloticus Efeito do núcleo homeopático homeopatila 100® na eficiência produtiva em alevinos revertidos de tilápia do nilo (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Ricardo Pereira Ribeiro

    2010-12-01

    Full Text Available It was researched the effect of Core Homeopathic Homeopatila 100® on the integrity branchial histological, weight, final length, survival, feed conversion and apparent index hepatossomátic in fingerlings from Nile tilapia (Oreochromis niloticus. We used in the control treatment (T1 with 20mL/kg water-alcohol solution (alcohol 30 GL and three treatments with 20mL/kg (T2, 40mL/kg (T3 e 60mL/kg (T4 of core homeopathic Homeopatila 100® in fingerlings male reversed, with initial weight and initial length the 1,05 ± 0,32g and 4,15 ± 0,42cm respectively. It was distributed a total of 832 fingerlings in 16 polyethylene water tanks with individual capacity of 2000 liters, contends 1000 liters each one, where they ha remained during 61 days. At the end of experiment, was not observed statistic difference between the different treatments in histological changes examined in gills: epithelial lifting, hyperplasia, telangectasy and lamellar fusion. The fingerlings which received 40mL/kg of Homeopatila 100® (T3 showed a higher rate of survival and also lower rate than the other hepatossomátic the fingerlings in control group (T1.Foi pesquisado o efeito do Núcleo Homeopático Homeopatila 100® na integridade histológica branquial, na sobrevivência, peso, comprimento final, conversão alimentar aparente e índice hepatossomático em alevinos de tilápia do Nilo (Oreochromis niloticus. Foi utilizado um tratamento controle (T1 com 20mL de solução hidroalcólica (álcool 30° GL a cada kg de ração e três tratamentos com 20mL/kg (T2, 40mL/kg (T3 e 60mL/kg (T4 do Núcleo Homeopático Homeopatila 100®, em alevinos machos revertidos, com peso e comprimento médio inicial de 1,05 ± 0,32g e 4,15 ± 0,42cm respectivamente. Foi distribuído um total de 832 alevinos em 16 caixas d´agua com capacidade individual de 2000 litros, contendo 1000 litros cada uma, onde permaneceram durante 61 dias. No final do experimento, não foi observada diferença estat

  8. Effect of Nile tilapia (Oreochromis niloticus on the growth performance of Pacific white shrimp (Litopenaeus vannamei in a sequential polyculture system Efecto de la tilapia del Nilo (Oreochromis niloticus sobre el crecimiento del camarón blanco del Pacífico (Litopenaeus vannamei, en un sistema de policultivo secuencial

    Directory of Open Access Journals (Sweden)

    Cesar Hernández-Barraza

    2012-11-01

    Full Text Available The present study was carried out at the Environmental Research Laboratory (ERL, University of Arizona, to assess the effect of the addition of Nile tilapia (Oreochromis niloticus, at different densities, on the growth performance of Pacific white shrimp (Litopenaeus vannamei. The growth rate and feed conversion of shrimp, both in polyculture and monoculture, were evaluated. Shrimp-tilapia proportions were 20:8 individuals in Treatment One (T1, 20:4 individuals in Treatment Two (T2 and 20:2 individuals in Treatment Three (T3, while in Treatment Four (T4 shrimp were stocked as a control group with a ratio of 20:0. The experiment lasted for four weeks at 10 ppt water salinity. The shrimp and fish were fed once a day with 8% and 3% of their body weight, respectively, using a 35% protein feed. At the end of the experiment, the average individual weight and best feed conversion ratio were obtained in shrimp polyculture treatment with highest tilapia density 6.08 ± 0.18 g and 1.26 ± 0.01 respectively, while the lowest scores were found in the monoculture treatment with 5.14 ± 0.59 g and 1.35 ± 0.01, respectively (P El presente estudio se llevó a cabo en el Laboratorio de Investigación del Medio Ambiente (ERL. de la Universidad de Arizona, para evaluar el efecto de la adición de la tilapia del Nilo (Oreochromis niloticus a diferentes densidades, en el desempeno del crecimiento del camarón blanco del Pacífico (Litopenaeus vannamei. La tasa de crecimiento y conversión alimenticia del camarón, tanto en policultivo y monocultivo, fueron evaluados. Las proporciones de camarón y la tilapia fueron de 20:8 individuos en el tratamiento uno (T1, 20:4 en el tratamiento dos (T2 y de 20:2 en el tratamiento tres (T3, mientras que en el tratamiento cuatro (T4, únicamente fueron sembrados camarones, participando como grupo control con una relación de 20:0. El experimento se realizó durante cuatro semanas y agua a 10 ppm de salinidad. Los camarones y

  9. Ectoparasitos de tilápia do Nilo (Oreochromis niloticus, das linhagens Chitralada e GIFT, em diferentes densidades e alimentadas com dois níveis de proteína = Ectoparasites in Nile tilapia (Oreochromis niloticus from Chitralada and GIFT strains, in different densities, fed with two protein levels

    Directory of Open Access Journals (Sweden)

    Graciela Lucca Braccini

    2007-10-01

    Full Text Available Foi verificada a infestação por ectoparasitos em tilápia do Nilo (Oreochromis niloticus, nas linhagens Chitralada e GIFT, em tanques e viveiros, utilizando-se ração com dois níveis de proteína. Durante o ensaio, foram analisados a temperatura, o pH, o oxigênio dissolvido e a condutividade elétrica. Foram realizadas amostras de raspados de tegumento e brânquias de machos pós-revertidos, em duas fases do experimento. A primeira, em 240 alevinos provenientes de 18 caixas de fibra de vidro de 500 L em três densidades. A prevalência total de parasitos na linhagem Chitralada (densidades de 30, 40 e 50 peixes m-3 foi 72,2, 83,3 e 59,5%, com predominância de Trichodina (38,9, 63,3 e 26,2%, respectivamente. Para a linhagem GIFT, nas mesmas densidades, foram observados 83,3, 73,3 e 80,9%, com maior predominância também de Trichodina (33,3, 73,3 e 45,2%,respectivamente. Na segunda fase, foram analisados 90 peixes de cada linhagem, de dois viveiros (140 m2 e duas dietas com 25 e 30% de proteína bruta. A prevalência total, para as linhagens Chitralada e GIFT com 25% PB foi 86,7 e 76,7%, respectivamente, e para 30% PBfoi 60,0%, para ambas as linhagens. O nível de 30% PB, independentemente da linhagem, apresentou a menor prevalência parasitária.Ectoparasites infestation in Nile Tilapia (Oreochromis niloticus was observed in Chitralada and GIFT strains cultivated in cages and ponds, using rations with two protein levels. During the assay, temperature, pH, dissolved oxygen and electric conductivity were analyzed. Tegument scraping and gill samples from reverted males were evaluated, in two experiment phases. The first phase was carried out with 240 fingerlings from 18 500 L fiberglass boxes using three stocking densities. Total prevalence of parasites in the Chitralada strain (stocking density of 30, 40 and 50 fish m-3 was 72.2, 83.3 and 59.5%, with Trichodina predominance (38.9, 63.3 and 26.2%, respectively. For the GIFT strain, at the same

  10. Efeito do peso de tilápia no nilo (Oreochromis niloticus sobre e rendimento e a qualidade de seus filés defumados com e sem pele Effect of nile tilapia (Oreochromis niloticus weight on yield and quality of their smoked and in natura fillets with and without skin

    Directory of Open Access Journals (Sweden)

    Maria Luiza Rodrigues de Souza

    2005-03-01

    Full Text Available O objetivo deste estudo foi avaliar o efeito de diferentes pesos de tilápia do Nilo (Oreochromis niloticus, sobre o rendimento e a qualidade dos seus filés com e sem pele, submetidos à defumação, tendo em conta o potencial de industrialização da referida espécie. Foram utilizados 100 exemplares em três classes de peso (C1 = 500 a 600g, C2 = 601 a 700g e C3 = 701 a 800g. De cada peixe foram retirados um filé com pele e outro sem pele e submetidos à salmouragem e à defumação a quente. O peso influenciou no rendimento dos filés in natura (C1 = 38,54; C2 = 40,23 e C3 = 40,47% e defumado (C1 = 22,97; C2 = 24,51 e C3 = 24,68%, e o índice de Massa de Filé in natura (C1 = 36,69; C2 = 39,45 e C3 = 41,18 g.cm-2, sendo maior para os peixes das classes C2 e C3. Os filés com pele apresentaram maior (PThe objective of this study was to evaluate the effect of different weights of Nile tilapia (Oreochromis niloticus on yield and quality of smoked and in natura fillets, with and without skin. One hundred tilapias, divided into three weight classes (C1=500-600g; C2=601-700g; C3=701-800g were used. Two fillet types, with skin and without skin were removed from each sample, salted and hot smoked. Weight affected yield of in natura (C1 = 38.54; C2 = 40.23 e C3 = 40.47% and smoked fillets (C1 = 22.97; C2 = 24.51 e C3 = 24.68%, and in natura fillet mass index (C1 = 36.69; C2 = 39.45 e C3 = 41.18 g.cm-2. The latter was higher in classes C2 and C3. Fillet with skin had a higher (p<0.05 water activity (0.99 rate than that of fillet without skin (0.98. Salt rate was higher (p<0.01 in smoked fillets than in natura ones. It was observed higher salt levels in the C1 skinless class. With the exception of a* and b* in natura fillet, no difference was reported in color. Smoked fillets from C3 class fish were more acceptable by judges. In larger fish the equation Y= -21.52 + 0.16034X (r=0.80, where X is the weight of fish, may be employed to calculate smoked

  11. Rendimento de carcaça, filé e subprodutos da filetagem da tilápia do Nilo, Oreochromis niloticus (L, em função do peso corporal Carcass, fillet and byproducts yield of filleting of Nile tilapia Oreochromis niloticus (L. in relation to body weight

    Directory of Open Access Journals (Sweden)

    Taciano Cesar Freire Maranhão

    2001-05-01

    Full Text Available O experimento foi realizado na indústria de processamento de pescado Frigopeixe, em Toledo, Estado do Paraná, Brasil. O objetivo foi analisar os rendimentos de carcaça, filé e subprodutos de filetagem (rendimento dos músculos abdominais, porcentagens de pele bruta e resíduos da tilápia do Nilo, Oreochromis niloticus (Perciformes, Cichlidae em duas categorias de peso vivo. Os resíduos foram definidos como as porcentagens de cabeça, vísceras e nadadeiras. Foram utilizados 100 exemplares, alimentados com ração peletizada com 22%PB, cultivados por um período de 5 meses e previamente depurados em tanques de alvenaria, por 24 horas antes do abate. A seguir, foram submetidos a choques térmicos, eviscerados e filetados. O processo de filetagem foi realizado em série, por mais de uma pessoa, conforme metodologia empregada pela indústria. O delineamento foi inteiramente casualizado, com dois tratamentos (categorias de peso P1 = 300-400 g e P2 = 401-500 g, com 50 repetições, sendo considerado o peixe a unidade experimental. A categoria de peso P2 proporcionou o maior rendimento de carcaça sem cabeça (78,18%, músculos abdominais (3,51% e pele bruta (6,56%, enquanto o P1 foi significativamente superior para porcentagens de cabeça (14,29% e vísceras (10,09%. Não houve diferença significativa para rendimento de filé (P1 = 36,50% e P2 = 36,84% e porcentagens de nadadeiras (P1 = 8,14% e P2 = 8,00% entre as duas categorias de peso da tilápia do Nilo.The experiment was undertaken at the fish processing industry Frigopeixe in Toledo, state of Paraná, Brazil. Its aim was to analyze carcass, fillet and other byproducts yields (ventral abdominal muscles yield, percentage of skin and residues of the Nile tilapia, Oreochromis niloticus (Perciformes, Cichlidae for two live weight categories. Residues consisted of head, viscera and fin percentages. One hundred specimens were fed with pellet rations with 22% of crude protein during 5 months

  12. Parâmetros hematológicos e bioquímicos da tilápia-do-Nilo (Oreochromis niloticus L. sob estresse por exposição ao ar Hematological parameters of Nile Tilapia (Oreochromis niloticus L. under air exposure stress

    Directory of Open Access Journals (Sweden)

    Roberta Dias da Silva

    2012-12-01

    Full Text Available No presente trabalho avaliaram-se os parâmetros hematológicos e bioquímicos de exemplares adultos de tilápias (Oreochromis niloticus sob a influência do fator estresse fisiológico em animais submetidos à exposição ao ar durante a engorda em sistema raceway. Foram analisados o eritrograma, teor de hemoglobina, volume globular, o volume corpuscular médio (VCM, a hemoglobina corpuscular média (HCM, a concentração de hemoglobina corpuscular média (CHCM, o leucograma, contagem diferencial de leucócitos, o plaquetograma, a glicose, a proteína total, o colesterol, o triglicerídeo e os eletrólitos (cálcio, cloretos, sódio e potássio. Os resultados revelaram que houve uma homogeneidade de distribuição para hemácias, volume globular, hemoglobina, índices hemantimétricos, proteína total, glicose, colesterol, e íons séricos, indicados pelos valores relativamente baixos do coeficiente de variação. Houve correlação positiva somente para leucócitos totais, células de defesa orgânica (neutrófilos e linfócitos, glicose, colesterol, sódio e cálcio. Quanto ao leucograma, à medida que os animais foram expostos ao ar, o número de leucócitos diminuiu gradativamente (leucopenia, ocorrendo simultaneamente neutrofilia e linfopenia. O índice glicêmico constituiu um bom indicador de estresse fisiológico, devido à hiperglicemia (82,0±20,88mg/dL demonstrada nos tratamentos. A exposição ao ar constituiu um fator de desequilíbrio na homeostase iônica, e na síntese de colesterol endógeno. Entretanto, o tempo de recuperação não ocasionou a completa reabilitação fisiológica frente ao desafio imposto.The present study evaluated the hematological and biochemical parameters of adult tilapia (Oreochromis niloticus under the influence of the physiological stress factor in animals submitted to air exposure during fattening in raceway system. Blood cell count, hemoglobin, hematocrit, mean corpuscular volume (MCV, mean

  13. Efeito do tanino na digestibilidade dos nutrientes da ração pela tilápia do Nilo, Oreochromis niloticus - DOI: 10.4025/actascianimsci.v26i2.1863 Effect of tannin on apparent digestibility of Nile tilapia, Oreochromis niloticus - DOI: 10.4025/actascianimsci.v26i2.1863

    OpenAIRE

    Edma Carvalho de Miranda; Luiz Edivaldo Pezzato; Luis Gabriel Quintero Pinto; Margarida Maria Barros; Wilson Massamitu Furuya

    2004-01-01

    Este estudo teve por objetivo avaliar o efeito do tanino de barbatimão (Dimorphandra mollis, Benth) adicionado a rações balanceadas para peixes. Foi avaliada a digestibilidade aparente da matéria seca, proteína bruta e extrato etéreo em juvenis de tilápia do Nilo, Oreochromis niloticus L.. Empregaram-se 80 peixes distribuídos em 5 grupos, os quais receberam rações contendo 0,0%; 0,23%; 0,46%; 0,69%; 0,92%; 1,37% e 1,82% de taninos totais, a partir do extrato de barbatimão. Após o período de a...

  14. Digestibilidade e desempenho de alevinos de tilápia do nilo (Oreochromis Niloticus alimentados com dietas contendo diferentes níveis de silagem ácida de pescado Digestibility and performance of nile tilapia (Oreochromis Niloticus fed diets with different levels of acid silage

    Directory of Open Access Journals (Sweden)

    Marinez Moraes de Oliveira

    2006-12-01

    Full Text Available Os experimentos foram conduzidos para avaliar os coeficientes de digestibilidade aparente dos nutrientes e da energia bruta da silagem ácida de resíduos da filetagem de tilápia do Nilo (Oreochromis niloticus para alevinos de tilápia nilótica e o desempenho dos alevinos recebendo níveis crescentes (0, 10, 20, 30, 40 % da silagem ácida em substituição à farinha de peixe na ração. Na digestibilidade foram utilizados 200 alevinos revertidos sexualmente, com peso médio de 2,0 g e acondicionados em aquários de 40 litros. A coleta de fezes foi feita durante 7 dias seguintes e a determinação dos coeficientes de digestibilidade aparente e energia metabolizável aparente foi feita por metodologia indireta, tendo sido utilizado 1% de Cr2O3 como indicador incorporado à ração. No desempenho, foram utilizados 2000 alevinos revertidos sexualmente com peso médio de 0,45 g, acondicionados em "hapas" de 1m², dispostos em um viveiro escavado. As variáveis analisadas foram: ganho de peso final (GPF, consumo de ração total (CRT, conversão alimentar aparente (CAA, acréscimo em altura (AA e em comprimento (AC. O delineamento utilizado foi o inteiramente casualizado, com 5 tratamentos e 4 repetições. Os valores de digestibilidade encontrados foram: coeficiente de digestibilidade aparente da matéria seca, 95,49%; coeficiente de digestibilidade aparente da proteína bruta, 96,66%; coeficiente de digestibilidade aparente do extrato etéreo, 97,18%; coeficiente de digestibilidade aparente da energia bruta, 95,44%, e energia digestível aparente 2.880,02 kcal/kg. Não houve diferença significativa (P> 0,05 para ganho de peso final, consumo de ração total, conversão e acréscimo em altura. Observou-se aumento linear (PThe experiments were carried out in order to evaluate the apparent digestibility coefficients of the nutrients and gross energy of acid silage of filetage residues from Nile tilapia (Oreochromis niloticus. This silage was given

  15. Effect of The Phytase Enzyme Addition in The Artificial Feed on Digestibility of Feed, Feed Conversion Ratio and Growth of Gift Tilapia Saline Fish (Oreochromis niloticus) Nursery Stadia I

    Science.gov (United States)

    Rachmawati, Diana; Samidjan, Istiyanto; Elfitasari, Tita

    2018-02-01

    The purpose of this study was to determine the effect of adding the phytase enzyme in the artificial feed on digestibility of feed, feed conversion ratio and growth of gift tilapia saline fish (Oreochromis niloticus) nursery stadia I. The fish samples in this study used gift tilapia saline fish (O. niloticus) with an average weight of 0,62 ± 0,008 g/fish and the stocking density of 1 fish1 L. Experimental method used in this study was completely randomized design with 4 treatments and 3 repetitions. The treatments were by adding phytase enzyme in artificial feed with the different level of doses those were A (0 FTU kg1 feed), B (500 FTU kg1 feed), C (1000 FTU kg1 feed) and D (1500 FTU kg1 feed). The results show that the addition of phytase enzyme was significantly (P0.05) affected on Survival Rate (SR) of gift tilapia saline fish. The optimum doses of phytase enzyme on RGR, FCR, PER, ADCP and ADCF of gift tilapia saline fish ranged from 1060 to 1100 FTU kg-1 feed.

  16. Local textile industry wastewater effect on freshwater fish species ...

    African Journals Online (AJOL)

    The effect of local tie-dye textile industry wastewater on two selected fish species (Clarias gariepinus and Oreochromis niloticus) of economic importance was investigated using static renewal bioassay method to determine the acute and sub-lethal effects on the test fish species. The physico-chemical parameters of the ...

  17. Ação do tanino na digestibilidade de dietas pela tilápia-do-nilo (Oreochromis niloticus Effect of tannin on digestibility of Nile tilapia (Orechromis niloticus diets

    Directory of Open Access Journals (Sweden)

    Edma Carvalho de Miranda

    2000-05-01

    Full Text Available Este experimento teve por objetivo avaliar o efeito do tanino de barbatimão (Stryphnodendron obovatum adicionado a rações completas para peixes. Avaliou-se a digestibilidade aparente das frações matéria seca, proteína bruta e extrato etéreo em juvenis de tilápia-do-nilo (Oreochromis niloticus. Usaram-se 80 peixes distribuídos em cinco grupos (16 peixes/aquário, os quais receberam rações contendo 0,00%; 0,21%; 0,42%; 0,63% e 0,84% de taninos totais, a partir do extrato de barbatimão (Stryphnodendron obovatum. Após um período de aclimação de três dias, foram colhidas amostras representativas das fezes produzidas diariamente até completar cinco repetições por cada grupo. A partir das análises químicas dos alimentos e das fezes, e utilizando óxido de crômio como marcador inerte, foram calculados os coeficientes de digestibilidade aparente da matéria seca, proteína bruta e extrato etéreo. Através dos resultados obtidos, pode-se concluir que, para tilápia-do-nilo na fase juvenil, a presença de até 0,42% de tanino não prejudica significativamente a digestibilidade da matéria seca, proteína bruta e extrato etéreo, e que níveis iguais ou superiores a 0,63% de tanino têm efeito deletério altamente significativo sobre a digestibilidade dos nutrientes analisados.This experiment was undertaken to determine the effect of tannin from Stryphnodendron obovatum added to fish diets. The apparent digestibility of dry matter, crude protein and lipid was evaluated. Eighty Nile tilapia juveniles were arranged in five groups (16/aquarium and fed diets containing 0.00%; 0.21%; 0.42%; 0.63% and 0.84% of total tannin from barbatimão (Stryphnodendron obovatum. After three days of acclimatation, feces were collected during 5 days up to reach five replicates/group. The apparent digestibility coefficient was determined based on chemical analyses of feedstuffs and feces using chromic acid as an inert marker. The results of this study

  18. Additive genetic variation in resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus iniae and S. agalactiae capsular type Ib: is genetic resistance correlated?

    Science.gov (United States)

    Streptococcus (S.) iniae and S. agalactiae are both economically important Gram positive bacterial pathogens affecting the globally farmed tilapia (Oreochromis spp.). Historically control of these bacteria in tilapia culture has included biosecurity, therapeutants and vaccination strategies. Genet...

  19. Lipídeos na Alimentação de Alevinos Revertidos de Tilápia do Nilo (Oreochromis niloticus, L. Fat on the Reverted Nile Tilapia (Oreochromis niloticus Fingerlings Feeding

    Directory of Open Access Journals (Sweden)

    Fábio Meurer

    2002-01-01

    aquarium with seven animals was considered experimental unit, for a period of 40 days. The temperature was kept in 27.2 ± 0.6ºC for heaters of 100W with thermostat and constant aeration. Diets were formulated to be isonitrogen, isoenergy and isoamino acidic for lysine and cystine + methionine, varying how much to the level of fat (3.0, 4.8, 6.6, 8.4, 10.2, and 12.0%. They had been evaluated the effect of the level of fat on the averages of the weight gain (GP, feed conversion (CA, tax of protein efficiency (TE, consumption of ration (CR, speed of food pass (VP and corporal fat (GC. The GP, TE, CA had decreased linearly as the dietary level of fat increased, while GC increased, the CR did not present difference between the treatments, the VP presented a quadratic effect with point of minimum in 6.0% of fat in the ration. To reverted Nile tilapia fingerlings it is recommend 3.0% as fat level in the diet and was show a better starch utilization like energy source than fat in this specie.

  20. A new and fast technique to generate offspring after germ cells transplantation in adult fish: the Nile tilapia (Oreochromis niloticus model.

    Directory of Open Access Journals (Sweden)

    Samyra M S N Lacerda

    Full Text Available BACKGROUND: Germ cell transplantation results in fertile recipients and is the only available approach to functionally investigate the spermatogonial stem cell biology in mammals and probably in other vertebrates. In the current study, we describe a novel non-surgical methodology for efficient spermatogonial transplantation into the testes of adult tilapia (O. niloticus, in which endogenous spermatogenesis had been depleted with the cytostatic drug busulfan. METHODOLOGY/PRINCIPAL FINDINGS: Using two different tilapia strains, the production of fertile spermatozoa with donor characteristics was demonstrated in adult recipient, which also sired progeny with the donor genotype. Also, after cryopreservation tilapia spermatogonial cells were able to differentiate to spermatozoa in the testes of recipient fishes. These findings indicate that injecting germ cells directly into adult testis facilitates and enable fast generation of donor spermatogenesis and offspring compared to previously described methods. CONCLUSION: Therefore, a new suitable methodology for biotechnological investigations in aquaculture was established, with a high potential to improve the production of commercially valuable fish, generate transgenic animals and preserve endangered fish species.

  1. Do dietary betaine and the antibiotic florfenicol influence the intestinal autochthonous bacterial community in hybrid tilapia (Oreochromis niloticus ♀ × O. aureus ♂)?

    Science.gov (United States)

    He, Suxu; Zhou, Zhigang; Liu, Yuchun; Cao, Yanan; Meng, Kun; Shi, Penjun; Yao, Bin; Ringø, Einar

    2012-03-01

    The attractant betaine and the antibiotic growth promoter florfenicol are commonly used together in Chinese fresh water aquaculture, but there is no information about the effect of these two feed additive on the intestinal autochthonous bacterial community in hybrid tilapia (Oreochromis nilotica ♀ × O. aureas ♂). Hybrid tilapia (240 fish in total; 20 fish per net cage; three cages per group) were divided into four dietary groups: control group, no betaine or florfenical addition (CK); betaine group, 0.1% betaine added (B); florfenicol group, 0.002% florfenicol added (F); and combination group, 0.1% betaine and 0.002% florfenicol added together (BF). After 8 weeks of feeding, six fish from each cage were chosen randomly, the guts were sampled and pooled, and their intestinal autochthonous bacterial communities were analyzed by 16S rDNA-denaturing gradient gel electrophoresis. Enumeration of total gut autochthonous bacteria was analyzed by quantitative PCR with rpoB as the endogenous control. The results showed that the fish intestinal bacteria of group B were more diverse than that of CK, and that of F and BF groups was reduced in the total numbers and limited to certain bacterial species or genera (P florfenicol play a depressor role. When combined together, florfenicol may overshadow the effect of betaine on the predominant intestinal bacteria of tilapia.

  2. Preparation of reactive oxygen scavenging peptides from tilapia (Oreochromis niloticus) skin gelatin: optimization using response surface methodology.

    Science.gov (United States)

    Zhuang, Yongliang; Sun, Liping

    2011-04-01

    Gelatin extracted from tilapia skin was hydrolyzed with Properase E. Response surface methodology (RSM) was applied to optimize the hydrolysis condition (temperature [T], enzyme-to-substrate ratio [E/S], pH and reaction time [t]), to obtain the hydrolysate with the highest hydroxyl radical (•OH) scavenging activity. The optimum conditions obtained were T of 44.2 °C, E/S of 2.2%, pH of 9.2, and t of 3.4 h. The predicted •OH scavenging activity of the hydrolysate under the optimum conditions was 60.7%, and the actually experimental scavenging activity was 60.8%. The hydrolysate was fractionated by ultrafiltration, and 4 fractions were collected. The fraction TSGH4 (MW<2000 Da) showed the strongest •OH scavenging activity with the highest yield. Furthermore, reactive oxygen species (ROS) scavenging activities of TSGH4 with different concentrations were investigated in 5 model systems, including superoxide anion radical (•O2), •OH, hydrogen peroxide (H2O2), peroxynitrite (ONOO-), and nitric oxide (NO•), compared with reduced glutathione (GSH). The results showed that TSGH4 significantly scavenged these ROS, and could be used as a functional ingredient in medicine and food industries.

  3. Growth performance of Nile tilapia, Oreochromis niloticus, fingerlings reared in Na2CO3 limed waters = Desempenho produtivo de alevinos de tilápia nilótica, Oreochromis niloticus, em aquários submetidos à calagem com Na2CO3

    Directory of Open Access Journals (Sweden)

    Davi de Holanda Cavalcante

    2010-07-01

    Full Text Available Current experiment was undertaken during 6 weeks with Nile tilapia,Oreochomis niloticus, fingerlings (1.28 . 0.03 g to assess the effects of moderate Na2CO3 liming on water quality and fish growth performance. Twenty-four 25 L-aquaria, with 15 fish per aquarium, were used, of which twelve aquaria were placed in the lab’s indoor room and twelve in the outdoor area. Two types of water (clear or green and three different water-quality managements (none, HCl acidification and Na2CO3 liming were simultaneously evaluated in a 3 x 2 factorial design. Total ammonia, calcium hardness, pH and total alkalinity in the green water aquaria were significantly higher than rates in the clear water aquaria. Slight liming acid water with Na2CO3 did not produce any significant effect on its water calcium hardness. No significant differences between controls and theexperimental group were observed for any growth variables. Lime rearing water with Na2CO3 has no significant effect on tilapia growth performance if the initial total alkalinity of water is higher than 20 mg CaCO3 L-1.O presente estudo foi realizado por seis semanas com alevinos de tilápia do Nilo, Oreochromis niloticus (1,28 . 0,03 g, para avaliar os efeitos da calagem moderada da água de cultivo com Na2CO3 naqualidade da água e no desempenho produtivo dos peixes cultivados. Vinte e quatro aquários de polietileno de 25 L foram utilizados para manter os peixes experimentais (15 peixes por aquário. Doze aquários foram instalados na sala interna do laboratório e 12 aquários na área externa. Dois tipos de águas (claras, sem fitoplâncton ou verdes,ricas em fitoplâncton e três diferentes manejos de qualidade de água (nenhum, acidificação com HCl ou calagem com Na2CO3 foram avaliados simultaneamente em delineamento fatorial 3 x 2. A concentração de amônia total, dureza cálcica, pH e alcalinidade total das águas verdes foram significativamente maiores que para as águas claras. A calagem

  4. Physiological and haematological response of Oreochromis niloticus (Osteichthyes: Cichlidae exposed to single and consecutive stress of capture - DOI: 10.4025/actascianimsci.v26i4.1719 Resposta fisiológica e hematológica de Oreochromis niloticus (Osteichthyes: Cichlidae exposto ao estresse único e consecutivo de captura - DOI: 10.4025/actascianimsci.v26i4.1719

    Directory of Open Access Journals (Sweden)

    Karina Ribeiro

    2004-04-01

    Full Text Available This work is a sequence of studies on tropical fish of economic importance that evaluated the effects of two different stress of handling on the physiology and haematology of Oreochromis niloticus L. acclimated for 10 days before the essay. The stress consisted in net capture of all fish from each aquarium for 30s emersion. Fish exposed to single stress (SS the samples were collected in the times 0, 10, 20, 30, 40, 50, 60, 120, 180, 240 and 300min. after stress. In the consecutive stress (CS the samples were collected in the times 0; 15min. after the first stress; 15min. after the second stress; 15min. after the third stress and 15, 30, 45, 60, 120, 180 e 240min. after the fourth stress totalizing four stimuli every 60min. Fish exposed to SS showed increased cortisol and glucose concentrations at 60min. as well as in the leucocytes number and hematocrit at 50min. after stress. Cortisol did not alter in fish exposed to CS, but glucose increased 15min. after the third stress. On the other hand, CS provoked reduction in the leucocytes number and later hematocrit increasing. Neutrophilia and lymphopenia were related to SS and CS.Este trabalho é seqüência de estudos com peixes tropicais de importância econômica avaliando os efeitos de dois tipos de estresse sobre a fisiologia e hematologia de O. niloticus L, aclimatados durante 10 dias antes do experimento. O estresse consistiu na captura de todos os peixes do aquário com rede e emersão por 30 s. Nos animais submetidos ao estímulo único de captura (EU as amostras foram coletadas nos tempos 0, 10, 20, 30, 40, 50, 60, 120, 180, 240 e 300min. após o estresse. No estímulo consecutivo (EC as amostras foram coletadas nos tempos 0; 15min. após o primeiro estresse; 15min. após o segundo estresse; 15min. após o terceiro estresse e 15, 30, 45, 60, 120, 180 e 240min. após o quarto estresse totalizando quatro estímulos a cada 60min. Os peixes expostos ao EU apresentaram aumento nas concentra

  5. Composicao quimica, perfil de acidos graxos e quantificacao dos acidos ƒ¿-linolenico, eicosapentaenoico e docosahexaenoico em visceras de tilapias (Oreochromis niloticus = Percentual composition, fatty acids and quantification of the LNA (Alfa-Linolenic, EPA (Eicosapentaenoic and DHA (Docosahexaenoic acids in visceras of Nile Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Nilson Evelázio de Souza

    2005-01-01

    Full Text Available Foi avaliada a composição química de vísceras de tilápias (Oreochromis niloticus criadas em cativeiro Os teores de umidade, cinza, proteína bruta e lipídios totais foram de 64,4%; 1,3%; 6,3% e 18,0%, respectivamente, caracterizando alta concentração de lipídiostotais em relação a outros resíduos de peixes. Foram identificados 49 ácidos graxos, sendo majoritários os ácidos: oléico, (32,8%, seguido do palmítico, (19,9% e linoléico, (18,2%. As razões entre n-6/n-3 e ácidos poliinsaturados/saturados foram de 5,5 e 0,9, respectivamente. As quantificações dos ácidos graxos alfa-linolênico, eicosapentaenóico e docosahexaenóico, em mg/g de lipídios totais, foram de 10,4, 1,4 e 9,3, respectivamente. O elevado teor de lipídios totais das vísceras contribuiu significativamente para as quantidadesde ácidos graxos n-3. Todos os parâmetros analisados foram satisfatórios sob o ponto de vista nutricional e neste sentido as vísceras de tilápias poderão ser utilizadaa para alimentar peixes ou outros animais.The chemical composition was evaluated in visceras of tilapias raised in captivity. The moisture, ash, crude protein and total lipids contents were 64.4%; 1.3%; 6.3% and 18.0%, respectively, characterizing high total lipids concentration in relation other residues of fish. Forty nine fatty acids were detected, the major fatty acids were oleic (32.8%, palmitic (19.9% and linoleic-1 (18.2% and oleic (9.4%. The ratio n-6/n-3 and polyunsaturated/saturated fatty acids, showed the values 5.5 and 0.9, respectively. The quantifications of alfa-linolenic, eicosapentaenoic and docosahexaenoic acids (in mg/g of total lipids, were 10.4, 1.4 and 0.3, respectively. The higher contents of total lipids in visceras contributed significantly for amounts of n-3 fatty acids. All the parameters analyzed were shown nutritional value satisfactory in this sense visceras of tilapias can be used in the feed of fish and other animal.

  6. Resistência a antimicrobianos de bactérias oriundas de ambiente de criação e filés de tilápias do nilo (Oreochromis niloticus Antibacterial resistance in bacteria from fish pond and Nile tilapia fillets (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Rejeana Márcia Santos Lima

    2006-02-01

    Full Text Available A resistência de bactérias a antimicrobianos foi determinada em uma piscicultura de tilápias (Oreochromis niloticus em tanques de terra, sem utilização de antibióticos para profilaxia ou controle de doenças. Foi selecionado um tanque, capturados peixes e coletadas amostras de conteúdo intestinal e superfície dos peixes, água de abastecimento e do tanque, ração, filés de tilápias frescos e congelados. Colônias representativas foram selecionadas e analisadas pelos testes de Gram, catalase, oxidase e oxidaçãofermentação. Foram selecionadas 89 amostras e submetidas a antibiograma, utilizando vários antimicrobianos. A maioria das bactérias pertenceu às famílias Enterobacteriaceae e Vibrionaceae. Tanto no ambiente de criação como nos filés de tilápias observou-se que os isolados bacterianos apresentaramse resistentes principalmente a ampicilina e eritromicina. O índice de múltipla resistência a antimicrobianos (MAR foi calculado, sendo que do total de 89 isolados analisados 74 (83%, apresentaram MAR ³ 0,2, ou seja apresentaram-se resistentes a dois ou mais antimicrobianos. As freqüências de índice MAR foram altas e maiores na ração.This study was conducted in a freshwater tilapia farm that has not used any antibiotic. It was selected one pond, caught 15 fishes and collected samples of intestinal content and mucus surface, water influent and pond water, ration, fresh tilapia fillets and frozen fillets.. Phenotypical characteristics, Gram stain, oxidase production, oxidative-fermentative utilization of glucose (O-F were determined of representative colony. Were selected 89 strains and submitted for antimicrobial sensitivy test using several antibiotics. The major identified bacterial families were belonged Enterobacteriaceae and Vibrionaceae. The most isolates showed resistance to ampicilin and eritromicin. From the 89 isolates evaluated 74 (83% showed a multiple antibiotic resistance index (MAR ³ 0.2, that mean

  7. Alien fish species in upper Sakarya River and their distribution ...

    African Journals Online (AJOL)

    However, the fact that the flood plains have been reclaimed, excessive hunting, destruction of the ecologic balance and invasion of the area by the alien fish species threatens the fish stocks in Sakarya River. In this study, we aimed to determine the dispersion area of Carassius gibelio (Bloch, 1782), Oreochromis niloticus ...

  8. Determination of the optimal dose of benzocaine hydrochloride in anesthesia of tilápia (Oreochromis niloticusDeterminação da dose ótima de cloridrato de benzocaína na anestesia de tilápias (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Marco Antonio da Rocha

    2012-12-01

    Full Text Available Fish anesthesia is indicated for several management procedures such as capturing, biometry, tagging, transporting, physical examination, reproductive management and surgical procedures. In this study the dose of benzocaine hydrochloride necessary for tilápia (Oreochromis niloticus anesthesia was determined through six phases with 240 fish. In each phase 40 fish were evaluated. The interval between phases was two months. Mean values for weight and (allometric condition factor, in each phase, were 25.64 (2.56, 167.58 (2.88, 286.12 (2.57, 388.24 (2.50, 518.19 (2.89, 592.71 (2.67, respectively. The values for allometric condition factors showed that the animals included in the experiments were in good body conditions (P > 0.05. In each phase, fishes were captured and kept in four containers with five liters of water and benzocaine hydrochloride diluted in 20 mL of ethanol, in concentrations of 100, 140, 180, and 220 mg/liter of water. The time of induction in seconds (TI was registered for each fish, and after the anesthetic induction the biometric analysis was conducted at fixed time of 10 minutes. After, the fishes were transferred to containers with 20 liters of water under constant flow, in order to evaluate the recovering time in seconds (TR. At each phase the minimum dose of benzocaine hydrochloride concentration was calculated using LRP (Linear Response Plateau. The model included the dose of benzocaine (mg/L and the time of induction in seconds. The values of LRP were, respectively, 146.60 and 67.45, 155.95 and 76.33, 160.45 and 87.42, 167.00 and 108.14, 165.87 and 174.03, 164.00 and 139.80. The optimum dose was related to the mean weight in each phase, resulting in the equation: Dose = 149.65 + 0.03183 x weigh (r2 = 0.73. This equation showed that an increase of 1g in the body weight corresponded to an increase of 0.032 mg/L in the dose of benzocaine hydrochloride.A anestesia em peixes é indicada para auxiliar a realização de diversos

  9. Polyculture of fresh water shrimp Macrobrachium amazonicum (Heller, 1862 wifh Nile tilapia (Oreochromis niloticus feeding with ration pelleted and mashed / Policultivo do camarão de água doce Macrobrachium amazonicum (Heller, 1862 com a Tilápia do Nilo (Oreochromis niloticus alimentadas com rações peletizada e farelada

    Directory of Open Access Journals (Sweden)

    Leandro Bohnenberger

    2009-07-01

    Full Text Available The objective of this work was to evaluate the influence of fresh water shrimp Macrobrachium amazonicum (Heller, 1862 in performance of Nile tilapia (Oreochromis niloticus cultivated in polyculture system and feeding with ration pelleted and mashed. The work was realized in Centro de Pesquisa em Aqüicultura Ambiental-CPAA/IAP – Toledo/PR during 37 days. Were utilized like experimental unit 16 ponds excavated, covered with concrete but with bottom of soil with dimension the 4 x 3 m and useful volume the 3,5 m3. Were utilized 30 tilapias e 150 shrimps for experimental unit distributed at an entirely randomized design with 4 treatments and 4 replications, where TF: tilapia feeding with ration mashed; TCF: tilapia and shrimp feeding with ration mashed; TP: tilapia feeding with ration pelleted; TCP: tilapia and shrimp feeding with ration pelleted. The density used were the 2,6 fishes/m2 with medium initial weight the 5,58 ± 0,10 g and initial length the 5,56 cm, and the density of shrimp was the 13 shrimps/m2 with initial length the 1,04 cm. The temperature was gauged daily, while the variables dissolved oxygen, pH and electrical conductivity, weekly. The quantity of ration supplied was the 10% of total biomass of fishes, with feed frequency the 4 times a day, being corrected weekly in function of the biometry. During the experimental period the medium values of temperature, dissolved oxygen, pH and electrical conductivity of the ponds water were 23,42 ± 0,83ºC, 5,32 ± 0,52 mg/L, 7,02 ± 0,39, e 100,96 ± 1,81 µS/ cm respectively. Won´t registering any influence of shrimp during the cultivation and the ration pelleted provide the better conversion alimentary and performance of tilapias.O objetivo deste trabalho foi avaliar a influência do camarão de água doce Macrobrachium amazonicum (Heller, 1862 no desempenho da Tilápia do Nilo (Oreochromis niloticus cultivada no sistema de policultivo e alimentada com rações peletizadas e fareladas

  10. Feminilização de larvas de tilápia do Nilo (Oreochromis niloticus L. a partir de banhos de imersão com valerato-de-estradiol Feminization of larvae of Nile tilapia (Oreochromis niloticus L. by immersion baths with estradiol valerate

    Directory of Open Access Journals (Sweden)

    Robie Allan Bombardelli

    2005-04-01

    Full Text Available Determinou-se o período ontogênico de maior sensibilidade das larvas de tilápias do Nilo (Oreochromis niloticus aos tratamentos de feminilização, por banhos de imersão de 36 horas, em solução contendo 2,0 mg de valerato-de-estradiol (VE.L-1. O experimento foi realizado em duas fases - a primeira com tratamentos hormonais e a segunda na fase de alevinagem. Foram utilizadas 1.200 larvas, provenientes de um mesmo lote de reprodutores, distribuídas em 24 recipientes plásticos de volume útil de 0,5 L, em um delineamento experimental inteiramente casualizado, composto por seis tratamentos e quatro repetições. Considerou-se a unidade experimental um recipiente plástico contendo 0,5 L de solução hormonal e 50 larvas. Os tratamentos constituíram-se no banho de imersão das larvas em diferentes fases ontogênicas, correspondentes a 175,2 UTAs (dias-grau ou 6,5 DPE (dias após a eclosão; 217,2 UTAs ou 8 DPE; 273,2 UTAs ou 10 DPE; 329,0 UTAs ou 12 DPE; 383,9 UTAs ou 14 DPE; e 438,1 UTAs ou 16 DPE. Após os tratamentos, as larvas foram cultivadas até atingirem comprimento-padrão de 25,0 mm, para posterior avaliação dos resultados. Os resultados de feminilização foram melhores para larvas mais jovens (6,5 DPE ou 175,2 UTAs, produzindo 39,20% de fêmeas, o que demonstra relação linear negativa entre o período ontogênico e a taxa de feminilização. Os índices de comprimento e peso final médio, fator de condição e sobrevivência não foram afetados pelos tratamentos. O período ontogênico mais adequado para a reversão sexual com VE correspondeu àquele em que as larvas apresentaram 175,2 UTAs ou 6,5 DPE, o que produziu 39,20% de fêmeas.An experiment was carried out to in two steps (the first was hormonal treatments and the other the larvae grow up phase to determine the best ontogenic periods for larvae of the Nile tilapia (Oreochromis niloticus regarding the feminization hormonal treatments by immersion baths during 36 hours

  11. Efeito de técnicas de recurtimento sobre a resistência do couro da tilápia do Nilo (Oreochromis niloticus L. - DOI: 10.4025/actascianimsci.v27i4.1185 Effect of retanning techniques on the resistance of the Nile tilapia leather (Oreochromis niloticus L. - DOI: 10.4025/actascianimsci.v27i4.1185

    Directory of Open Access Journals (Sweden)

    Maria Luiza Rodrigues de Souza

    2005-03-01

    Full Text Available O objetivo do trabalho foi avaliar a resistência do couro de tilápia do Nilo (Oreochromis niloticus L. curtido com sais de cromo e diferentes técnicas de recurtimento. As peles foram distribuídas em delineamento inteiramente casualizado, em esquema fatorial 4x2, sendo quatro técnicas de recutimento (T1= 4% de sais de cromo; T2= 4% taninos vegetais; T3 = 4% taninos sintéticos e T4= 2% taninos sintéticos e 2% vegetais e dois sentidos do couro (S1=Longitudinal; S2=Transversal, com 6 repetições. Para os testes de determinação da resistência à tração, alongamento e rasgamento progressivo foi utilizado o dinamômetro EMIC, com velocidade de afastamento entre as cargas de 100 ± 20 mm/mm, em ambiente climatizado (±23ºC e UR do ar de 50%, por 24 horas (ABNT-NBR 10455, 1988. A técnica de recurtimento influenciou na espessura do couro, sendo que com sais de cromo (T1=0,61 a 0,68 mm a espessura foi inferior aos demais tratamentos (1,30 a 1,53 mm. O sentido do couro não teve influencia sobre a espessura. Os couros recurtidos com sais de cromo apresentaram significativamente valores superiores para tração (30,31 N/mm2, alongamento (52,42% e rasgamento progressivo (91,23 N/mm comparados aos curtidos com os taninos vegetais, sintéticos ou combinados. O sentido longitudinal do couro apresentou superior tração (23,00 N/mm2 comparado ao transversal (12,03 N/mm2, porém, não diferiu no teste de alongamento e rasgamento progressivo entre o longitudinal e transversal. Segundo padrões da literatura, o couro curtido ao cromo deve apresentar uma resistência à tração de mínimo de 9,80 N/mm2, 60% para elongação e 14,70 N/mm para rasgo. A pele curtida com cromo e recurtida com sais de cromo apresentaram os valores mais adequados ao recomendado para confecção de vestuárioThe aim of this work was to evaluate the resistance of the Nile Tilapia leather (Oreochromis niloticus tanned with chromium salts and different techniques of retanning

  12. Effects of replacing soybean meal with rubber seed meal on growth, antioxidant capacity, non-specific immune response, and resistance to Aeromonas hydrophila in tilapia (Oreochromis niloticus × O. aureus).

    Science.gov (United States)

    Deng, Junming; Mai, Kangsen; Chen, Liqiao; Mi, Haifeng; Zhang, Lu

    2015-06-01

    This study evaluated the effects of replacing soybean meal (SBM) with rubber seed meal (RSM) on growth, antioxidant capacity, non-specific immune response and resistance to Aeromonas hydrophila in tilapia (Oreochromis niloticus × Oreochromis aureus). Five experimental diets were formulated with 0 (control), 10, 20, 30, and 40% RSM replacing graded levels of SBM, respectively. Fish were fed one of the five experimental diets for eight weeks, and then challenged by A. hydrophila via intraperitoneal injection and kept for seven days. Dietary RSM inclusion level up to 30% did not affect the weight gain and daily growth coefficient, whereas these were depressed by a further inclusion. Fish fed diet with 40% RSM showed the lowest serum total antioxidant capacity, lysozyme, alternative complement pathway, respiratory burst and phagocytic activities. Dietary RSM inclusion gradually depressed the post-challenge survival rate, and that was significantly lower in fish fed diet with 40% RSM compared to fish fed the control diet. Conversely, the inclusion of RSM generally increased the serum total cholesterol level, the plasma alanine aminotransferase and aspartate aminotransferase activities, and these were significantly higher in fish fed diet with 40% RSM compared to fish fed the control diet. The results indicated that RSM can be included at level up to 30% in diet for tilapia without obvious adverse effects on the growth, antioxidant capacity, non-specific immune response and resistance to A. hydrophila infection, whereas these were depressed by a further inclusion. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Verification of contamination by dimetoato and aldicarb in liver of Nile tilapias (Oreochromis niloticus collected in two cold-storages in the State of Paraná / Verificação da contaminação por dimetoato e aldicarb em fígado de tilápias do Nilo (Oreochromis niloticus coletados em dois frigoríficos do Estado do Paraná

    Directory of Open Access Journals (Sweden)

    Alexandre Nabuhiro Tajiri

    2009-12-01

    Full Text Available The importance of fish as a protein source in food is unquestionable, but its role as an indicator of environmental contamination is also very important. This study aimed to analysis the livers of Nile tilapia (Oreochromis niloticus, collected from commercial cold-storages in two municipal districts in the State of Parana, for investigation of contamination by organophosphorus compounds and carbamates. It was collected 30 samples of Nile tilapias (O. niloticus liver in the cold-storage A and 45 samples in the cold-storage B, totaling 75 samples. At each location were three visits, and at random, collected the samples from July 2006 to May 2007. For extraction and analysis of samples it was used the qualitative methodology of Thin Layer Chromatography (TLC. Patterns of organophosphate and carbamate used in the analysis of the TLC were respectively Dimethoate and Aldicarb. Of the samples tested were found cabarmate in seven samples, one of the samples collected in the cold-storage A and six collected in the cold-storage B. The organophosphate compound was found in fifteen samples from 75 samples, seven of the cold-storage A and eight samples from the cold-storage B. The results infer the possibility of contamination of the tanks in the creation of farms and the need for constant monitoring for the presence of residues of pesticides in this important food matrix.A importância dos peixes como fonte protéica na alimentação humana é indiscutível, porém seu papel como indicador de contaminação ambiental também é muito relevante. O presente trabalho objetivou a análise de fígados de Tilápia do Nilo (Oreochromis niloticus, coletados em frigoríficos comerciais de dois municípios do Estado do Paraná para averiguação de contaminação pelos compostos organofosforados e carbamatos. Coletou-se 30 amostras de fígado de Tilápia do Nilo (O. niloticus no frigorífico A e 45 amostras no frigorífico B, totalizando 75 amostras analisadas. Em

  14. Impacts of Oreochromis mossambicus (Perciformes: Cichlidae) upon habitat segregation among cyprinodontids (Cyprinodontiformes) of a species flock in Mexico

    OpenAIRE

    Linda Fuselier

    2001-01-01

    Five species of Cyprinodon in Laguna Chichancanab, Yucatan, Mexico comprise a young species flock whose ecology and evolution has not been thoroughly studied, but whose existence is threatened with extinction. Species flocks evolve in isolated areas where predators and competitors are absent. Since the description of the Chichancanab flock, Oreochromis mossambicus, a species introduced into the lake for which I examined habitat in the 1980’s, has become common throughout the basin. I assessed...

  15. Hematologia de Oreochromis niloticus (Cichlidae e Cyprinus carpio (Cyprinidae mantidos em diferentes condições de manejo e alimentação no Estado de Santa Catarina, Brasil - DOI: 10.4025/actascibiolsci.v28i4.162 Haematology of Oreochromis niloticus (Cichlidae and Cyprinus carpio (Cyprinidae maintained in different conditions of handling and feeding from the State of Santa Catarina, Brazil- DOI: 10.4025/actascibiolsci.162

    Directory of Open Access Journals (Sweden)

    Marcela Maia Yamashita

    2007-11-01

    Full Text Available Este estudo analisou o quadro hematológico de Oreochromis niloticus (tilápia do Nilo e Cyprinus carpio (carpa comum capturados em diferentes propriedades de Blumenau, Joinville e Ituporanga, Estado de Santa Catarina, Brasil. Os resultados foram relacionados às condições de manejo e alimentação a que os animais estavam expostos. Além de ração, as propriedades A e C de Blumenau alimentavam seus peixes com vísceras de peixes, arroz cozido, sobras de alimento do restaurante e ração artesanal. A e C de Ituporanga eram caracterizadas pela consorciação com suínos como principal fonte de alimento alimento e em Joinville as propriedades caracterizavam-se pelo fornecimento de ração comercial como o único alimento aos peixes. O percentual de hematócrito e o número de eritrócitos nas tilápias da região de Joinville foram maiores do que nas demais. Nas propriedades A e C de Blumenau e nas de Ituporanga foram observados os maiores valores na contagem total de leucócitos. As tilápias expostas a dejetos de suínos apresentaram também maior número de linfócitos. Os valores hematológicos de carpas não apresentaram variações significativas que pudessem ser relacionadas com o ambiente.This work evaluated the haematological parameters in Oreochromis niloticus (Nile tilapia and Cyprinus carpio (carp captured from the different owners in the cities of Blumenau, Joinville and Ituporanga, State of Santa Catarina, Brazil. The results were related to handling and feeding that the fish were exposed. Not only the ration, but also entrails, cooked rice, restaurant scraps and ration made in fish farm were used in the feeding of fish in the facilities A and C of Blumenau. However, A and C in Ituporanga were characterized by pig manure as the main source of feeding. In Joinville the diet was characterized by ration as the main source of food. Hematocrit and the erythrocyte number were higher in fish from Joinville than the others. The highest

  16. Efeito da cor e da presença de refúgio artificial sobre o desenvolvimento e sobrevivência de alevinos de Oreochromis niloticus (Linnaeus, 1758 - DOI: 10.4025/actascibiolsci.v26i1.1659 Effect of colour and presence of artificial haven on the development and survival of Oreochromis niloticus (Linnaeus, 1758 fry - DOI: 10.4025/actascibiolsci.v26i1.1659

    Directory of Open Access Journals (Sweden)

    Carmino Hayashi

    2004-04-01

    Full Text Available Com o objetivo de avaliar o desenvolvimento e a sobrevivência de alevinos revertidos de tilápias do Nilo (Oreochromis niloticus, cultivados sob condições de refúgios artificiais de diferentes colorações, realizou-se o presente trabalho, durante 28 dias, utilizando 240 alevinos de tilápia do Nilo com peso inicial médio de 0,51g ± 0,11g. Os animais foram distribuídos em 24 aquários com capacidade para 50L, em um delineamento experimental inteiramente casualizado, com 6 tratamentos (sem refúgios e com refúgios nas cores branca, azul, marrom, vermelho e verde e 4 repetições. Ao final do período experimental, foram analisadas as variáveis biomassa total média, fator de condição, uniformidade do lote e de sobrevivência. Observou-se que a uniformidade de peso e comprimento e o fator de condição foram influenciados pelas cores dos tratamentos, sendo que o tratamento com refúgio azul apresentou maior uniformidade. Concluiu-se, portanto, que a presença e a coloração do refúgio influenciam em parte do desenvolvimento de tilápias do NiloThe development and survival of sexually-reverted Nile tilapias (Oreochromis niloticus fry, bred in artificial havens of different colors, are provided. Research was carried out during 28 days, with 240 fry of the Nile tilapia, initial average weight 0.51 ± 0.11g. Animals were distributed in 24 50L-aquariums, in a randomized experimental design in six treatments (haven-less and havens in white, blue, brown, red and green and four replications. At the end of the experimental period, variable total biomass, condition factor, lot uniformity and survival were analyzed. Weight and length uniformity and factor of condition were affected by the colors of the treatments. Blue treatment had the best uniformity. Factor of condition was best in treatments with brown, red, blue and white havens. Actually they differed significantly from control and green treatments. It may be concluded that presence and

  17. Substituição do milho pela silagem de sorgo com alto e baixo teor de tanino em dietas para juvenis de tilápia do Nilo (Oreochromis niloticus - DOI: 10.4025/actascianimsci.v25i2.1989 Replacement of corn by sorghum silage with low and high tannin contents in diets for juvenile Nile tilapia (Oreochromis niloticus- DOI: 10.4025/actascianimsci.v25i2.1989

    Directory of Open Access Journals (Sweden)

    Patrícia Ribeiro Neves

    2003-04-01

    Full Text Available Este trabalho foi realizado para avaliar a substituição do milho pela silagem de sorgo como fonte de energia para juvenis de tilápia do Nilo, Oreochromis niloticus L. (Cichlidae. Foram formuladas 3 dietas práticas isocalóricas (3000kcal de energia digestível e isoprotéica (28% de proteína bruta. O farelo de milho foi substituído pela silagem de sorgo de baixo (0,44% (SSBT e alto (1,14% (SSAT teor de tanino. Os peixes (55,09 ± 0,94g foram distribuídos em tanques de fibro-cimento (1000L e alimentados com dietas experimentais até à saciedade 3 vezes ao dia, durante 67 dias. Não foram observadas diferenças significativas sobre a conversão alimentar, eficiência protéica, índice hepato-somático, gordura visceral e taxa de sobrevivência. O ganho de peso dos peixes alimentados com SSBT foi significativamente maior que os alimentados com dietas contendo milho e SSAT. Os peixes alimentados com dietas contendo SSBT consumiram mais ração do que os peixes alimentados com a dieta com SSAT. Os resultados indicaram que a inclusão de 44% de silagem de sorgo nas dietas podem suportar normal crescimento nos juvenis de tilápia do Nilo, com potencial para substituir o milho.This work was carried out to evaluate the replacement of corn by sorghum silage as an energy source for juvenile Nile tilapia, Oreochromis niloticus L. (Cichlidae. Three isocaloric (3000kcal of digestible energy and isoproteic (28% of crude protein practical diets were formulated. Corn meal was totally substituted by low (0.44% (LTSS and high (1.14% (HTSS tannin contents silage sorghum. Fish (55.09 ± 0.94g were reared in fiberglass tanks (1000L and hand-fed with experimental diets until reach they satiation, three times a day during 67 days. Feed conversion, protein efficiency ratio, hepatosomatic index, visceral fat and survival ratio of fish fed with the diets were not significantly different. Weight gain of fish fed with LTSS diet was significantly higher than those

  18. Fitase na alimentação da tilápia do Nilo (Oreochromis niloticus, durante o período de reversão de sexo - DOI: 10.4025/actascianimsci.v26i3.1778 Phytase as feeding for Nile tilapia (Oreochromis niloticus, during sex reversion period - DOI: 10.4025/actascianimsci.v26i3.1778

    Directory of Open Access Journals (Sweden)

    Lilian Carolina Rosa Silva

    2004-04-01

    Full Text Available Este trabalho foi realizado para avaliar a influência de níveis de fitase sobre o desempenho da tilápia do Nilo (Oreochromis niloticus no período de reversão de sexo. Foram utilizadas 1000 larvas de tilápia do Nilo com peso inicial 0,02 ± 0,002g, alimentadas com rações contendo 0; 500; 1000; 2000 e 4000 unidades de fitase (UF/kg, durante 31 dias. A ração referência continha 3143 kcal de energia digestível/kg, 30% de proteína bruta e 0,85 e 0,35% de fósforo (P total e disponível, respectivamente. Não foram observados efeitos (P>0,05 dos valores de inclusão de fitase sobre o ganho de peso e taxa de sobrevivência. O aumento nos níveis de fitase nas rações elevou linearmente (PThis work was carried out to examine the influence of dietary levels of phytase on Nile tilapia (Oreochromis niloticus performance during the sex reversion period. Were used 1,000 fries of Nile tilápia with initial weight 0.02 ± 0.002g, fed with diets containing 0; 500; 1000; 2000 and 4000 phytase units (PU/kg of diet 31 days. The reference diet provided 3,143 kcal of digestible energy/kg, 30% of crude protein and 0,85 and 0,35% of total and disponible phosphorus (P, respectively. No effects (P>0.05 were observed of phytase inclusion on weight gain and survival rate. Dietary phytase levels increase linearly (P<0.05 the calcium retention in the carcass. There was observed quadratic effect (P<0.05 of dietary phytase supplementation on P retention in the carcass, estimated the values of 1,990 PU/kg for the highest value for this variable. The results of this work indicate that a dietary level of 1,990 of PU provide maximal P retention in the carcass of Nile tilapia, during sex reversal period.

  19. Análise parasitológica e hematológica em tilápia do Nilo, Oreochromis niloticus Linnaeus, 1757, da represa de Guarapiranga, Estado de São Paulo, Brasil - DOI: 10.4025/actascibiolsci.v27i3.1334 Parasitological and hematological analysis of Nile tilapia Oreochromis niloticus Linnaeus, 1757 from Guarapiranga reservoir, São Paulo State, Brazil - DOI: 10.4025/actascibiolsci.v27i3.1334

    Directory of Open Access Journals (Sweden)

    Nilza Nunes Felizardo

    2005-03-01

    Full Text Available Foram coletadas na represa de Guarapiranga, São Paulo, entre agosto de 1996 e abril de1998, 206 tilápias, Oreochromis niloticus, com o objetivo de relacionar a condição de saúde desses animais à ocorrência de parasitos. Foram analisados: hematócrito e contagem diferencial de leucócitos. Foram feitos raspados de pele e brânquias, sendo estas removidas e fixadas para a identificação de Monogenoidea. Nas brânquias, foram encontrados: Trichodina Ehrenberg, 1838, Ichthyophtirius multifiliis (Fouquet, 1876, Cryptobia, amebas e Monogenoidea (Cichlidogyrus sp., e na pele: Trichodina sp., Cryptobia sp. e Henneguya sp. A prevalência de alguns parasitos parece estar associada à temperatura e ao nível de oxigênio dissolvido da água. O hematócrito e a porcentagem dos leucócitos apresentaram pouca variação. Apenas basófilos demonstram diferença significativa entre os valores médios mensais. A porcentagem de eosinófilos foi mais alta nos peixes parasitados por I. multifiliis e Cichlidogyrus sp. e nos não parasitados. Durante esse período, não houve mortalidade de peixes. Conclui-se que os peixes estavam em boas condições de saúde, embora as condições da água da represa não estivessem ideaisA total of 206 adult specimens of tilapia, Oreochromis niloticus, were collected from the Guarapiranga Reservoir, Sao Paulo, from August 1996 to April 1998, to relate their health condition with parasite infestation. Hematocrits and the differential leukocyte counts were analyzed. Scrapings of skin and gills were performed and this last removed and fixed for the identification of monogeneans. In the gills, Trichodina, Ichthyophtirius multifiliis, Cryptobia, amoebas and monogeneans (Cichlidogyrus sp. were found, and in the skin, Trichodina, Cryptobia and Henneguya. The prevalence of some parasites seemed to be associated with water temperature and the level of dissolved oxygen. The hematocrit and leukocyte cells percentage showed little

  20. QUALITÉ NUTRITIVE DE L’ALIMENTATION NATURELLE DU TILAPIA OREOCHROMIS NILOTICUS EN ÉLEVAGE EXTENSIF DANS DES ÉTANGS DE BARRAGE (CÔTE D’IVOIRE

    Directory of Open Access Journals (Sweden)

    BLE M. C.

    2007-04-01

    Full Text Available La composition chimique des sources alimentaires (périphyton, matières en suspension et sédiment et celle des contenus stomacaux d’Oreochromis niloticus en élevage extensif dans deux barrages situés en zone rurale (Gueyo, Sud-Ouest de la Côte d’Ivoire ont été déterminées afin d’apprécier la qualité de la nourriture naturelle ingérée par ces poissons. Les proportions des différents constituants chimiques mesurés dans ces trois sources alimentaires laissent apparaître la part importante que représentent les matières organiques hydrolysables dans le périphyton (65 et 67 % aux barrages 1 et 2, respectivement, alors que les matières minérales constituent plus de la moitié du poids sec total des matières en suspension (59 et 63 % et de la ressource sédimentaire (76 et 63 %. Sur les deux sites, les fibres représentent moins de 15 % de ces trois ressources. Les teneurs en protéines (19 % et le ratio Protéines/Énergie (17 mg.kJ-1 observés dans la ressource périphytique sont respectivement 2 et 3 fois supérieurs aux valeurs mesurées dans les deux autres ressources. L’analyse biochimique des contenus stomacaux montre que les protéines sont présentes en très faibles proportions dans la nourriture ingérée par O. niloticus (7 et 11 % dans les deux barrages. Par contre, les proportions en fibres (12 et 16 % et lipides (11 et 8 % de même que les ratios Protéines/Énergie (6 et 12 mg.kJ-1 caractérisant l’alimentation semblent répondre aux exigences de croissance chez cette espèce de tilapia. Les poids moyens des poissons en fin de cycle d’élevage traduisent la capacité d’O. niloticus à présenter une croissance correcte à partir d’une alimentation pauvre en matières azotées pourvu qu’une faible densité soit appliquée dans les sites d’élevage.

  1. Influence of the exposure way and the time of sacrifice on the effects induced by a single dose of pure Cylindrospermopsin on the activity and transcription of glutathione peroxidase and glutathione-S-transferase enzymes in Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Gutiérrez-Praena, Daniel; Jos, Angeles; Pichardo, Silvia; Puerto, María; Cameán, Ana M

    2013-01-01

    Cylindrospermopsin is a cyanobacterial toxin frequently implicated in cyanobacterial blooms that is approaching an almost cosmopolitan distribution pattern. Moreover, the predominant extracellular availability of this cyanotoxin makes it particularly likely to be taken up by a variety of aquatic organisms including fish. Recently, Cylindrospermopsin has shown to alter the activity and gene expression of some of the glutathione related enzymes in tilapias (Oreochromis niloticus), but little is known about the influence of the route of exposure and the time of sacrifice after a single exposure to Cylindrospermopsin on these biomarkers. With this aim, tilapias were exposed by gavage or by intraperitoneal injection to a single dose of 200 μg kg(-1) bw of pure Cylindrospermopsin and after 24h or 5d they were sacrificed. The activity and relative mRNA expression by real-time PCR of antioxidant enzymes glutathione peroxidase and soluble glutathione-S-transferases (sGST) and the sGST protein abundance by Western blot analysis were evaluated in liver and kidney. Results showed differential responses in dependence on the variables considered with a higher toxicity with the intraperitoneal exposure and with 5d as time of sacrifice. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. PCR en tiempo real para el sexaje y análisis citológico de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Zulita Prieto

    2017-01-01

    Full Text Available El objetivo de la presente investigación fue dar a conocer nuevos marcadores moleculares para la PCR en tiempo real asociados a los cromosomas sexuales y el análisis de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis nil oticus . Se diseñaron cuatro pares de cebadores y se pusieron a prueba por PCR punto final y por PCR en tiempo real utilizando el fluorescente SYBR® Green en muestras de ADN de hembras XX, machos XY y supermachos YY. Los tamaños de los fragmentos amplificad os por PCR punto final fueron concordantes a los valores esperados y por PCR en tiempo real se demostró igual especificidad pero con ventaja en rapidez en la detección de amplificación de marcadores asociados a los cromosoma X y Y, de acuerdo con las condi ciones de la PCR establecidas. Las diferencias genéticas entre las regiones de los cromosomas X y Y demostradas con los marcadores específicos no fueron perceptibles citológicamente en los espermatocitos en paquiteno de O. niloticus XY. En base a las difer encias y homologías de las secuencias de ADN entre las accesiones KC710223 y KC710224 de los cromosomas X y Y se propone un modelo de sinapsis del bivalente XY.

  3. The effects of composting on the nutritional composition of fibrous bio-regenerative life support systems (BLSS) plant waste residues and its impact on the growth of Nile tilapia ( Oreochromis niloticus)

    Science.gov (United States)

    Gonzales, John M.; Lowry, Brett A.; Brown, Paul B.; Beyl, Caula A.; Nyochemberg, Leopold

    2009-04-01

    Utilization of bio-regenerative life support systems (BLSS) plant waste residues as a nutritional source by Nile tilapia ( Oreochromis niloticus) has proven problematic as a result of high concentrations of fibrous compounds in the plant waste residues. Nutritional improvement of plant waste residues by composting with the oyster mushroom ( Pleurotus ostreatus), and the effects on growth and nutrient utilization of Nile tilapia fed such residues were evaluated. Five Nile tilapia (mean weight = 70.9 ± 3.1 g) were stocked in triplicate aquaria and fed one of two experimental diets, cowpea (CP) and composted cowpea (CCP), twice daily for a period of 8 weeks. Composting of cowpea residue resulted in reduced concentrations of nitrogen-free extract, hemi-cellulose and trypsin inhibitor activity, though trypsin inhibitor activity remained high. Composting did not reduce crude fiber, lignin, or cellulose concentrations in the diet. No significant differences ( P tilapia fed CP and CCP. These results suggest that P. ostreatus is not a suitable candidate for culture in conjunction with the culture of Nile tilapia. Additional work is needed to determine what, if any, benefit can be obtained from incorporating composted residue as feed for Nile tilapia.

  4. Genotoxicity and mutagenicity of water contaminated with tannery effluents, as evaluated by the micronucleus test and comet assay using the fish Oreochromis niloticus and chromosome aberrations in onion root-tips

    Directory of Open Access Journals (Sweden)

    Silvia Tamie Matsumoto

    2006-01-01

    Full Text Available Cytotoxicity of metals is important because some metals are potential mutagens able to induce tumors in humans and experimental animals. Chromium can damage DNA in several ways, including DNA double strand breaks (DSBs which generate chromosomal aberrations, micronucleus formation, sister chromatid exchange, formation of DNA adducts and alterations in DNA replication and transcription. In our study, water samples from three sites in the Córrego dos Bagres stream in the Franca municipality of the Brazilian state of São Paulo were subjected to the comet assay and micronucleus test using erythrocytes from the fish Oreochromis niloticus. Nuclear abnormalities of the erythrocytes included blebbed, notched and lobed nuclei, probably due to genotoxic chromium compounds. The greatest comet assay damage occurred with water from a chromium-containing tannery effluent discharge site, supporting the hypothesis that chromium residues can be genotoxic. The mutagenicity of the water samples was assessed using the onion root-tip cell assay, the most frequent chromosomal abnormalities observed being: c-metaphases, stick chromosome, chromosome breaks and losses, bridged anaphases, multipolar anaphases, and micronucleated and binucleated cells. Onion root-tip cell mutagenicity was highest for water samples containing the highest levels of chromium.

  5. The Diet of Five Cichlid Fish Species from Lake Kariba, Zimbabwe ...

    African Journals Online (AJOL)

    The diet of five cichlid fish species from the littoral areas of Lake Kariba was investigated in 1996-97. Serranochromis macrocephalus, Pseudocrenilabrus philander and Pharyngochromis acuticeps fed mostly on calanoid copepods, chironomid larvae, rotifers, phytoplankton and fish fry. Oreochromis niloticus and 0.

  6. The Effect Of Textile Mill Effluent On Two Brachish Fauna Species ...

    African Journals Online (AJOL)

    Acute toxicity of textile mill effluent to two brackish fauna species, Oreochromis niloticus (finfish) and Paleamonetes africanus. (Shrimp) fingerlings were assessed in a static renewable bioassay for 96h to determine median lethal concentrations (LC50). Seven different graded concentrations were prepared as 0.5, 1.0, 2.0, ...

  7. Influência das densidades de estocagem e sistemas de aeração sobre o peso e características de carcaça da tilápia do Nilo (Oreochromis niloticus Linnaeus, 1757 Influence of stocking densities and aeration systems on Nile tilapia (Oreochromis niloticus, 1757

    Directory of Open Access Journals (Sweden)

    Newton Castagnolli

    1998-10-01

    Full Text Available O experimento foi conduzido em nove tanques (38m2, durante 252 dias, com Oreochromis niloticus, revertidas para macho, pesando em média 16,3g, alimentadas com ração comercial (29,5% PB. Comparou-se a eficiência dos sistemas de aeração (A1=controle-sem aeração; A2=compressor radial e A3=chafariz, em três densidades de estocagem (D1=3 peixes/m3; D2=6 peixes/m3 e D3=9 peixes/m3, avaliadas através do peso final (PF dos peixes, peso de carcaça (PC, filé (PFI, pele (PP, gordura visceral (PGV e rendimentos de carcaça (RC e filé (RFI. O delineamento foi inteiramente casualizado, em esquema fatorial 3x3, com 30 repetições, sendo o peixe considerado a unidade experimental. O maior PF (530,27g e PC (431,22 foram obtidos na D1. O compressor radial (A2 foi significativamente mais eficiente do que os demais sistemas, para PF e PC, porém para PFI, somente foi significativamente mais eficiente na D2 (162,67g. O maior PGV (37,36g e PP (38,13g foram observados na D1 respectivamente, com A2 e A3. Para RC, não houve diferença entre as densidades e o A3 proporcionou o maior resultado, apesar de não diferir de A1. O RFI variou de 31,73% (A2D1 a 37,14% (A1D1 entre os tratamentos.A 252-day experiment was carried out in nine fish ponds with male sex-reversed Nile tilapia with 16.3g average weight and fed on commercial ration (29.5% crude protein. The efficiency of aeration systems (A1=non-aeration control; A2=radial compressor and A3=sprinkler was compared in three stocking densities (D1=3 fish/m3; D2=6 fish/m3 and D3=9 fish/m3, through the evaluation on their final weight (FW, carcass weight (CW, fillet weight (FIW, skin weight (SWO, visceral fat weight (VFW, carcass yield (CY and fillet yield (FIY. Plotting was completely randomized through a 3x3 factorial scheme, with 30 replications, and each fish was considered as an experimental unit. The heaviest FW (530.27g and CW (431.22g were obtained in D1. The radial compressor system was significantly

  8. Caracterización de tilapia roja (Oreochromis sp. con marcadores moleculares RAPD Characterization of the red tilapia Oreochromis sp. through molecular markers RAPD

    Directory of Open Access Journals (Sweden)

    Julieta Torres Jaramillo

    2010-04-01

    Full Text Available Se utilizó la técnica RAPD (amplificación al azar de ADN polimórfico para el estudio de la diversidad genética de Oreochromis sp. (tilapia roja en cinco piscícolas del Valle del Cauca (Colombia y en la determinación del nivel de introgresión de las especies parentales Oreochromis mosambicus, O. niloticus y O. aureus. Se evaluaron 25 cebadores, ocho fueron polimórficos y se obtuvieron 109 bandas. Los valores de heterocigosidad esperada (0.196 a 0.256 y la estructura genética (Gst = 0.22 para Oreochromis sp. indicaron un elevado grado de polimorfismo y alta estructuración genética. Estos resultados fueron consistente con el Fst = 0.268 (P Random amplified polymorphic DNA (RAPD markers were used to study genetic diversity on red Tilapia (Oreochromis sp. species collected from five fish farms located in the Valle del Cauca, Colombia and to determine the level of introgression from three parental species O. mosambicus, O. niloticus and O. aureus into local Oreochromis populations. from the 25 RAPD primers evaluated, eight were polymorphic and 109 banding patterns were observed, any of them were specific. The expected levels of heterozygosis (0.1964 to 0.2561 and genetic structure (Gst = 0.22 funded for Oreochrosmis sp. indicate high grade of polymorphism and genetic structuring. This results were observed following the analysis of molecular variance [AMOVA] (Fst = 0.268 (P <0.0001 and Multiple correspondence analysis (Gst = 0.040. The values of genetic similarity, the analysis of group, the analysis of multiple correspondence and the level of introgression, indicated that the differences in the introgression levels(P=0.0001 were significant. The low level of observed genetic differentiation among populations, could be the result of fish with the same genetic origin, whereas the high variation within populations can be displayed by handling practices and the pressure of selection to favor commercial phenotypes. The level of introgression

  9. Lactobacillus planarum subsp. plantarum JCM 1149 vs. Aeromonas hydrophila NJ-1 in the anterior intestine and posterior intestine of hybrid tilapia Oreochromis niloticus ♀ × Oreochromis aureus ♂: an ex vivo study.

    Science.gov (United States)

    Ren, Pengfei; Xu, Li; Yang, Yaling; He, Suxu; Liu, Wenshu; Ringø, Einar; Zhou, Zhigang

    2013-07-01

    To investigate the ex vivo interactions of probiotic-pathogen-host in warm-water fish, hybrid tilapia (Oreochromis niloticus♀ × Oreochromis aureus♂) were sacrificed to isolate anterior and posterior intestine for incubation with phosphate-buffered saline (PBS; pH 7.2) as the control, Lactobacillus plantarum JCM 1149 at 1.0 × 10(9) CFU/ml, Aeromonas hydrophila NJ-1 at 1.0 × 10(8) CFU/ml, or the both combination. Denaturing Gradient Gel Electrophoresis (DGGE) fingerprint and consequent sequence analysis confirmed anterior intestine sac was more prone to the colonization of L. plantarum JCM 1149 and A. hydrophila NJ-1 than the posterior part. L. plantarum JCM 1149 and A. hydrophila NJ-1 inhibited the population each other in anterior or posterior sac, indicating their competition for the colonization. The induced expression of HSP70, IL-1β and TNF-α in the anterior sac by the addition of L. plantarum JCM 1149 or A. hydrophila NJ-1 demonstrated the activity and a local immune response of ex vivo anterior sac. Compared with posterior intestine, higher population colonization and more sensitive immune response of anterior sac indicated differential patterns for the probiotic-pathogen-host interactions. Scanning electronic microscopy (SEM) observation showed that pathogen A. hydrophila NJ-1 damaged the anterior intestine, which was alleviated by the pretreatment of L. plantarum JCM 1149, showing its probiotic effect. Copyright © 2013 Elsevier Ltd. All rights reserved.