So-Eum Type as an Independent Risk Factor for Irritable Bowel Syndrome: A Population-Based Study in Korea

Science.gov (United States)

Lee, Seung Ku; Yoon, Dae Wui; Yi, Hyeryeon; Lee, Si Woo; Kim, Jong Yeol; Kim, Jin Kwan; Hong, Jeong Hwa

2014-01-01

Abstract Objectives: It has been hypothesized that Sasang constitutional types (SCTs) have a specific hypoactive organ, which can account for vulnerability to related diseases or symptoms. This study examined the relationship between SCTs and irritable bowel syndrome (IBS). Design: Cross-sectional study in a population-based cohort study in Korea. Participants: 1362 individuals (705 men and 657 women) who participated in the Korean Genome and Epidemiology Study. Outcome measures: The participants were classified into SCTs by the integrated diagnostic model and asked about symptoms related to IBS using the Rome II criteria. Results: The prevalence of IBS differed significantly among the SCTs, with 33 (18.3%) of the So-eum (SE) type, 74 (9.9%) of the Tae-eum (TE) type, and 57 (13.2%) of the So-yang (SY) type having IBS. Even after adjustment for possible confounders, the SE type for both sexes continued to show 1.82-fold (95% confidence interval [CI], 1.05–3.16) excess odds of having IBS. Men with SE type had a 2.97 times (95% CI, 1.34–6.58) and a 2.50 times (95% CI, 1.15–5.47) significantly higher odds of having IBS than the TE and SY types, respectively. In analysis for the joint effect of SCT and psychological stress, the multivariate odds ratio of IBS was 3.21 (95% CI, 1.33–7.75) for the SE type and Psychological Well-Being Index-Short Form (PWI-SF) score (<27), and 5.83 (95% CI, 1.80–18.88) for the SE type and PWI-SF (≥27) compared with the TE type and PWI-SF score (<27). Conclusions: The SE type of SCT is an independent risk factor for IBS. The findings support the hypothesis that persons with SE type are vulnerable to gastrointestinal diseases. PMID:25148474

(e- Mind Thinking with e-Um

Directory of Open Access Journals (Sweden)

Damjan Kobal

2008-04-01

Full Text Available Modern technology has opened up many new possibilities in learning. Unfortunately, technology's uncritical use can also be damaging. In promoting productive and comprehensive IT learning the essential issue lies within the capability of the teacher and IT material to use computer to promote the basic cognitive aspects of learning and not only to manipulate the learner to remain motivated. Motivation is productive only if used with a focus towards knowledge and understanding. Especially in mathematics the concepts, we try to teach, are simple and logical, but often abstract. Smart use of computers can motivate this abstract concepts through intuitive simulations and animations as well as provide a sophisticated but simple insight into the causality of mathematical thinking. Thus, we argue that preparation of good e-Learning materials requires an almost contemplative focus on what we want to communicate in order not to overwhelm the student with too many effects that the technology offers. The concept and the vision of E-um project has been based on the above premises with a comprehensive system of simple technical, mathematical and didactical guidelines, together with a dynamic and creative system of permanent self evaluation and control. To support those premises new software package based on the Exe open source system has been developed. In order to provide an adequate technical framework for our conceptual ideas new emerging technologies with an emphasis on writing mathematical texts had been used.

Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

International Nuclear Information System (INIS)

Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

Science.gov (United States)

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA

Directory of Open Access Journals (Sweden)

Jamile Rosa RAMPINELLI

2010-11-01

Full Text Available

Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.

Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

Science.gov (United States)

Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

2009-07-30

This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

USO DE HOJARASCA DE ROBLE y BAGAZO DE CAÑA EN LA PRODUCCIÓN DE Pleurotus ostreatus USO DA SERAPILHEIRA DE CARVALHO E BAGAÇO DA CANA NA PRODUÇÃO DO Pleurotus ostreatus USE OF THE OAK DEAD LEAVES AND SUGAR CANE BAGASSE IN THE Pleurotus ostreatus PRODUCTION

Directory of Open Access Journals (Sweden)

PILAR SUDIANY VARGAS

2012-06-01

Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos

Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.

Science.gov (United States)

Plagemann, Ina; Krings, Ulrich; Berger, Ralf G

2014-01-01

The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.

Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

Czech Academy of Sciences Publication Activity Database

Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

2009-01-01

Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

Science.gov (United States)

Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

2014-11-01

Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...

African Journals Online (AJOL)

Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...

VALOR NUTRICIONAL DEL HENO DE TRANSVALA INOCULADO CON EL HONGO Pleurotus ostreatus sp

Directory of Open Access Journals (Sweden)

Rodolfo WingChing-Jones

2009-01-01

Full Text Available Se analizó el valor nutricional del heno de Transvala utilizado en la producción del hongo comestible Pleurotus ostreatus. El heno fue analizado antes de inocular el hongo y después de la cosecha. Se determinó: materia seca (MS, proteína cruda (PC, extracto etéreo (EE, ceniza (Ce, digestibilidad in vitro de la MS (DIVMS, carbohidratos no fibrosos (CNF, fibra detergente neutro (FDN, fibra detergente ácido (FDA, lignina, nitrógeno ligado a la fibra detergente neutro (N-FDN y a la fibra detergente ácida (N-FDA, nutrimentos digestibles totales (NDT (1X, energía digestible (ED, energía metabolizable (EM, energía neta de lactancia (ENl, energía de mantenimiento (ENm y energía neta de ganancia (ENg. Sobresalen niveles bajos de PC, DIVMS y NDT; y valores altos de lignina, FDN y FDA. El contenido de MS, FDN, hemicelulosa (He, lignina, CNF y EE presentó diferencias significativas, debidas al crecimiento del hongo. La variación en calidad en estas variables fue de (- 48,75%, (- 24,76%, (- 80,22%, (- 27,94%, (+ 51,52% y (- 26,13%, respectivamente. La mejoría en la calidad nutricional del heno, después de la cosecha del hongo, no es tan significativa como para cambiar la perspectiva en su uso dentro de la ración total de rumiantes, por lo que el beneficio del heno se basa más en aspectos físicos que nutricionales.

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

SERVER

2008-01-04

Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833

Directory of Open Access Journals (Sweden)

Heloisa Helena Batista da Silva

2009-12-01

Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.

New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

Science.gov (United States)

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-06-01

Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

Directory of Open Access Journals (Sweden)

Gabriela Popa

2016-11-01

Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

African Journals Online (AJOL)

Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

Directory of Open Access Journals (Sweden)

Yueting Dai

2017-11-01

Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

Science.gov (United States)

Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

2017-01-01

Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

Halobacterium sp. SP1(1) as a starter culture for accelerating fish sauce fermentation.

Science.gov (United States)

Akolkar, A V; Durai, D; Desai, A J

2010-07-01

Application of Halobacterium sp. SP1(1) for the acceleration of fish sauce fermentation. Traditional fish sauce fermentation was mimicked using Halobacterium sp. SP1(1) as starter culture. Protease activity, peptide release and α-amino content (parameters used to monitor the progress of the fermentation) were high at day 10 in tests and day 20 in un-inoculated controls. The total protein and nitrogen contents were also high in tests compared with controls. The amino acid profile observed at the end of fermentation in experimental samples, when compared with the commercial sauce preparation, was found to be better with respect to flavour and aroma contributing amino acids as well as essential amino acid lysine. Microflora analysis of the final fish sauce revealed the absence of any nonhalophilic or halotolerant micro-organisms. The protease-producing halophilic isolates obtained from the fish sauce of eviscerated and uneviscerated controls were identified as Halobacterium sp. F1 and F2, respectively, by 16S rDNA sequence analysis. Exogenous augmentation of Halobacterium sp. SP1(1) accelerated the fish sauce fermentation process with an additive effect on the existing natural microflora present in the fish during fermentation. Halobacterium sp SP1(1), therefore, can be used as an important starter culture for accelerating the fish fermentation process, which is attributed to its extracellular protease. The present study is the first report on use of Halobacterium species as a starter culture for accelerating fish sauce fermentation. Use of halobacterial starter cultures may revolutionize the process in fish sauce industries by reducing the fermentation time and making the process more economical with improved nutritive value of product. Journal compilation © 2009 The Society for Applied Microbiology. No claim to Indian Government works.

The effect of repair inhibitor on radiation damages of pleurotus ostreatus

International Nuclear Information System (INIS)

Yang Zongqu; Wang Bonan; Li Xuzhao

1996-01-01

The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA

Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

International Nuclear Information System (INIS)

Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

2010-01-01

Research highlights: → Sp1 zinc fingers themselves interact with importin α. → Sp1 zinc finger domains play an essential role as a nuclear localization signal. → Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin α in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin α including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin α. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

DNA marking of some quantitative trait loci in the cultivated edible mushroom Pleurotus ostreatus (Fr.) Kumm

NARCIS (Netherlands)

Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.

2012-01-01

Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.

The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

Science.gov (United States)

Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

2015-12-01

Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

Directory of Open Access Journals (Sweden)

Marli Camassola

2013-01-01

Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...

African Journals Online (AJOL)

PROF HORSFALL

pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.

Tow-step degradation of pyrene by white-rot fungi and soil microorganisms

International Nuclear Information System (INIS)

Wische, C. in der; Martens, R.; Zadrazil, F.

1996-01-01

The effect of soil microorganisms on mineralization of 14 C-labelled pyrene by white-rot fungi in solid-state fermentation was investigated. Two strains of white-rot fungi, Dichomitus squalens and a Pleurotus sp., were tested. The fungi were incubated on milled wheat straw contaminated with [ 14 C]pyrene for 15 weeks. CO 2 and 14 CO 2 liberated from the cultures were determined weekly. To study the effect of soil microorganisms on respiration and [ 14 C]pyrene mineralization in different periods of fungal development, the fungal substrate was covered with soil at different times of incubation (after 0, 1, 3, 5, 7, 9 or 11 weeks). The two fungi showed contrasting ecological behaviour in competition with the soil microflora. Pleurotus sp. was highly resistant to microbial attack and had the ability to penetrate the soil. D. squalens was less competitive and did not colonize the soil. The resistance of the fungus was dependent on the duration of fungal preincubation. Mineralization of [ 14 C]pyrene by mixed cultures of D. squalens and soil microorganisms was higher than by the fungus or the soil microflora alone when soil was added after 3 weeks of incubation or later. With Pleurotus sp., the mineralization of [ 14 C]pyrene was enhanced by the soil microflora irrespective of the time of soil application. With D. squalens, which in pure culture mineralized less [ 14 C]pyrene than did Pleurotus sp., the increase of [ 14 C]pyrene mineralization caused by soil application was higher than with Pleurotus sp. (orig.)

nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

African Journals Online (AJOL)

DJFLEX

The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

Caracterización de la lacasa obtenida por dos métodos de producción con Pleurotus ostreatus Characterising laccase obtained by two production methods using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Martínez César

2003-12-01

Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000

Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

Science.gov (United States)

Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

2012-01-01

Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

Directory of Open Access Journals (Sweden)

Maura Téllez-Téllez

2016-03-01

Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

International Nuclear Information System (INIS)

Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

2017-01-01

The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

African Journals Online (AJOL)

The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

Mutation breeding and submerged fermentation of a Pleurotus polysaccharide high-yield strain with low-energy heavy ions implantation

International Nuclear Information System (INIS)

Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian

2010-01-01

Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)

Transcriptional Regulation of Frizzled-1 in Human Osteoblasts by Sp1.

Directory of Open Access Journals (Sweden)

Shibing Yu

Full Text Available The wingless pathway has a powerful influence on bone metabolism and is a therapeutic target in skeletal disorders. Wingless signaling is mediated in part through the Frizzled (FZD receptor family. FZD transcriptional regulation is poorly understood. Herein we tested the hypothesis that Sp1 plays an important role in the transcriptional regulation of FZD1 expression in osteoblasts and osteoblast mineralization. To test this hypothesis, we conducted FZD1 promoter assays in Saos2 cells with and without Sp1 overexpression. We found that Sp1 significantly up-regulates FZD1 promoter activity in Saos2 cells. Chromatin immunoprecipitation (ChIP and electrophoretic mobility shift (EMSA assays identified a novel and functional Sp1 binding site at -44 to -40 from the translation start site in the FZD1 promoter. The Sp1-dependent activation of the FZD1 promoter was abolished by mithramycin A (MMA, an antibiotic affecting both Sp1 binding and Sp1 protein levels in Saos2 cells. Similarly, down-regulation of Sp1 in hFOB cells resulted in less FZD1 expression and lower alkaline phosphatase activity. Moreover, over-expression of Sp1 increased FZD1 expression and Saos2 cell mineralization while MMA decreased Sp1 and FZD1 expression and Saos2 cell mineralization. Knockdown of FZD1 prior to Sp1 overexpression partially abolished Sp1 stimulation of osteoblast differentiation markers. Taken together, our results suggest that Sp1 plays a role in human osteoblast differentiation and mineralization, which is at least partially mediated by Sp1-dependent transactivation of FZD1.

Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

Science.gov (United States)

Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

2015-10-01

Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

International Nuclear Information System (INIS)

Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

2011-01-01

Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

Directory of Open Access Journals (Sweden)

W.A. Tapie

2016-08-01

Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

Diseases and pests noxious to Pleurotus spp. mushroom crops.

Science.gov (United States)

Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Heterologous production of the stain solving peptidase PPP1 from Pleurotus pulmonarius.

Science.gov (United States)

Leonhardt, Robin-Hagen; Krings, Ulrich; Berger, Ralf G; Linke, Diana

2016-05-01

A novel stain solving subtilisin-like peptidase (PPP1) was identified from the culture supernatant of the agaricomycete Pleurotus pulmonarius. It was purified to homogeneity using a sequence of preparative isoelectric focusing, anion exchange and size exclusion chromatography. Peptides were identified by ab initio sequencing (nLC-ESI-QTOF-MS/MS), characterizing the enzyme as a member of the subtilase family (EC 3.4.21.X). An expression system was established featuring the pPIC9K vector, an alternative Kozak sequence, the codon optimized gene ppp1 gene without the native signal sequence with C-terminal hexa-histidine tag, and Pichia pastoris GS115 as expression host. Intracellular active enzyme was obtained from cultivations in shake flasks and in a five liter bioreactor. With reaction optima of 40 °C and a pH > 8.5, considerable bleaching of pre-stained fabrics (blood, milk and India ink), and the possibility of larger-scale production, the heterologous enzyme is well suitable for detergent applications, especially at lower temperatures as part of a more energy- and cost-efficient washing process. Showing little sequence similarity to other subtilases, this unique peptidase is the first subtilisin-like peptidase from Basidiomycota, which has been functionally produced in Pichia pastoris.

Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

Directory of Open Access Journals (Sweden)

Yan Liang

2013-11-01

Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

Improving the feeding value of straws with Pleurotus ostreatus

NARCIS (Netherlands)

Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

2015-01-01

The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

Science.gov (United States)

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-05-01

One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

Directory of Open Access Journals (Sweden)

Miriam HAIDUKOWSKI

2017-05-01

Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

International Nuclear Information System (INIS)

Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

2007-01-01

The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

African Journals Online (AJOL)

An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

Preliminary investigation into the use of Pleurotus tuber-regium ...

African Journals Online (AJOL)

The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

Análise química de corpos de frutificação de Pleurotus sajor-caju cultivado em diferentes concentrações de nitrogênio Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

Directory of Open Access Journals (Sweden)

Evânia Geralda Silva

2007-03-01

Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.

Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

OpenAIRE

Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

2007-01-01

Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

African Journals Online (AJOL)

Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

African Journals Online (AJOL)

Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

OpenAIRE

Albuquerque, Margeli Pereira de

2010-01-01

As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

Transcriptional regulation of HIV-1 host factor COMMD1 by the Sp family.

Science.gov (United States)

Kudo, Eriko; Taura, Manabu; Suico, Mary Ann; Goto, Hiroki; Kai, Hirofumi; Okada, Seiji

2018-04-01

Copper metabolism Murr1 domain containing 1 (COMMD1) has multiple functions in the regulation of protein stability at the plasma membrane and in the cytoplasm. However, the regulation of COMMD1 transcriptional has remained to be elucidated. In the present study, the 5'‑flanking region (‑1,192/+83 bp) of the human COMMD1 gene was cloned. It was observed that the COMMD1 promoter region contains GC‑rich region that has 7 putative Sp1‑binding sites via in silico analysis. The proximal promoter region at ‑289/+83 bp was required for COMMD1 basal promoter activity by deletion constructs of COMMD1 promoter. Moreover, Sp1 inhibitor, mithramycin A, suppressed basal COMMD1 promoter activity. The Sp1‑binding site (‑11/‑1 bp) in the proximal promoter region was a critical site for COMMD1 gene regulation by Sp1 and Sp3. Sp1 upregulated COMMD1 promoter activity, whereas Sp3 suppressed it. Endogenous Sp1 and Sp3 bound to the proximal promoter region of COMMD1. Taken together, Sp1 constitutively regulates the basal expression of the COMMD1 gene in human epithelial cell lines.

Evaluation of biomass of some invasive weed species as substrate for oyster mushroom (Pleurotus spp.) cultivation.

Science.gov (United States)

Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha

2014-01-15

This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.

EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

Directory of Open Access Journals (Sweden)

MARÍA DEL PILAR RÍOS

2010-12-01

Full Text Available Se evaluaron medios alternativos para la propagación de Pleurotus ostreatus y se comparó su comportamiento frente a un medio comercial. La respuesta a estos medios fue medida mediante la adaptación del hongo en cebada para la obtención de semilla comercial, y ésta a su vez en la respuesta a un sustrato a base de bagazo de caña para la obtención de orellanas. En la primera fase se obtuvo y sembró el hongo en un medio sólido de extracto de papa a dos concentraciones y tres valores de pH, utilizando un diseño factorial 2x3 (pH vs concentración de extracto de papa. En la segunda fase se midió el crecimiento de Pleurotus ostreatus inoculado en cebada hidratada esterilizada mediante un diseño completamente al azar 3x3. En la tercera se evaluó la colonización y fructificación del hongo en bagazo de caña usando parámetros como eficiencia biológica, rendimiento y tasa de producción semilla, con un diseño completamente al azar 3x3. El medio alternativo con pH 5,0 fue el más adecuado para el crecimiento del Pleurotus ostreatus, demostrando su adaptabilidad a medios con alto contenido de carbohidratos, cuyos rendimientos fueron apropiados para obtener niveles de producción competitivos en crecimiento y fructificación, disminuyendo así el tiempo de incubación y cosecha.Foram avaliados os meios alternativos para a propagação de fungos Pleurotus ostreatus e se comparou o seu comportamento em um ambiente comercial. A resposta a esses meios foi medida pela adaptação do fungo em cevada para a obtenção de sementes comerciais e este por sua vez, em resposta a um substrato a base de bagaço de cana para a produção de "Orellana". Na primeira fase foi obtida e plantou o fungo em meio sólido de extrato de batata a duas concentrações e três valores de pH, utilizando um design fatorial 2x3 (pH vs concentração de extrato de batata. Na segunda fase, mediu o crescimento de Pleurotus ostreatus inoculadas em cevada estéril úmida em 3x

Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Gabriel, Jiří

2002-01-01

Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

Directory of Open Access Journals (Sweden)

Carol Daniela Coello-Loor

2017-12-01

Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Czech Academy of Sciences Publication Activity Database

Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

2016-01-01

Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2016-09-01

Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

Biomass production of pleurotus sajor-caju by submerged culture fermentation

International Nuclear Information System (INIS)

Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.

2006-01-01

The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)

Quality improvement on half-fin anchovy (Setipinna taty) fish sauce by Psychrobacter sp. SP-1 fermentation.

Science.gov (United States)

Zheng, Bin; Liu, Yu; He, Xiaoxia; Hu, Shiwei; Li, Shijie; Chen, Meiling; Jiang, Wei

2017-10-01

A method of improving fish sauce quality during fermentation was investigated. Psychrobacter sp. SP-1, a halophilic protease-producing bacterium, was isolated from fish sauce with flavor-enhancing properties and non-biogenic amine-producing activity. The performance of Psychrobacter sp. SP-1 in Setipinna taty fish sauce fermentation was investigated further. The inoculation of Psychrobacter sp. SP-1 did not significantly affect pH or NaCl concentration changes (P > 0.05), although it significantly increased total moderately halophilic microbial count, protease activity, total soluble nitrogen content and amino acid nitrogen content, and also promoted the umami taste and meaty aroma (P sauce quality by fermentation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

Science.gov (United States)

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

Directory of Open Access Journals (Sweden)

javad janpoor

2018-03-01

Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

International Nuclear Information System (INIS)

Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

2012-01-01

Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

Energy Technology Data Exchange (ETDEWEB)

Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

2012-05-15

Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

Czech Academy of Sciences Publication Activity Database

Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

2002-01-01

Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

ORF Alignment: NC_004337 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_000913 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_004741 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_002655 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_002695 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

ORF Alignment: NC_004431 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available UM|F Chain F, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1EUM|E Chain E, Crystal Structure Of ... The E.Co...li Ferritin Ecftna pdb|1EUM|D Chain D, Crystal ... Structure Of The E.Coli... Ferritin Ecftna pdb|1EUM|C Chain ... C, Crystal Structure Of The E.Coli Fer...ritin Ecftna ... pdb|1EUM|B Chain B, Crystal Structure Of The E.Coli ... Ferritin Ecftna pdb|1...EUM|A Chain A, Crystal Structure Of ... The E.Coli Ferritin Ecftna dbj|BAA

Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

NARCIS (Netherlands)

Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

2006-01-01

When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

Zac1, an Sp1-like protein, regulates human p21WAF1/Cip1 gene expression in HeLa cells

International Nuclear Information System (INIS)

Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

2011-01-01

Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21 WAF1/Cip1 gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein–protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21 WAF1/Cip1 gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

Science.gov (United States)

Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

2010-10-01

Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

Sp1 and Sp3 Are the Transcription Activators of Human ek1 Promoter in TSA-Treated Human Colon Carcinoma Cells.

Science.gov (United States)

Kuan, Chee Sian; See Too, Wei Cun; Few, Ling Ling

2016-01-01

Ethanolamine kinase (EK) catalyzes the phosphorylation of ethanolamine, the first step in the CDP-ethanolamine pathway for the biosynthesis of phosphatidylethanolamine (PE). Human EK exists as EK1, EK2α and EK2β isoforms, encoded by two separate genes, named ek1 and ek2. EK activity is stimulated by carcinogens and oncogenes, suggesting the involvement of EK in carcinogenesis. Currently, little is known about EK transcriptional regulation by endogenous or exogenous signals, and the ek gene promoter has never been studied. In this report, we mapped the important regulatory regions in the human ek1 promoter. 5' deletion analysis and site-directed mutagenesis identified a Sp site at position (-40/-31) that was essential for the basal transcription of this gene. Treatment of HCT116 cells with trichostatin A (TSA), a histone deacetylase inhibitor, significantly upregulated the ek1 promoter activity through the Sp(-40/-31) site and increased the endogenous expression of ek1. Chromatin immunoprecipitation assay revealed that TSA increased the binding of Sp1, Sp3 and RNA polymerase II to the ek1 promoter in HCT116 cells. The effect of TSA on ek1 promoter activity was cell-line specific as TSA treatment did not affect ek1 promoter activity in HepG2 cells. In conclusion, we showed that Sp1 and Sp3 are not only essential for the basal transcription of the ek1 gene, their accessibility to the target site on the ek1 promoter is regulated by histone protein modification in a cell line dependent manner.

Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

Science.gov (United States)

Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

2014-01-01

Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

Usability and Workflow Evaluation of “RhEumAtic Disease Activity” (READY)

Science.gov (United States)

Yen, Po-Yin; Lara, Barbara; Lopetegui, Marcelo; Bharat, Aseem; Ardoin, Stacy; Johnson, Bernadette; Mathur, Puneet; Embi, Peter J.

2016-01-01

Summary Background RhEumAtic Disease activitY (READY) is a mobile health (mHealth) application that aims to create a shared platform integrating data from both patients and physicians, with a particular emphasis on arthritis disease activity. Methods We made READY available on an iPad and pilot implemented it at a rheumatology out-patient clinic. We conducted 1) a usability evaluation study to explore patients’ and physicians’ interactions with READY, and 2) a time motion study (TMS) to observe the clinical workflow before and after the implementation. Results A total of 33 patients and 15 physicians participated in the usability evaluation. We found usability problems in navigation, data entry, pain assessment, documentation, and instructions along with error messages. Despite these issues, 25 (75,76%) patients reported they liked READY. Physicians provided mixed feedback because they were concerned about the impact of READY on clinical workflow. Six physicians participated in the TMS. We observed 47 patient visits (44.72 hours) in the pre-implementation phase, and 42 patient visits (37.82 hours) in the post-implementation phase. We found that patients spent more time on READY than paper (4.39mins vs. 2.26mins), but overall, READY did not delay the workflow (pre = 52.08 mins vs. post = 45.46 mins). This time difference may be compensated with READY eliminating a workflow step for the staff. Conclusion Patients preferred READY to paper documents. Many found it easier to input information because of the larger font size and the ease of ‘tapping’ rather than writing-out or circling answers. Even though patients spent more time on READY than using paper documents, the longer usage of READY was mainly due to when troubleshooting was needed. Most patients did not have problems after receiving initial support from the staff. This study not only enabled improvements to the software but also serves as good reference for other researchers or institutional decision

UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

Directory of Open Access Journals (Sweden)

JOSE MIGUEL CAMPO GAVIRIA

2017-12-01

Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

Directory of Open Access Journals (Sweden)

Maria Teresa Branà

Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

Scalability of Parallel Spatial Direct Numerical Simulations on Intel Hypercube and IBM SP1 and SP2

Science.gov (United States)

Joslin, Ronald D.; Hanebutte, Ulf R.; Zubair, Mohammad

1995-01-01

The implementation and performance of a parallel spatial direct numerical simulation (PSDNS) approach on the Intel iPSC/860 hypercube and IBM SP1 and SP2 parallel computers is documented. Spatially evolving disturbances associated with the laminar-to-turbulent transition in boundary-layer flows are computed with the PSDNS code. The feasibility of using the PSDNS to perform transition studies on these computers is examined. The results indicate that PSDNS approach can effectively be parallelized on a distributed-memory parallel machine by remapping the distributed data structure during the course of the calculation. Scalability information is provided to estimate computational costs to match the actual costs relative to changes in the number of grid points. By increasing the number of processors, slower than linear speedups are achieved with optimized (machine-dependent library) routines. This slower than linear speedup results because the computational cost is dominated by FFT routine, which yields less than ideal speedups. By using appropriate compile options and optimized library routines on the SP1, the serial code achieves 52-56 M ops on a single node of the SP1 (45 percent of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a "real world" simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP supercomputer. For the same simulation, 32-nodes of the SP1 and SP2 are required to reach the performance of a Cray C-90. A 32 node SP1 (SP2) configuration is 2.9 (4.6) times faster than a Cray Y/MP for this simulation, while the hypercube is roughly 2 times slower than the Y/MP for this application. KEY WORDS: Spatial direct numerical simulations; incompressible viscous flows; spectral methods; finite differences; parallel computing.

Crescimento micelial de Pleurotus ostreatus em resíduo de Simarouba amara Mycelial growth of Pleurotus ostreatus in Simarouba amara sawdust

Directory of Open Access Journals (Sweden)

Ceci Sales-Campos

2008-11-01

Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.

Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Pei-Yao [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Hsieh, Tsai-Yuan [Division of Gastroenterology, Department of Internal Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Liu, Shu-Ting; Chang, Yung-Lung [Department of Biochemistry, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Lin, Wei-Shiang [Division of Cardiology, Department of Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Wang, Wei-Ming, E-mail: ades0431@ms38.hinet.net [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Department of Dermatology, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Huang, Shih-Ming, E-mail: shihming@ndmctsgh.edu.tw [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Department of Biochemistry, National Defense Medical Center, Taipei 114, Taiwan, ROC (China)

2011-12-10

Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

Nutriceutical potential of Pleurotus tuber-regium sclerotium

Directory of Open Access Journals (Sweden)

R. C. Ohiri

2018-04-01

Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

Electrical stimulation in white oyster mushroom (Pleurotus florida) production

Science.gov (United States)

Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

2017-09-01

White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

Establishment of an efficient transformation system for Pleurotus ostreatus.

Science.gov (United States)

Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

2017-11-21

Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

Science.gov (United States)

This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

Directory of Open Access Journals (Sweden)

Eustáquio Souza Dias

2003-12-01

Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

O. M. Alekseenko

2010-07-01

Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

The comparative study on screening of pleurotus polysaccharide high-yield strains by use of ion beam implantation and composite mutagenesis

International Nuclear Information System (INIS)

Wang Lianfeng; Chen Henglei; Zhang Jun; Zeng Xianxian

2009-01-01

In order to screen pleurotus mycelium polysaccharide high-yield strains, the comparative study was made by use of ion beam implantation and composite mutagenesis before screening. The treating mycelium pellet of pleurotus ferulae tentatively with ion beam implantation was performed at the first. Two polysaccharide high-yield strains, PFPH-1and PFPH-2, were selected using fermentation quantitative screening after auxotrophy qualitative primary screening. It has been found that the polysaccharide yield of the mutants is 551.80mg/L and 659.46mg/L respectively,which increases by 46.55% and 75.14% respectively compared to that of initial strain. Then PFPH-1and PFPH-2, as the original strain, is exposed to ultraviolet light and is suffered by additive of LiCl respectively. The results indicate that the polysaccharide yield of strains 1,9 and 10 decreases by 27%, 38% and 37% respectively compared to that of PFPH-1 meanwhile the polysaccharide yield of strain 17 decreases by 28% compared to that of PFPH-2 after high-flux qualitative primary screening. In this study, composite mutagenesis with exposure of ultra-violet and additive of lithium chloride shows some negative effects. (authors)

Effects of oriental medicine music therapy in an ovarian cancer patient with So-Eum-type constitution: a case report

Directory of Open Access Journals (Sweden)

Seung-Hyun Lee

2015-03-01

Full Text Available The cancer incidence in Korea has been increasing, although there is a serious lack of supportive care for the treatment and management of the rapidly increasing number of cancer patients, and there is an immense need for therapeutic interventions to support cancer patients. A 47-year-old So-Eum-type Korean female patient, who was diagnosed with ovarian cancer, had been receiving chemotherapies. She was experiencing pain due to swelling of her hands and feet, and under extreme stress due to hardships of life. During the patient's fourth chemotherapy treatment, she received oriental medicine music therapy twice per week for 2 weeks, for 1 hour each time (4 sessions in total. A self-administered questionnaire and the visual analog scale were used to assess and determine the level of negative and positive feelings. After receiving the oriental medicine music therapy, her negative and positive feelings as well as the visual analog scale score that reflects subjective health conditions have improved and stabilized. This case report suggests the potential of oriental medicine music therapy as a complementary and alternative medical treatment method to promote and enhance quality of life and health conditions of cancer patients in postsurgical care and chemotherapy treatment.

Effects of oriental medicine music therapy in an ovarian cancer patient with So-Eum-type constitution: a case report.

Science.gov (United States)

Lee, Seung-Hyun; Song, Eunhye; Kim, Seul-Ki

2015-03-01

The cancer incidence in Korea has been increasing, although there is a serious lack of supportive care for the treatment and management of the rapidly increasing number of cancer patients, and there is an immense need for therapeutic interventions to support cancer patients. A 47-year-old So-Eum -type Korean female patient, who was diagnosed with ovarian cancer, had been receiving chemotherapies. She was experiencing pain due to swelling of her hands and feet, and under extreme stress due to hardships of life. During the patient's fourth chemotherapy treatment, she received oriental medicine music therapy twice per week for 2 weeks, for 1 hour each time (4 sessions in total). A self-administered questionnaire and the visual analog scale were used to assess and determine the level of negative and positive feelings. After receiving the oriental medicine music therapy, her negative and positive feelings as well as the visual analog scale score that reflects subjective health conditions have improved and stabilized. This case report suggests the potential of oriental medicine music therapy as a complementary and alternative medical treatment method to promote and enhance quality of life and health conditions of cancer patients in postsurgical care and chemotherapy treatment.

Inhibition of Sp1 functions by its sequestration into PML nuclear bodies.

Directory of Open Access Journals (Sweden)

June Li

Full Text Available Promyelocytic leukemia nuclear bodies (PML NBs are comprised of PML and a striking variety of its associated proteins. Various cellular functions have been attributed to PML NBs, including the regulation of gene expression. We report here that induced expression of PML recruits Sp1 into PML NBs, leading to the reduction of Sp1 transactivation function. Specifically, Chromatin immunoprecipitation (ChIP assay demonstrated that induced expression of PML significantly diminishes the amount of Sp1 binding to its target gene promoter, immunofluorescence staining showed dramatic increase in the co-localization between PML and Sp1 upon induction of PML expression, moreover, PML and Sp1 co-fractionated in the core nuclear matrix. Our study further showed that PML promotes SUMOylation of Sp1 in a RING-motif-dependent manner, SUMOylation of Sp1 facilitates physical interaction between Sp1 and PML and recruitment of Sp1 into the PML NBs, the SUMO binding motif of PML was also important for its interaction with Sp1. The results of this study demonstrate a novel mechanism by which PML regulates gene expression through sequestration of the transcription factor into PML NBs.

Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Seyma Ozcirak Ergun

2017-06-01

Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

Control of Branchionus sp. and Amoeba sp. in cultures of Arthrospira sp. Control de Branchionus sp. y Amoeba sp. en cultivos de Arthrospira sp.

Directory of Open Access Journals (Sweden)

Carlos Méndez

2012-09-01

Full Text Available Cultivation of cyanobacterium Arthrospira sp. has been developed in many countries for the production of proteins, pigments and other compounds. Outdoor mass cultures are often affected by biological contamination, drastically reducing productivity as far as bringing death. This study evaluates the control of Branchionus sp. and Amoeba sp. with two chemical compounds: urea (U and ammonium bicarbonate (AB, in laboratory conditions and outdoor mass culture of Arthrospira sp. The lethal concentration 100 (LC100 at 24 h for Branchionus sp. and Amoeba sp. determined was of 60-80 mg L-1 (U and 100-150 mg L-1 (AB. The average effective inhibition concentration for 50% of the population (IC50 in Arthrospira sp., after 72 h, was 80 mg L-1 (U and 150 mg L-1 (AB. The application of doses of 60 mg L-1 (U or 100 mg L-1 (AB in the outdoor mass culture of this contaminated microalga, completely inhibited grazing and did not affect the growth of Arthrospira sp. but rather promoted rapid recovery of algal density at levels prior to infestation. These compounds provided an economical and effective control of predators in cultures of Arthrospira sp.El cultivo de la cianobacteria Arthrospira sp. ha sido desarrollado en muchos países para la obtención de proteínas, pigmentos y otros compuestos. Cultivo que a nivel industrial se ve afectado frecuentemente por contaminación biológica, reduciendo drásticamente la productividad hasta causar la muerte. Este estudio evalúa el control de Branchionus sp. y de Amoeba sp. con dos compuestos químicos, la urea (U y bicarbonato de amonio (AB en cultivos de Arthrospira sp. La concentración letal 100 (LC100 determinada a las 24 h para Branchionus sp. y Amoeba sp. fue de 60-80 mg L-1 (U y 100-150 mg L-1 (AB. La concentración media de inhibición efectiva, después de 72 h, para el 50% de la población (IC50 en Arthrospira fue de 80 mg L-1 (U y 150 mg L-1 (AB. La aplicación de dosis de 60 mg L-1 (U ó 100 mg L-1 (AB en

Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

Directory of Open Access Journals (Sweden)

Ceci Sales-Campos

2009-12-01

Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

Response of ligninolytic macrofungi to the herbicide atrazine: dose-response bioassays.

Science.gov (United States)

Cupul, Wilberth Chan; Abarca, Gabriela Heredia; Vázquez, Refugio Rodríguez; Salmones, Dulce; Hernández, Rigoberto Gaitán; Gutiérrez, Enrique Alarcón

2014-01-01

The effect of atrazine concentrations on mycelial growth and ligninolytic enzyme activities of eight native ligninolytic macrofungi isolated in Veracruz, México, were evaluated in a semi-solid culture medium. Inhibition of mycelial growth and growth rates were significantly affected (p=0.05) by atrazine concentrations (468, 937, 1875, and 3750 mg/l). In accordance with the median effective concentration (EC50), Pleurotus sp. strain 1 proved to be the most tolerant isolate to atrazine (EC50=2281.0 mg/l), although its enzyme activity was not the highest. Pycnoporus sanguineus strain 2, Daedalea elegans and Trametes maxima showed high laccase activity (62.7, 31.9, 29.3 U mg/protein, respectively) without atrazine (control); however, this activity significantly increased (p<0.05) (to 191.1, 83.5 and 120.6 U mg/protein, respectively) owing to the effect of atrazine (937 mg/l) in the culture medium. Pleurotus sp. strain 2 and Cymatoderma elegans significantly increased (p<0.05) their manganese peroxidase (MnP) activities under atrazine stress at 468 mg/l. The isolates with high EC50 (Pleurotus sp. strain 1) and high enzymatic activity (P. sanguineus strain 2 and T. maxima) could be considered for future studies on atrazine mycodegradation. Furthermore, this study confirms that atrazine can increase laccase and MnP activities in ligninolytic macrofungi. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Suitable conditions for xylanases activities from Bacillus sp. GA2(1 and Bacillus sp. GA1(6 and their properties for agricultural residues hydrolysis

Directory of Open Access Journals (Sweden)

Sudathip Chantorn

2016-04-01

Full Text Available Bacillus sp. GA2(1 and Bacillus sp. GA1(6 were isolated from soybean field in Khon Kaen province, Thailand. Crude enzymes from both isolates showed the activities of cellulase, xylanase, and mannanase at 37°C for 24 h. The highest xylanase activities of Bacillus sp. GA2(1 and Bacillus sp. GA1(6 were 1.58±0.25 and 0.82±0.16 U/ml, respectively. The relative xylanase activities from both strains were more than 60% at pH 5.0 to 8.0. The optimum temperature of xylanases was 50°C in both strains. The residual xylanase activities from both strains were more than 70% at 60°C for 60 min. Five agricultural wastes (AWs, namely coffee residue, soybean meal, potato peel, sugarcane bagasse, and corn cobs, were used as substrates for hydrolysis properties. The highest reducing sugar content of 101±1.32 µg/ml was obtained from soybean meal hydrolysate produced by Bacillus sp. GA2(1 xylanase.

NF1, Sp1 and HSF1 are synergistically involved in sulfide-induced sqr activation in echiuran worm Urechis unicinctus

Energy Technology Data Exchange (ETDEWEB)

Liu, Xiaolong; Qin, Zhenkui; Li, Xueyu; Ma, Xiaoyu; Gao, Beibei; Zhang, Zhifeng, E-mail: zzfp107@ouc.edu.cn

2016-06-15

Highlights: • Sulfide activates sqr transcription against respiratory toxicity in Urechis unicinctus. • Sulfide increases expressions and activities of NF1, Sp1 and HSF1 in a time-dependent manner. • NF1 and Sp1 participate in both basal and early sulfide-induced sqr transcription. • HSF1 functions more significantly than NF1 and Sp1 in sulfide-induced sqr transcription. • Transcription factors NF1, Sp1 and HSF1 enhance sqr promoter activity synergistically. - Abstract: Background: Sulfide is a well-known environmental toxic substance. Mitochondrial sulfide oxidation is a main mechanism of sulfide detoxification in organisms, and sulfide: quinone oxidoreductase (SQR) is a key enzyme which is involved in transferring electrons from sulfide to ubiquinone and converting sulfide into thiosulfate. Previous studies have revealed the SQR-mediated mitochondrial sulfide oxidation exists in the echiuran worm Urechis unicinctus, and its sqr mRNA level increased significantly when the worm is exposed to sulfide. In this study, we attempt to reveal the synergistic regulation of transcription factors on sulfide-induced sqr transcription in U. unicinctus. Methods: ChIP and EMSA were used to identify the interactions between sqr proximal promoter (from −391 to +194 bp) and transcription factors NF1 (nuclear factor 1) and Sp1 (specificity protein 1). Site-directed mutation and transfection assays further revealed their binding sites and synergistic roles of HSF1, NF1 and Sp1 in the sqr transcription. When U. unicinctus were exposed to 150 μM sulfide, the expression levels and nuclear contents of NF1 and Sp1 were examined by Western blotting, and the binding contents between NF1 or Sp1 and the sqr promoter were also detected by ChIP. Results: Transcription factors NF1 and Sp1 were confirmed to interact with the sqr proximal promoter, and their binding sites were identified in −75 to −69 bp for NF1 and −210 to −201 bp for Sp1. Transfection assays showed mutation

Wnt-mediated down-regulation of Sp1 target genes by a transcriptional repressor Sp5

Czech Academy of Sciences Publication Activity Database

Fujimura, Naoko; Vacík, Tomáš; Machoň, Ondřej; Vlček, Čestmír; Scalabrin, S.; Speth, M.; Diep, D.; Krauss, S.; Kozmik, Zbyněk

2007-01-01

Roč. 282, č. 2 (2007), s. 1225-1237 ISSN 0021-9258 Institutional research plan: CEZ:AV0Z50520514 Keywords : Wnt -mediated signaling * Sp5 transcription factor * Sp1 target genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.581, year: 2007

O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

International Nuclear Information System (INIS)

Lim, Kihong; Chang, Hyo-Ihl

2009-01-01

The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

Imperatorin inhibits HIV-1 replication through an Sp1-dependent pathway.

Science.gov (United States)

Sancho, Rocío; Márquez, Nieves; Gómez-Gonzalo, Marta; Calzado, Marco A; Bettoni, Giorgio; Coiras, Maria Teresa; Alcamí, José; López-Cabrera, Manuel; Appendino, Giovanni; Muñoz, Eduardo

2004-09-03

Coumarins and structurally related compounds have been recently shown to present anti-human immunodeficiency virus, type 1 (HIV-1) activity. Among them, the dietary furanocoumarin imperatorin is present in citrus fruits, in culinary herbs, and in some medicinal plants. In this study we report that imperatorin inhibits either vesicular stomatitis virus-pseudotyped or gp160-enveloped recombinant HIV-1 infection in several T cell lines and in HeLa cells. These recombinant viruses express luciferase as a marker of viral replication. Imperatorin did not inhibit the reverse transcription nor the integration steps in the viral cell cycle. Using several 5' long terminal repeat-HIV-1 constructs where critical response elements were either deleted or mutated, we found that the transcription factor Sp1 is critical for the inhibitory activity of imperatorin induced by both phorbol 12-myristate 13-acetate and HIV-1 Tat. Moreover in transient transfections imperatorin specifically inhibited phorbol 12-myristate 13-acetate-induced transcriptional activity of the Gal4-Sp1 fusion protein. Since Sp1 is also implicated in cell cycle progression we further studied the effect of imperatorin on cyclin D1 gene transcription and protein expression and in HeLa cell cycle progression. We found that imperatorin strongly inhibited cyclin D1 expression and arrested the cells at the G(1) phase of the cell cycle. These results highlight the potential of Sp1 transcription factor as a target for natural anti-HIV-1 compounds such as furanocoumarins that might have a potential therapeutic role in the management of AIDS.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

Directory of Open Access Journals (Sweden)

S. N. FASEHAH

2017-04-01

Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

International Nuclear Information System (INIS)

Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

2013-01-01

The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

International Nuclear Information System (INIS)

Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

2002-01-01

This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

Science.gov (United States)

Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

Application of pregnancy specific β1 glycoprotein-radioimmunoassay (SP1-ria) in obstetrics and gynecology

International Nuclear Information System (INIS)

Zhang Weiyuan

1988-01-01

Serum SP 1 values of 395 patients were determined by radioimmunoassay. It was found that SP 1 was apparently absent from the blood of normal men and nonpregnant women, increased with gestational stage in pregnant women, and was highest in late pregnancy. In high-risk pregnancy, SP 1 was lower than normal pregnamey group (PC0.01) could also be detected in ectopic pregnancy. In patients with benign and malignant hydatidiform mole, and choriocarcinoma, AP 1 level decreased with malignant degree. The authors suggest that measurement of SP 1 levels is a valuable index for monitoring high-risk pregnancy, diagnosing ectopic pregnancy and following-up trophoblastic cell diseases

Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

Science.gov (United States)

Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

2016-08-01

This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme

International Nuclear Information System (INIS)

Hassan Hamdani Mutaat; Mat Rasol Awang

2004-01-01

The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)

The SpTransformer Gene Family (Formerly Sp185/333) in the Purple Sea Urchin and the Functional Diversity of the Anti-Pathogen rSpTransformer-E1 Protein

Science.gov (United States)

Smith, L. Courtney; Lun, Cheng Man

2017-01-01

The complex innate immune system of sea urchins is underpinned by several multigene families including the SpTransformer family (SpTrf; formerly Sp185/333) with estimates of ~50 members, although the family size is likely variable among individuals of Strongylocentrotus purpuratus. The genes are small with similar structure, are tightly clustered, and have several types of repeats in the second of two exons and that surround each gene. The density of repeats suggests that the genes are positioned within regions of genomic instability, which may be required to drive sequence diversification. The second exon encodes the mature protein and is composed of blocks of sequence called elements that are present in mosaics of defined element patterns and are the major source of sequence diversity. The SpTrf genes respond swiftly to immune challenge, but only a single gene is expressed per phagocyte. Many of the mRNAs appear to be edited and encode proteins with altered and/or missense sequence that are often truncated, of which some may be functional. The standard SpTrf protein structure is an N-terminal glycine-rich region, a central RGD motif, a histidine-rich region, and a C-terminal region. Function is predicted from a recombinant protein, rSpTransformer-E1 (rSpTrf-E1), which binds to Vibrio and Saccharomyces, but not to Bacillus, and binds tightly to lipopolysaccharide, β-1,3-glucan, and flagellin, but not to peptidoglycan. rSpTrf-E1 is intrinsically disordered but transforms to α helical structure in the presence of binding targets including lipopolysaccharide, which may underpin the characteristics of binding to multiple targets. SpTrf proteins associate with coelomocyte membranes, and rSpTrf-E1 binds specifically to phosphatidic acid (PA). When rSpTrf-E1 is bound to PA in liposome membranes, it induces morphological changes in liposomes that correlate with PA clustering and leakage of luminal contents, and it extracts or removes PA from the bilayer. The

Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

International Nuclear Information System (INIS)

Chuang, Jian-Ying; Hung, Jan-Jong

2011-01-01

Highlights: → Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. → Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. → Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

Energy Technology Data Exchange (ETDEWEB)

Chuang, Jian-Ying [Department of Pharmacology, National Cheng-Kung University, Tainan 701, Taiwan (China); Hung, Jan-Jong, E-mail: petehung@mail.ncku.edu.tw [Department of Pharmacology, National Cheng-Kung University, Tainan 701, Taiwan (China); Institute of Bioinformatics and Biosignal Transduction, National Cheng-Kung University, Tainan 701, Taiwan (China)

2011-04-15

Highlights: {yields} Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. {yields} Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. {yields} Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

The production of Pleurotus sajor-caju in peach palm leaves (Bactris gasipaes and evaluation of its use to enrich wheat flour

Directory of Open Access Journals (Sweden)

Paula Fernanda Bomfim Oliveira Cogorni

2014-06-01

Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.

Radioimmunoassay of serum SP 1 and HPL in normal and abnormal pregnancies

International Nuclear Information System (INIS)

Pluta, M.; Hardt, W.; Schmidt-Gollwitzer, K.; Schmidt-Gollwitzer, M.

1979-01-01

Serum concentrations of the pregnancy-specific β 1 -glycoprotein (SP 1) and human placental lactogen (HPL) were measured by radioimmunoassay in 372 blood samples obtained from 40 women in the second half of a normal singleton pregnancy. The mean level of SP 1 steadily increased from 40 μg/ml in the 22nd week of pregnancy to 168 μg/ml in the 36th week of gestation and thereafter reached a plateau. The half-life of SP 1 during the first week after delivery was about 39 h. The clinical value of SP 1 in comparison to HPL estimation was assessed in a prospective study of a few high risk pregnancies. There were no significant differences between serum SP 1 and HPL levels in pregnancies complicated by preeclampsia with or without intrauterine growth retardation and in twin pregnancies. Serum HPL and SP 1 levels were equally effective in predicting placental insufficiency with fetal growth retardation. (orig./AJ) [de

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

OpenAIRE

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

Science.gov (United States)

Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

2007-03-01

Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

Directory of Open Access Journals (Sweden)

Tony Hadibarata

2011-11-01

Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

Directory of Open Access Journals (Sweden)

Isaacs Richard J

2007-05-01

Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

Role of zinc finger structure in nuclear localization of transcription factor Sp1

International Nuclear Information System (INIS)

Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji; Kuwahara, Jun

2009-01-01

Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

[Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

Science.gov (United States)

Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

Science.gov (United States)

Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

2016-03-01

Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

Sp1/Sp3 and DNA-methylation contribute to basal transcriptional activation of human podoplanin in MG63 versus Saos-2 osteoblastic cells

Directory of Open Access Journals (Sweden)

Puri Christina

2007-03-01

Full Text Available Abstract Background Podoplanin is a membrane mucin that, among a series of tissues, is expressed on late osteoblasts and osteocytes. Since recent findings have focussed on podoplanin's potential role as a tumour progression factor, we aimed at identifying regulatory elements conferring PDPN promoter activity. Here, we characterized the molecular mechanism controlling basal PDPN transcription in human osteoblast-like MG63 versus Saos-2 cells. Results We cloned and sequenced 2056 nucleotides from the 5'-flanking region of the PDPN gene and a computational search revealed that the TATA and CAAT box-lacking promoter possesses features of a growth-related gene, such as a GC-rich 5' region and the presence of multiple putative Sp1, AP-4 and NF-1 sites. Reporter gene assays demonstrated a functional promoter in MG63 cells exhibiting 30-fold more activity than in Saos-2 cells. In vitro DNase I footprinting revealed eight protected regions flanked by DNaseI hypersensitive sites within the region bp -728 to -39 present in MG63, but not in Saos-2 cells. Among these regions, mutation and supershift electrophoretic mobility shift assays (EMSA identified four Sp1/Sp3 binding sites and two binding sites for yet unknown transcription factors. Deletion studies demonstrated the functional importance of two Sp1/Sp3 sites for PDPN promoter activity. Overexpression of Sp1 and Sp3 independently increased the stimulatory effect of the promoter and podoplanin mRNA levels in MG63 and Saos-2 cells. In SL2 cells, Sp3 functioned as a repressor, while Sp1 and Sp3 acted positively synergistic. Weak PDPN promoter activity of Saos-2 cells correlated with low Sp1/Sp3 nuclear levels, which was confirmed by Sp1/Sp3 chromatin immunoprecipitations in vivo. Moreover, methylation-sensitive Southern blot analyses and bisulfite sequencing detected strong methylation of CpG sites upstream of bp -464 in MG63 cells, but hypomethylation of these sites in Saos-2 cells. Concomitantly

Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

Science.gov (United States)

Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

2003-01-01

Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

Overexpression of transcription factor Sp1 leads to gene expression perturbations and cell cycle inhibition.

Directory of Open Access Journals (Sweden)

Emmanuelle Deniaud

Full Text Available BACKGROUND: The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. METHODOLOGY AND PRINCIPAL FINDINGS: We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. CONCLUSION: This study shows that the binding to DNA

Sp1 is a transcription repressor to stanniocalcin-1 expression in TSA-treated human colon cancer cells, HT29.

Science.gov (United States)

Law, Alice Y S; Yeung, B H Y; Ching, L Y; Wong, Chris K C

2011-08-01

Our previous study demonstrated that, stanniocalcin-1 (STC1) was a target of histone deacetylase (HDAC) inhibitors and was involved in trichostatin A (TSA) induced apoptosis in the human colon cancer cells, HT29. In this study, we reported that the transcriptional factor, specificity protein 1 (Sp1) in association with retinoblastoma (Rb) repressed STC1 gene transcription in TSA-treated HT29 cells. Our data demonstrated that, a co-treatment of the cells with TSA and Sp1 inhibitor, mithramycin A (MTM) led to a marked synergistic induction of STC1 transcript levels, STC1 promoter (1 kb)-driven luciferase activity and an increase of apoptotic cell population. The knockdown of Sp1 gene expression in TSA treated cells, revealed the repressor role of Sp1 in STC1 transcription. Using a protein phosphatase inhibitor okadaic acid (OKA), an increase of Sp1 hyperphosphorylation and so a reduction of its transcriptional activity, led to a significant induction of STC1 gene expression. Chromatin immunoprecipitation (ChIP) assay revealed that Sp1 binding on STC1 proximal promoter in TSA treated cells. The binding of Sp1 to STC1 promoter was abolished by the co-treatment of MTM or OKA in TSA-treated cells. Re-ChIP assay illustrated that Sp1-mediated inhibition of STC1 transcription was associated with the recruitment of another repressor molecule, Rb. Collectively our findings identify STC1 is a downstream target of Sp1. Copyright © 2011 Wiley-Liss, Inc.

Pengaruh Campuran Ampas Tebu Dan Alang-Alang (Imperata Cylindrica) Sebagai Media Pertumbuhan Terhadap Kandungan Nutrisi Jamur Tiram Putih (Pleurotus Ostreatus)

OpenAIRE

Naila, Ishmatun; Purnomo, Adi Setyo

2016-01-01

Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...

Development of a protocol and catalogue for existing end-use metered data from Canadian utilities

International Nuclear Information System (INIS)

Robillard, P.; Lopes, J.

1994-12-01

Reasons for collection of end-use metering (EUM) data by electrical utilities were cited as: (1) demand-side management (DSM); (2) class end-use load research; (3) technology assessment; and (4) marketing and customer support. The emergence of DSM evaluation has served to focus on EUM as a strategic tool. The combination of DSM- related load research and other load data requirements has resulted in diverse means of end-use data collection, most of them involving frequent data collection. EUM technology was considered costly, and time consuming to implement. Also, the intrusive character of EUM can sometimes strain customer relations. Electric utilities were found to be interested in pursuing options for sharing of EUM data. An expert service function should be developed to provide EUM study design, implementation, and data analysis services to participating utilities. A planning process for coordinating projects among utilities was recommended to reduce single party costs. Organizational mechanisms for providing EUM services were identified. A number of recommendations were made directed toward the CEA for the realization of an EUM service

Sp1 transcriptional activity is up-regulated by phosphatase 2A in dividing T lymphocytes.

Science.gov (United States)

Lacroix, Isabelle; Lipcey, Carol; Imbert, Jean; Kahn-Perlès, Brigitte

2002-03-15

We have followed Sp1 expression in primary human T lymphocytes induced, via CD2 plus CD28 costimulation, to sustained proliferation and subsequent return to quiescence. Binding of Sp1 to wheat germ agglutinin lectin was not modified following activation, indicating that the overall glycosylation of the protein was unchanged. Sp1 underwent, instead, a major dephosphorylation that correlated with cyclin A expression and, thus, with cell cycle progression. A similar change was observed in T cells that re-entered cell cycle following secondary interleukin-2 stimulation, as well as in serum-induced proliferating NIH/3T3 fibroblasts. Phosphatase 2A (PP2A) appears involved because 1) treatment of dividing cells with okadaic acid or cantharidin inhibited Sp1 dephosphorylation and 2) PP2A dephosphorylated Sp1 in vitro and strongly interacted with Sp1 in vivo. Sp1 dephosphorylation is likely to increase its transcriptional activity because PP2A overexpression potentiated Sp1 site-driven chloramphenicol acetyltransferase expression in dividing Kit225 T cells and okadaic acid reversed this effect. This increase might be mediated by a stronger affinity of dephosphorylated Sp1 for DNA, as illustrated by the reduced DNA occupancy by hyperphosphorylated Sp factors from cantharidin- or nocodazole-treated cells. Finally, Sp1 dephosphorylation appears to occur throughout cell cycle except for mitosis, a likely common feature to all cycling cells.

Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

Science.gov (United States)

Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

2012-10-01

Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

Characterization of the human Activin-A receptor type II-like kinase 1 (ACVRL1 promoter and its regulation by Sp1

Directory of Open Access Journals (Sweden)

Botella Luisa M

2010-06-01

Full Text Available Abstract Background Activin receptor-like kinase 1 (ALK1 is a Transforming Growth Factor-β (TGF-β receptor type I, mainly expressed in endothelial cells that plays a pivotal role in vascular remodelling and angiogenesis. Mutations in the ALK1 gene (ACVRL1 give rise to Hereditary Haemorrhagic Telangiectasia, a dominant autosomal vascular dysplasia caused by a haploinsufficiency mechanism. In spite of its patho-physiological relevance, little is known about the transcriptional regulation of ACVRL1. Here, we have studied the different origins of ACVRL1 transcription, we have analyzed in silico its 5'-proximal promoter sequence and we have characterized the role of Sp1 in the transcriptional regulation of ACVRL1. Results We have performed a 5'Rapid Amplification of cDNA Ends (5'RACE of ACVRL1 transcripts, finding two new transcriptional origins, upstream of the one previously described, that give rise to a new exon undiscovered to date. The 5'-proximal promoter region of ACVRL1 (-1,035/+210 was analyzed in silico, finding that it lacks TATA/CAAT boxes, but contains a remarkably high number of GC-rich Sp1 consensus sites. In cells lacking Sp1, ACVRL1 promoter reporters did not present any significant transcriptional activity, whereas increasing concentrations of Sp1 triggered a dose-dependent stimulation of its transcription. Moreover, silencing Sp1 in HEK293T cells resulted in a marked decrease of ACVRL1 transcriptional activity. Chromatin immunoprecipitation assays demonstrated multiple Sp1 binding sites along the proximal promoter region of ACVRL1 in endothelial cells. Furthermore, demethylation of CpG islands, led to an increase in ACVRL1 transcription, whereas in vitro hypermethylation resulted in the abolishment of Sp1-dependent transcriptional activation of ACVRL1. Conclusions Our results describe two new transcriptional start sites in ACVRL1 gene, and indicate that Sp1 is a key regulator of ACVRL1 transcription, providing new insights into

Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells

Directory of Open Access Journals (Sweden)

Ennion Steven J

2006-03-01

Full Text Available Abstract Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and

Evidence for cooperative mineralization of diuron by Arthrobacter sp. BS2 and Achromobacter sp. SP1 isolated from a mixed culture enriched from diuron exposed environments.

Science.gov (United States)

Devers-Lamrani, Marion; Pesce, Stéphane; Rouard, Nadine; Martin-Laurent, Fabrice

2014-12-01

Diuron was found to be mineralized in buffer strip soil (BS) and in the sediments (SED) of the Morcille river in the Beaujolais vineyard repeatedly treated with this herbicide. Enrichment cultures from BS and SED samples led to the isolation of three bacterial strains transforming diuron to 3,4-dichloroaniline (3,4-DCA) its aniline derivative. 16S rRNA sequencing revealed that they belonged to the genus Arthrobacter (99% of similarity to Arthrobacter globiformis strain K01-01) and were designated as Arthrobacter sp. BS1, BS2 and SED1. Diuron-degrading potential characterized by sequencing of the puhA gene, characterizing the diuron-degradaing potential, revealed 99% similarity to A. globiformis strain D47 puhA gene isolated a decade ago in the UK. These isolates were also able to use chlorotoluron for their growth. Although able to degrade linuron and monolinuron to related aniline derivatives they were not growing on them. Enrichment cultures led to the isolation of a strain from the sediments entirely degrading 3,4-DCA. 16S rRNA sequence analysis showed that it was affiliated to the genus Achromobacter (99% of similarity to Achromobacter sp. CH1) and was designated as Achromobacter sp. SP1. The dcaQ gene encoding enzyme responsible for the transformation of 3,4-DCA to chlorocatechol was found in SP1 with 99% similarity to that of Comamonas testosteroni WDL7. This isolate also used for its growth a range of anilines (3-chloro-4-methyl-aniline, 4-isopropylaniline, 4-chloroaniline, 3-chloroaniline, 4-bromoaniline). The mixed culture composed of BS2 and SP1 strains entirely mineralizes (14)C-diuron to (14)CO2. Diuron-mineralization observed in the enrichment culture could result from the metabolic cooperation between these two populations. Copyright © 2014. Published by Elsevier Ltd.

DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

Directory of Open Access Journals (Sweden)

Hamid Akbarirad

2013-06-01

Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

On the Role of the SP1 Domain in HIV-1 Particle Assembly: a Molecular Switch?▿

Science.gov (United States)

Datta, Siddhartha A. K.; Temeselew, Lakew G.; Crist, Rachael M.; Soheilian, Ferri; Kamata, Anne; Mirro, Jane; Harvin, Demetria; Nagashima, Kunio; Cachau, Raul E.; Rein, Alan

2011-01-01

Expression of a retroviral protein, Gag, in mammalian cells is sufficient for assembly of immature virus-like particles (VLPs). VLP assembly is mediated largely by interactions between the capsid (CA) domains of Gag molecules but is facilitated by binding of the nucleocapsid (NC) domain to nucleic acid. We have investigated the role of SP1, a spacer between CA and NC in HIV-1 Gag, in VLP assembly. Mutational analysis showed that even subtle changes in the first 4 residues of SP1 destroy the ability of Gag to assemble correctly, frequently leading to formation of tubes or other misassembled structures rather than proper VLPs. We also studied the conformation of the CA-SP1 junction region in solution, using both molecular dynamics simulations and circular dichroism. Consonant with nuclear magnetic resonance (NMR) studies from other laboratories, we found that SP1 is nearly unstructured in aqueous solution but undergoes a concerted change to an α-helical conformation when the polarity of the environment is reduced by addition of dimethyl sulfoxide (DMSO), trifluoroethanol, or ethanol. Remarkably, such a coil-to-helix transition is also recapitulated in an aqueous medium at high peptide concentrations. The exquisite sensitivity of SP1 to mutational changes and its ability to undergo a concentration-dependent structural transition raise the possibility that SP1 could act as a molecular switch to prime HIV-1 Gag for VLP assembly. We suggest that changes in the local environment of SP1 when Gag oligomerizes on nucleic acid might trigger this switch. PMID:21325421

Cytosine methylation does not affect binding of transcription factor Sp1

International Nuclear Information System (INIS)

Harrington, M.A.; Jones, P.A.; Imagawa, M.; Karin, M.

1988-01-01

DNA methylation may be a component of a multilevel control mechanism that regulates eukaryotic gene expression. The authors used synthetic oligonucleotides to investigate the effect of cytosine methylation on the binding of the transcription factor Sp1 to its target sequence (a G+C-rich sequence known as a GC box). Concatemers of double-stranded 14-mers containing a GC box successfully competed with the human metallothionein IIA promoter for binding to Sp1 in DNase I protection experiments. The presence of 5-methylcytosine in the CpG sequence of the GC box did not influence Sp1 binding. The result was confirmed using double-stranded 20-mers containing 16 base pairs of complementary sequence. Electrophoretic gel retardation analysis of annealed 28-mers containing a GC box incubated with an Sp1-containing HeLa cell nuclear extract demonstrated the formation of DNA-protein complexes; formation of these complexes was not inhibited when an oligomer without a GC box was used as a competitor. Once again, the presence of a 5-methylcytosine residue in the GC box did not influence the binding of the protein to DNA. The results therefore preclude a direct effect of cytosine methylation on Sp1-DNA interactions

Bioactive metabolites produced by Penicillium sp. 1 and sp. 2, two endophytes associated with Alibertia macrophylla (Rubiaceae).

Science.gov (United States)

Oliveira, Camila M; Silva, Geraldo H; Regasini, Luis O; Zanardi, Lisinéia M; Evangelista, Alana H; Young, Maria C M; Bolzani, Vanderlan S; Araujo, Angela R

2009-01-01

In the course of our continuous search for bioactive metabolites from endophytic fungi living in plants from the Brazilian flora, leaves of Alibertia macrophylla (Rubiaceae) were submitted to isolation of endophytes, and two species of Penicillium were isolated. The acetonitrile fraction obtained in corn from a culture of Penicillium sp. 1 afforded orcinol (1). On the other hand, Penicillium sp. 1 cultivated in potato-dextrose-broth furnished two different compounds, cyclo-(L-Pro-L-Val) (2) and uracil (3). The chromatographic fractionation of the acetonitrile fraction obtained from Penicillium sp. 2 led to three dihydroisocoumarins, 4-hydroxymellein (4), 8-methoxymellein (5) and 5-hydroxymellein (6). Compounds 5 and 6 were obtained from the Penicillium genus for the first time. Additionally, metabolites 1-6 were evaluated for their antifungal and acetylcholinesterase (AChE) inhibitory activities. The most active compounds 1 and 4 exhibited detection limits of 5.00 and 10.0 microg against Cladosporium cladosporioides and C. sphaerospermum, respectively. Compound 2 showed a detection limit of 10.0 microg, displaying potent AChE inhibitory activity.

Monoclonal antibodies against pregnancy-specific β1-glycoprotein (SP1) in immunohistochemistry and radioimmunoassay

International Nuclear Information System (INIS)

Wahlstroem, T.; Heikinheimo, M.

1983-01-01

Monoclonal mouse antibodies against pregnancy-specific beta-1-glycoprotein (SP 1 ) have been studied for their suitability in immunoperoxidase staining and radioimmunoassay methodologies. These antibodies were useful in staining normal placentas, hydatidiform moles, invasive moles and choriocarcinomas. They showed good specificity, with minimal background staining, and will thus be superior to conventional polyclonal antisera in immunohistochemistry. However, the presently tested monoclonal anti-SP 1 antibodies were found not to be suitable for radioimmunoassay. (Auth.)

Sp1-CD147 positive feedback loop promotes the invasion ability of ovarian cancer.

Science.gov (United States)

Zhao, Jing; Ye, Wei; Wu, Juan; Liu, Lijuan; Yang, Lina; Gao, Lu; Chen, Biliang; Zhang, Fanglin; Yang, Hong; Li, Yu

2015-07-01

CD147 is a novel cancer biomarker that has been confirmed to be overexpressed in ovarian carcinoma, which is significantly associated with poor prognosis. Although the Sp1 protein regulates the expression level of CD147, it remains unclear whether Sp1 phosphorylation plays a role in this regulation. A dual-luciferase assay revealed that T453 and T739 mutations decreased the activity of Sp1 binding to the promoter of CD147, followed by a decrease in CD147 mRNA and protein expression. Western blot analysis showed that CD147 promoted Sp1 phosphorylation at T453 and T739 through the PI3K/AKT and MAPK/ERK pathways. In addition, blocking the Sp1-CD147 positive feedback loop reduced the invasion ability of HO-8910pm cells. Immunohistochemical staining showed that the components of the feedback loop were overexpressed in ovarian cancer tissues. The correlation analysis revealed a significant correlation between phospho-Sp1 (T453), phospho-Sp1 (T739) and CD147 expression levels, with correlation coefficients of r=0.477 and r=0.461, respectively. Collectively, our results suggest that a Sp1-CD147 positive feedback loop plays a critical role in the invasion ability of ovarian cancer cells.

Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

Directory of Open Access Journals (Sweden)

Ahmed I. El-Batal

2015-03-01

Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

Effect of tea saponin on ephyrae and polyps of the moon jellyfish Aurelia sp.1.

Directory of Open Access Journals (Sweden)

Zhijun Dong

Full Text Available The moon jellyfish (Aurelia sp.1 is thought to be a nuisance for the sea cucumber aquaculture, which commonly occur in the sea cucumber (Apostichopus japonicus culture ponds of the Yellow Sea, China. To develop an appropriate method to control Aurelia sp.1 blooms, the toxic effects of tea saponin on Aurelia sp.1 ephyrae and polyps were tested in laboratory experiments. Our results revealed that tea saponin caused significant morphological changes, behavioral abnormality and mortality in Aurelia sp.1 ephyrae and polyps in 24 h and 48 h exposure experiments. The 24 h and 48 h median lethal concentrations (LC50 values of tea saponin for Aurelia sp.1 ephyrae were 1.9 and 1.1 mg L-1 respectively, while the LC50 value for Aurelia sp.1 polyps was 0.4 mg L-1 after 24h and 48 h of exposure to tea saponin. Comparison with literature results of tea saponin on A. japonicus indicates that the resistance of A. japonicus to tea saponin is 12-18 times greater than that of Aurelia sp.1 ephyrae. Therefore, the appropriate tea saponin dosage for the control of Aurelia sp.1 should be paid enough attention in order to minimize possible damage for sea cucumber. We suggest that the recommended level of tea saponin to eradicate Aurelia sp.1 ephyrae and polyps in sea cucumber culture ponds be lower than 1.35 mg L-1.

Effect of tea saponin on ephyrae and polyps of the moon jellyfish Aurelia sp.1.

Science.gov (United States)

Dong, Zhijun; Sun, Tingting; Liang, Likun; Wang, Lei

2017-01-01

The moon jellyfish (Aurelia sp.1) is thought to be a nuisance for the sea cucumber aquaculture, which commonly occur in the sea cucumber (Apostichopus japonicus) culture ponds of the Yellow Sea, China. To develop an appropriate method to control Aurelia sp.1 blooms, the toxic effects of tea saponin on Aurelia sp.1 ephyrae and polyps were tested in laboratory experiments. Our results revealed that tea saponin caused significant morphological changes, behavioral abnormality and mortality in Aurelia sp.1 ephyrae and polyps in 24 h and 48 h exposure experiments. The 24 h and 48 h median lethal concentrations (LC50) values of tea saponin for Aurelia sp.1 ephyrae were 1.9 and 1.1 mg L-1 respectively, while the LC50 value for Aurelia sp.1 polyps was 0.4 mg L-1 after 24h and 48 h of exposure to tea saponin. Comparison with literature results of tea saponin on A. japonicus indicates that the resistance of A. japonicus to tea saponin is 12-18 times greater than that of Aurelia sp.1 ephyrae. Therefore, the appropriate tea saponin dosage for the control of Aurelia sp.1 should be paid enough attention in order to minimize possible damage for sea cucumber. We suggest that the recommended level of tea saponin to eradicate Aurelia sp.1 ephyrae and polyps in sea cucumber culture ponds be lower than 1.35 mg L-1.

The potential of Pleurotus-treated olive mill solid waste as cattle feed.

Science.gov (United States)

Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

2009-12-01

The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

Directory of Open Access Journals (Sweden)

Cristina Ramos

2011-01-01

Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

Domestic wastewater treatment and biofuel production by using microalga Scenedesmus sp. ZTY1.

Science.gov (United States)

Zhang, Tian-Yuan; Wu, Yin-Hu; Hu, Hong-Ying

2014-01-01

Cultivation of microalgae for biomass production is a promising way to dispose of wastewater and recover nutrients simultaneously. The properties of nutrient removal and biomass production in domestic wastewater of a newly isolated microalga Scenedesmus sp. ZTY1 were investigated in this study. Scenedesmus sp. ZTY1, which was isolated from a wastewater treatment plant in Beijing, grew well in both the primary and secondary effluents of a wastewater treatment plant during the 21-day cultivation, with a maximal algal density of 3.6 × 10(6) and 1.9 × 10(6) cells · mL(-1), respectively. The total phosphorus concentrations in both effluents could be efficiently removed by over 97% after the cultivation. A high removal rate (over 90%) of total nitrogen (TN) was also observed. After cultivation in primary effluent for 21 days, the lipid content of Scenedesmus sp. ZTY1 in dry weight had reached about 32.2%. The lipid and triacylglycerol (TAG) production of Scenedesmus sp. ZTY1 was increased significantly with the extension of cultivation time. The TAG production of Scenedesmus sp. ZTY1 increased from 32 mg L(-1) at 21 d to 148 mg L(-1) at 45 d in primary effluent. All the experiments were carried out in non-sterilized domestic wastewater and Scenedesmus sp. ZTY1 showed good adaptability to the domestic wastewater environment.

Avaliação do cultivo de Pleurotus sajor-caju (fries sing. sobre o resíduo de algodão da industria têxtil para a produção de cogumelos e para alimentação animal Evaluation of the cultivation of Pleurotus sajor-caju (fries sing. on cotton textile mill waste for mushroom production and animal feeding

Directory of Open Access Journals (Sweden)

Clenderson Corradi de Mattos Gonçalves

2010-02-01

Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste

Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

Directory of Open Access Journals (Sweden)

Nelson Menolli Junior

2010-04-01

Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

Degradation of Green Polyethylene by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

Degradation of Green Polyethylene by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

2015-01-01

We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

Directory of Open Access Journals (Sweden)

Akpaja EO

2012-02-01

Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

Science.gov (United States)

Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

2008-07-01

Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

Cultivation of Pleurotus ostreatus and other edible mushrooms.

Science.gov (United States)

Sánchez, Carmen

2010-02-01

Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

Bojesodok-eum, a Herbal Prescription, Ameliorates Acute Inflammation in Association with the Inhibition of NF-κB-Mediated Nitric Oxide and ProInflammatory Cytokine Production

Directory of Open Access Journals (Sweden)

Kook Ho Sohn

2012-01-01

Full Text Available Bojesodok-eum (BSE is a herbal prescription consisting of Coptidis Rhizoma and Scutellariae Radix as main components. This paper investigated the effects of BSE on the induction of nitric oxide (NO, prostaglandin E2 (PGE2, and proinflammatory cytokines that are caused by lipopolysaccharide (LPS in murine macrophage cell line and on the paw edema formation in animals. Administration of BSE (0.3 g/kg and 1 g/kg in rats significantly inhibited carrageenan-induced paw edema formation, as did dexamethasone, an anti-inflammatory positive control drug. In cell model, treatment of BSE decreased the production of NO and PGE2 in RAW264.7 cells stimulated by LPS. BSE also inhibited the expression of iNOS and COX-2 protein as well as COX activity in a concentration-dependent manner. Consistently, BSE suppressed the ability of LPS to produce TNF-α, interleukin-1β, and interleukin-6. LPS treatment induced nuclear NF-κB level and I-κBα phosphorylation, which were inhibited subsequent treatment of BSE, suggesting its repression of LPS-inducible NF-κB activation. BSE abrogated the induction of NO, PGE2, and proinflammatory cytokines, as well as iNOS and COX-2 protein expression in RAW264.7 cells stimulated by LPS as mediated with NF-κB inhibition.

Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

International Nuclear Information System (INIS)

Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

2005-01-01

A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

Molecular cloning, characterization and antigenicity of Babesia sp. BQ1 (Lintan) (Babesia cf. motasi) apical membrane antigen-1 (AMA-1).

Science.gov (United States)

Niu, Qingli; Liu, Zhijie; Yang, Jifei; Guan, Guiquan; Pan, Yuping; Luo, Jianxun; Yin, Hong

2017-04-01

Apical membrane antigen-1 (AMA-1) has been described as a potential vaccine candidate in apicomplexan parasites. Here we characterize the ama-1 gene. The full-length ama-1 gene of Babesia sp. BQ1 (Lintan) (BLTAMA-1) is 1785 bp, which contains an open reading frame (ORF) encoding a 65-kDa protein of 594 amino acid residues; by definition, the 5' UTR precedes the first methionine of the ORF. Phylogenetic analysis based on AMA-1 amino acid sequences clearly separated Piroplasmida from other Apicomplexa parasites. The Babesia sp. BQ1 (Lintan) AMA-1 sequence is most closely associated with that of B. ovata and B. bigemina, with high bootstrap value. A recombinant protein encoding a conserved region and containing ectodomains I and II of BLTAMA-1 was constructed. BLTrAMA-1-DI/DII proteins were tested for reactivity with sera from sheep infected by Babesia sp. BQ1 (Lintan). In Western-blot analysis, native Babesia sp. BQ1 (Lintan) AMA-1 proteins were recognized by antibodies raised in rabbits against BLTrAMA-1 in vitro. The results of this study are discussed in terms of gene characterization, taxonomy and antigenicity.

Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone.

Science.gov (United States)

Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke

2008-11-28

TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

Experimental in vitro transmission of Babesia sp. (EU1) by Ixodes ricinus.

Science.gov (United States)

Bonnet, Sarah; Brisseau, Nadine; Hermouet, Axelle; Jouglin, Maggy; Chauvin, Alain

2009-01-01

Babesia sp. (EU1), first characterized in 2003, has been implicated in human cases of babesiosis in Italy, Austria and Germany. It has been identified in roe deer and in its suspected tick vector, Ixodes ricinus, in several European countries. The aim of the present study was to validate the competence of I. ricinus as a vector of Babesia sp. (EU1) via experimental infections. For this purpose, a parasite strain isolated from roe deer was cloned in sheep erythrocytes. After experimental infections, parasite DNA was successfully amplified by PCR in both eggs and larvae originating from infected I. ricinus females and in the salivary glands of females exposed to Babesia sp. (EU1) as nymphs. We also demonstrate that infected females were able to transmit parasite DNA during a new blood meal. Together with previous epidemiological studies, these results validate I. ricinus as a competent vector for Babesia sp. (EU1).

Merozoite proteins from Babesia sp. BQ1 (Lintan) as potential antigens for serodiagnosis by ELISA.

Science.gov (United States)

Guan, G Q; Chauvin, A; Rogniaux, H; Luo, J X; Yin, H; Moreau, E

2010-05-01

Babesia sp. BQ1 (Lintan) is a Babesia isolated from sheep infested with Haemaphysalis qinghaiensis in China, and is closely related to B. motasi based on the 18S rRNA gene sequence. In the present study, an ELISA was developed with merozoite antigens of Babesia sp. BQ1 (Lintan) (BQMA) purified from in vitro culture. When the positive threshold was chosen as 30% of the antibodies rate, evaluated with 198 negative sera, the specificity was 95.5%. Except for Babesia sp. Tianzhu, there was no cross-reaction between BQMA and positive sera from Babesia sp. BQ1 (Ningxian)-, Babesia sp. Hebei-, Babesia sp. Xinjiang-, Theileria luwenshuni-, T. uilenbergi-, or Anaplasma ovis-infected sheep, which are the dominant haemoparasites of small ruminants in China. Specific antibodies against Babesia sp. BQ1 (Lintan) were produced 1 or 2 weeks post-infection and a high level of antibodies persisted for more than 8 months in experimentally infected sheep. This ELISA was tested on 974 sera collected from field-grazing sheep in 3 counties of Gansu province, northwestern China to evaluate the seroprevalence of Babesia sp. BQ1 (Lintan) infection and the average positive rate was 66.84%. The feasibility of increasing the specificity of this BQMA-based ELISA, by using some BQMA antigens for serodiagnosis is discussed.

Methyl (Sp-2-(diphenylphosphinoferrocene-1-carboxylate

Directory of Open Access Journals (Sweden)

Petr Štěpnička

2009-10-01

Full Text Available The title compound, [Fe(C5H5(C19H16O2P], obtained serendipitously during recrystallization of 1-hydroxybenzotriazolyl (Sp-2-(diphenylphosphinoferrocene-1-carboxylate from methanol, crystallizes in the chiral space group P212121. Its crystal structure not only confirms the anticipated absolute configuration but also establishes a rather regular geometry for the ferrocene unit, devoid of any significant deformation due to the attached substituents. In the crystal, symmetry-related molecules are linked via weak C—H...O interactions.

Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

Science.gov (United States)

Guan, Qinlan; Gong, Mingfu; Tang, Mei

2018-04-01

The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

OpenAIRE

Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

2011-01-01

A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

Directory of Open Access Journals (Sweden)

Alfonso Soto-Sánchez

2015-09-01

Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Kátia Maria Gomes Machado

2006-12-01

Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

Biological effects of space flight on SP{sub 1} traits of fenugreek

Energy Technology Data Exchange (ETDEWEB)

Rong, Xu; Jing, Yu; Jiang, Xu; Feng, Zhou; Jun, Chen [The Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Beijing Union Medical College, Beijing (China); Yougang, Liu [Tianjin Univ. of Traditional Chinese Medicine, Tianjin (China); Suqin, Sun [Department of Chemistry, Tsinghua Univ., Beijing (China)

2009-04-15

Fenugreek (Trigonella Foenum-graecum L.) seeds introduced from United Arab Emirates (UAE) were carried to the space by the recoverable satellite 'Shi Jian 8'. After space loading, the seeds were planted to be observed and investigated compared to the control group. The results showed that the germination rate declined after space loading compared to the control group. SP{sub 1} plants grew inhibited first, and then vigorously later at the seedling stage. The branch number, pods and plant weight of SP{sub 1} plants' increased. More important, single pod was changed to dual pod. At the same time, the Fourier transform infrared spectroscopy (FT-IR) was used to analyze and appraise the fenugreek SP{sub 1} seeds. The results indicated that the major components and the structures remained intact, in another word, space mutation had no obvious effect on the quality of SP{sub 1} seeds. Based on the results, some variations mutated by space flight could appear at the present generation. These variations were important to gain high yield. (authors)

Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.

Science.gov (United States)

Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z

2011-02-01

A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.

[Biofilm Formation by the Nonflagellated flhB1 Mutant of Azospirillum brasilense Sp245].

Science.gov (United States)

Shelud'ko, A V; Filip'echeva, Yu A; Shumiliva, E M; Khlebtsov, B N; Burov, A M; Petrova, L P; Katsy, E I

2015-01-01

Azospirillum brasilense Sp245 with mixed flagellation are able to form biofilms on various surfaces. A nonflagellated mutant of this strain with inactivated chromosomal copy of the flhB gene (flhB1) was shown to exhibit specific traits at the later stages of biofilm formation on a hydrophilic (glass) surface. Mature biofilms of the flhB1::Omegon-Km mutant Sp245.1063 were considerably thinner than those of the parent strain Sp245. The biofilms of the mutant were more susceptible to the forces of hydrodynamic shear. A. brasilense Sp245 cells in biofilms were not found to possess lateral flagella. Cells with polar flagella were, however, revealed by atomic force microscopy of mature native biofilms of strain Sp245. Preservation of a polar flagellum (probably nonmotile) on the cells of A. brasilense Sp245 may enhance the biofilm stability.

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

Science.gov (United States)

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

IL LIBRO D’ORO DI ARISTOMACHE: UNA NOTIZIA ANTIQUARIA IN PLUTARCO (MOR. 675 B E UN FRAMMENTO DI EPOS CORINTIO (EUM. FR. 8 BERNABÉ

Directory of Open Access Journals (Sweden)

Roberto Capel Badino

2014-09-01

Full Text Available Discutendo un problema cronologico in merito all’inclusione di gare poetiche nel contesto dei festival panellenici, Plutarco (mor. 675 b riferisce – sull’autorità di Polemone, scrittore antiquario (fr. 27 Preller – informazioni circa un libro d’oro offerto come ex voto nel tesoro dei Sicionii a Delfi dalla sconosciuta figura di Aristomache, vincitrice all’Istmo.Lo studio discute alcuni problemi riguardo al testo di Plutarco – pubblicato con un nuovo apparato critico, la natura dell’ex voto e l’identità di Aristomache. Poiché non c’è notizia di agoni poetici a Corinto prima della fine del IV sec. a.C., con maggiore coerenza rispetto al ragionamento di Plutarco, Aristomache può essere considerata una figura leggendaria assimilabile a una Sibilla. Il frammento di Polemone può essere confrontato con Eum. fr. 8 Bernabé (Favor. Corinth. 13, p. 305.8 Barigazzi, un frammento di un’opera epica, dove una Sibilla, parlando in prima persona, fornisce una tradizione corintia circa l’origine delle Istmie.

Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

Science.gov (United States)

Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

2002-11-01

We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.

25-hydroxycholesterol promotes RANKL-induced osteoclastogenesis through coordinating NFATc1 and Sp1 complex in the transcription of miR-139-5p

International Nuclear Information System (INIS)

Zhang, Lishan; Lv, Yinping; Xian, Guozhe; Lin, Yanliang

2017-01-01

25-hydroxycholesterol (25-HC) is implicated in many processes, including lipid metabolism and the immune response. However, the role of 25-HC in RANKL-induced osteoclastogenesis remains largely unknown. Our results showed that 25-HC inhibited miR-139-5p expression in mouse bone marrow macrophages (BMMs) cultured in receptor activator of NF-κB ligand (RANKL) and monocyte macrophage colony-stimulating factor (M-CSF). Further investigation suggested that 25-HC promoted the expression of nuclear factor of activated T cell cytoplasmic 1 (NFATc1) and Sp1, especially in the presence of RANKL and M-CSF. Meanwhile, 25-HC induced nuclear translocation of NFATc1, resulting in the interaction between NFATc1 and Sp1 that was confirmed by co-immunoprecipitation. Chromatin immunoprecipitation assay indicated that Sp1 could bind to miR-139-5p promoter, but NFATc1 had no binding capacity. Although forming NFATc1/Sp1 complex increased its binding to miR-139-5p promoter, the complex inhibited the transcriptional activity of Sp1. Inhibition of NFATc1 increase the expression of miR-139-5p, which might be due to the release of free Sp1 that could bind to the promoter of miR-139-5p. Enforced expression of miR-139-5p impaired osteoclastogenesis induced by co-treatment with 25-HC and RANKL. These results suggested that 25-HC induced the interaction between NFATc1 and Sp1, reducing the level of free Sp1 to inhibit miR-139-5p expression and promote osteoclastogenesis. - Highlights: • 25-hydroxycholesterol inhibited miR-139-5p expression in bone marrow macrophages. • 25-hydroxycholesterol promoted the expression of NFATc1 and Sp1. • 25-hydroxycholesterol induced the interaction between NFATc1 and Sp1. • NFATc1/Sp1 complex inhibited the transcription of miR-139-5p. • MiR-139-5p impaired osteoclastogenesis induced by 25-hydroxycholesterol and RANKL.

Butyric acid production from red algae by a newly isolated Clostridium sp. S1.

Science.gov (United States)

Lee, Kyung Min; Choi, Okkyoung; Kim, Ki-Yeon; Woo, Han Min; Kim, Yunje; Han, Sung Ok; Sang, Byoung-In; Um, Youngsoon

2015-09-01

To produce butyric acid from red algae such as Gelidium amansii in which galactose is a main carbohydrate, microorganisms utilizing galactose and tolerating inhibitors in hydrolysis including levulinic acid and 5-hydroxymethylfurfural (HMF) are required. A newly isolated bacterium, Clostridium sp. S1 produced butyric acid not only from galactose as the sole carbon source but also from a mixture of galactose and glucose through simultaneous utilization. Notably, Clostridium sp. S1 produced butyric acid and a small amount of acetic acid with the butyrate:acetate ratio of 45.4:1 and it even converted acetate to butyric acid. Clostridium sp. S1 tolerated 0.5-2 g levulinic acid/l and recovered from HMF inhibition at 0.6-2.5 g/l, resulting in 85-92% butyric acid concentration of the control culture. When acid-pretreated G. amansii hydrolysate was used, Clostridium sp. S1 produced 4.83 g butyric acid/l from 10 g galactose/l and 1 g glucose/l. Clostridium sp. S1 produces butyric acid from red algae due to its characteristics in sugar utilization and tolerance to inhibitors, demonstrating its advantage as a red algae-utilizing microorganism.

Utilização do composto exaurido de Pleurotus sajor caju em rações de frangos de corte e seus efeitos no desempenho dessas aves - DOI: 10.4025/actascianimsci.v31i2.4811 Utilization of the spent substrate of Pleurotus sajor caju mushroom in broiler chicks ration and the effect on broiler chicken performance - DOI: 10.4025/actascianimsci.v31i2.4811

Directory of Open Access Journals (Sweden)

Antônio Gilberto Bertechini

2009-08-01

Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and

Quantitative approach to track lipase producing Pseudomonas sp. S1 in nonsterilized solid state fermentation.

Science.gov (United States)

Sahoo, R K; Subudhi, E; Kumar, M

2014-06-01

Proliferation of the inoculated Pseudomonas sp. S1 is quantitatively evaluated using ERIC-PCR during the production of lipase in nonsterile solid state fermentation an approach to reduce the cost of enzyme production. Under nonsterile solid state fermentation with olive oil cake, Pseudomonas sp. S1 produced 57·9 IU g(-1) of lipase. DNA fingerprints of unknown bacterial isolates obtained on Bushnell Haas agar (BHA) + tributyrin exactly matched with that of Pseudomonas sp. S1. Using PCR-based enumeration, population of Pseudomonas sp. S1 was proliferated from 7·6 × 10(4) CFU g(-1) after 24 h to 4·6 × 10(8) CFU g(-1) after 96 h, which tallied with the maximum lipase activity as compared to control. Under submerged fermentation (SmF), Pseudomonas sp. S1 produced maximum lipase (49 IU ml(-1) ) using olive oil as substrate, while lipase production was 9·754 IU ml(-1) when Pseudomonas sp. S1 was grown on tributyrin. Optimum pH and temperature of the crude lipase was 7·0 and 50°C. Crude enzyme activity was 71·2% stable at 50°C for 360 min. Pseudomonas sp. S1 lipase was also stable in methanol showing 91·6% activity in the presence of 15% methanol, whereas 75·5 and 51·1% of activity were retained in the presence of 20 and 30% methanol, respectively. Thus, lipase produced by Pseudomonas sp. S1 is suitable for the production of biodiesel as well as treatment of oily waste water. This study presents the first report on the production of thermophilic organic solvent tolerant lipase using agro-industry waste in nonsterile solid state fermentation. Positive correlation between survival of Pseudomonas sp. S1 and lipase production under nonsterile solid state fermentation was established, which may emphasize the need to combine molecular tools and solid state fermentation in future studies. Our study brings new insights into the lipase production in cost-effective manner, which is an industrially relevant approach. © 2014 The Society for Applied Microbiology.

Overexpression of the transcription factor Sp1 activates the OAS-RNAse L-RIG-I pathway.

Directory of Open Access Journals (Sweden)

Valéryane Dupuis-Maurin

Full Text Available Deregulated expression of oncogenes or transcription factors such as specificity protein 1 (Sp1 is observed in many human cancers and plays a role in tumor maintenance. Paradoxically in untransformed cells, Sp1 overexpression induces late apoptosis but the early intrinsic response is poorly characterized. In the present work, we studied increased Sp1 level consequences in untransformed cells and showed that it turns on an early innate immune transcriptome. Sp1 overexpression does not activate known cellular stress pathways such as DNA damage response or endoplasmic reticulum stress, but induces the activation of the OAS-RNase L pathway and the generation of small self-RNAs, leading to the upregulation of genes of the antiviral RIG-I pathway at the transcriptional and translational levels. Finally, Sp1-induced intrinsic innate immune response leads to the production of the chemokine CXCL4 and to the recruitment of inflammatory cells in vitro and in vivo. Altogether our results showed that increased Sp1 level in untransformed cells constitutes a novel danger signal sensed by the OAS-RNase L axis leading to the activation of the RIG-I pathway. These results suggested that the OAS-RNase L-RIG-I pathway may be activated in sterile condition in absence of pathogen.

INTERAKSI ANTARA Trichoderma Harzianum, Penicillium SP. DAN Pseudomonas SP. SERTA KAPASITAS ANTAGONISMENYA TERHADAP Phytophthora CapsicilN VITRO*[Interaction Among Trichoderma Harzianum, Penicillium SP., Pseudomonas SP. and Antagonism Capacities Against Phy

OpenAIRE

Suharna, Nandang

2003-01-01

A preliminary study has been done to know antagonism capacities of three isolates of Trichoderma harzianum, two isolates of Penicillium sp.and one isolate of Pseudomonas sp.against Phytophthora capsici in vitro and interaction among those six antagonists.The highest antagonism capacity possessed by Penicillium sp. KN1, respectively followed by Penicillium sp.KN2,Pseudomonas sp. GH1 and the three T. harzianum isolates. Except for those three T. harzianum isolates, the two Penicillium sp.isolat...

The 10 sea urchin receptor for egg jelly proteins (SpREJ are members of the polycystic kidney disease-1 (PKD1 family

Directory of Open Access Journals (Sweden)

Miyata Shinji

2007-07-01

Full Text Available Abstract Background Mutations in the human polycystic kidney disease-1 (hPKD1 gene result in ~85% of cases of autosomal dominant polycystic kidney disease, the most frequent human monogenic disease. PKD1 proteins are large multidomain proteins involved in a variety of signal transduction mechanisms. Obtaining more information about members of the PKD1 family will help to clarify their functions. Humans have five hPKD1 proteins, whereas sea urchins have 10. The PKD1 proteins of the sea urchin, Strongylocentrotus purpuratus, are referred to as the Receptor for Egg Jelly, or SpREJ proteins. The SpREJ proteins form a subfamily within the PKD1 family. They frequently contain C-type lectin domains, PKD repeats, a REJ domain, a GPS domain, a PLAT/LH2 domain, 1–11 transmembrane segments and a C-terminal coiled-coil domain. Results The 10 full-length SpREJ cDNA sequences were determined. The secondary structures of their deduced proteins were predicted and compared to the five human hPKD1 proteins. The genomic structures of the 10 SpREJs show low similarity to each other. All 10 SpREJs are transcribed in either embryos or adult tissues. SpREJs show distinct patterns of expression during embryogenesis. Adult tissues show tissue-specific patterns of SpREJ expression. Conclusion Possession of a REJ domain of about 600 residues defines this family. Except for SpREJ1 and 3, that are thought to be associated with the sperm acrosome reaction, the functions of the other SpREJ proteins remain unknown. The sea urchin genome is one-fourth the size of the human genome, but sea urchins have 10 SpREJ proteins, whereas humans have five. Determination of the tissue specific function of each of these proteins will be of interest to those studying echinoderm development. Sea urchins are basal deuterostomes, the line of evolution leading to the vertebrates. The study of individual PKD1 proteins will increase our knowledge of the importance of this gene family.

Induction of truncated form of tenascin-X (XB-S) through dissociation of HDAC1 from SP-1/HDAC1 complex in response to hypoxic conditions

International Nuclear Information System (INIS)

Kato, Akari; Endo, Toshiya; Abiko, Shun; Ariga, Hiroyoshi; Matsumoto, Ken-ichi

2008-01-01

ABSTRACT: XB-S is an amino-terminal truncated protein of tenascin-X (TNX) in humans. The levels of the XB-S transcript, but not those of TNX transcripts, were increased upon hypoxia. We identified a critical hypoxia-responsive element (HRE) localized to a GT-rich element positioned from - 1410 to - 1368 in the XB-S promoter. Using an electrophoretic mobility shift assay (EMSA), we found that the HRE forms a DNA-protein complex with Sp1 and that GG positioned in - 1379 and - 1378 is essential for the binding of the nuclear complex. Transfection experiments in SL2 cells, an Sp1-deficient model system, with an Sp1 expression vector demonstrated that the region from - 1380 to - 1371, an HRE, is sufficient for efficient activation of the XB-S promoter upon hypoxia. The EMSA and a chromatin immunoprecipitation (ChIP) assay showed that Sp1 together with the transcriptional repressor histone deacetylase 1 (HDAC1) binds to the HRE of the XB-S promoter under normoxia and that hypoxia causes dissociation of HDAC1 from the Sp1/HDAC1 complex. The HRE promoter activity was induced in the presence of a histone deacetylase inhibitor, trichostatin A, even under normoxia. Our results indicate that the hypoxia-induced activation of the XB-S promoter is regulated through dissociation of HDAC1 from an Sp1-binding HRE site

Edible mushroom Pleurotus sajor-caju production on washed and supplemented sugarcane bagasse Produção do cogumelo comestível Pleurotus sajor-caju em bagaço de cana-de-açúcar lavado e suplementado

Directory of Open Access Journals (Sweden)

Evelise Moncaio Moda

2005-04-01

Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com �

Investigating trehalose synthesis genes after cold acclimation in the Antarctic nematode Panagrolaimus sp. DAW1

Directory of Open Access Journals (Sweden)

Anna C. Seybold

2017-12-01

Full Text Available Panagrolaimus sp. DAW1 is a freeze-tolerant Antarctic nematode which survives extensive intracellular ice formation. The molecular mechanisms of this extreme adaptation are still poorly understood. We recently showed that desiccation-enhanced RNA interference (RNAi soaking can be used in conjunction with quantitative polymerase chain reaction (qPCR to screen for phenotypes associated with reduced expression of candidate genes in Panagrolaimus sp. DAW1. Here, we present the use of this approach to investigate the role of trehalose synthesis genes in this remarkable organism. Previous studies have shown that acclimating Panagrolaimus sp. DAW1 at 5°C before freezing or desiccation substantially enhances survival. In this study, the expression of tps-2 and other genes associated with trehalose metabolism, as well as lea-1, hsp-70 and gpx-1, in cold-acclimated and non-acclimated nematodes was analyzed using qPCR. Pd-tps-2 and Pd-lea-1 were significantly upregulated after cold acclimation, indicating an inducible expression in the cold adaptation of Panagrolaimus sp. DAW1. The role of trehalose synthesis genes in Panagrolaimus sp. DAW1 was further investigated by RNAi. Compared to the controls, Pd-tps-2a(RNAi-treated and cold-acclimated nematodes showed a significant decrease in mRNA, but no change in trehalose content or freezing survival. The involvement of two other trehalose synthesis genes (tps-2b and gob-1 was also investigated. These findings provide the first functional genomic investigation of trehalose synthesis genes in the non-model organism Panagrolaimus sp. DAW1. The presence of several trehalose synthesis genes with different RNAi sensitivities suggests the existence of multiple backup systems in Panagrolaimus sp. DAW1, underlining the importance of this sugar in preparation for freezing.

Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

Energy Technology Data Exchange (ETDEWEB)

Xiang, Zhonghua; Qiao, Ling; Zhou, Yan [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada); Babiuk, Lorne A. [University of Alberta, Edmonton, Alberta (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada)

2010-11-19

Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

International Nuclear Information System (INIS)

Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

2010-01-01

Research highlights: → A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. → HCV-3a NS5A increases mature SREBP-1c protein level. → HCV-3a NS5A activates SREBP-1c transcription. → Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. → Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

Science.gov (United States)

Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

2015-01-01

The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

Transcriptional activation of Mina by Sp1/3 factors.

Science.gov (United States)

Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

Professional ASPNET 35 SP1 Edition In C# and VB

CERN Document Server

Evjen, Bill; Rader, Devin

2009-01-01

Professional ASP.NET 3.5 SP1 In C# and VB. ASP.NET 3.5 brings the power of Visual Studio® 2008 along with the multitude of language improvements in C# 2008 and Visual Basic® 2008 as well as powerful new technology called LINQ, together with the ASP.NET 2.0 Framework you already know and love. Packed with valuable coverage of ASP.NET 3.5 SP1, this essential resource offers both C# and VB examples throughout the book, and shares new and updated content on the ADO.NET Entity Framework, ADO.NET Dynamic Data, and ADO.NET Data Services. While ASP.NET 3.5 boasts server controls like the ListView and

Biomineralization of a calcifying ureolytic bacterium Microbacterium sp. GM-1

Directory of Open Access Journals (Sweden)

Guojing Xu

2017-01-01

Conclusions: The results of this research provide evidence that Microbacterium sp. GM-1 can biologically induce calcification and suggest that strain GM-1 may play a potential role in the synthesis of new biominerals and in bioremediation or biorecovery.

[EFFICIENCY OF INTRODUCING CAROTENE PRODUCING STRAINS BACILLUS SP. 1.1 AND B. AMYLOLIQUEFACIENS UCM B-5113 INTO THE CHIKENS DIET].

Science.gov (United States)

Nechypurenko, O O; Kharhota M A; Avdeeva, L V

2015-01-01

It was shown the efficiency of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 in the diet of chickens. Also it was detected the lowering of the quantitative content of bacterial genera Enterococcus, Staphylococcus, family Enterobacteriaceae in the gut after eating by chickens cross "H&N Brown Nick" fodder with strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 alone and in composition in quantities 1 x 10(10) CFU per 1 g of feed. On the 18th day after introduction of cultures Bacillus sp. 1.1, B. amyloliquefaciens UCM B-5113 and their composition in the diet of poultry we revealed the increasing of body weight by 21.6, 7.6 and 22.0%, respectively, comparesing to controls. Also due to Bacillus sp. 1.1 it was detected the restore of intestinal villous structures, tissues of spleen, liver and heart. We found the additive effect of the composition of the investigated strains of bacteria genus Bacillus to the chickens.

Draft genome sequences of six neonatal meningitis-causing escherichia coli isolates (SP-4, SP-5, SP-13, SP-16, SP-46, and SP-65)

Science.gov (United States)

Neonatal meningitis Escherichia coli isolates (SP-4, SP-5, SP-13, SP-16, SP-46, and SP-65) were recovered from infants in the Netherlands from 1989 to 1997. Here, we report the draft genome sequences for these six E. coli isolates, which are currently being used to validate food safety processing te...

An analysis of employee exposure to organic dust at large-scale composting facilities

Science.gov (United States)

Sykes, P.; Allen, J. A.; Wildsmith, J. D.; Jones, K. P.

2009-02-01

The occupational health implications from exposure to dust, endotoxin and 1-3 β Glucan at commercial composting sites are uncertain. This study aims to establish employee exposure levels to inhalable and respirable dust, endotoxin and 1-3 β Glucan during various operational practices in the composting process. Personal samples were collected and the inhalable and respirable dust fractions were determined by gravimetric analysis. Endotoxin concentrations were determined using a Limulus Amebocyte Lysate assay (LAL). 1-3 β Glucan levels were estimated using a specific blocking agent to establish the contribution that these compounds gave to the original endotoxin assay. Employees' exposure to dust was found to be generally lower than the levels stipulated in the Control of Substances Hazardous to Health Regulations (COSHH) 2002 (as amended), (median inhalable fraction 1.08 mg/m3, min 0.25 mg/m3 max 10.80 mg/m3, median respirable fraction 0.05 mg/m3, min 0.02 mg/m3, max 1.49 mg/m3). Determination of the biological component of the dust showed that employees' exposures to endotoxin were elevated (median 31.5 EU/m3, min 2.00 EU/m3, max 1741.78 EU/m3), particularly when waste was agitated (median 175.0 EU/m3, min 2.03 EU/m3, max 1741.78 EU/m3). Eight out of 32 (25%) of the personal exposure data for endotoxin exceeded the 200 EU/m3 temporary legal limit adopted in the Netherlands and thirteen out of 32 (40.6%) exceeded the suggested 50 EU/m3 guidance level suggested to protect workers from respiratory health effects. A significant correlation was observed between employee inhalable dust exposure and personal endotoxin concentration (r = 0.728, phealth risks associated with endotoxin exposure at composting sites. Employee exposure levels and dose-response disease mechanisms are not well understood at this present time. Consequently, in light of this uncertainty, it is recommended that a precautionary approach be adopted in managing the potential health risks associated

Effect of agroforestry residues partially biodegraded by pleurotus ostreatus (pleurotaceae) on tomato seedlings development

International Nuclear Information System (INIS)

Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel

2013-01-01

It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.

Draft Genome Sequence of a Chitinase-producing Biocontrol Bacterium Serratia sp. C-1

Directory of Open Access Journals (Sweden)

Seur Kee Park

2015-09-01

Full Text Available The chitinase-producing bacterial strain C-1 is one of the key chitinase-producing biocontrol agents used for effective bioformulations for biological control. These bioformulations are mixed cultures of various chitinolytic bacteria. However, the precise identification, biocontrol activity, and the underlying mechanisms of the strain C-1 have not been investigated so far. Therefore, we evaluated in planta biocontrol efficacies of C-1 and determined the draft genome sequence of the strain in this study. The bacterial C-1 strain was identified as a novel Serratia sp. by a phylogenic analysis of its 16S rRNA sequence. The Serratia sp. C-1 bacterial cultures showed strong in planta biocontrol efficacies against some major phytopathogenic fungal diseases. The draft genome sequence of Serratia sp. C-1 indicated that the C-1 strain is a novel strain harboring a subset of genes that may be involved in its biocontrol activities.

Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

Directory of Open Access Journals (Sweden)

I MADE SUDARMA

2015-09-01

Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

Extracellular polysaccharide production by a strain of Pleurotus djamor isolated in the south of Brazil and antitumor activity on Sarcoma 180

Directory of Open Access Journals (Sweden)

Gisele Martini Borges

2013-12-01

Full Text Available Polysaccharides with medicinal properties can be obtained from fruiting bodies, mycelium and culture broth of several fungus species. This work was carried out in batch culture using a stirred tank reactor with two different initial glucose concentrations (40-50 g/L and pH values (3.0-4.0 to enhance extracellular polysaccharides production by Pleurotus djamor UNIVILLE 001 and evaluate antitumor effect of intraperitonial administration of Pleurotus djamor extract on sarcoma 180 animal model. According to factorial design, the low pH value (pH 3.0 led to a gain of 1.6 g/L on the extracellular polysaccharide concentration, while glucose concentration in the tested range had no significant effect on the concentration of polysaccharide. With 40 g/L initial glucose concentration and pH 3.0, it was observed that yield factor of extracellular polysaccharide on substrate (Y P/S = 0.072 and maximum extracellular polysaccharide productivity (Q Pmax = 11.26 mg/L.h were about 188% and 321% respectively higher than those obtained in the experiment performed at pH 4.0. Under these conditions, the highest values of the yield factor of biomass on substrate (Y X/S = 0.24 and maximal biomass productivity (Q Xmax = 32.2 mg/L.h were also reached. In tumor response study, mean tumor volume on the 21th day was 35.3 cm³ in untreated group and 1.6 cm³ in treated group (p = 0.05 with a tumor inhibition rate of 94%. These impressive results suggests an inhibitory effect of P.djamor extract on cancer cells.

SP-D impedes transfer of HIV-1 from multi-layered vaginal epithelium with a distinct gene signature

Directory of Open Access Journals (Sweden)

Hrishikesh Pandit

2017-12-01

Full Text Available Surfactant Protein (SP D is a member of the collectin family of soluble pattern recognition receptors. We have previously shown that a recombinant fragment of SP-D (rhSP-D inhibits gp120-CD4 interaction and HIV-1 entry in target cells. To potentiate its prophylactic use as a vaginal microbicide, we determined ex vivo efficacy using organotypic human vaginal-ectocervical epithelia (VEC-100 that closely resemble the native tissues of origin. VEC-100, stratified human vaginal-ectocervical tissues grown on membrane inserts were treated with rhSP-D followed by a challenge with HIV-1 to assess the transfer of HIV-1 through the VEC-100 tissues to PBMCs in the basal submucosal compartment. Treated VEC tissues were subjected to mRNA Illumina microarray analysis. Levels of transcripts encoding for immune mediators, adhesion and tight junction proteins were also evaluated. Effect of rhSP-D on viability, NFκB activation, cytokine secretion and bacterial colonization of cervical vaginal epithelial cells was determined. rhSP-D significantly inhibited HIV-1 transfer from the multi-layered epithelial tissues to the basal PBMCs as compared to HIV-1 alone. Global gene expression profile of HIV-1 challenged VEC-100 tissues revealed differential regulation of genes and pathways majorly involved in inflammation, cell survival and transcription factors. Levels of Guanylate-binding proteins (GBPs and interferon-inducible proteins were significantly upregulated suggesting an interferon host defense response. rhSP-D showed an inhibition in the levels of GBPs and rescued the cell adhesion molecules such as Claudin 2, 3, 4, 5 and Occludin, known to be down regulated by HIV-1 in primary vaginal cells. Importantly, rhSP-D conditioned VEC tissue supernatants did not enhance susceptibility of target cells to HIV-1. rhSP-D treated vaginal epithelial cells did not show any significant alteration in viability, NFκB activation and levels of immune mediators like IL-1RA, Elafin

Serine proteases SP1 and SP13 mediate the melanization response of Asian corn borer, Ostrinia furnacalis, against entomopathogenic fungus Beauveria bassiana.

Science.gov (United States)

Chu, Yuan; Liu, Yang; Shen, Dongxu; Hong, Fang; Wang, Guirong; An, Chunju

2015-06-01

Exposure to entomopathogenic fungi is one approach for insect pest control. Little is known about the immune interactions between fungus and its insect host. Melanization is a prominent immune response in insects in defending against pathogens such as bacteria and fungi. Clip domain serine proteases in insect plasma have been implicated in the activation of prophenoloxidase, a key enzyme in the melanization. The relationship between host melanization and the infection by a fungus needs to be established. We report here that the injection of entomopathogenic fungus Beauveria bassiana induced both melanin synthesis and phenoloxidase activity in its host insect, the Asian corn borer, Ostrinia furnacalis (Guenée). qRT-PCR analysis showed several distinct patterns of expression of 13 clip-domain serine proteases in response to the challenge of fungi, with seven increased, two decreased, and four unchanged. Of special interest among these clip-domain serine protease genes are SP1 and SP13, the orthologs of Manduca sexta HP6 and PAP1 which are involved in the prophenoloxidase activation pathway. Recombinant O. furnacalis SP1 was found to activate proSP13 and induce the phenoloxidase activity in corn borer plasma. Additionally, SP13 was determined to directly cleave prophenoloxidase and therefore act as the prophenoloxidase activating protease. Our work thus reveals a biochemical mechanism in the melanization in corn borer associated with the challenge by B. bassiana injection. These insights could provide valuable information for better understanding the immune responses of Asian corn borer against B. bassiana. Copyright © 2015 Elsevier Inc. All rights reserved.

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.

Science.gov (United States)

Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1

Directory of Open Access Journals (Sweden)

Preeti N. Tallur

2015-09-01

Full Text Available Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF, polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

Sex determination and differentiation in Aurelia sp.1: the absence of temperature dependence

Science.gov (United States)

Liu, Chunsheng; Gu, Zhifeng; Xing, Mengxin; Sun, Yun; Chen, Siqing; Chen, Zhaoting

2018-03-01

Cnidarians, being regarded as `basal' metazoan animals, are considered to have relatively high plasticity in terms of sex reversal. In this study we used an experimental approach to demonstrate sexual differentiation and plasticity in benthic polyps and pelagic medusae of Aurelia sp.1 maintained at different temperatures. Results indicated that in Aurelia sp.1, sex differentiation has been determined at the polyp stage and that all medusae originating from a given polyp are, phenotypically, of the same sex. In addition, the sex of polyps budding from the same clone (either male or female) at different temperatures appears to be the same as that of the parent. The sex of medusae that had originated from a known-sex polyp was observed to remain the same as that of the parent, irrespective of differences in strobilation or rearing temperatures. These results indicate that the mechanism of sex determination of Aurelia sp.1. is not influenced by prevailing temperature regimes. A comparison of variability in terms of sexual plasticity of Aurelia sp.1 with that of Hydrozoa and Anthozoa suggests that species characterized by a free-swimming medusa life stage have a high dispersal potential, which probably results in a lower rate of sex reversal.

Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Rossana Liguori

2015-01-01

Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.

Effect of space flight on seeds and plant growth of Dianthus barbatus in SP1

International Nuclear Information System (INIS)

Yang Xuejun; Teng Wenjun; Yuan Xiaohuan; Chao Gongping; Zhang Jianfang; Sun Zhenyuan

2011-01-01

The dry seeds of Dianthus barbatus were carried by recoverable satellite No.21 of China, and seeds were sown after returning back to the ground. The growth characteristic were observed, including seed vitality, emergence rate, plant growth and chlorophyll content of SP 1 generation. The results showed that the seed vitality, emergence rate and plant height, flower stalk length in SP 1 generation were significantly decreased and the floret size were significantly increased. The leaf width, chlorophyll content and chlorophyll a/b ratio decreased, while crown diameter and floret number increased in SP 1 generation plants. (authors)

Improvement of Fish Sauce Quality by Strain CMC5-3-1: A Novel Species of Staphylococcus sp.

Science.gov (United States)

Udomsil, Natteewan; Rodtong, Sureelak; Tanasupawat, Somboon; Yongsawatdigul, Jirawat

2015-09-01

Staphylococcus sp. CMC5-3-1 and CMS5-7-5 isolated from fermented fish sauce at 3 to 7 mo, respectively, showed different characteristics on protein hydrolysis and volatile formation. These Gram-positive cocci were able to grow in up to 15% NaCl with the optimum at 0.5% to 5% NaCl in tryptic soy broth. Based on ribosomal 16S rRNA gene sequences, Staphylococcus sp. CMC5-3-1 and CMS5-7-5 showed 99.0% similarity to that of Staphylococcus piscifermentans JCM 6057(T) , but DNA-DNA relatedness was sauce inoculated with Staphylococcus sp. CMC5-3-1 was 740.5 mM, which was higher than that inoculated by the strain CMS5-7-5 (662.14 mM, P sauce inoculated with Staphylococcus sp. CMC5-3-1 showed the highest content of total glutamic acid (P sauce inoculated with Staphylococcus sp. CMC5-3-1 was 2-methypropanal, contributing to the desirable dark chocolate note. Staphylococcus sp. CMC5-3-1 could be applied as a starter culture to improve the umami and aroma of fish sauce. © 2015 Institute of Food Technologists®

Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes

Science.gov (United States)

Ochiai, Ayasa; Miyata, Shingo; Iwase, Masamori; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

2016-01-01

A high level of plasma low-density lipoprotein (LDL) cholesterol is considered a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) is essential for clearing plasma LDL cholesterol, activation of LDLR is a promising therapeutic target for patients with atherosclerotic disease. Here we demonstrated how the flavonoid kaempferol stimulated the gene expression and activity of LDLR in HepG2 cells. The kaempferol-mediated stimulation of LDLR gene expression was completely inhibited by knockdown of Sp1 gene expression. Treatment of HepG2 cells with kaempferol stimulated the recruitment of Sp1 to the promoter region of the LDLR gene, as well as the phosphorylation of Sp1 on Thr-453 and Thr-739. Moreover, these kaempferol-mediated processes were inhibited in the presence of U0126, an ERK pathway inhibitor. These results suggest that kaempferol may increase the activity of Sp1 through stimulation of Sp1 phosphorylation by ERK1/2 and subsequent induction of LDLR expression and activity. PMID:27109240

BIODIVERSITAS DAN POTENSI JAMUR BASIDOMYCOTA DI KAWASAN KASEPUHAN CISUNGSANG, KABUPATEN LEBAK, BANTEN

Directory of Open Access Journals (Sweden)

Ahmad Ni’matullah Al Ulya

2017-04-01

Full Text Available Abstrak Biodiversitas jamur Basidiomycota di kawasan konservasi Taman Nasional Gunung Halimun Salak (TNGHS yang terletak di Kabupaten Lebak, Provinsi Banten, belum pernah diteliti sebelumnya. Kawasan konservasi tersebut dihuni oleh masyarakat adat dari Kasepuhan Cisungsang, yang selama ini memanfaatkan jamur dalam kehidupan sehari-hari. Oleh karena itu, penelitian ini mengeks-plorasi keanekaragaman jamur Basidiomycota dan pemanfaatannya oleh masyarakat adat Kasepuhan Cisungsang. Penelitian dilaksanakan pada bulan Maret-Mei 2016. Sebanyak 34 spesies dari 21 marga, 16 keluarga, dan 5 bangsa dari jamur Basidiomycota berhasil ditemukan di daerah sawah, pekarangan, kebun, talun atau dudukan, dan hutan. Tujuh marga yang ditemukan diketahui dapat dimanfaatkan sebagai sumber makanan, yaitu supa ceuli (Auricularia sp.; supa amis (Marasmiellus sp.; supa beas (Coprinus sp.; supa tiram (Pleurotus sp.; supa jerami (Volvariella sp.; suung tunggal (Termitomyce sp.; dan supa kebo (Boletus sp.. Data ini menunjukkan tingginya biodiversitas jamur Basidiomycota di daerah masyarakat adat wilayah ini dan potensinya sebagai sumber makanan. Abstract Biodiversity of fungi Basidiomycota in the conservation area of Taman Nasional Gunung Halimun (TNNGHS Salak in Lebak, Province Banten, has never been studied. This area is resided by indigenous people from Kasepuhan Cisungsang, which uses the fungi in their life. Therefore, this study was aimed at exploring the biodiversity of mushrooms (Basidiomycota in Kasepuhan Cisungsang. The exploration was conducted from March to May 2016. A total number of 34 species which belong to 21 genera, 16 families, 5 orders were found in the rice field, yard, garden, and forest. About 7 genera are commonly consumed by the community. These include supa ceuli (Auricularia sp.; supa amis (Marasmiellus sp.; supa beas (Coprinus sp.; supa tiram (Pleurotus sp.; supa jerami (Volvariella sp.; suung tunggal (Termitomyce sp.; and supa kebo (Boletus sp

In Vitro Antimicrobial and Antioxidant Activities of Ethanolic Extract of Lyophilized Mycelium of Pleurotus ostreatus PQMZ91109

Directory of Open Access Journals (Sweden)

Emanuel Vamanu

2012-03-01

Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.

Mutation induction of pleurotus ferulae by low-energy N+ ion implantation and characters of the selected mutant

International Nuclear Information System (INIS)

Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian

2008-01-01

In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)

USO DEL BAGAZO ENRIQUECIDO CON EL HONGO Pleurotus ostreatus, EN DIETAS PARA BOVINOS ESTABULADOS EN CEBA UTILIZAÇÃO DO BAGAÇO ENRIQUECIDO COMO FUNGO Pleurotus ostreatus, EM DIETAS PARA BOVINOS ESTABULADOS EM ENGORDA Pleurotus ostreatus ENRICHED SUGAR CANEHUSKS UTILIZATION ON INDOOR CATTLEFATTENING DIETS

Directory of Open Access Journals (Sweden)

NATALIA LIZETTE CASTAÑO

2012-12-01

Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen

Inducible Expression of the De-Novo Designed Antimicrobial Peptide SP1-1 in Tomato Confers Resistance to Xanthomonas campestris pv. vesicatoria.

Directory of Open Access Journals (Sweden)

Areli Herrera Diaz

Full Text Available Antimicrobial peptides (AMPs are small peptides with less than 50 amino acids and are part of the innate immune response in almost all organisms, including bacteria, vertebrates, invertebrates and plants. AMPs are active against a broad-spectrum of pathogens. The inducible expression of AMPs in plants is a promising approach to combat plant pathogens with minimal negative side effects, such as phytotoxicity or infertility. In this study, inducible expression of the de-novo designed AMP SP1-1 in Micro Tom tomato protected tomato fruits against bacterial spot disease caused by Xanthomonas campestris pv. vesicatoria. The peptide SP1-1 was targeted to the apoplast which is the primary infection site for plant pathogens, by fusing SP1-1 peptide to the signal peptide RsAFP1 of radish (Raphanus sativus. The pathogen inducibility of the expression was enabled by using an optimized inducible 4XW2/4XS promoter. As a result, the tomato fruits of independently generated SP1-1 transgenic lines were significantly more resistant to X. campestris pv. vesicatoria than WT tomato fruits. In transgenic lines, bacterial infection was reduced up to 65% in comparison to the infection of WT plants. Our study demonstrates that the combination of the 4XW2/4XS cis-element from parsley with the synthetic antimicrobial peptide SP1-1 is a good alternative to protect tomato fruits against infections with X. campestris pv. vesicatoria.

Ovos de Toxocara sp. e larvas de Ancylostoma sp. em praça pública de Lavras, MG Toxocara sp. eggs and Ancylostoma sp. larva in public parks, Brazil

Directory of Open Access Journals (Sweden)

Antônio Marcos Guimarães

2005-04-01

Full Text Available Larva migrans visceral e cutânea são zoonoses parasitárias causadas pela infecção da larva de Toxocara sp. e Ancylostoma sp., respectivamente. O objetivo do estudo foi verificar a contaminação por ovos de Toxocara sp. e ovos e larvas de Ancylostoma sp. em amostras de solos coletadas de praças públicas e de áreas de recreação infantil de Lavras, Estado de Minas Gerais, por meio da técnica de centrífugo-flutuação e do método de Baermann. A ocorrência de ovos de Toxocara sp. e, ovos e larvas de Ancylostoma sp. foi observada em 69,6% (16/23 das amostras de solo coletadas de praças públicas. A contaminação somente por ovos de Ancylostoma sp. em amostras de solo coletadas em escolas/creches foi de 22,2% (4/18. A percentagem de amostras de areia coletadas de escolas/creches contaminadas somente com larvas de Ancylostoma sp. foi de 11,1% (2/18. Praças públicas são as áreas com maior risco potencial de infecção por Toxocara sp. e Ancylostoma sp. Exame coproparasitológico realizado em 174 amostras de fezes de cães observou 58% e 23%, respectivamente, com ovos de Ancylostoma sp. e Toxocara sp.Visceral and cutaneous larva migrans are parasitic zoonoses caused by the infection of larval nematodes Toxocara sp. and Ancylostoma sp. respectively. The objective of this study was to investigate the contamination by Toxocara sp. eggs and Ancylostoma sp. eggs and larva of soil samples collected from public parks and children's playground areas in state of Minas Gerais, Brazil, using both Baermann's method and centrifugal flotation technique. Toxocara sp. and Ancylostoma sp. eggs were observed in soil samples collected from public squares in 17.4% (4/23 and 69.6 (16/23 respectively. In schools and child day care settings the contamination by Ancylostoma sp. larva in sand samples was 11.1% (2/18. Public parks are settings of more potential risk of Toxocara sp. eggs and Ancylostoma sp. infection. Stool parasitology testing of 174 stool

Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

Science.gov (United States)

Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

2016-12-01

Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

Transcriptional regulation of human FE65, a ligand of Alzheimer's disease amyloid precursor protein, by Sp1.

LENUS (Irish Health Repository)

Yu, Hoi-Tin

2010-03-01

FE65 is a neuronal-enriched adaptor protein that binds to the Alzheimer\\'s disease amyloid precursor protein (APP). FE65 forms a transcriptionally active complex with the APP intracellular domain (AICD). The precise gene targets for this complex are unclear but several Alzheimer\\'s disease-linked genes have been proposed. Additionally, evidence suggests that FE65 influences APP metabolism. The mechanism by which FE65 expression is regulated is as yet unknown. To gain insight into the regulatory mechanism, we cloned a 1.6 kb fragment upstream of the human FE65 gene and found that it possesses particularly strong promoter activity in neurones. To delineate essential regions in the human FE65 promoter, a series of deletion mutants were generated. The minimal FE65 promoter was located between -100 and +5, which contains a functional Sp1 site. Overexpression of the transcription factor Sp1 potentiates the FE65 promoter activity. Conversely, suppression of the FE65 promoter was observed in cells either treated with an Sp1 inhibitor or in which Sp1 was knocked down. Furthermore, reduced levels of Sp1 resulted in downregulation of endogenous FE65 mRNA and protein. These findings reveal that Sp1 plays a crucial role in transcriptional control of the human FE65 gene.

Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

Science.gov (United States)

Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

2017-01-01

Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

aPKC-ι/P-Sp1/Snail signaling induces epithelial-mesenchymal transition and immunosuppression in cholangiocarcinoma.

Science.gov (United States)

Qian, Yawei; Yao, Wei; Yang, Tao; Yang, Yan; Liu, Yan; Shen, Qi; Zhang, Jian; Qi, Weipeng; Wang, Jianming

2017-10-01

Cholangiocarcinoma (CCA) is a highly malignant bile duct cancer that tends to invade and metastasize early. The epithelial-mesenchymal transition (EMT) has been implicated in cancer cell invasion and metastasis, as well as in cancer cell evasion of host immunity. In this study, we investigated the interaction between atypical protein kinase C-iota (aPKC-ι) and Snail in the regulation of EMT and its relationship to CCA immunosuppression. Our results demonstrated that aPKC-ι, Snail, and infiltrated immunosuppressive cells were significantly up-regulated in CCA tumor tissues and linked to poor prognosis. aPKC-ι induced EMT and immunosuppression by regulating Snail in vitro and in vivo, although aPKC-ι did not directly interact with Snail in coimmunoprecipitation experiments. To further clarify the molecular interaction between aPKC-ι and Snail in relation to EMT, quantitative iTRAQ-based phosphoproteomic analysis and liquid chromatography-tandem mass spectrometry were conducted to identify the substrates of aPKC-ι-dependent phosphorylation. Combined with coimmunoprecipitation, we showed that specificity protein 1 (Sp1) was directly phosphorylated by aPKC-ι on Ser59 (P-Sp1). Both Sp1 and P-Sp1 were up-regulated in CCA tumor tissues and associated with clinicopathological features and poor prognosis in CCA patients. Moreover, using chromatin immunoprecipitation assays, we found that P-Sp1 regulated Snail expression by increasing Sp1 binding to the Snail promoter. P-Sp1 also regulated aPKC-ι/Snail-induced EMT-like changes and immunosuppression in CCA cells. Our findings further indicated that CCA cells with EMT-like features appear to generate immunosuppressive natural T regulatory-like cluster of differentiation 4-positive (CD4 + )CD25 - cells rather than to increase CD4 + CD25 + natural T regulatory cells, in part by mediating T regulatory-inducible cytokines such as transforming growth factor β1 and interleukin 2. These results demonstrate that a

Scenedesmus sp. NJ-1 isolated from Antarctica: a suitable renewable lipid source for biodiesel production.

Science.gov (United States)

Chen, Zhuo; Gong, Yangmin; Fang, Xiantao; Hu, Hanhua

2012-11-01

Microalgal lipids are promising alternative feedstocks for biodiesel production. Scenedesmus sp. NJ-1, an oil-rich freshwater microalga isolated from Antarctica, was identified to be a suitable candidate to produce biodiesel in this study. This strain could grow at temperatures ranging from 4 to 35 °C. With regular decrease in nitrate concentration in the medium, large quantities of triacylglycerols accumulated under batch culture conditions detected by thin layer chromatography and BODIPY 505/515 fluorescent staining. Scenedesmus sp. NJ-1 achieved the average biomass productivity of 0.105 g l⁻¹ d⁻¹ (dry weight) and nearly the highest lipid content (35 % of dry cell weight) was reached at day 28 in the batch culture. Neutral lipids accounted for 78 % of total lipids, and C18:1 (n-9), C16:0 were the major fatty acids in total lipids, composing 37 and 20 % of total fatty acids of Scenedesmus sp. NJ-1 grown for 36 days, respectively. These results suggested that Scenedesmus sp. NJ-1 was a good source of microalgal oils for biodiesel production.

Effect of gamma irradiation on the structure of corn stalks and their subsequent bioconversion into protein-rich mycelial biomass of pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Awafo, V [Quebec Univ., Montreal, PQ (Canada)

1994-12-31

Lignocellulosic biomass like corn stalk is an abundant and renewable resource from which food, feed and chemicals may be derived. Enzymatic hydrolysis of native lignocellulosic material is prohibitively slow due to their compositional heterogeneity and structural complexity. In this work, ground corn stalks (20 mesh) were subjected to gamma irradiation (10-170 Mrads) as pretreatments to make them more susceptible for bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757. The irradiation was carried out in air in a {sup 60}Co Underwater Calibrator (UC-15, Nordion International) at a dose rate of 2.5 Mrads/h as measured by Fricke dosimetry. No apparent structural differences were observed under the light microscope. However, the protein synthesis and the proportion of mycelial biomass increased with the increase in both the dose of irradiation and time of fermentation during the bioconversion of 1% corn stalk into mycelial biomass of Pleurotus sajor-caju. Gamma irradiation at the dose of 50 Mrads or lower did not produce any appreciable increase in the amount of protein synthesised. At 170 Mrads, the final product contained 28% protein representing a 2-fold increase from non-irradiated corn stalk and an efficiency of 36% conversion of total utilizable polysaccharides of corn stalks into mycelial biomass. The lag phase during mycelial biomass production was much more prolonged at very high doses indicating possible production of some toxic substances during irradiation. (author). 2 tabs., 6 figs.

Metagenome-Assembled Genome Sequences of Acetobacterium sp. Strain MES1 and Desulfovibrio sp. Strain MES5 from a Cathode-Associated Acetogenic Microbial Community.

Science.gov (United States)

Ross, Daniel E; Marshall, Christopher W; May, Harold D; Norman, R Sean

2017-09-07

Draft genome sequences of Acetobacterium sp. strain MES1 and Desulfovibrio sp. strain MES5 were obtained from the metagenome of a cathode-associated community enriched within a microbial electrosynthesis system (MES). The draft genome sequences provide insight into the functional potential of these microorganisms within an MES and a foundation for future comparative analyses. Copyright © 2017 Ross et al.

Performance of Pleurotus pulmonarius mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

2017-10-01

Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.

Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

Science.gov (United States)

Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

2004-02-01

The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

Directory of Open Access Journals (Sweden)

Xianghe Yuan

2016-02-01

Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

Transcription of human resistin gene involves an interaction of Sp1 with peroxisome proliferator-activating receptor gamma (PPARgamma.

Directory of Open Access Journals (Sweden)

Anil K Singh

2010-03-01

Full Text Available Resistin is a cysteine rich protein, mainly expressed and secreted by circulating human mononuclear cells. While several factors responsible for transcription of mouse resistin gene have been identified, not much is known about the factors responsible for the differential expression of human resistin.We show that the minimal promoter of human resistin lies within approximately 80 bp sequence upstream of the transcriptional start site (-240 whereas binding sites for cRel, CCAAT enhancer binding protein alpha (C/EBP-alpha, activating transcription factor 2 (ATF-2 and activator protein 1 (AP-1 transcription factors, important for induced expression, are present within sequences up to -619. Specificity Protein 1(Sp1 binding site (-276 to -295 is also present and an interaction of Sp1 with peroxisome proliferator activating receptor gamma (PPARgamma is necessary for constitutive expression in U937 cells. Indeed co-immunoprecipitation assay demonstrated a direct physical interaction of Sp1 with PPARgamma in whole cell extracts of U937 cells. Phorbol myristate acetate (PMA upregulated the expression of resistin mRNA in U937 cells by increasing the recruitment of Sp1, ATF-2 and PPARgamma on the resistin gene promoter. Furthermore, PMA stimulation of U937 cells resulted in the disruption of Sp1 and PPARgamma interaction. Chromatin immunoprecipitation (ChIP assay confirmed the recruitment of transcription factors phospho ATF-2, Sp1, Sp3, PPARgamma, chromatin modifier histone deacetylase 1 (HDAC1 and the acetylated form of histone H3 but not cRel, C/EBP-alpha and phospho c-Jun during resistin gene transcription.Our findings suggest a complex interplay of Sp1 and PPARgamma along with other transcription factors that drives the expression of resistin in human monocytic U937 cells.

Usability and Workflow Evaluation of "RhEumAtic Disease activitY" (READY). A Mobile Application for Rheumatology Patients and Providers.

Science.gov (United States)

Yen, Po-Yin; Lara, Barbara; Lopetegui, Marcelo; Bharat, Aseem; Ardoin, Stacy; Johnson, Bernadette; Mathur, Puneet; Embi, Peter J; Curtis, Jeffrey R

2016-11-02

RhEumAtic Disease activitY (READY) is a mobile health (mHealth) application that aims to create a shared platform integrating data from both patients and physicians, with a particular emphasis on arthritis disease activity. We made READY available on an iPad and pilot implemented it at a rheumatology outpatient clinic. We conducted 1) a usability evaluation study to explore patients' and physicians' interactions with READY, and 2) a time motion study (TMS) to observe the clinical workflow before and after the implementation. A total of 33 patients and 15 physicians participated in the usability evaluation. We found usability problems in navigation, data entry, pain assessment, documentation, and instructions along with error messages. Despite these issues, 25 (75,76%) patients reported they liked READY. Physicians provided mixed feedback because they were concerned about the impact of READY on clinical workflow. Six physicians participated in the TMS. We observed 47 patient visits (44.72 hours) in the pre-implementation phase, and 42 patient visits (37.82 hours) in the post-implementation phase. We found that patients spent more time on READY than paper (4.39mins vs. 2.26mins), but overall, READY did not delay the workflow (pre = 52.08 mins vs. post = 45.46 mins). This time difference may be compensated with READY eliminating a workflow step for the staff. Patients preferred READY to paper documents. Many found it easier to input information because of the larger font size and the ease of 'tapping' rather than writing-out or circling answers. Even though patients spent more time on READY than using paper documents, the longer usage of READY was mainly due to when troubleshooting was needed. Most patients did not have problems after receiving initial support from the staff. This study not only enabled improvements to the software but also serves as good reference for other researchers or institutional decision makers who are interested in implementing such a

An ethnomycological survey of macrofungi utilized by Aeta communities in Central Luzon, Philippines

Directory of Open Access Journals (Sweden)

De Leon AM

2012-04-01

Full Text Available Questionnaires and formatted interviews were used to determine mushrooms used as food and as materials for societal rituals and beliefs among six Aeta communities in three provinces of Central Luzon, Northern Philippines. Thirty-eight different fungi were utilized by the Aeta communities: 21 in Pampanga, 10 in Tarlac, and 19 in Zambales. Fourteen fungal species were collected and identified based on their morphological characters: Auricularia auricula, A. polytricha, Calvatia sp., Ganoderma lucidum, Lentinus tigrinus, L. sajor-caju, Mycena sp., Pleurotus sp., Schizophyllum commune, Termitomyces clypeatus, T. robustus, Termitomyces sp. 1, Termitomyces sp. 2, and Volvariella volvacea. Twelve of the identified macrofungi were consumed as food while Ganoderma lucidum and Mycena sp. were used as house decoration and medicine, respectively. The Aeta communities also performed rituals prior to the collection of these mushrooms, including tribal dancing, praying and kissing the ground. Their indigenous beliefs regarding mushrooms are also documented. This is the most extensive enthnomycological study on the Aeta communities in the Philippines.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

LAMOST DR1: Stellar Parameters and Chemical Abundances with SP_Ace

Science.gov (United States)

Boeche, C.; Smith, M. C.; Grebel, E. K.; Zhong, J.; Hou, J. L.; Chen, L.; Stello, D.

2018-04-01

We present a new analysis of the LAMOST DR1 survey spectral database performed with the code SP_Ace, which provides the derived stellar parameters {T}{{eff}}, {log}g, [Fe/H], and [α/H] for 1,097,231 stellar objects. We tested the reliability of our results by comparing them to reference results from high spectral resolution surveys. The expected errors can be summarized as ∼120 K in {T}{{eff}}, ∼0.2 in {log}g, ∼0.15 dex in [Fe/H], and ∼0.1 dex in [α/Fe] for spectra with S/N > 40, with some differences between dwarf and giant stars. SP_Ace provides error estimations consistent with the discrepancies observed between derived and reference parameters. Some systematic errors are identified and discussed. The resulting catalog is publicly available at the LAMOST and CDS websites.

Antibacterial Actions and Potential Phototoxic Effects of Volatile oils of Foeniculum sp. (fennel, Salvia sp. (sage, Vitis sp. (grape, Lavandula sp. (lavender

Directory of Open Access Journals (Sweden)

Elif Ayse Erdogan Eliuz

2016-09-01

Full Text Available In the present study, the volatile compounds of essential oil of Foeniculum vulgare (fennel, Salvia officinalis (sage, Vitis vinifera (grape, Lavandula angustifolia (lavender were analysed by gas chromatography-mass spectrometry (GC-MS using the Nist and Willey libraries. It was determined that the main components of Foeniculum sp. were anethole (41.11%, carvacrol (9.18%. whereas main components of Salvia sp were 1.8 cineole (34.09%, caryophyllene (10.95%, camphor (9.44%, α-pinene (8.42%. Vitis sp. contained linoleic acid (36.98%, 2,4-decadienal (30.79%. Finally, volatile component of Lavandula sp. was linalool (33.57%, linalyl acetate (30.74%. Photoxic antibacterial activity of volatile oil of those plants against Escherichia coli (ATCC 25293, Klebsiella pneumoniae (10031, Salmonella thyphimurium, Bacillus subtilis (ATCC 6633, Staphylococcus aureus (ATCC 25925, Enterococcus feacalis (ATCC 29212 were examined by using disc diffusion method. We demonstrated that volatile oil effectively can be activated by a standard LED light. In vitro, significant phototoxicity was demonstrated by volatile oil of Foeniculum sp. and Vitis sp. (P < 0.05, while minor phototoxicity was induced by Lavandula sp. Therefore, volatile oil of plant can be considered as a potential photosensitizer in the photochemical therapy.

Serum-SP/sub 1/-pregnancy-specific-. beta. -glycoprotein in choriocarcinoma and other neoplastic disease

Energy Technology Data Exchange (ETDEWEB)

Searle, F; Leake, B A; Bagshawe, K D; Dent, J [Charing Cross Group of Hospitals, London (UK)

1978-03-18

A radioimmunoassay for a placental glycoprotein, ..beta../sub 1/SP/sub 1/, capable of detecting 2 ..mu..g/l of the glycoprotein in serum was used to measure concentrations of ..beta../sub 1/SP/sub 1/ in patients with choriocarcinoma, teratoma, colonic cancer, breast cancer, and ovarian cancer. Twelve out of 94 (13%) healthy men and healthy non-pregnant women had detectable serum-..beta../sub 1/SP/sub 1/ concentrations. Concentrations up to 50,000 ..mu..g/l were found in the sera of patients with hydatidiform mole, invasive mole, choriocarcinoma, and malignant teratoma. ..beta../sub 1/-glycoprotein concentrations were generally much lower than corresponding concentrations of chorionic gonadotrophin which is the most reliable marker for trophoblastic tumors. In a few cases, however, ..beta../sub 1/-glycoprotein measurements may be useful in the detection of minimal residual tumor. The slightly raised values found in some patients with carcinoma of the colon, breast, or ovary seem unlikely to be useful for diagnostic purposes or for monitoring the course of these cancers.

Histone deacetylase 3 represses p15INK4b and p21WAF1/cip1 transcription by interacting with Sp1

International Nuclear Information System (INIS)

Huang Weifeng; Tan Dapeng; Wang Xiuli; Han Songyan; Tan Jiang; Zhao Yanmei; Lu Jun; Huang Baiqu

2006-01-01

Histone deacetylase 3 (HDAC3) has been implicated to play roles in governing cell proliferation. Here we demonstrated that the overexpression of HDAC3 repressed transcription of p15 INK4b and p21 WAF1/cip1 genes in 293T cells, and that the recruitment of HDAC3 to the promoter regions of these genes was critical to this repression. We also showed that HDAC3 repressed GAL4-Sp1 transcriptional activity, and that Sp1 was co-immunoprecipitated with FLAG-tagged HDAC3. We conclude that HDAC3 can repress p15 INK4b and p21 WAF1/cip1 transcription by interacting with Sp1. Furthermore, knockdown of HDAC3 by RNAi up-regulated the transcriptional expression of p15 INK4b , but not that of p21 WAF1/cip1 , implicating the different roles of HDAC3 in repression of p15 INK4b and p21 WAF1/cip1 transcription. Data from this study indicate that the inhibition of p15 INK4b and p21 WAF1/cip1 may be one of the mechanisms by which HDAC3 participates in cell cycle regulation and oncogenesis

Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

Directory of Open Access Journals (Sweden)

Petcharat, V. and

2004-09-01

Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

[The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

Science.gov (United States)

Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

2009-01-01

The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

Radioimmunoassay for estimating the concentration of pregnancy-specific beta-1-glycoprotein (SP-1) in normal pregnancy

International Nuclear Information System (INIS)

Moroz, J.; Regieli, A.; Karski, J.; Witkowska, R.; Golabek, A.

1982-01-01

Two modifications of radioimmunoassay of pregnancy-specific beta-1-glycoprotein are described which differ in their sensitivity and duration of assay and thus in the possibility of their clinical application. Using these methods the concentration of SP-1 was determined in 180 serum samples of healthy pregnant women in different periods of normal pregnancy, 15-non-pregnant women, 16 healthy men, and in 20 samples of amniotic fluid as well as in 15 samples of umbilical vein blood. The described technique of SP-1 radioimmunoassay is useful for assessing the concentration of this protein in the serum of pregnant women during the whole pregnancy. Selection of a proper modification of the method makes the adaptation of its sensitivity and time of the assay possible for the clinical needs. (author)

Critical analysis of the potential for the therapeutic targeting of the Sp1 transcription factor in pancreatic cancer

Directory of Open Access Journals (Sweden)

Jutooru I

2014-06-01

Full Text Available Indira Jutooru,1 Gayathri Chadalapaka,1 Stephen Safe1,21Department of Veterinary Physiology and Pharmacology, Texas A&M University, College Station, TX, USA; 2Institute of Biosciences and Technology, Texas A&M Health Science Center, Houston, TX, USAAbstract: Pancreatic ductal adenocarcinoma (PDAC is a major cause of cancer-related deaths in developed countries and, in 2013, it is estimated that in excess of 45,220 new cases were diagnosed in the United States. PDAC is a highly aggressive disease that invariably evades early diagnosis. The mean survival time for patients with metastatic disease is only 3–6 months, and only 20%–30% of pancreatic cancer patients are alive after 12 months. Because pancreatic cancers are frequently detected at an advanced stage, treatments have provided very limited improvements in tumor regression and overall survival times after diagnosis. 5-Fluorouracil alone or in combination with other drugs has been extensively used for treatment of advanced pancreatic cancer, and gemcitabine has partially replaced 5-fluorouracil as a treatment for pancreatic cancer. Gemcitabine provides increased clinical benefits in terms of response rate; however, future studies need to focus on developing treatment modalities that will improve the survival rate for pancreatic cancer patients. Specificity protein 1 (Sp1 is overexpressed in PDAC patients, and high expression is associated with poor prognosis, lymph node metastasis, and low survival. Knockdown studies have shown that Sp1 plays an important role in cell growth, angiogenesis, inflammation, survival, and metastasis. Sp1 expression is low in normal tissue when compared to tumor tissue, which makes Sp1 a potential target for development of new mechanism-based drugs for treatment of pancreatic cancer. Several drugs such as tolfenamic acid, betulinic acid, and methyl-2-cyano3,12-dioxooleana-1,9(11-dien-28-oate are shown to downregulate Sp1 expression through various pathways

Seroprevalencia de Leptospira sp., Rickettsia sp. Ehrlichia sp. en trabajadores rurales del departamento de Sucre, Colombia Seroprevalence of Leptospira sp., Rickettsia sp. and Ehrlichia sp. in rural workers of Sucre, Colombia

Directory of Open Access Journals (Sweden)

Rodrigo Ríos

2008-06-01

Full Text Available Objective. Determinar la seroprevalencia de Leptospira sp., Rickettsia sp. y Ehrlichia sp. en trabajadores de áreas rurales del departamento de Sucre. Material y métodos. Se realizó un estudio escriptivo, prospectivo, de corte transversal, que pretendió determinar la seroprevalencia e Leptospira sp., Rickettsia sp. y Ehrlichia sp. en 90 trabajadores de áreas rurales del departamento de Sucre. Se estableció la presencia de anticuerpos séricos anti-IgM específicos anti-Leptospira por la técnica de ELISA indirecta. Para la determinación de Rickettsia sp. y Ehrlichia sp. se uso la técnica de inmunofluorescencia indirecta. Resultados. La población evaluada estaba compuesta por 27 (30% ordeñadores, 21 (23% jornaleros, 18 (20% profesionales del campo y 24 (27% que realizaban otras actividades. Ventidós (24% muestras resultaron positivas en alguna de las pruebas. De éstas, 12 (13,3% fueron positivas para Leptospira sp., 7 (7,8% para Rickettsia sp. y 3 (3,3% ara Ehrlichia sp. Conclusión. Este fue el primer estudio que se llevó a cabo en el departamento de Sucre y permitió demostrar que existe una prevalencia importante de Leptospira p.,Rickettsia sp. y Ehrlichia sp.. Los factores de riesgo ocupacional fueron factores determinantes en la seropositividad.Objective. To determine the seroprevalence of Leptospira sp., Rickettsia sp. and Ehrlichia sp. in agricultural workers of Sucre. Methods. A descriptive prospective cross-sectional study was conducted in ninety rural workers of Sucre. Presence of serum antibodies anti-IgM specific anti-Leptospira by indirect ELISA was established. For the determination of Rickettsia and Ehrlichia indirect inmunoflorescence was used. Results.The population was composed by 27 (30% milkers, 21 (23% day workers, 18 farm professionals (20% and 24 (26% workers in others activities. A total of 22 (24% samples were positive to some test. Twelve (13.3% were positive to Leptospira sp., seven (7.8% to Rickettsia sp

From spent graphite to amorphous sp2+sp3 carbon-coated sp2 graphite for high-performance lithium ion batteries

Science.gov (United States)

Ma, Zhen; Zhuang, Yuchan; Deng, Yaoming; Song, Xiaona; Zuo, Xiaoxi; Xiao, Xin; Nan, Junmin

2018-02-01

Today, with the massive application of lithium ion batteries (LIBs) in the portable devices and electric vehicles, to supply the active materials with high-performances and then to recycle their wastes are two core issues for the development of LIBs. In this paper, the spent graphite (SG) in LIBs is used as raw materials to fabricate two comparative high-capacity graphite anode materials. Based on a microsurgery-like physical reconstruction, the reconstructed graphite (RG) with a sp2+sp3 carbon surface is prepared through a microwave exfoliation and subsequent spray drying process. In contrast, the neural-network-like amorphous sp2+sp3 carbon-coated graphite (AC@G) is synthesized using a self-reconfigurable chemical reaction strategy. Compared with SG and commercial graphite (CG), both RG and AC@G have enhanced specific capacities, from 311.2 mAh g-1 and 360.7 mAh g-1 to 409.7 mAh g-1 and 420.0 mAh g-1, at 0.1C after 100 cycles. In addition, they exhibit comparable cycling stability, rate capability, and voltage plateau with CG. Because the synthesis of RG and AC@G represents two typical physical and chemical methods for the recycling of SG, these results on the sp2+sp3 carbon layer coating bulk graphite also reveal an approach for the preparation of high-performance graphite anode materials derived from SG.

Utilization of the cyanobacteria Anabaena sp CH1 in biological carbon dioxide mitigation processes

Energy Technology Data Exchange (ETDEWEB)

Chiang, C.L.; Lee, C.M.; Chen, P.C. [Hungkuang University, Taichung (Taiwan)

2011-05-15

Before switching totally to alternative fuel stage, CO{sub 2} mitigation process has considered a transitional strategy for combustion of fossil fuels inevitably. In comparison to other CO{sub 2} mitigation options, such as oceanic or geologic injection, the biological photosynthetic process would present a far superior and sustainable solution under both environmental and social considerations. The utilization of the cyanobacteria Anabaena sp. CH1 in carbon dioxide mitigation processes is analyzed in our research. It was found that an original developed photobioreactor with internal light source exhibits high light utilization. Anabaena sp. CH1 demonstrates excellent CO{sub 2} tolerance even at 15% CO{sub 2} level. This enables flue gas from power plant to be directly introduced to Anabaena sp. CH1 culture. Double light intensity and increased 47% CO{sub 2} bubble retention time could enhance CO{sub 2} removal efficiencies by 79% and 67%, respectively. A maximum CO{sub 2} fixation rate of 1.01 g CO{sub 2} L{sup -1} day{sup -1} was measured experimentally.

Malachite Green and Crystal Violet Decolorization by Ganoderma lucidum and Pleurotus ostreatus Supernatant and by rGlLCC1 and rPOXA 1B Concentrates: Molecular Docking Analysis.

Science.gov (United States)

Morales-Álvarez, Edwin D; Rivera-Hoyos, Claudia M; Poveda-Cuevas, Sergio A; Reyes-Guzmán, Edwin A; Pedroza-Rodríguez, Aura M; Reyes-Montaño, Edgar A; Poutou-Piñales, Raúl A

2018-03-01

Laccases catalyze the oxidation of various aromatic organic compounds concomitantly with molecular oxygen reduction to water. Triphenylmethane dyes are synthetic compounds widely used in diverse industries. Their removal from effluents is difficult, due to their high degree of structural complexity; hence, their high concentration in effluents cause a negative impact on the environment. In the present work, molecular docking was used to evaluate interactions between rGlLCC1 or rPOXA 1B enzymes with Crystal Violet (CV) or Malachite Green (MG) dyes. In addition, removal tests of the two dyes were performed. Van der Waals interactions were obtained for only the CV dye for both GlLCC1 and POXA 1B enzymes. Nevertheless, in the GlLCC1 model, two π-π interactions were observed. For the MG dye only, Van der Waals interactions were obtained. Moreover, amino acid composition interacting in each model with each dye was similar. It is important to highlight that by molecular docking, none of the estimated ligand configurations generated hydrogen bonds. Thus, explaining the difficulty to degrade CV and MG. Regarding CV, maximum decolorization percentage was 23.6 ± 1.0% using Ganoderma lucidum supernatant and 5.0 ± 0.5% with Pleurotus ostreatus supernatant. When using recombinant laccase enzyme concentrates, decolorization percentages were 9.9 ± 0.1 and 7.5 ± 1.0% for rGlLCC1 and rPOXA 1B, respectively. On the other hand, for the MG dye, maximum decolorization percentages were 52.1 ± 5.1 and 2.3 ± 0.2% using G. lucidum and P. ostreatus concentrates, respectively. Whereas with recombinant laccase enzymatic concentrates, values of 9.4 ± 0.8% were obtained, with rGlLCC1, and 2.1 ± 0.1% when using rPOXA 1B. These findings represent an important step in bioremediation processes improvement and efficiency of industry-generated products, using environmentally friendly alternatives.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Gómez Carabalí Arnulfo

2010-03-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y ‘estopa’ de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

New lipases by mining of Pleurotus ostreatus genome.

Directory of Open Access Journals (Sweden)

Alessandra Piscitelli

Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.

Mechanism of thorium biosorption by the cells of the soil fungal isolate Geotrichum sp. dwc-1

Energy Technology Data Exchange (ETDEWEB)

Ding, Congcong; Feng, Su [Sichuan Univ., Chengdu (China). Key Laboratory of Biological Resource and Ecological Environment; Li, Xiaolong [Sichuan Univ., Chengdu (China). Key Laboratory of Radiation Physics and Technology; and others

2014-04-01

In order to understand the impact of microorganisms on the fate of thorium in soils, we investigated the thorium biosorption behavior and the corresponding mechanisms by the cells of Geotrichum sp. dwc-1, one of the dominant species of fungal group isolated from 3.5 m depth soil layer in Southwest China. It was observed that fast thorium adsorption onto cells of G. sp. dwc-1 could take place, with a high distribution coefficient K{sub d} (0.93 mL/mg) obtained, when Geotrichum sp. dwc-1and thorium concentrations were 5 g/L and 10 mg/L, respectively. The thorium biosorption behavior was dependent on the pH value, and the lower pH could disrupt cell membrane of G. sp. dwc-1. At pH 1, thorium was accumulated in the cytoplasmic region of the cells. When pH was higher than 1, thorium was adsorbed on the cell surface of G. sp. dwc-1, like in periplasmic region or in the outer membrane. FTIR study combined with biosorption experiments further indicated that the thorium distribution and binding behavior on cell surface were associated with amino, hydroxyl groups and phosphate or sulphur functional groups, and might also be governed by electrostatic interaction. Moreover, PIXE and EPBS showed that ion-exchange mechanism contributed to the thorium biosorption process, in which the tetravalent thorium ions replaced smaller counter-ions (K{sup +}, Ca{sup 2+} and Fe{sup 3+}) occuring on the cell surface. (orig.)

Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis

DEFF Research Database (Denmark)

List, Karin; Haudenschild, Christian C; Szabo, Roman

2002-01-01

of Matriptase/MT-SP1 also seriously affected hair follicle development resulting in generalized follicular hypoplasia, absence of erupted vibrissae, lack of vibrissal hair canal formation, ingrown vibrissae, and wholesale abortion of vibrissal follicles. Furthermore, Matriptase/MT-SP1-deficiency resulted...... in dramatically increased thymocyte apoptosis, and depletion of thymocytes. This study demonstrates that Matriptase/MT-SP1 has pleiotropic functions in the development of the epidermis, hair follicles, and cellular immune system....

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

Directory of Open Access Journals (Sweden)

Claudia M Rivera-Hoyos

Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range

Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

Science.gov (United States)

Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

2014-01-01

Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

Energy Technology Data Exchange (ETDEWEB)

Hong, J. S.; Kim, D.H.

1981-01-01

Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

Bioremediation of wastewater from edible oil refinery factory using oleaginous microalga Desmodesmus sp. S1.

Science.gov (United States)

Mar, Cho Cho; Fan, Yong; Li, Fu-Li; Hu, Guang-Rong

2016-12-01

Edible oil industry produced massive wastewater, which requires extensive treatment to remove pungent smell, high phosphate, carbon oxygen demand (COD), and metal ions prior to discharge. Traditional anaerobic and aerobic digestion could mainly reduce COD of the wastewater from oil refinery factories (WEORF). In this study, a robust oleaginous microalga Desmodesmus sp. S1 was adapted to grow in WEORF. The biomass and lipid content of Desmodesmus sp. S1 cultivated in the WEORF supplemented with sodium nitrate were 5.62 g·L(-1) and 14.49%, whereas those in the WEORF without adding nitrate were 2.98 g·L(-1) and 21.95%. More than 82% of the COD and 53% of total phosphorous were removed by Desmodesmus sp. S1. In addition, metal ions, including ferric, aluminum, manganese and zinc were also diminished significantly in the WEORF after microalgal growth, and pungent smell vanished as well. In comparison with the cells grown in BG-11 medium, the cilia-like bulges and wrinkles on the cell surface of Desmodesmus sp. S1 grown in WEORF became out of order, and more polyunsaturated fatty acids were detected due to stress derived from the wastewater. The study suggests that growing microalgae in WEORF can be applied for the dual roles of nutrient removal and biofuel feedstock production.

Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts

Directory of Open Access Journals (Sweden)

Milovanović Ivan

2014-01-01

Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032

Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.

Science.gov (United States)

Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G

2012-03-01

Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.

Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

Directory of Open Access Journals (Sweden)

Ira Djajanegara

2012-02-01

Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

Eficiencia de pseudomonas sp, rhodopseudomonas sp, micrococcus sp y bacillus sp empleados como cultivos individuales y en consorcio, en la degradación de petróleo diesel ii

OpenAIRE

Otiniano García, Nélida Milly Esther

2010-01-01

In order to evaluate the efficiency of Pseudomonas sp, Rhodopseudomonas sp, Micrococcus sp, Bacillus sp, and the consortium formed by these four microorganisms in the diesel II petroleum degradation, it was worked in 5 bioreactors of aerated and shaken tank of 1.5 litters of capacity, with speed agitation of 120 rpm, and air flow of 0.5 vvm; in which were placed; 940 mL of Minimum Broth of Davies pH 7.0; 50 mL of diesel II petroleum as source of carbon and 10 mL of a suspension of approx...

Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

International Nuclear Information System (INIS)

Khalaf, M.A.; Atia, A.I.

2009-01-01

Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

Science.gov (United States)

Akpinar, Merve; Urek, Raziye Ozturk

2012-01-01

Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

Competitive adsorption of heavy metals by extracellular polymeric substances extracted from Klebsiella sp. J1.

Science.gov (United States)

Yang, Jixian; Wei, Wei; Pi, Shanshan; Ma, Fang; Li, Ang; Wu, Dan; Xing, Jie

2015-11-01

The adsorption of Cu(2+) and Zn(2+) by extracellular polymeric substances (EPS) extracted from Klebsiella sp. J1 and competitive adsorption mechanism were investigated. Equilibrium adsorption capacities of Cu(2+) (1.77mMg(-1)) on Klebsiella sp. J1 EPS were higher than those of Zn(2+) (1.36mMg(-1)) in single systems. The competitive Langmuir and Langmuir-Freundlich isotherm models were proven to be effective in describing the experimental data of binary component system. The three dimensional sorption surfaces of binary component system demonstrated that the presence of Cu(2+) more significantly decreased the sorption of Zn(2+), but the sorption of Cu(2+) was not disturbed by the presence of Zn(2+). FTIR and EEM results revealed the adsorption sites of Cu(2+) entirely overlapped with those of Zn(2+). Cu(2+) and Zn(2+) showed competitive adsorption in binary systems, and Cu(2+) was preferentially adsorbed because of the stronger complexation ability of the protein-like substances in Klebsiella sp. J1 EPS. Copyright © 2015 Elsevier Ltd. All rights reserved.

Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

OpenAIRE

Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

2014-01-01

Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

Impact of serum SP-A and SP-D levels on comparison and prognosis of idiopathic pulmonary fibrosis

Science.gov (United States)

Wang, Kai; Ju, Qing; Cao, Jing; Tang, Wenze; Zhang, Jian

2017-01-01

Abstract Background and objective: Idiopathic pulmonary fibrosis (IPF) has a poor prognosis in general; however, it is heterogeneous to detect relative biomarkers for predicting the disease progression. Serum biomarkers can be conveniently collected to detect and help to differentially diagnose IPF and predict IPF prognosis. This meta-analysis aimed to evaluate the use of serum surfactant proteins A and D (SP-A and SP-D) for differential diagnosis and prognosis of IPF. Methods: Relevant articles were searched in PubMed, Embase, and Chinese National Knowledge Infrastructure databases and reviewed by 2 independent readers. Standard mean difference (SMD) and 95% confidence interval (CI) were calculated to assess the difference in serum levels of SP-A/D among patients with IPF, when compared to patients with non-IPF interstitial lung disease (ILD), pulmonary infection, and healthy control. Hazard ratio (HR) and 95% CI were used to compare the relative risk of mortality. Results: Twenty-one articles (totalling 1289 IPF patients) were included in final meta-analysis. Serum SP-A levels were significantly higher in patients with IPF than in patients with non-IPF ILD (SMD: 1.108 [0.584, 1.632], P infection (SMD: 1.320 [0.999, 1.640], P SMD: 2.802 [1.901, 3.702], P SMD: 0.459 [−0.000, 0.919], P = .050). Serum SP-D levels were significantly higher in patients with IPF than in patients with pulmonary infection (SMD: 1.308 [0.813, 1.803], P SMD: 2.235 [1.739, 2.731], P < .001). Risk of death in patients with IPF and elevated serum SP-A was increased 39% compared to patients with low SP-A groups. Elevated SP-D increased risk by 111% when compared to low SP-D. In acute exacerbation of IPF, serum SP-A/D were higher than those in stable stage. The comparisons and prognosis might be different in Asian and Caucasian patients. Conclusions: Serum SP-A/D detection might be useful for differential diagnosis and prediction of survival in patients with IPF. PMID:28591049

Crescimento e capacidade de biosorção de metais por Pleurotus sajor-caju, em cultivo líquido e em cultivo sólido

OpenAIRE

Silva, Stela Maris da

2007-01-01

Neste trabalho, avaliaram-se o crescimento e a capacidade de biosorção de metais de Pleurotus sajor-caju PS 2001, em meios de cultivo líquido e sólido, contendo sulfatos de cobre II, de ferro II, de alumínio, de zinco, de cromo II e de níquel II, em concentrações de 30 ou 60mg.100mL-1 . O crescimento e a massa micelial foram avaliados aos 7, 14 e 21 dias de desenvolvimento para cultivo líquido sendo que para cada etapa de desenvolvimento foram retiradas amostras que foram submetidas a metodol...

Inhibitory effects of soluble algae products (SAP) released by Scenedesmus sp. LX1 on its growth and lipid production.

Science.gov (United States)

Zhang, Tian-Yuan; Yu, Yin; Wu, Yin-Hu; Hu, Hong-Ying

2013-10-01

Soluble algal products (SAP) accumulated in culture medium via water reuse may affect the growth of microalga during the cultivation. Scenedesmus sp. LX1, a freshwater microalga, was used in this study to investigate the effect of SAP on growth and lipid production of microalga. Under the SAP concentrations of 6.4-25.8 mg L(-1), maximum algal density (K) and maximum growth rate (Rmax) of Scenedesmus sp. LX1 were decreased by 50-80% and 35-70% compared with the control group, respectively. The effect of SAP on lipid accumulation of Scenedesmus sp. LX1 was non-significant. According to hydrophilic-hydrophobic and acid-base properties, SAP was fractionized into six fractions. All of the fractions could inhibit the growth of Scenedesmus sp. LX1. Organic bases (HIB, HOB) and hydrophilic acids (HIA) showed the strongest inhibition. HIA could also decrease the lipid content of Scenedesmus sp. LX1 by 59.2%. As the inhibitory effect, SAP should be seriously treated before water reuse. Copyright © 2013 Elsevier Ltd. All rights reserved.

Prevalence of Metabolic Syndrome according to Sasang Constitutional Medicine in Korean Subjects.

Science.gov (United States)

Song, Kwang Hoon; Yu, Sung-Gon; Kim, Jong Yeol

2012-01-01

Metabolic syndrome (MS) is a complex disorder defined by a cluster of abdominal obesity, atherogenic dyslipidemia, hyperglycemia, and hypertension; the condition is recognized as a risk factor for diabetes and cardiovascular disease. This study assessed the effects of the Sasang constitution group (SCG) on the risk of MS in Korean subjects. We have analyzed 1,617 outpatients of Korean oriental medicine hospitals who were classified into three SCGs, So-Yang, So-Eum, and Tae-Eum. Significant differences were noted in the prevalence of MS and the frequencies of all MS risk factors among the three SCGs. The odds ratios for MS as determined via multiple logistic regression analysis were 2.004 for So-Yang and 4.521 for Tae-Eum compared with So-Eum. These results indicate that SCG may function as a significant risk factor of MS; comprehensive knowledge of Sasang constitutional medicine may prove helpful in predicting susceptibility and developing preventive care techniques for MS.

Prevalence of Metabolic Syndrome according to Sasang Constitutional Medicine in Korean Subjects

Directory of Open Access Journals (Sweden)

Kwang Hoon Song

2012-01-01

Full Text Available Metabolic syndrome (MS is a complex disorder defined by a cluster of abdominal obesity, atherogenic dyslipidemia, hyperglycemia, and hypertension; the condition is recognized as a risk factor for diabetes and cardiovascular disease. This study assessed the effects of the Sasang constitution group (SCG on the risk of MS in Korean subjects. We have analyzed 1,617 outpatients of Korean oriental medicine hospitals who were classified into three SCGs, So-Yang, So-Eum, and Tae-Eum. Significant differences were noted in the prevalence of MS and the frequencies of all MS risk factors among the three SCGs. The odds ratios for MS as determined via multiple logistic regression analysis were 2.004 for So-Yang and 4.521 for Tae-Eum compared with So-Eum. These results indicate that SCG may function as a significant risk factor of MS; comprehensive knowledge of Sasang constitutional medicine may prove helpful in predicting susceptibility and developing preventive care techniques for MS.

Diversidade de Agaricales (Basidiomycota na Reserva Biológica Walter Egler, Amazonas, Brasil Diversity of Agaricales (Basidiomycota in the Reserva Biológica Walter Egler, Amazonas, Brazil

Directory of Open Access Journals (Sweden)

Helenires Queiroz de Souza

2004-01-01

Full Text Available Foi realizado um estudo dos representantes da Ordem Agaricales Clements (Hymenomycetes, Basidiomycotina, ocorrentes na Reserva Biológica Walter Egler, situada na Estrada AM-010, Manaus-Itacoatiara, Km 64, Latitude 02° 43' S e Longitude 59° 47' W, Rio Preto da Eva, Amazonas. A área abrange 709 ha de floresta de terra firme primária. As coletas foram realizadas no período de dezembro de 2000 a junho de 2001 e seguiu-se a metodologia usual para identificação de Agaricales. Foram estudadas um total de 39 espécies, distribuídas em 13 gêneros e seis famílias: Polyporaceae: Pleurotus sp.; Hygrophoraceae: Hygrocybe cf. megistospora, Hygrocybe aff. miniceps, Hygrocybe occidentalis var. scarletina, e mais oito espécies de Hygrocybe indeterminadas; Tricholomataceae: Clitocybe sp., Hydropus sp.1 e Hydropus sp.2, Macrocystidia sp., Marasmiellus sp., Marasmius bellus, Marasmius haedinus var. haedinus,Marasmius cf. leoninus, Marasmius cf. mazatecus, Marasmius cf. ruber,Marasmius cf. setulosifolius, Marasmius tageticolor, Marasmius cf. variabiliceps var. variabiliceps, Marasmius sp.1, Marasmius sp.2, Marasmius sp.3 e Marasmius sp.4, Tricholoma sp.; Agaricaceae: Agaricus sp.1 e Agaricus sp.2, Lepiota sp., Cystoderma sp.; Entolomataceae: Entoloma cf. azureoviride, Entoloma cf. cystidiophorum, Entoloma strigosissima, Entoloma sp.; Russulaceae: Lactarius panuoides. Destas, Entoloma azureoviride, Hygrocybe miniceps, Lactarius panuoides, Marasmius cf. mazatecus, Marasmius cf. setulosifolius e Marasmius variabiliceps var. variabiliceps, provavelmente, estão sendo aqui citadas pela primeira vez, para o Brasil. Com exceção de Marasmius tageticolor, as demais espécies são citadas pela primeira vez, para a Reserva Egler. São fornecidas tabelas com a ocorrência das espécies de acordo com o gradiente topográfico (baixio, vertente, platô e seus respectivos habitats.A study of the order Agaricales Clements (Hymenomycetes, Basidiomycotina, occurring in

A putative serine protease, SpSsp1, from Saprolegnia parasitica is recognised by sera of rainbow trout, Oncorhynchus mykiss

Science.gov (United States)

Minor, Kirsty L.; Anderson, Victoria L.; Davis, Katie S.; Van Den Berg, Albert H.; Christie, James S.; Löbach, Lars; Faruk, Ali Reza; Wawra, Stephan; Secombes, Chris J.; Van West, Pieter

2014-01-01

Saprolegniosis, the disease caused by Saprolegnia sp., results in considerable economic losses in aquaculture. Current control methods are inadequate, as they are either largely ineffective or present environmental and fish health concerns. Vaccination of fish presents an attractive alternative to these control methods. Therefore we set out to identify suitable antigens that could help generate a fish vaccine against Saprolegnia parasitica. Unexpectedly, antibodies against S. parasitica were found in serum from healthy rainbow trout, Oncorhynchus mykiss. The antibodies detected a single band in secreted proteins that were run on a one-dimensional SDS-polyacrylamide gel, which corresponded to two protein spots on a two-dimensional gel. The proteins were analysed by liquid chromatography tandem mass spectrometry. Mascot and bioinformatic analysis resulted in the identification of a single secreted protein, SpSsp1, of 481 amino acid residues, containing a subtilisin domain. Expression analysis demonstrated that SpSsp1 is highly expressed in all tested mycelial stages of S. parasitica. Investigation of other non-infected trout from several fish farms in the United Kingdom showed similar activity in their sera towards SpSsp1. Several fish that had no visible saprolegniosis showed an antibody response towards SpSsp1 suggesting that SpSsp1 might be a useful candidate for future vaccination trial experiments. PMID:25088077

Characterization of a marine-isolated mercury-resistant Pseudomonas putida strain SP1 and its potential application in marine mercury reduction

Energy Technology Data Exchange (ETDEWEB)

Zhang, Weiwei; Chen, Lingxin; Liu, Dongyan [Chinese Academy of Sciences, Yantai, SD (China). Yantai Inst. of Coastal Zone Research (YICCAS); Chinese Academy of Sciences, Yantai, SD (China). Shandong Provincial Key Lab. of Coastal Zone Environmental Processes

2012-02-15

The Pseudomonas putida strain SP1 was isolated from marine environment and was found to be resistant to 280 {mu}M HgCl{sub 2}. SP1 was also highly resistant to other metals, including CdCl{sub 2}, CoCl{sub 2}, CrCl{sub 3}, CuCl{sub 2}, PbCl{sub 2}, and ZnSO{sub 4}, and the antibiotics ampicillin (Ap), kanamycin (Kn), chloramphenicol (Cm), and tetracycline (Tc). mer operon, possessed by most mercury-resistant bacteria, and other diverse types of resistant determinants were all located on the bacterial chromosome. Cold vapor atomic absorption spectrometry and a volatilization test indicated that the isolated P. putida SP1 was able to volatilize almost 100% of the total mercury it was exposed to and could potentially be used for bioremediation in marine environments. The optimal pH for the growth of P. putida SP1 in the presence of HgCl{sub 2} and the removal of HgCl{sub 2} by P. putida SP1 was between 8.0 and 9.0, whereas the optimal pH for the expression of merA, the mercuric reductase enzyme in mer operon that reduces reactive Hg{sup 2+} to volatile and relatively inert monoatomic Hg{sup 0} vapor, was around 5.0. LD50 of P. putida SP1 to flounder and turbot was 1.5 x 10{sup 9} CFU. Biofilm developed by P. putida SP1 was 1- to 3-fold lower than biofilm developed by an aquatic pathogen Pseudomonas fluorescens TSS. The results of this study indicate that P. putida SP1 is a low virulence strain that can potentially be applied in the bioremediation of HgCl{sub 2} contamination over a broad range of pH. (orig.)

Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

Science.gov (United States)

Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

2016-08-01

The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.

Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

2014-09-03

Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

Five novel Wickerhamomyces- and Metschnikowia-related yeast species, Wickerhamomyces chaumierensis sp. nov., Candida pseudoflosculorum sp. nov., Candida danieliae sp. nov., Candida robnettiae sp. nov. and Candida eppingiae sp. nov., isolated from plants

NARCIS (Netherlands)

Groenewald, Marizeth; Robert, Vincent; Smith, Maudy Th

On the basis of nucleotide divergences in the D1/D2 domain of the 26S rRNA gene and the internal transcribed spacers (ITS) domain of the rRNA gene, five novel yeast species, Wickerhamomyces chaumierensis sp. nov. (CBS 8565(T)  = JCM 17246(T)), Candida pseudoflosculorum sp. nov. (CBS 8584(T)  = JCM

Bifidobacterium reuteri sp. nov., Bifidobacterium callitrichos sp. nov., Bifidobacterium saguini sp. nov., Bifidobacterium stellenboschense sp. nov. and Bifidobacterium biavatii sp. nov. isolated from faeces of common marmoset (Callithrix jacchus) and red-handed tamarin (Saguinus midas).

Science.gov (United States)

Endo, Akihito; Futagawa-Endo, Yuka; Schumann, Peter; Pukall, Rüdiger; Dicks, Leon M T

2012-03-01

Five strains of bifidobacteria were isolated from faeces of a common marmoset (Callithrix jacchus) and a red-handed tamarin (Saguinus midas). The five isolates clustered inside the phylogenetic group of the genus Bifidobacterium but did not show high sequence similarities between the isolates and to known species in the genus by phylogenetic analysis based on 16S rRNA gene sequences. Sequence analyses of dnaJ1 and hsp60 also indicated their independent phylogenetic positions to each other in the Bifidobacterium cluster. DNA G+C contents of the species ranged from 57.3 to 66.3 mol%, which is within the values recorded for Bifidobacterium species. All isolates showed fructose-6-phosphate phosphoketolase activity. Based on the data provided, the five isolates represent five novel species, for which the names Bifidobacterium reuteri sp. nov. (type strain: AFB22-1(T) = JCM 17295(T) = DSM 23975(T)), Bifidobacterium callitrichos sp. nov. (type strain: AFB22-5(T) = JCM 17296(T) = DSM 23973(T)), Bifidobacterium saguini sp. nov. (type strain: AFB23-1(T) = JCM 17297(T) = DSM 23967(T)), Bifidobacterium stellenboschense sp. nov. (type strain: AFB23-3(T) = JCM 17298(T) = DSM 23968(T)) and Bifidobacterium biavatii sp. nov. (type strain: AFB23-4(T) = JCM 17299(T) = DSM 23969(T)) are proposed. Copyright © 2011 Elsevier GmbH. All rights reserved.

Hsp27 promotes ABCA1 expression and cholesterol efflux through the PI3K/PKCζ/Sp1 pathway in THP-1 macrophages.

Science.gov (United States)

Kuang, Hai-Jun; Zhao, Guo-Jun; Chen, Wu-Jun; Zhang, Min; Zeng, Gao-Feng; Zheng, Xi-Long; Tang, Chao-Ke

2017-09-05

Heat shock protein 27 (Hsp27) is a putative biomarker and therapeutic target in atherosclerosis. This study was to explore the potential mechanisms underlying Hsp27 effects on ATP-binding cassette transporter A1 (ABCA1) expression and cellular cholesterol efflux. THP-1 macrophage-derived foam cells were infected with adenovirus to express wild-type Hsp27, hyper-phosphorylated Hsp27 mimic (3D Hsp27), antisense Hsp27 or hypo-phosphorylated Hsp27 mimic (3A Hsp27). Wild-type and 3D Hsp27 were found to up-regulate ABCA1 mRNA and protein expression and increase cholesterol efflux from cells. Expression of antisense or 3A Hsp27 suppressed the expression of ABCA1 and cholesterol efflux. Furthermore, over-expression of wild-type and 3D Hsp27 significantly increased the levels of phosphorylated specificity protein 1 (Sp1), protein kinase C ζ (PKCζ) and phosphatidylinositol 3-kinase (PI3K). In addition, the up-regulation of ABCA1 expression and cholesterol efflux induced by 3D Hsp27 was suppressed by inhibition of Sp1, PKCζ and PI3K with specific kinase inhibitors. Taken together, our results revealed that Hsp27 may up-regulate the expression of ABCA1 and promotes cholesterol efflux through activation of the PI3K/PKCζ/Sp1 signal pathway in THP-1 macrophage-derived foam cells. Our findings may partly explain the mechanisms underlying the anti-atherogenic effect of Hsp27. Copyright © 2017 Elsevier B.V. All rights reserved.

Pengaruh Perbedaan Konsentrasi Ekstrak Sargassum sp. dan Lama Penyimpanan terhadap Oksidasi Lemak pada Fillet Ikan Patin (Pangasius sp.

Directory of Open Access Journals (Sweden)

Fatin Hidayati

2017-05-01

Full Text Available ABSTRAK Ikan patin merupakan ikan air tawar yang mengandung lemak dan protein tinggi sehingga apabila dilakukan penyimpanan rentan terjadi oksidasi yang mengakibatkan ketengikan. Sargassum sp. dengan kandungan fenol dan flavonoid mampu menghambat terjadinya oksidasi pada fillet ikan patin. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan ekstrak Sargassum sp. dan lama penyimpanan dalam menghambat terjadinya oksidasi pada fillet ikan patin. Materi yang digunakan dalam penelitian ini adalah ekstrak Sargassum sp. dan fillet ikan patin. Metode penelitian yang digunakan adalah experimental laboratories dengan menggunakan Rancangan Acak Lengkap (RAL faktorial dengan 2 faktor yaitu konsentrasi ekstrak Sargassum sp. (0%, 1%, 1,5% dan 2% dan lama penyimpanan (hari ke-0, hari ke-2, hari ke-4, dan hari ke-6. Hasil penelitian menunjukkan bahwa perbedaan penambahan konsentrasi ekstrak Sargassum sp. dan lama penyimpanan memberikan pengaruh nyata terhadap nilai PV, nilai TBA, kadar lemak, kadar protein, kadar air serta organoleptik (P < 0,05. Hasil penelitian tahap I didapatkan rendemen Sargassum sp. dengan pelarut etanol 96% sebesar 1,39%, kandungan fenol 1,813%, flavonoid 0,278% dan aktivitas antioksidan 99,1659 ppm (kuat. Hasil penelitian tahap II didapatkan nilai PV berkisar antara 2,03 - 19,82 meq/kg, nilai TBA 0,63 - 6,72 mg.mal/kg. Konsentrasi 1,5% merupakan konsentrasi terbaik ekstrak Sargassum sp. dalam menghambat oksidasi lemak pada fillet ikan patin selama penyimpanan. Kata kunci: Antioksidan, Ekstrak Sargassum sp., Lama Penyimpanan, Oksidasi lemak, Fillet Ikan patin ABSTRACT Catfish is a freshwater fish that contain high fat and protein so that if its stored it will susceptible to oxidation process which leads to rancidity. Sargassum sp. with its phenolic and flavonoid content are able to inhibit the oxidation process in catfish fillet. This research was aimed to know the effects of different concentrations of Sargassum sp. extracts and

Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

Science.gov (United States)

Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

2016-11-01

Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

Novel structural features of xylanase A1 from Paenibacillus sp. JDR-2

Science.gov (United States)

Franz J. St John; James F. Preston; Edwin Pozharski

2012-01-01

The Gram-positive bacterium Paenibacillus sp. JDR-2 (PbJDR2) has been shown to have novel properties in the utilization of the abundant but chemically complex hemicellulosic sugar glucuronoxylan. Xylanase A1 of PbJDR2 (PbXynA1) has been implicated in an efficient process in which extracellular...

Babesia sp. EU1 from Roe Deer and Transmission within Ixodes ricinus

Science.gov (United States)

Jouglin, Maggy; L’Hostis, Monique; Chauvin, Alain

2007-01-01

We report in vitro culture of zoonotic Babesia sp. EU1 from blood samples of roe deer in France. This study provides evidence of transovarial and transstadial transmission of the parasite within Ixodes ricinus, which suggests that this tick could be a vector and reservoir of EU1. PMID:17953093

Copper tolerance in Frankia sp. strain EuI1c involves surface binding and copper transport.

Science.gov (United States)

Rehan, Medhat; Furnholm, Teal; Finethy, Ryan H; Chu, Feixia; El-Fadly, Gomaah; Tisa, Louis S

2014-09-01

Several Frankia strains have been shown to be copper-tolerant. The mechanism of their copper tolerance was investigated for Frankia sp. strain EuI1c. Copper binding was shown by binding studies. Unusual globular structures were observed on the surface of the bacterium. These globular structures were composed of aggregates containing many relatively smaller "leaf-like" structures. Scanning electron microscopy with energy-dispersive X-ray (SEM-EDAX) analysis of these structures indicated elevated copper and phosphate levels compared to the control cells. Fourier transform infrared spectroscopy (FTIR) analysis indicated an increase in extracellular phosphate on the cell surface of copper-stressed cells. Bioinformatics' analysis of the Frankia sp. strain EuI1c genome revealed five potential cop genes: copA, copZ, copC, copCD, and copD. Experiments with Frankia sp. strain EuI1c using qRT-PCR indicated an increase in messenger RNA (mRNA) levels of the five cop genes upon Cu(2+) stress. After 5 days of Cu(2+) stress, the copA, copZ, copC, copCD, and copD mRNA levels increased 25-, 8-, 18-, 18-, and 25-fold, respectively. The protein profile of Cu(2+)-stressed Frankia sp. strain EuI1c cells revealed the upregulation of a 36.7 kDa protein that was identified as FraEuI1c_1092 (sulfate-binding periplasmic transport protein). Homologues of this gene were only present in the genomes of the Cu(2+)-resistant Frankia strains (EuI1c, DC12, and CN3). These data indicate that copper tolerance by Frankia sp. strain EuI1c involved the binding of copper to the cell surface and transport proteins.

Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation

Directory of Open Access Journals (Sweden)

Gian Luigi Rana

2013-03-01

Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.

Membrane-aerated biofilm reactor for the removal of 1,2-dichloroethane by Pseudomonas sp strain DCA1

NARCIS (Netherlands)

Hage, J.C.; Houten, R.T.; Tramper, J.; Hartmans, S.

2004-01-01

A membrane-aerated biofilm reactor (MBR) with a biofilm of Pseudomonas sp. strain DCA1 was studied for the removal of 1,2-dichloroethane (DCA) from water. A hydrophobic membrane was used to create a barrier between the liquid and the gas phase. Inoculation of the MBR with cells of strain DCA1 grown

Modular Stereoselective Synthesis of (1 -> 2)-C-Glycosides based on the sp(2)-sp(3) Suzuki-Miyaura Reaction

Czech Academy of Sciences Publication Activity Database

Oroszová, B.; Choutka, J.; Pohl, Radek; Parkan, K.

2015-01-01

Roč. 21, č. 19 (2015), s. 7043-7047 ISSN 0947-6539 Grant - others:GA ČR(CZ) GPP207/12/P713; GA ČR(CZ) GA15-17572S Institutional support: RVO:61388963 Keywords : C-disaccharides * C-glycosides * diastereoselectivity * Mitsunobu reaction * sp(2)-sp(3) coupling Subject RIV: CC - Organic Chemistry Impact factor: 5.771, year: 2015

Babesia sp. BQ1 (Lintan): molecular evidence of experimental transmission to sheep by Haemaphysalis qinghaiensis and Haemaphysalis longicornis.

Science.gov (United States)

Guan, Guiquan; Moreau, Emmanuelle; Liu, Junlong; Hao, Xuefen; Ma, Miling; Luo, Jianxun; Chauvin, Alain; Yin, Hong

2010-06-01

Ovine babesiosis is an economically important disease induced by tick transmitted haemoparasites throughout the world. In China, several ovine Babesia strains have been isolated from field-collected ticks or sheep blood during the last two decades but little is known about the vector ticks and transmission pattern. Babesia sp. BQ1 (Lintan) is a Babesia strain infective for sheep and goats, isolated from blood of sheep experimentally infested with Haemaphysalis qinghaiensis collected in field. In the present study, we explored the experimental transmission of Babesia sp. BQ1 (Lintan) to sheep by H. qinghaiensis and Haemaphysalis longicornis. Based on the evidence from nested PCR, it suggested that H. qinghaiensis and H. longicornis are the potential vector ticks of Babesia sp. BQ1 (Lintan) and that larvae, nymphs and adults of both tick species were able to transmit Babesia sp. BQ1 (Lintan) to sheep. Parasites could be detected in the blood, by specific nested PCR, for one month post-infestation.

The prototype HIV-1 maturation inhibitor, bevirimat, binds to the CA-SP1 cleavage site in immature Gag particles

Directory of Open Access Journals (Sweden)

Nguyen Albert T

2011-12-01

Full Text Available Abstract Background Bevirimat, the prototype Human Immunodeficiency Virus type 1 (HIV-1 maturation inhibitor, is highly potent in cell culture and efficacious in HIV-1 infected patients. In contrast to inhibitors that target the active site of the viral protease, bevirimat specifically inhibits a single cleavage event, the final processing step for the Gag precursor where p25 (CA-SP1 is cleaved to p24 (CA and SP1. Results In this study, photoaffinity analogs of bevirimat and mass spectrometry were employed to map the binding site of bevirimat to Gag within immature virus-like particles. Bevirimat analogs were found to crosslink to sequences overlapping, or proximal to, the CA-SP1 cleavage site, consistent with previous biochemical data on the effect of bevirimat on Gag processing and with genetic data from resistance mutations, in a region predicted by NMR and mutational studies to have α-helical character. Unexpectedly, a second region of interaction was found within the Major Homology Region (MHR. Extensive prior genetic evidence suggests that the MHR is critical for virus assembly. Conclusions This is the first demonstration of a direct interaction between the maturation inhibitor, bevirimat, and its target, Gag. Information gained from this study sheds light on the mechanisms by which the virus develops resistance to this class of drug and may aid in the design of next-generation maturation inhibitors.

Incidencia del medio y de las condiciones de cultivo en el potencial como nutriceútico de tres especies del genero Pleurotus

OpenAIRE

Chegwin Angarita, Carolina

2014-01-01

El cultivo biotecnológico empleando fermentaciones en estado líquido de hongos del género Pleurotus, usando salvado de trigo y harinas de cereales y leguminosas como fuentes de carbono no convencionales, en busca de evaluar el efecto del cambio de algunas condiciones del proceso sobre la composición tanto de los micelios como de los caldos agotados y por ende del potencial como nutriceútico del mismo, para posteriormente evaluar la aplicabilidad de dicho producto en la obtención de fructifica...

Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

2012-12-01

Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

Exopolysaccharides from Pleurotus pulmonarius: Fermentation Optimization, Characterization and Antioxidant Activity

Directory of Open Access Journals (Sweden)

Jin-Wen Shen

2013-01-01

Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.

Transcriptional regulation of BRD7 expression by Sp1 and c-Myc

Directory of Open Access Journals (Sweden)

Li Shufang

2008-12-01

Full Text Available Abstract Background Bromodomain is an evolutionally conserved domain that is found in proteins strongly implicated in signal-dependent transcriptional regulation. Genetic alterations of bromodomain genes contributed to the development of many human cancers and other disorders. BRD7 is a recently identified bromodomain gene. It plays a critical role in cellular growth, cell cycle progression, and signal-dependent gene expression. Previous studies showed that BRD7 gene exhibited much higher-level of mRNA expression in normal nasopharyngeal epithelia than in nasopharyngeal carcinoma (NPC biopsies and cell lines. However, little is known about its transcriptional regulation. In this study, we explored the transcriptional regulation of BRD7 gene. Method Potential binding sites of transcription factors within the promoter region of BRD7 gene were predicted with MatInspector Professional http://genomatix.de/cgi-bin/matinspector_prof/mat_fam.pl. Mutation construct methods and luciferase assays were performed to define the minimal promoter of BRD7 gene. RT-PCR and western blot assays were used to detect the endogenous expression of transcription factor Sp1, c-Myc and E2F6 in all cell lines used in this study. Electrophoretic mobility shift assays (EMSA and Chromatin immunoprecipitation (ChIP were used to detect the direct transcription factors that are responsible for the promoter activity of BRD7 gene. DNA vector-based siRNA technology and cell transfection methods were employed to establish clone pools that stably expresses SiRNA against c-Myc expression in nasopharyngeal carcinoma 5-8F cells. Real-time PCR was used to detect mRNA expression of BRD7 gene in 5-8F/Si-c-Myc cells. Results We defined the minimal promoter of BRD7 gene in a 55-bp region (from -266 to -212bp, and identified that its promoter activity is inversely related to c-Myc expression. Sp1 binds to the Sp1/Myc-Max overlapping site of BRD7 minimal promoter, and slightly positively

Effect of nitrogen sources on biomass, lipid and docosahexanoic acid production by Aurantiochytrium sp. SW1

Science.gov (United States)

Auma, Khairunnisa; Hamid, Aidil Abdul; Yusoff, Wan Mohtar Wan

2018-04-01

A local isolate, Aurantiochytrium sp. SW1 has been verified to have high content of docosahexanoic acid (DHA). However, the effect of different nitrogen sources on biomass, lipid concentration and DHA content in Aurantiochytrium sp. SW1 is still unknown. Hence, this study is focused in using six different organic and inorganic nitrogen sources to grow Aurantiochytrium sp. SW1 in optimized Burja medium. Monosodium glutamate (MSG) gave the highest biomass concentration of 15.97 g/L followed by ammonium nitrate (NH4NO3) with 13.37 g/L at 96 hr. These two nitrogen sources had significant effect on the biomass concentration (pDHA content in lipid showed cultivation using MSG reached 47.9% (4.95 g/L). Statistical analysis using least significant difference (LSD) showed significant lipid production (pDHA productivity (0.052 g/L hr-1) was obtained in medium containing MSG. This study proves that nitrogen component in the medium significantly affects the biomass concentration, lipid and DHA content.

Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

Science.gov (United States)

Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

2013-01-01

With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

The effect of temperature on the nutritional quality of feed from biological treated oil palm empty fruit bunch by Pleurotus sajor caju

International Nuclear Information System (INIS)

Mat Rasol Awang; Hassan Hamdani Mutaat; Yusri Atan; Tamikazu Kume; Shoji Hashimoto; Shinpei Matsuhashi

1998-01-01

In solid state fermentation, Pleurotus sajor caju degrades oil palm Empty Fruit Bunch (EFB) fibre to give a useful feed material (1). Its chemical composition, dry matter digestibility both in vitro and in vivo have been characterised and described previously (2). However, the performance of this microorganism in degradation activity has not been described. Since CO sub 2 is the most important metabolic product of this fermentation, the microbial degradation activity is directly related to the rate and total CO sub 2 evolved in the fermentation. In this work a range of temperature were selected for fermentation, aiming to suit its practical application for countries of tropical climate in general, particularly Malaysia. The nutritional quality of fermented products obtained from the fermentation at different temperature were analysed and discussed

Docetaxel Hidrat Menghambat Proliferasi dan Metastasis Sel Kanker Oral SP-C1 melalui Induksi Protein Maspin

Directory of Open Access Journals (Sweden)

Supriatno Supriatno

2013-07-01

Full Text Available Human oral tongue cancer (SP-C1 is thought to be a high grade malignancy. Despite advances in surgery, radiotherapy, chemotherapy and combination therapy, prognosis and survival of patients with human tongue cancer have not significantly improved over the past several decades. Treatment options for recurrent or refractory tongue cancer are limited. Therefore, as a strategy for refractory cancer, anti-mitotic chemotherapy and its mechanisms are of considerable interest, including those using docetaxel hydrate for inducing maspin protein. In the current study, the mechanisms responsible for growth suppression and metastasis of SP-C1 by docetaxel hydrate through induction of maspin regulation were investigated. To evaluate in vitro cell proliferation and cell metastasis, MTT and out-growth assays were performed, respectively. Furthermore, the expression of maspin mediated by docetaxel hydrate was analysed by Western blotting. The results showed that treatment with 50 g/ml docetaxel hydrate significantly suppressed SP-C1 cell growth from day 1. Strong inhibition of metastasis of SP-C1 cells was also shown by treatment with 50 g/ml of docetaxel hydrate. Moreover, a significant induction of maspin regulation was detected in cells treated with 10 and 50 g/ml of docetaxel hydrate. However, the same protein level was demonstrated in -tubulin expression. These findings suggest that docetaxel hydrate may have potential for powerful anti-mitotic chemotherapy through induction of maspin regulation.DOI: 10.14693/jdi.v15i1.77

Cyclin A regulates a cell-cycle-dependent expression of CKAP2 through phosphorylation of Sp1

International Nuclear Information System (INIS)

Kang, Du-Seock; Hong, Kyeong-Man; Park, Joobae; Bae, Chang-Dae

2012-01-01

Highlights: ► We identified a GC box and a CHR element in human CKAP2 minimal promoter. ► The CHR element repressed the CKAP2 minimal promoter activity at the G1/S phase. ► The GC box was essential for the basic promoter activity of human CKAP2. ► The GC box was also essential for the cyclic expression of human CKAP2. ► The phosphorylation of Sp1, mediated by Cyclin A, underlies the cyclic expression. -- Abstract: CKAP2 plays crucial roles in proper chromosome segregation and maintaining genomic stability. CKAP2 protein showed cell-cycle-dependent expression, which reached a maximum level at the G2/M phase and disappeared at the onset of G1 phase. To elucidate the mechanisms underlying cell cycle-dependent expression of CKAP2, we cloned and analyzed the human CKAP2 promoter. The upstream 115-bp region from the transcription start site was sufficient for minimal CKAP2 promoter activity. We identified 2 regulatory sequences; a CHR (−110 to −104 bp) and a GC box (−41 to −32 bp). We confirmed Sp1 bound to the GC box using a supershift assay and a ChIP assay. Mutation in the GC box resulted in a near complete loss of CKAP2 promoter activity while mutation in the CHR decreased the promoter activity by 50%. The CHR mutation showed enhanced activity at the G1/S phase, but still retained cyclic activity. The Chromatin IP revealed that the amount of Sp1 bound to the GC box gradually increased and reached a maximum level at the G2/M phase. The amount of Sp1 bound to the GC box was greatly reduced when Cyclin A was depleted, which was restored by adding Cyclin A/Cdk2 complex back into the nuclear extracts. Together, we concluded that the GC box was responsible for the cyclic activity of human CKAP2 promoter through the phosphorylation of Sp1, possibly by Cyclin A/Cdk complex.

Systematic review of type-specific pathophysiological symptoms of Sasang typology

Directory of Open Access Journals (Sweden)

Yoo Ri Han

2016-06-01

Full Text Available Previous studies on the Sasang typology have focused on the differential diagnosis of each Sasang type with type-specific pathophysiological symptoms (TSPS. The purpose of this study was to elucidate the latent physiological mechanism related to these clinical indicators. We searched six electronic databases for articles published from 1990 to 2015 using the Sasang typology-related keywords, and found and analyzed 35 such articles. The results were summarized into six TSPS categories: perspiration, temperature preference, sleep, defecation, urination, and susceptibility to stress. The Tae-Eum and So-Eum types showed contrasting features with TSPS, and the So-Yang type was in the middle. The Tae-Eum type has good digestive function, regular bowel movement and defecation, high sleep quality, and low susceptibility to stress and cold. The Tae-Eum type has relatively large volumes of sweat and feels fresh after sweating; however, the urine is highly concentrated. These clinical features might be related to the biopsychological traits of the Tae-Eum type, including a low trait anxiety level and high ponderal and body mass indices. This study used the autonomic reactivity hypothesis for explaining the pathophysiological predispositions in the Sasang typology. The Tae-Eum and So-Eum Sasang types have a low threshold in parasympathetic and sympathetic activation, respectively. This study provides a foundation for integrating traditional Korean personalized medicine and Western biomedicine.

A dioxygenase of Pleurotus sapidus transforms (+)-valencene regio-specifically to (+)-nootkatone via a stereo-specific allylic hydroperoxidation.

Science.gov (United States)

Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G

2010-01-01

A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.

Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria

OpenAIRE

da Silva, F?bio Daniel Flor?ncio; Lima, Alex Ranieri Jer?nimo; Moraes, Pablo Henrique Gon?alves; Siqueira, Andrei Santos; Dall?Agnol, Leonardo Teixeira; Bara?na, Anna Rafaella Ferreira; Martins, Luisa Car?cio; Oliveira, Karol Guimar?es; de Lima, Clayton Pereira Silva; Nunes, M?rcio Roberto Teixeira; Vianez-J?nior, Jo?o L?dio Silva Gon?alves; Gon?alves, Evonnildo Costa

2016-01-01

Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here.

Tratamento do feno de braquiária pelo fungo Pleurotus ostreatus Pretreatment effects on fiber degradation of brachiaria hay by Pleurotus ostreatus fungus

Directory of Open Access Journals (Sweden)

Patrick Schmidt

2003-12-01

Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus

Characterization of the novel dimethyl sulfide-degrading bacterium Alcaligenes sp. SY1 and its biochemical degradation pathway

Energy Technology Data Exchange (ETDEWEB)

Sun, Yiming; Qiu, Jiguo; Chen, Dongzhi; Ye, Jiexu; Chen, Jianmeng, E-mail: jchen@zjut.edu.cn

2016-03-05

Highlights: • A novel efficient DMS-degrading bacterium Alcaligenes sp. SY1 was identified. • A RSM was applied to optimize incubation condition of Alcaligenes sp. SY1. • SIP was applied as C{sup 13} labelled DMS to trace intermediates during DMS degradation. • Kinetics of DMS degradation via batch experiment was revealed. • Carbon and sulfur balance were analyzed during DMS degradation process. - Abstract: Recently, the biodegradation of volatile organic sulfur compounds (VOSCs) has become a burgeoning field, with a growing focus on the reduction of VOSCs. The reduction of VOSCs encompasses both organic emission control and odor control. Herein, Alcaligenes sp. SY1 was isolated from active sludge and found to utilize dimethyl sulfide (DMS) as a growth substrate in a mineral salt medium. Response surface methodology (RSM) analysis was applied to optimize the incubation conditions. The following conditions for optimal degradation were identified: temperature 27.03 °C; pH 7.80; inoculum salinity 0.84%; and initial DMS concentration 1585.39 μM. Under these conditions, approximately 99% of the DMS was degraded within 30 h of incubation. Two metabolic compounds were detected and identified by gas chromatography–mass spectrometry (GC–MS): dimethyl disulfide (DMDS) and dimethyl trisulfide (DMTS). The DMS degradation kinetics for different concentrations were evaluated using the Haldane–Andrews model and the pseudo first-order model. The maximum specific growth rate and degradation rate of Alcaligenes sp. SY1 were 0.17 h{sup −1} and 0.63 gs gx{sup −1} h{sup −1}. A possible degradation pathway is proposed, and the results suggest that Alcaligenes sp. SY1 has the potential to control odor emissions under aerobic conditions.

Transcription factors ETF, E2F, and SP-1 are involved in cytokine-independent proliferation of murine hepatocytes.

Science.gov (United States)

Zellmer, Sebastian; Schmidt-Heck, Wolfgang; Godoy, Patricio; Weng, Honglei; Meyer, Christoph; Lehmann, Thomas; Sparna, Titus; Schormann, Wiebke; Hammad, Seddik; Kreutz, Clemens; Timmer, Jens; von Weizsäcker, Fritz; Thürmann, Petra A; Merfort, Irmgard; Guthke, Reinhard; Dooley, Steven; Hengstler, Jan G; Gebhardt, Rolf

2010-12-01

The cellular basis of liver regeneration has been intensely investigated for many years. However, the mechanisms initiating hepatocyte "plasticity" and priming for proliferation are not yet fully clear. We investigated alterations in gene expression patterns during the first 72 hours of C57BL/6N mouse hepatocyte culture on collagen monolayers (CM), which display a high basal frequency of proliferation in the absence of cytokines. Although many metabolic genes were down-regulated, genes related to mitogen-activated protein kinase (MAPK) signaling and cell cycle were up-regulated. The latter genes showed an overrepresentation of transcription factor binding sites (TFBS) for ETF (TEA domain family member 2), E2F1 (E2F transcription factor 1), and SP-1 (Sp1 transcription factor) (P ETF, E2F1, and SP-1 and displayed increased expression of E2F1. Cultivation of murine hepatocytes on CM primes cells for proliferation through cytokine-independent activation of MAPK signaling. The transcription factors ETF, E2F1, and SP-1 seem to play a pronounced role in mediating proliferation-dependent differential gene expression. Similar events, but on a shorter time-scale, occur very early after liver damage in vivo. Copyright © 2010 American Association for the Study of Liver Diseases.

Pengendalian Hayati Penyakit Layu Fusarium Pisang (Fusarium oxysporum f.sp. cubense dengan Trichoderma sp.

Directory of Open Access Journals (Sweden)

Albertus Sudirman

2011-07-01

adalah waktu pemberian dengan tiga aras (dua minggu sebelum, bersamaan, dan dua minggu setelah inokulasi dengan Foc. Tiap perlakuan terdiri atas 10 ulangan. Intensitas penyakit diamati dengan sistem scoring (1–4 terhadap kelayuan daun. Biakan Trichoderma sp. ditumbuhkan dalam medium campuran sekam dan bekatul (2:1, g/g. Hasil penelitian menunjukkan bahwa Trichoderma sp. bersifat antagonistik terhadap Foc in vitro dengan daya hambat terhadap perkembangan koloni Foc 86%. Mekanisme penghambatan berupa hiperparasitisme. Hifa Trichoderma sp. menempel, melilit pada hifa Foc sehingga terjadi lisis hifa. Lisis hifa Foc terjadi pada tempat persinggungan antara hifa Foc dan hifa Trichoderma sp. Hasil pengujian di rumah kaca menunjukkan bahwa penyakit layu Fusarium dapat dihambat dengan pemberian Trichoderma sp. dalam medium campuran dedak dan bekatul sebanyak 25 g pada per polibag yang dilakukan bersamaan dengan waktu inokulasi Foc.

Biodegradation of toxic chemicals by Pleurotus eryngii in submerged fermentation and solid-state fermentation.

Science.gov (United States)

Chang, Bea-Ven; Chang, Yi-Ming

2016-04-01

The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.

A Trichostatin A (TSA)/Sp1-mediated mechanism for the regulation of SALL2 tumor suppressor in Jurkat T cells.

Science.gov (United States)

Hepp, Matías I; Escobar, David; Farkas, Carlos; Hermosilla, Viviana; Álvarez, Claudia; Amigo, Roberto; Gutiérrez, José L; Castro, Ariel F; Pincheira, Roxana

2018-05-17

SALL2 is a transcription factor involved in development and disease. Deregulation of SALL2 has been associated with cancer, suggesting that it plays a role in the disease. However, how SALL2 is regulated and why is deregulated in cancer remain poorly understood. We previously showed that the p53 tumor suppressor represses SALL2 under acute genotoxic stress. Here, we investigated the effect of Histone Deacetylase Inhibitor (HDACi) Trichostatin A (TSA), and involvement of Sp1 on expression and function of SALL2 in Jurkat T cells. We show that SALL2 mRNA and protein levels were enhanced under TSA treatment. Both, TSA and ectopic expression of Sp1 transactivated the SALL2 P2 promoter. This transactivation effect was blocked by the Sp1-binding inhibitor mithramycin A. Sp1 bound in vitro and in vivo to the proximal region of the P2 promoter. TSA induced Sp1 binding to the P2 promoter, which correlated with dynamic changes on H4 acetylation and concomitant recruitment of p300 or HDAC1 in a mutually exclusive manner. Our results suggest that TSA-induced Sp1-Lys703 acetylation contributes to the transcriptional activation of the P2 promoter. Finally, using a CRISPR/Cas9 SALL2-KO Jurkat-T cell model and gain of function experiments, we demonstrated that SALL2 upregulation is required for TSA-mediated cell death. Thus, our study identified Sp1 as a novel transcriptional regulator of SALL2, and proposes a novel epigenetic mechanism for SALL2 regulation in Jurkat-T cells. Altogether, our data support SALL2 function as a tumor suppressor, and SALL2 involvement in cell death response to HDACi. Copyright © 2018. Published by Elsevier B.V.

A new aurone glycoside with antifungal activity from marine-derived fungus Penicillium sp. FJ-1.

Science.gov (United States)

Song, Yan-xia; Ma, Qiang; Li, Jie

2015-03-01

Endophytic fungi which reside in the tissue of mangrove plants seem to play an important role in the discovery of new biologically active substances. During the course of screening for the antimicrobial metabolites from the endophytic fugus Penicillium sp. FJ-1 of mangrove plant Avicennia marina, a new aurone glycoside (1) was isolated by repeated column chromatography on silica gel and recrystallization methods. The structure of 1 was elucidated as (Z)-7,4'-dimethoxy-6-hydroxy-aurone-4-O-β-glucopyranoside, on the basis of spectroscopic analysis. Compound 1 exhibited antifungal activity against Candida sp., with the potency comparable to amphotericin B and much better than fluconazole. Compound 1 can also inhibit extracellular phospholipase secretion in a concentration-dependent manner.

SP140L, an Evolutionarily Recent Member of the SP100 Family, Is an Autoantigen in Primary Biliary Cirrhosis

Directory of Open Access Journals (Sweden)

Mario Saare

2015-01-01

Full Text Available The SP100 family members comprise a set of closely related genes on chromosome 2q37.1. The widely expressed SP100 and the leukocyte-specific proteins SP110 and SP140 have been associated with transcriptional regulation and various human diseases. Here, we have characterized the SP100 family member SP140L. The genome sequence analysis showed the formation of SP140L gene through rearrangements of the two neighboring genes, SP100 and SP140, during the evolution of higher primates. The SP140L expression is interferon-inducible with high transcript levels in B cells and other peripheral blood mononuclear cells. Subcellularly, SP140L colocalizes with SP100 and SP140 in nuclear structures that are devoid of SP110, PML, or p300 proteins. Similarly to SP100 and SP140 protein, we detected serum autoantibodies to SP140L in patients with primary biliary cirrhosis using luciferase immunoprecipitation system and immunoblotting assays. In conclusion, our results show that SP140L is phylogenetically recent member of SP100 proteins and acts as an autoantigen in primary biliary cirrhosis patients.

Molecular characterization and phylogenetic analysis of Babesia sp. NV-1 detected from wild American Mink ( Neovison vison ) in Hokkaido, Japan.

Science.gov (United States)

Hirata, Haruyuki; Ishinabe, Satoki; Jinnai, Michio; Asakawa, Mitsuhiko; Ishihara, Chiaki

2013-04-01

Babesiosis is a tick-borne protozoan disease affecting many mammalian species worldwide, caused by the intraerythrocytic multiplication of Babesia spp. The present study aimed to detect the presence of Babesia sp. in 13 American mink from Hokkaido, Japan. One of 13 animals was positive, as indicated by nested PCR targeting the 18S ribosomal RNA (SSU rDNA) and subunit 7 (eta) of the chaperonin-containing t-complex polypeptide 1 (CCT7) genes from species of Babesia and Theileria. Sequencing of the PCR product of SSU rDNA revealed 99% homology to the isolates of Babesia sp. SAP#131 found in raccoons in Hokkaido, whereas that of the CCT7 gene showed 80% homology to the isolates of Babesia gibsoni in dogs as determined by BLAST analysis. We refer to the cognate sequence as Babesia sp. NV-1. Phylogenetic analyses of SSU rDNA and CCT7 genes from Babesia sp. NV-1 revealed them to be most closely related to the Babesia sp. SAP#131 from a raccoon in Hokkaido and to canine B. gibsoni, respectively. Here, we provide the first molecular evidence of the Babesia sp. NV-1 parasite in feral American mink ( Neovison vison ) in Hokkaido, Japan.

Prdx6 Upregulation by Curcumin Attenuates Ischemic Oxidative Damage via SP1 in Rats after Stroke

Directory of Open Access Journals (Sweden)

Gongwei Jia

2017-01-01

Full Text Available Background. The role of Peroxiredoxin 6 (Prdx6 in brain ischemia remains unclear. Curcumin (Cur treatment elicits neuroprotective effects against cerebral ischemic injury, and the associated mechanisms may involve Prdx6. In this study, we investigated whether Prdx6 and the transcription factor specific protein 1 (SP1 were involved in the antioxidant effect of Cur after stoke. Methods. Focal cerebral ischemic injury was induced by transient middle cerebral artery occlusion for 2 hours in male Sprague-Dawley rats treated with or without Prdx6 siRNA. Expression of Prdx6 in the penumbra was assessed by Real-Time PCR (RT-PCR, Western blot analysis, and immunoflourescent staining. In addition, infarct volume, neurological deficit score, and oxidative stress were evaluated. Prdx6 levels were also determined in the presence and absence of SP1 antagonist mithramycin A (MTM-A. Results. Cur treatment upregulated Prdx6 protein expression and the number of Prdx6-positive neuronal cells 24 hours after reperfusion. Cur treatment also attenuated oxidative stress and induced neuroprotective effects against ischemic damage, whereas the beneficial effects of Cur treatment were lost in animals treated with Prdx6-siRNA. Prdx6 upregulation by Cur treatment was abolished by SP1 antagonists MTM. Conclusions. Prdx6 upregulation by Cur treatment attenuates ischemic oxidative damage through SP1 induction in rats after stroke. This represents a novel mechanism of Cur-induced neuroprotection against cerebral ischemia.

Rhodotorula bloemfonteinensis sp. nov., Rhodotorula eucalyptica sp. nov., Rhodotorula orientis sp. nov. and Rhodotorula pini sp. nov., yeasts isolated from monoterpene-rich environments.

Science.gov (United States)

Pohl, Carolina H; Smit, Martha S; Albertyn, Jacobus

2011-09-01

Recent rDNA sequencing of 25 isolates from a previous study, during which limonene-utilizing yeasts were isolated from monoterpene-rich environments by using 1,4-disubstituted cyclohexanes as sole carbon sources, led to the identification of four hitherto unknown Rhodotorula species. Analyses of the 26S rDNA D1/D2 region as well as the internal transcribed spacer (ITS) domain indicated that two isolates (CBS 8499(T) and CBS 10736) were identical and were closely related to Rhodotorula cycloclastica, a previously described limonene-utilizing yeast. These novel isolates differed from known yeast species and could be distinguished from R. cycloclastica by standard physiological tests. The other three isolates represent three novel Rhodotorula species, closely related to Sporobolomyces magnisporus. These three species could also be distinguished from other Rhodotorula species by standard physiological tests. Based on these results, we suggest that the new isolates represent novel species, for which the names Rhodotorula eucalyptica sp. nov. (type strain CBS 8499(T)  = NRRL Y-48408(T)), Rhodotorula pini sp. nov. (type strain CBS 10735(T)  = NRRL Y-48410(T)), Rhodotorula bloemfonteinensis sp. nov. (type strain CBS 8598(T)  = NRRL Y-48407(T)) and Rhodotorula orientis sp. nov. (type strain CBS 8594(T)  = NRRL Y-48719(T)) are proposed. R. eucalyptica and R. pini can also utilize limonene.

Desulfurization of dibenzothiophene by Corynebacterium sp. strain SY1

International Nuclear Information System (INIS)

Omori, Toshio; Monna, L.; Saiki, Yuko; Kodama, Tohru

1992-01-01

Strain SY1, identified as a Corynebacterium sp., was isolated on the basis of the ability to utilize dibenzothiophene (DBT) as a sole source of sulfur. Strain SY1 could utilize a wide range of organic and inorganic sulfur compounds, such as DBT sulfone, dimethyl sulfide, dimethyl sulfoxide, dimethyl sulfone, CS 2 , FeS 2 , and even elemental sulfur. Strain SY1 metabolized DBT to dibenzothiophene-5-oxide, DBT sulfone, and 2-hydroxybiphenyl, which was subsequently nitrated to produce at least two different hydroxynitrobiphenyls during cultivation. These metabolites were separated by silica gel column chromatography and identified by nuclear magnetic resonance, UV, and mass spectral techniques. Resting cells of SY1 desulfurized toluenesulfonic acid and released sulfite anion. On the basis of these results, a new DBT degradation pathway is proposed

Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

Science.gov (United States)

Jayakumar, T; Ramesh, E; Geraldine, P

2006-12-01

This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

Cyclooxygenase-2 up-regulates CCR7 expression via AKT-mediated phosphorylation and activation of Sp1 in breast cancer cells.

Science.gov (United States)

Chuang, Chun-Wei; Pan, Mei-Ren; Hou, Ming-Feng; Hung, Wen-Chun

2013-02-01

Up-regulation of cyclooxygenase-2 (COX-2) is frequently found in human cancers and is significantly associated with tumor metastasis. Our previous results demonstrate that COX-2 and its metabolite prostaglandin E2 (PGE2) stimulate the expression of CCR7 chemokine receptor via EP2/EP4 receptors to promote lymphatic invasion in breast cancer cells. In this study, we address the underlying mechanism of COX-2/PGE2-induced CCR7 expression. We find that COX-2/PGE2 increase CCR7 expression via the AKT signaling pathway in breast cancer cells. Promoter deletion and mutation assays identify the Sp1 site located at the -60/-57 region of CCR7 gene promoter is critical for stimulation. Chromatin immunoprecipitation (ChIP) assay confirms that in vivo binding of Sp1 to human CCR7 promoter is increased by COX-2 and PGE2. Knockdown of Sp1 by shRNA reduces the induction of CCR7 by PGE2. We demonstrate for the first time that AKT may directly phosphorylate Sp1 at S42, T679, and S698. Phosphorylation-mimic Sp1 protein harboring S42D, T679D, and S698D mutation strongly activates CCR7 expression. In contrast, change of these three residues to alanine completely blocks the induction of CCR7 by PGE2. Pathological investigation demonstrates that CCR7 expression is strongly associated with phospho-AKT and Sp1 in 120 breast cancer tissues. Collectively, our results demonstrate that COX-2 up-regulates CCR7 expression via AKT-mediated phosphorylation and activation of Sp1 and this pathway is highly activated in metastatic breast cancer. Copyright © 2012 Wiley Periodicals, Inc.

BnaA.bZIP1 Negatively Regulates a Novel Small Peptide Gene, BnaC.SP6, Involved in Pollen Activity

Directory of Open Access Journals (Sweden)

Xuanpeng Wang

2017-12-01

Full Text Available Small peptides secreted to the extracellular matrix control many aspects of the plant’s physiological activities which were identified in Arabidopsis thaliana, called ATSPs. Here, we isolated and characterized the small peptide gene Bna.SP6 from Brassica napus. The BnaC.SP6 promoter was cloned and identified. Promoter deletion analysis suggested that the -447 to -375 and -210 to -135 regions are crucial for the silique septum and pollen expression of BnaC.SP6, respectively. Furthermore, the minimal promoter region of p158 (-210 to -52 was sufficient for driving gene expression specifically in pollen and highly conserved in Brassica species. In addition, BnaA.bZIP1 was predominantly expressed in anthers where BnaC.SP6 was also expressed, and was localized to the nuclei. BnaA.bZIP1 possessed transcriptional activation activity in yeast and protoplast system. It could specifically bind to the C-box in p158 in vitro, and negatively regulate p158 activity in vivo. BnaA.bZIP1 functions as a transcriptional repressor of BnaC.SP6 in pollen activity. These results provide novel insight into the transcriptional regulation of BnaC.SP6 in pollen activity and the pollen/anther-specific promoter regions of BnaC.SP6 may have their potential agricultural application for new male sterility line generation.

Avaliação de resíduos lignocelulósicos para a produção de Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes

OpenAIRE

Claudia Paganelli Lacerda de Azevedo

2000-01-01

Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes foram produzidos, em condições controladas, com resíduos lignocelulósicos em seis composições; (1) resíduo sólido de indústria de cerveja+ bagaço de cana de açúcar + sais minerais (2) resíduo sólido de indústria de cerveja + serragem de euca/yptus + sais minerais (3) resíduo sólido de indústria de cerveja + palha de arroz + sais minerais (4) resíduo sólido de indústria de cerveja + bagaço de cana de açúcar (5) resíduo sólido de indústr...

Association of collagen type I alpha1 (COLIA1) Sp1 polymorphism with osteoporotic fracture in Caucasian post-menopausal women: a meta-analysis.

LENUS (Irish Health Repository)

Ji, G-R

2012-01-06

This study was designed to summarize quantitatively the evidence for a relationship between collagen type I alpha1 (COLIA1) Sp1 polymorphism and osteoporotic fracture risk in Caucasian post-menopausal women. This meta-analysis included 16 studies, which analysed 2294 patients with fractures and 10 285 controls. The combined results showed that there was a significant difference in genotype distribution (SS odds ratio [OR] 0.72; Ss OR 1.18; ss OR 1.97) between patients with fractures and controls. When stratifying by the fracture site, it was found that: (i) patients with vertebral fractures had a significantly higher frequency of the Ss genotype and a lower frequency of the SS genotype than controls; and (ii) patients with non-vertebral fractures had a significantly higher frequency of the ss genotype and a lower frequency of the SS genotype than controls. This meta-analysis suggests that the COLIA1 Sp1 polymorphism may be associated with osteoporotic fracture in Caucasian post-menopausal women.

Analysis list: SP2 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available SP2 Blood,Liver,Pluripotent stem cell + hg19 http://dbarchive.biosciencedbc.jp/kyus...hu-u/hg19/target/SP2.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/SP2.5.tsv http://dbarchive....biosciencedbc.jp/kyushu-u/hg19/target/SP2.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/SP2.Blood.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/SP2.Liver.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/SP2.Pluripotent_stem_cell.tsv http://dbarchive.biosciencedbc

Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

2000-01-01

Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

Course of infection by Babesia sp. BQ1 (Lintan) and B. divergens in sheep depends on the production of IFNgamma and IL10.

Science.gov (United States)

Guan, G; Chauvin, A; Yin, H; Luo, J; Moreau, E

2010-02-01

Ovine babesiosis is an important disease in China and responsible for economic losses. Several Babesia strains are involved, but Babesia sp. BQ1 (Lintan) and Babesia sp. BQ1 (Ningxian) are particularly prevalent in the Guansu region. Babesia divergens, in contrast, can experimentally infect spleen-intact sheep, but does not induce clinical signs. The immune response of spleen-intact sheep to Babesia sp. BQ1 (Lintan) and to B. divergens was therefore compared to identify the immune mechanisms involved in pathogenicity. The greater pathogenicity of Babesia sp. BQ1 (Lintan) than that of B. divergens was confirmed: sheep infected with Babesia sp. BQ1 (Lintan), but not with B. divergens, developed hyperthermia and showed patent parasitaemia in Giemsa-stained blood smears from the ear vein. Furthermore, more parasites were also detected in the blood from the jugular vein of Babesia sp. BQ1 (Lintan)-infected sheep. Pathogenicity of Babesia spp. involved cellular responses, but not humoral responses. Interferon-gamma was produced only by specifically activated PBMC from B. divergens-infected sheep and interleukin-10 only by specifically activated PBMC from Babesia sp. BQ1 (Lintan)-infected sheep. The role of these cytokines in the course of infection by Babesia spp. is discussed.

Enhanced production of poly glutamic acid by Bacillus sp. SW1-2 ...

African Journals Online (AJOL)

Bacillus sp. SW1-2 producing poly glutamic acid (PGA), locally isolated from Eastern province in Saudi Arabia, was characterized and identified based on 16S rRNA gene sequencing. Phylogenetic analysis revealed its closeness to Bacillus megaterium. The homopolymer consists mainly of glutamic as indicated in the ...

Crystallization and preliminary X-ray analysis of alginate importer from Sphingomonas sp. A1

International Nuclear Information System (INIS)

Maruyama, Yukie; Itoh, Takafumi; Nishitani, Yu; Mikami, Bunzo; Hashimoto, Wataru; Murata, Kousaku

2012-01-01

Alginate importer from Sphingomonas sp. A1 is a member of the ABC transporter superfamily that directly transports alginate polysaccharide into the cytoplasm. Crystals of alginate importer in complex with the periplasmic binding protein AlgQ2 diffracted X-rays to 3.3 Å resolution. Sphingomonas sp. A1 directly incorporates alginate polysaccharides through a ‘superchannel’ comprising a pit on the cell surface, alginate-binding proteins in the periplasm and an ABC transporter (alginate importer) in the inner membrane. Alginate importer, consisting of four subunits, AlgM1, AlgM2 and two molecules of AlgS, was crystallized in the presence of the binding protein AlgQ2. Preliminary X-ray analysis showed that the crystal diffracted to 3.3 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 72.5, b = 136.8, c = 273.3 Å, suggesting the presence of one complex in the asymmetric unit

Elevated expression and potential roles of human Sp5, a member of Sp transcription factor family, in human cancers

International Nuclear Information System (INIS)

Chen Yongxin; Guo Yingqiu; Ge Xijin; Itoh, Hirotaka; Watanabe, Akira; Fujiwara, Takeshi; Kodama, Tatsuhiko; Aburatani, Hiroyuki

2006-01-01

In this report, we describe the expression and function of human Sp5, a member of the Sp family of zinc finger transcription factors. Like other family members, the Sp5 protein contains a Cys2His2 zinc finger DNA binding domain at the C-terminus. Our experiments employing Gal4-Sp5 fusion proteins reveal multiple transcriptional domains, including a N-terminal activity domain, an intrinsic repressive element, and a C-terminal synergistic domain. Elevated expression of Sp5 was noted in several human tumors including hepatocellular carcinoma, gastric cancer, and colon cancer. To study the effects of the Sp5 protein on growth properties of human cancer cells and facilitate the identification of its downstream genes, we combined an inducible gene expression system with microarray analysis to screen for its transcriptional targets. Transfer of Sp5 into MCF-7 cells that expressed no detectable endogenous Sp5 protein elicited significant growth promotion activity. Several of the constitutively deregulated genes have been associated with tumorigenesis (CDC25C, CEACAM6, TMPRSS2, XBP1, MYBL1, ABHD2, and CXCL12) and Wnt/β-Catenin signaling pathways (BAMBI, SIX1, IGFBP5, AES, and p21 WAF1 ). This information could be utilized for further mechanistic research and for devising optimized therapeutic strategies against human cancers

Intrastrain Comparison of the Chemical Composition and Antioxidant Activity of an Edible Mushroom, Pleurotus giganteus, and Its Potent Neuritogenic Properties

Directory of Open Access Journals (Sweden)

Chia-Wei Phan

2014-01-01

Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.

Bovine lactoferricin induces TIMP-3 via the ERK1/2-Sp1 axis in human articular chondrocytes.

Science.gov (United States)

Yan, Dongyao; Chen, Di; Hawse, John R; van Wijnen, Andre J; Im, Hee-Jeong

2013-03-15

Bovine lactoferricin (LfcinB) is a heparan sulfate-binding peptide with multiple bioactivities. In human articular cartilage, LfcinB antagonizes interleukin-1 β (IL-1β) and fibroblast growth factor 2 (FGF-2) in proteoglycan metabolism, catabolic protease expression, and induction of pro-inflammatory mediators. LfcinB specifically activates ERK1/2, p38 and Akt, but whether these signaling pathways control the expression of LfcinB target genes remained unknown. In this report, we characterized a novel aspect of LfcinB-mediated genetic response in human articular chondrocytes, tissue inhibitor of metalloproteinase 3 (TIMP-3) induction. Inhibition of individual signaling pathways revealed that ERK1/2 functions as the major pathway in TIMP-3 expression, whereas Akt plays a minor role. Further investigation identified Sp1 as a critical transcriptional activator in TIMP-3 regulation, and Sp1 activity is modulated by ERK1/2, not Akt. Comparative quantification indicates that significant downregulation of TIMP-3 occurs in OA chondrocytes, suggesting a beneficial role of LfcinB in OA pathogenesis. Our results collectively provide new insights into the mechanism of action of LfcinB, and support the candidacy of LfcinB as a chondroprotective agent. Copyright © 2013 Elsevier B.V. All rights reserved.

Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria.

Science.gov (United States)

da Silva, Fábio Daniel Florêncio; Lima, Alex Ranieri Jerônimo; Moraes, Pablo Henrique Gonçalves; Siqueira, Andrei Santos; Dall'Agnol, Leonardo Teixeira; Baraúna, Anna Rafaella Ferreira; Martins, Luisa Carício; Oliveira, Karol Guimarães; de Lima, Clayton Pereira Silva; Nunes, Márcio Roberto Teixeira; Vianez-Júnior, João Lídio Silva Gonçalves; Gonçalves, Evonnildo Costa

2016-05-19

Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here. Copyright © 2016 da Silva et al.

Development of natural cellulase inhibitor mediated intensified biological pretreatment technology using Pleurotus florida for maximum recovery of cellulose from paddy straw under solid state condition.

Science.gov (United States)

Naresh Kumar, Manickam; Ravikumar, Rajarathinam; Thenmozhi, Senniyappan; Kirupa Sankar, Muthuvelu

2017-11-01

Inhibitor mediated intensified bio-pretreatment (IMBP) technology using natural cellulase inhibitor (NCI) for maximum cellulose recovery from paddy straw was studied. Pretreatment was carried out under solid state condition. Supplementation of 8% NCI in pretreatment medium improves cellulose recovery and delignification by 1.2 and 1.5-fold respectively, compared to conventional bio-pretreatment due to inhibition of 61% of cellulase activity in IMBP. Further increase in NCI concentration showed negative effect on Pleurotus florida growth and suppress the laccase productivity by 1.1-fold. Laccase activity in IMBP was found to be 2.0U/mL on 19 th day, which is higher than (1.5U/mL) conventional bio-pretreatment. Physico-chemical modifications in paddy straw before and after pretreatment were analysed by SEM, ATR-FTIR, XRD and TGA. According to these findings, the IMBP technology can be a viable eco-friendly technology for sustainable production of bioethanol with maximum cellulose recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Large-scale bioreactor production of the herbicide-degrading Aminobacter sp. strain MSH1

DEFF Research Database (Denmark)

Schultz-Jensen, Nadja; Knudsen, Berith Elkær; Frkova, Zuzana

2014-01-01

The Aminobacter sp. strain MSH1 has potential for pesticide bioremediation because it degrades the herbicide metabolite 2,6-dichlorobenzamide (BAM). Production of the BAM-degrading bacterium using aerobic bioreactor fermentation was investigated. A mineral salt medium limited for carbon and with ......The Aminobacter sp. strain MSH1 has potential for pesticide bioremediation because it degrades the herbicide metabolite 2,6-dichlorobenzamide (BAM). Production of the BAM-degrading bacterium using aerobic bioreactor fermentation was investigated. A mineral salt medium limited for carbon...... and with an element composition similar to the strain was generated. The optimal pH and temperature for strain growth were determined using shaker flasks and verified in bioreactors. Glucose, fructose, and glycerol were suitable carbon sources for MSH1 (μ =0.1 h−1); slower growth was observed on succinate and acetic...... acid (μ =0.01 h−1). Standard conditions for growth of theMSH1 strain were defined at pH 7 and 25 °C, with glucose as the carbon source. In bioreactors (1 and 5 L), the specific growth rate of MSH1 increased from μ =0.1 h−1 on traditional mineral salt medium to μ =0.18 h−1 on the optimized mineral salt...

Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

Science.gov (United States)

Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

2016-11-01

This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fatty acid composition of Spirulina sp., Chlorella sp. and Chaetoceros sp. microalgae and introduction as potential new sources to extinct omega 3 and omega 6

Directory of Open Access Journals (Sweden)

Homan Gorjzdadeh

2016-05-01

Full Text Available Background: This study was carried out to determine the oil fatty acids from two special species of microalgae; Spirulina sp.,Chlorella sp. and also Chaetoceros sp. collected from Bahmanshir River. Materials and Methods: Sampling of microalgae Chaetoceros sp. from Bahmanshir River was under taken using bottle samplers during spring season of 2013. Microalgae Spirulina sp. and Chlorella sp. were supplied from Shrimp Research Institute of Iran in Bushehr Province. Samples then were cultured under controlled laboratory conditions and mass culture for 100 liters was undertaken. Isolation of microalgae species from water of cultured media was carried out using filtration and centrifugation methods. The fatty acid compositions were determined by Gas – FID chromatography. Results: Results showed that regarding Saturated Fatty Acids (SFA obtained from purified culture of Chaetoceros sp., Spirulina sp. and Chlorella sp. the maximum amount of total fatty acids were belonged to palmitic acids (C16:0 with 15.21%, 30.1% and 25.17% of total fatty acids  respectively. Analysis of Mono Unsaturated Fatty Acids (MUFA showed that in the Oleic acid was maximum amount of 34% in Spirulina sp. In addition the amount of MUFA in Chlorella sp. was 16.37% of total fatty acids. On the other hand the amount of palmeotic acid in purified culture of Chaetoceros sp. was 30.33% from total content of fatty acids. Analysis of Poly Unsaturated Fatty Acids (PUFA, Linoleic acid (C18:2 (Omega 6, revealed maximum percentage in Spirulina sp. with 18.8%. Results of Alpha linoleic acid (C18:3 (Omega3 analysis showed maximum amount of 9.66% in Chlorella sp. compared to other microalgae with lower omega 3 contents. Spirulina sp. contained maximum amount of Linoleic acid (C18:2 with 18.8% of total fatty acids. Therefore, Spirulina sp. can be considered as a rich source of omega 6 for the purpose of fatty acid extractions. The presence of PUFA in Chlorella sp. and Spirulina sp. was

Draft genome sequence of Pseudomonas sp. strain M47T1, carried by Bursaphelenchus xylophilus isolated from Pinus pinaster.

Science.gov (United States)

Proença, Diogo Neves; Espírito Santo, Christophe; Grass, Gregor; Morais, Paula V

2012-09-01

The draft genome sequence of Pseudomonas sp. strain M47T1, carried by the Bursaphelenchus xylophilus pinewood nematode, the causative agent of pine wilt disease, is presented. In Pseudomonas sp. strain M47T1, genes that make this a plant growth-promoting bacterium, as well as genes potentially involved in nematotoxicity, were identified.

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh Produtividade e composição nutricional de linhagens de cogumelo‑ostra recentemente lançadas em Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.

Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

OpenAIRE

Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

2015-01-01

The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

Increased constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. and a decrease in microflora diversity may be indicators of ventilator-associated pneumonia: a prospective study in the respiratory tracts of neonates.

Directory of Open Access Journals (Sweden)

Wei Lu

Full Text Available Ventilator-associated pneumonia (VAP is a common complication and cause of death in neonates on mechanical ventilation. However, it is difficult to define the causes of VAP. To understand the causes of VAP, we undertook a prospective study based on the diversity of the microflora in VAP. The experimental group consisted of newborns who suffered from respiratory distress syndrome (RDS and VAP, while the control group suffered from RDS without VAP. Sputa were collected within 1, 3, and 5 days of ventilation and were divided into six groups. DNA was extracted from the samples, and the 16S rDNA was PCR amplified, separated using denaturing gradient gel electrophoresis (DGGE, cloned and sequenced. The resulting sequences were compared using BLAST. The DGGE pictures were measured, and the richness, Shannon-Wiener index, and cluster maps were analyzed. No differences were found regarding the constituent ratio of any genus between the Non-VAP and VAP group within 1 day after intubation. After 1 to 3 days, the constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. in the VAP group were higher than those in the Non-VAP group, and the ratios of Serratia sp. and Achromobacter sp. were lower. After 3 to 5 days, the ratios of Klebsiella sp., Acinetobacter sp., Serratia sp., and Achromobacter sp. were lower than those in the Non-VAP group. The richness and Shannon-Wiener index of the Non-VAP group were higher than those of the VAP group from 1 to 3 days after intubation, while no differences were found within 1 day and from 3 to 5 days. We conclude that during the first three days of intubation, the microflora diversity in the lower respiratory tract was reduced due to VAP, and the greater constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. in the sputum may be indicators of VAP.

Metabolites of the endophytic fungus Penicillium sp. FJ-1 of Acanthus ilicifolius.

Science.gov (United States)

Liu, Jian-Fang; Chen, Wei-Jie; Xin, Ben-Ru; Lu, Jie

2014-06-01

Two new compounds, named as (2R,3S)-pinobanksin-3-cinnamate (1), and 15alpha-hydroxy-(22E,24R)-ergosta-3,5,8(14),22-tetraen-7-one (2), were isolated from the endophytic fungus Penicillium sp. FJ-1 of Acanthus ilicifolius Linn. Their structures were elucidated on the basis of spectroscopic analysis. Additionally, compound 1 exhibited potent neuroprotective effects on corticosterone-damaged PC12 cells, and compound 2 showed potent cytotoxicity on glioma cell lines.

Biodegradable and Biocompatible Biomaterial, Polyhydroxybutyrate, Produced by an Indigenous Vibrio sp. BM-1 Isolated from Marine Environment

Directory of Open Access Journals (Sweden)

Ho-Shing Wu

2011-04-01

Full Text Available Polyhydroxybutyrate (PHB is one of the polyhydroxyalkanoates (PHAs which has biodegradable and biocompatible properties. They are adopted in the biomedical field, in, for example, medical implants and drug delivery carriers. This study seeks to promote the production of PHB by Vibrio sp. BM-1, isolated from a marine environment by improving constituents of medium and implementing an appropriate fermentation strategy. This study successfully developed a glycerol-yeast extract-tryptone (GYT medium that can facilitate the growth of Vibrio sp. BM-1 and lead to the production of 1.4 g/L PHB at 20 h cultivation. This study also shows that 1.57 g/L PHB concentration and 16% PHB content were achieved, respectively, when Vibrio sp. BM-1 was cultivated with MS-GYT medium (mineral salts-supplemented GYT medium for 12 h. Both cell dry weight (CDW and residual CDW remained constant at around 8.2 g/L and 8.0 g/L after the 12 h of cultivation, until the end of the experiment. However, both 16% of PHB content and 1.57 g/L of PHB production decreased rapidly to 3% and 0.25 g/L, respectively from 12 h of cultivation to 40 h of cultivation. The results suggest that the secretion of PHB depolymerase that might be caused by the addition of mineral salts reduced PHB after 12 h of cultivation. However, work will be done to explain the effect of adding mineral salts on the production of PHB by Vibrio sp. BM-1 in the near future.

Biodegradable and biocompatible biomaterial, polyhydroxybutyrate, produced by an indigenous Vibrio sp. BM-1 isolated from marine environment.

Science.gov (United States)

Wei, Yu-Hong; Chen, Wei-Chuan; Wu, Ho-Shing; Janarthanan, Om-Murugan

2011-01-01

Polyhydroxybutyrate (PHB) is one of the polyhydroxyalkanoates (PHAs) which has biodegradable and biocompatible properties. They are adopted in the biomedical field, in, for example, medical implants and drug delivery carriers. This study seeks to promote the production of PHB by Vibrio sp. BM-1, isolated from a marine environment by improving constituents of medium and implementing an appropriate fermentation strategy. This study successfully developed a glycerol-yeast extract-tryptone (GYT) medium that can facilitate the growth of Vibrio sp. BM-1 and lead to the production of 1.4 g/L PHB at 20 h cultivation. This study also shows that 1.57 g/L PHB concentration and 16% PHB content were achieved, respectively, when Vibrio sp. BM-1 was cultivated with MS-GYT medium (mineral salts-supplemented GYT medium) for 12 h. Both cell dry weight (CDW) and residual CDW remained constant at around 8.2 g/L and 8.0 g/L after the 12 h of cultivation, until the end of the experiment. However, both 16% of PHB content and 1.57 g/L of PHB production decreased rapidly to 3% and 0.25 g/L, respectively from 12 h of cultivation to 40 h of cultivation. The results suggest that the secretion of PHB depolymerase that might be caused by the addition of mineral salts reduced PHB after 12 h of cultivation. However, work will be done to explain the effect of adding mineral salts on the production of PHB by Vibrio sp. BM-1 in the near future.

Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.

Science.gov (United States)

Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman

2010-11-01

A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.

Detection of Salmonella sp., Vibrio sp. and total plate count bacteria on blood cockle (Anadara granosa)

Science.gov (United States)

Ekawati, ER; Yusmiati, S. N. H.

2018-01-01

Blood cockle (Anadara granosa) has high level of zinc and protein, which is beneficial for therapeutic function for malnourished particularly stunting case in children. Zinc in animal foods is more absorbable than that from vegetable food. Blood cockle (Anadara granosa) is rich in nutrient and an excellent environment for the growth of microorganisms. This research aimed to identify the contamination of Salmonella sp., Vibrio sp. and total plate count bacteria on blood cockle (Anadara granosa). This was observation research with laboratory analysis. Salmonella sp. and Vibrio sp. were detected from blood cockle. Total plate count was determine of the total amount of the bacteria. Results detected from 20 samples of blood cockle showed that all samples were negative of Salmonella sp. and 1 sample positive Vibrio sp. The result of total plate count bacteria was < 5 x 105 colony/g sample.

Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

Science.gov (United States)

Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

2003-08-01

Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

Essential and non-essential DNA replication genes in the model halophilic Archaeon, Halobacterium sp. NRC-1

Directory of Open Access Journals (Sweden)

DasSarma Shiladitya

2007-06-01

Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten

Metabolites from the endophytic fungus Penicillium sp. FJ-1 of Ceriops tagal.

Science.gov (United States)

Jin, Peng-fei; Zuo, Wen-jian; Guo, Zhi-kai; Mei, Wen-li; Dai, Hao-fu

2013-11-01

To investigate the chemical constituents of the endophytic fungus Penicillium sp. FJ-1 of Ceriops tagal, the chemical constituents were isolated by column chromatography on silica gel and Sephadex LH-20. Their structures were elucidated on the basis of spectroscopic analysis. Their antibacterial activity was tested by paper disco diffusion method. Two compounds were isolated and identified as 7-hydroxy-deoxytalaroflavone (1), and deoxytalaroflavone (2). Compound 1 is a new compound, and compounds 1 and 2 showed weak activity against Staphylococcus aureus and methicillin-resistant Staphylococcus aureus.

Effect of Pleurotus eryngii stalk residue on the oxidative status and meat quality of broiler chickens.

Science.gov (United States)

Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi

2012-11-07

Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.

Sp6 and Sp8 Transcription Factors Control AER Formation and Dorsal-Ventral Patterning in Limb Development

Science.gov (United States)

Haro, Endika; Delgado, Irene; Junco, Marisa; Yamada, Yoshihiko; Mansouri, Ahmed; Oberg, Kerby C.; Ros, Marian A.

2014-01-01

The formation and maintenance of the apical ectodermal ridge (AER) is critical for the outgrowth and patterning of the vertebrate limb. The induction of the AER is a complex process that relies on integrated interactions among the Fgf, Wnt, and Bmp signaling pathways that operate within the ectoderm and between the ectoderm and the mesoderm of the early limb bud. The transcription factors Sp6 and Sp8 are expressed in the limb ectoderm and AER during limb development. Sp6 mutant mice display a mild syndactyly phenotype while Sp8 mutants exhibit severe limb truncations. Both mutants show defects in AER maturation and in dorsal-ventral patterning. To gain further insights into the role Sp6 and Sp8 play in limb development, we have produced mice lacking both Sp6 and Sp8 activity in the limb ectoderm. Remarkably, the elimination or significant reduction in Sp6;Sp8 gene dosage leads to tetra-amelia; initial budding occurs, but neither Fgf8 nor En1 are activated. Mutants bearing a single functional allele of Sp8 (Sp6−/−;Sp8+/−) exhibit a split-hand/foot malformation phenotype with double dorsal digit tips probably due to an irregular and immature AER that is not maintained in the center of the bud and on the abnormal expansion of Wnt7a expression to the ventral ectoderm. Our data are compatible with Sp6 and Sp8 working together and in a dose-dependent manner as indispensable mediators of Wnt/βcatenin and Bmp signaling in the limb ectoderm. We suggest that the function of these factors links proximal-distal and dorsal-ventral patterning. PMID:25166858

Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

Directory of Open Access Journals (Sweden)

Wei-Jie Wu

Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

Directory of Open Access Journals (Sweden)

Juliet B. Akinyele

2012-09-01

Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

Propiece IL-1α facilitates the growth of acute T-lymphocytic leukemia cells through the activation of NF-κB and SP1.

Science.gov (United States)

Zhang, Yinsheng; Yu, Xiao; Lin, Dandan; Lei, Lei; Hu, Bo; Cao, Fengzhang; Mei, Yu; Wu, Depei; Liu, Haiyan

2017-02-28

Interleukin 1α (IL-1α) is a pro-inflammatory cytokine that possesses multiple immune-regulatory functions. It is mainly expressed as the cell-associated form and not actively secreted in healthy tissues. The intracellular IL-1α has been shown to be a chromatin-associated cytokine and can affect transcription. There are spontaneous expressions of IL-1α in acute lymphocytic leukemia (ALL) blasts. However, the role of nuclear-localized IL-1α in ALL is not clear. Here we showed that overexpression of the nuclear form of IL-1α (propiece IL-1α) could promote proliferation and reduce apoptosis of T-ALL cells. It also increased the ALL cells' resistance to low serum concentration and cisplatin treatment. In vivo growth of the T-ALL cells overexpressing the propiece IL-1α were also enhanced compared to the control cells. Microarray analysis revealed many changes in gene expressions related to cell growth and stress, including a group of metallothionein genes. Moreover, the expressions of transcription factors, NFκB and specific protein 1 (SP1), were up-regulated by propiece IL-1α. Propiece IL-1α could bind to the promoter of SP1 and a binding sequence logo was identified. Therefore, nuclear expression of propiece IL-1α can facilitate the growth of T-ALL cells possibly through the activation of NFκB and SP1.

Chain sampling plan (ChSP-1) for desired acceptable quality level (AQL) and limiting quality level (LQL)

Science.gov (United States)

Raju, C.; Vidya, R.

2017-11-01

Chain Sampling Plan is widely used whenever a small sample attributes plan is required to be used for situations involving destructive products coming out of continuous production process [1, 2]. This paper presents a procedure for the construction and selection of a ChSP-1 by attributes inspection based on membership functions [3]. A procedure using search technique is developed for obtaining the parameters of single sampling plan for a given set of AQL and LQL values. A sample of tables providing ChSP-1 plans for various combinations of AQL and LQL values are presented [4].

Analysis of Major Nutritional Components of Pleurotus pulmonarius During the Cultivation in Different Indoor Environmental Conditions on Sawdust

Directory of Open Access Journals (Sweden)

Tariqul Islam

2017-03-01

Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.

Expression analysis and biological characterization of Babesia sp. BQ1 (Lintan) (Babesia motasi-like) rhoptry-associated protein 1 and its potential use in serodiagnosis via ELISA.

Science.gov (United States)

Niu, Qingli; Liu, Zhijie; Yang, Jifei; Yu, Peifa; Pan, Yuping; Zhai, Bintao; Luo, Jianxun; Moreau, Emmanuelle; Guan, Guiquan; Yin, Hong

2016-05-31

In China, ovine babesiosis is one of the most important tick-borne haemoparasitic diseases of small ruminants. It has a significant economic impact, and several Babesia motasi-like isolates have been recently shown to be responsible for ovine babesiosis in this country. Full-length and C-terminal-truncated forms of the rap-1a61-1 gene of Babesia sp. BQ1 (Lintan) were cloned into the pET-30a plasmid and subsequently expressed as His-fusion proteins. The resulting recombinant RAP-1a proteins (rRAP-1a61-1 and rRAP-1a61-1/CT) were purified and evaluated as diagnostic antigens using Western blot analysis and ELISA. The native Babesia sp. BQ1 (Lintan) RAP-1 protein was recognized using Western blots and IFAT by antibodies that were raised in rabbits against rRAP-1a61-1/CT. The specificity, sensitivity and positive threshold values for rRAP-1a61-1/CT in ELISA were evaluated. Cross-reactivity was observed between rRAP-1a61-1/CT and positive sera for Babesia sp. BQ1 (Lintan), Babesia sp. BQ1 (Ningxian) and Babesia sp. Tianzhu isolates obtained from infected sheep. At one week post-inoculation, a significant increase was observed in the amount of antibodies produced against RAP-1a, and high levels of antibodies against RAP-1a were observed for 3 months (at 84 days p.i.). A total of 3198 serum samples were collected from small ruminants in 54 different regions in 23 provinces of China. These samples were tested using ELISA based on the rRAP-1a61-1/CT protein. The results indicated that the average positive rate was 36.02 %. The present study suggests that rRAP-1a61-1/CT might be a potential diagnostic antigen for detecting several isolates of B. motasi-like parasites infection.

EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Ummu Kalsum

2011-09-01

Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

SPECTROSCOPIC CONFIRMATION OF A MASSIVE RED-SEQUENCE-SELECTED GALAXY CLUSTER AT z = 1.34 IN THE SpARCS-SOUTH CLUSTER SURVEY

International Nuclear Information System (INIS)

Wilson, Gillian; Demarco, Ricardo; Muzzin, Adam; Yee, H. K. C.; Lacy, Mark; Surace, Jason; Gilbank, David; Blindert, Kris; Hoekstra, Henk; Majumdar, Subhabrata; Gardner, Jonathan P.; Gladders, Michael D.; Lonsdale, Carol

2009-01-01

The Spitzer Adaptation of the Red-sequence Cluster Survey (SpARCS) is a z'-passband imaging survey, consisting of deep (z' ≅ 24 AB) observations made from both hemispheres using the CFHT 3.6 m and CTIO 4 m telescopes. The survey was designed with the primary aim of detecting galaxy clusters at z > 1. In tandem with pre-existing 3.6 μm observations from the Spitzer Space Telescope SWIRE Legacy Survey, SpARCS detects clusters using an infrared adaptation of the two-filter red-sequence cluster technique. The total effective area of the SpARCS cluster survey is 41.9 deg 2 . In this paper, we provide an overview of the 13.6 deg 2 Southern CTIO/MOSAIC II observations. The 28.3 deg 2 Northern CFHT/MegaCam observations are summarized in a companion paper by Muzzin et al. In this paper, we also report spectroscopic confirmation of SpARCS J003550-431224, a very rich galaxy cluster at z = 1.335, discovered in the ELAIS-S1 field. To date, this is the highest spectroscopically confirmed redshift for a galaxy cluster discovered using the red-sequence technique. Based on nine confirmed members, SpARCS J003550-431224 has a preliminary velocity dispersion of 1050 ± 230 km s -1 . With its proven capability for efficient cluster detection, SpARCS is a demonstration that we have entered an era of large, homogeneously selected z > 1 cluster surveys.

Development and evaluation of Pleurotus tuber-regium-cornstarch composite as a direct compression multifunctional excipient.

Science.gov (United States)

Okoye, Ebere I; Onyekweli, Anthony O

2016-01-01

The aim was to develop a novel excipient from Pleurotus tuber-regium (PT)-cornstarch (CS) mixture and evaluate its multifunctional characteristics in tablet formulation. Composites were generated from dephytochemicalized PT and CS combined at 1:1 to 4:1 ratios and pregelatinized in a hot water bath at 65°C ± 2°C for 5 min. The paste was dried, pulverized, and screened through 150-μm sieve. PT-CS physical mixtures were prepared and their characteristics/functionalities in tableting chloroquine were compared to those of composites and microcrystalline cellulose (Avicel(®)). PT ash value was 0.40 ± 0.09% and heavy metal contents were below official limits. PT's differential scanning calorimetric (DSC) thermogram depicted broad melting peak at 329.5°C; this peak was attenuated by the presence of CS. Fourier transform infrared (FTIR) spectra predicted compatibility between PT and CS. Composites consolidated better and also flowed better than physical mixtures and Avicel(®). Increasing PT content enhanced the excipients' swellabilities, and composites possessed significantly (P plastic deformation with yield pressures significantly (P plastic deformation. The mechanical properties of chloroquine tablets were acceptable, with the 1:4 (PT:CS) imparting the best properties. Mean disintegration times for the commercial comparator and Avicel(®) -containing tablets were significantly higher (P < 0.05) than those of composites. Drug release from tablets formulated with composites were similar to the commercial comparator, but significantly higher (P < 0.05) than those of Avicel(®). The novel composites are excellent multifunctional excipients, the best (PT:CS 1:4) one showcasing potentially better mechanical functionality than Avicel(®), a popular multifunctional excipient.

Novel Glucose-1-Phosphatase with High Phytase Activity and Unusual Metal Ion Activation from Soil Bacterium Pantoea sp. Strain 3.5.1.

Science.gov (United States)

Suleimanova, Aliya D; Beinhauer, Astrid; Valeeva, Liia R; Chastukhina, Inna B; Balaban, Nelly P; Shakirov, Eugene V; Greiner, Ralf; Sharipova, Margarita R

2015-10-01

Phosphorus is an important macronutrient, but its availability in soil is limited. Many soil microorganisms improve the bioavailability of phosphate by releasing it from various organic compounds, including phytate. To investigate the diversity of phytate-hydrolyzing bacteria in soil, we sampled soils of various ecological habitats, including forest, private homesteads, large agricultural complexes, and urban landscapes. Bacterial isolate Pantoea sp. strain 3.5.1 with the highest level of phytase activity was isolated from forest soil and investigated further. The Pantoea sp. 3.5.1 agpP gene encoding a novel glucose-1-phosphatase with high phytase activity was identified, and the corresponding protein was purified to apparent homogeneity, sequenced by mass spectroscopy, and biochemically characterized. The AgpP enzyme exhibits maximum activity and stability at pH 4.5 and at 37°C. The enzyme belongs to a group of histidine acid phosphatases and has the lowest Km values toward phytate, glucose-6-phosphate, and glucose-1-phosphate. Unexpectedly, stimulation of enzymatic activity by several divalent metal ions was observed for the AgpP enzyme. High-performance liquid chromatography (HPLC) and high-performance ion chromatography (HPIC) analyses of phytate hydrolysis products identify dl-myo-inositol 1,2,4,5,6-pentakisphosphate as the final product of the reaction, indicating that the Pantoea sp. AgpP glucose-1-phosphatase can be classified as a 3-phytase. The identification of the Pantoea sp. AgpP phytase and its unusual regulation by metal ions highlight the remarkable diversity of phosphorus metabolism regulation in soil bacteria. Furthermore, our data indicate that natural forest soils harbor rich reservoirs of novel phytate-hydrolyzing enzymes with unique biochemical features. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Isolation of C11 Cyclopentenones from Two Didemnid Species, Lissoclinum sp. and Diplosoma sp.

Directory of Open Access Journals (Sweden)

Katsuhiro Ueda

2009-12-01

Full Text Available A series of new C11 cyclopentenones 1-7 was isolated, together with four known metabolites 9/10, 12 and 13, from the extract of the didemnid ascidian Lissoclinum sp. The other didemnid ascidian Diplosoma sp. contained didemnenones 1, 2 and 5, and five known metabolites 8-12. The structures of 1-7 were elucidated by spectroscopic analyses. Cytotoxicity of the isolated compounds was evaluated against three human cancer cell lines (HCT116, A431 and A549.

Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

Science.gov (United States)

Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

2017-10-01

The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

Pesticide lambda-cyhalothrin degradation using mesorhizobium sp. (s1b) and bartonella sp. (s2b) strains isolated from cotton crop

International Nuclear Information System (INIS)

Chumro, W.A.; Phulpoto, A.H.; Mangi, S.; Kanhar, N.A.; Ahmed, S.; Qazi, M.A.; Pirzada, T.

2017-01-01

Lambda-cyhalothrin (LC), synthetic pyrethroid pesticide is used to control a wide range of pests in variety of agricultural fields. Pesticides are potentially harmful environmental pollutants and pose serious threat to human health. Very limited options are available for environment friendly removal of LC. Interestingly, soil microbes have been known to possess remarkable genetic makeup that helps them to perform vital job in cleaning-up harmful pollutants from the environment. In present study, two LC-degrading bacteria viz. Mesorhizobium sp. strain S1B (Accession no. gb|MF471843|) and Bartonella sp. strain S2B (Accession no. b|MF471844|) were isolated by soil enrichment technique from cotton crop soil and characterized taxonomically using conventional methods and molecular PCR-based 16S rRNA sequence homology. The bacterial strains S1B and S2B achieved 29% and 40% removal of LC (conc. 250 mg/L, w/v), with maximum growth absorbance (OD) of 1.19 +- 0.06 and 1.13+- 0.09, respectively, during 20 days of incubation at 30 degree C and agitation 200 rpm under experimental laboratory circumstances. The percent removal of LC was estimated using UV-Vis Spectroscopy at 287 nm (? max) against the standard curve plotted at different LC concentrations. The bacterial isolates of present study have exhibited substantial efficiency for environmental biodegradation of the pesticide. (author)

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.

Effect of Agroforestry Residues Partially Biodegraded by Pleurotus Ostreatus (Pleurotaceae on Tomato Seedlings Development

Directory of Open Access Journals (Sweden)

Jorge Alberto Luna Fontalvo

2013-05-01

Se evaluó el desarrollo de plántulas de tomate (planta bioindicadora de toxicidad en suelos con aserrín y cascarilla de arroz parcialmente biodegradados por Pleurotus Ostreatus bajo condiciones de invernadero. Se determinaron los componentes orgánicos (carbono, celulosa, lignina, extraíbles y materia orgánica e inorgánicos (nitrógeno, fósforo y pH antes y después de inocular el hongo en el aserrín y la cascarilla de arroz. Se realizaron mezclas de cada sustrato con un suelo pobre en nutrientes en proporciones iguales (1:1 y se les determinó el porcentaje de humedad. El experimento estuvo constituido por un diseño completamente aleatorio, con dos grupos de seis tratamientos para cada sustrato, a los 30 días se determinaron los parámetros de crecimiento y desarrollo de las plántulas. Los sustratos biodegradados reportaron bajo contenido de C, N y P. El tratamiento aserrín biodegradado + suelo fertilizado (ASB + SF, presentó los mejores resultados en número de hojas (12,9, altura de las plantas (25,94 cm, longitud radical (5,92 cm, peso seco (0,138 g y peso fresco (1,012 g. El sustrato ASB + SF puede funcionar como sustrato favorable para el cultivo de plántulas de tomate debido a que aporta los nutrientes necesarios para el buen crecimiento de las plántulas. En la cascarilla de arroz las plantas no crecieron adecuadamente para conseguir ser trasplantadas.

Structure of a thermostable serralysin from Serratia sp. FS14 at 1.1 Å resolution.

Science.gov (United States)

Wu, Dongxia; Ran, Tinting; Wang, Weiwu; Xu, Dongqing

2016-01-01

Serralysin is a well studied metalloprotease, and typical serralysins are not thermostable. The serralysin isolated from Serratia sp. FS14 was found to be thermostable, and in order to reveal the mechanism responsible for its thermostability, the crystal structure of serralysin from Serratia sp. FS14 was solved to a crystallographic R factor of 0.1619 at 1.10 Å resolution. Similar to its homologues, it mainly consists of two domains: an N-terminal catalytic domain and a `parallel β-roll' C-terminal domain. Comparative studies show that the shape of the catalytic active-site cavity is more open owing to the 189-198 loop, with a short 310-helix protruding further from the molecular surface, and that the β-sheets comprising the `parallel β-roll' are longer than those in its homologues. The formation of hydrogen bonds from one of the nonconserved residues (Asn200) to Lys27 may contribute to the thermostability.

Large-scale evidence for the effect of the COLIA1 Sp1 polymorphism on osteoporosis outcomes: the GENOMOS study.

Directory of Open Access Journals (Sweden)

Stuart H Ralston

2006-04-01

Full Text Available Osteoporosis and fracture risk are considered to be under genetic control. Extensive work is being performed to identify the exact genetic variants that determine this risk. Previous work has suggested that a G/T polymorphism affecting an Sp1 binding site in the COLIA1 gene is a genetic marker for low bone mineral density (BMD and osteoporotic fracture, but there have been no very-large-scale studies of COLIA1 alleles in relation to these phenotypes.Here we evaluated the role of COLIA1 Sp1 alleles as a predictor of BMD and fracture in a multicenter study involving 20,786 individuals from several European countries. At the femoral neck, the average (95% confidence interval [CI] BMD values were 25 mg/cm2 (CI, 16 to 34 mg/cm2 lower in TT homozygotes than the other genotype groups (p < 0.001, and a similar difference was observed at the lumbar spine; 21 mg/cm2 (CI, 1 to 42 mg/cm2, (p = 0.039. These associations were unaltered after adjustment for potential confounding factors. There was no association with fracture overall (odds ratio [OR] = 1.01 [CI, 0.95 to 1.08] in either unadjusted or adjusted analyses, but there was a non-significant trend for association with vertebral fracture and a nominally significant association with incident vertebral fractures in females (OR = 1.33 [CI, 1.00 to 1.77] that was independent of BMD, and unaltered in adjusted analyses.Allowing for the inevitable heterogeneity between participating teams, this study-which to our knowledge is the largest ever performed in the field of osteoporosis genetics for a single gene-demonstrates that the COLIA1 Sp1 polymorphism is associated with reduced BMD and could predispose to incident vertebral fractures in women, independent of BMD. The associations we observed were modest however, demonstrating the importance of conducting studies that are adequately powered to detect and quantify the effects of common genetic variants on complex diseases.

Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

Science.gov (United States)

Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

2009-04-01

The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

Cultivation of Pleurotus sajor-caju on banana stalk and Bahia grass based substrates Cultivo de Pleurotus sajor-caju em substratos a base de grama batatais e engaço de bananeira

Directory of Open Access Journals (Sweden)

Félix G de Siqueira

2011-06-01

Full Text Available Banana stalks and Bahia grass were utilized as basic starting materials for the production of the mushroom Pleurotus sajor-caju. Banana stalks were combined with other waste or supplement products (wheat bran, coast-cross hay, bean straw and cotton textile mill to obtain different nitrogen concentrations. Since Bahia grass is relatively rich in protein, it was combined with other substrates (banana stalk, coast-cross hay and bean straw to maintain a substrate nitrogen concentration of about 1.5%. Banana stalks and Bahia grass were both more efficient in the production of the mushroom P. sajor-caju when utilized without the addition of other substrates, with biological efficiencies of 74.4% and 74.12%, respectively. When combined with other substrates or grasses, there was a drop in biological efficiency, independent of the concentration of nitrogen. Furthermore, the addition of protein-rich waste to banana stalks resulted in a decrease or absence of fructification, which indicates that high concentrations of nitrogen in the cultivation substrate may hinder the cultivation of this mushroom. On the other hand, results reveal that the ideal concentration of nitrogen may depend on other physicochemical factors and these factors may determine the success in cultivating P. sajor-caju. Therefore, we conclude that P. sajor-caju may be cultivated on banana stalk and Bahia grass as pure substrates, not being necessary their supplementation or combine them with another substrates.O engaço de bananeira e a grama batatais foram utilizados como matérias-primas básicas para a produção do substrato de cultivo do cogumelo Pleurotus sajor-caju. O engaço de bananeira foi combinado com outros resíduos (farelo de trigo, capim "Coast-cross", palha de feijão e resíduo de lixadeira de algodão, com o objetivo de se obter substratos com diferentes concentrações de nitrogênio. Como a grama batatais é relativamente rica em proteína, a mesma foi combinada com

Impact of serum SP-A and SP-D levels on comparison and prognosis of idiopathic pulmonary fibrosis: A systematic review and meta-analysis.

Science.gov (United States)

Wang, Kai; Ju, Qing; Cao, Jing; Tang, Wenze; Zhang, Jian

2017-06-01

Idiopathic pulmonary fibrosis (IPF) has a poor prognosis in general; however, it is heterogeneous to detect relative biomarkers for predicting the disease progression. Serum biomarkers can be conveniently collected to detect and help to differentially diagnose IPF and predict IPF prognosis. This meta-analysis aimed to evaluate the use of serum surfactant proteins A and D (SP-A and SP-D) for differential diagnosis and prognosis of IPF. Relevant articles were searched in PubMed, Embase, and Chinese National Knowledge Infrastructure databases and reviewed by 2 independent readers. Standard mean difference (SMD) and 95% confidence interval (CI) were calculated to assess the difference in serum levels of SP-A/D among patients with IPF, when compared to patients with non-IPF interstitial lung disease (ILD), pulmonary infection, and healthy control. Hazard ratio (HR) and 95% CI were used to compare the relative risk of mortality. Twenty-one articles (totalling 1289 IPF patients) were included in final meta-analysis. Serum SP-A levels were significantly higher in patients with IPF than in patients with non-IPF ILD (SMD: 1.108 [0.584, 1.632], P infection (SMD: 1.320 [0.999, 1.640], P SMD: 2.802 [1.901, 3.702], P SMD: 0.459 [-0.000, 0.919], P = .050). Serum SP-D levels were significantly higher in patients with IPF than in patients with pulmonary infection (SMD: 1.308 [0.813, 1.803], P SMD: 2.235 [1.739, 2.731], P < .001). Risk of death in patients with IPF and elevated serum SP-A was increased 39% compared to patients with low SP-A groups. Elevated SP-D increased risk by 111% when compared to low SP-D. In acute exacerbation of IPF, serum SP-A/D were higher than those in stable stage. The comparisons and prognosis might be different in Asian and Caucasian patients. Serum SP-A/D detection might be useful for differential diagnosis and prediction of survival in patients with IPF.

Rhodotorula rosulata sp. nov., Rhodotorula silvestris sp. nov. and Rhodotorula straminea sp. nov., novel myo-inositol-assimilating yeast species in the Microbotryomycetes.

Science.gov (United States)

Golubev, Wladyslav I; Scorzetti, Gloria

2010-10-01

Three novel species are described as Rhodotorula rosulata sp. nov. (type strain VKM Y-2962(T) =CBS 10977(T)), Rhodotorula silvestris sp. nov. (type strain VKM Y-2971(T) =CBS 11420(T)) and Rhodotorula straminea sp. nov. (type strain VKM Y-2964(T) =CBS 10976(T)) based on the study of eight isolates from needle litter. The new species, phylogenetically located within the Microbotryomycetes, are related to glucuronate-assimilating species of the genus Rhodotorula. Sequencing of the D1/D2 domains of the LSU rDNA gene and the internal transcribed spacer (ITS) region, as well as physiological characterization, revealed their distinct taxonomic positions.

Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

Directory of Open Access Journals (Sweden)

Savić Milena D.

2009-01-01

Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

A comparison between electrical uterine monitor, tocodynamometer and intra uterine pressure catheter for uterine activity in labor.

Science.gov (United States)

Hadar, Eran; Biron-Shental, Tal; Gavish, Oz; Raban, Oded; Yogev, Yariv

2015-08-01

We aimed to evaluate the performance of a non-invasive EMG electrical uterine monitor (EUM) versus tocodynamometry (TOCO) by comparing both to internal uterine pressure catheter (IUPC). Prospective observational trial. Uterine activity was recorded continuously and simultaneously, in women during active term labor, with TOCO, EUM and IUPC. Uterine activity tracings were analyzed by three blinded physicians. Overall, 385 tracings from 43 women were analyzed. A similar rate of interpretable tracings between physicians was demonstrated for EUM (87%; 95% CI 80.9-92.7%) and IUPC (94.8%; 95% CI 83.4-96.3%), with a significantly lower rate for TOCO (67.5%; 95% CI 59.4-76.8%, p TOCO versus IUPC (-3.34 ± 4.97). There is a high variability between the timing of TOCO contractions as compared to IUPC (4.74 ± 10.03 seconds), while a gap of 8.46 ± 4.24 seconds was detected for EUM. The sensitivity, positive predictive value and false positive rate for individual contraction identification by TOCO and EUM are 54.0%, 84.4%, 15.6% and 94.2%, 87.6%, 12.4%, respectively. EUM is efficient as IUPC for uterine activity assessment and both techniques are superior in comparison to external tocodynamometry. Our results support the use of non-invasive EMG technology to monitor uterine activity.

Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

Science.gov (United States)

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

2017-01-01

Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Directory of Open Access Journals (Sweden)

Čeněk Novotný

2016-07-01

Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.

Induction of miR-137 by Isorhapontigenin (ISO) Directly Targets Sp1 Protein Translation and Mediates Its Anticancer Activity Both In Vitro and In Vivo.

Science.gov (United States)

Zeng, Xingruo; Xu, Zhou; Gu, Jiayan; Huang, Haishan; Gao, Guangxun; Zhang, Xiaoru; Li, Jingxia; Jin, Honglei; Jiang, Guosong; Sun, Hong; Huang, Chuanshu

2016-03-01

Our recent studies found that isorhapontigenin (ISO) showed a significant inhibitory effect on human bladder cancer cell growth, accompanied with cell-cycle G0-G1 arrest as well as downregulation of Cyclin D1 expression at transcriptional level via inhibition of Sp1 transactivation in bladder cancer cells. In the current study, the potential ISO inhibition of bladder tumor formation has been explored in a xenograft nude mouse model, and the molecular mechanisms underlying ISO inhibition of Sp1 expression and anticancer activities have been elucidated both in vitro and in vivo. Moreover, the studies demonstrated that ISO treatment induced the expression of miR-137, which in turn suppressed Sp1 protein translation by directly targeting Sp1 mRNA 3'-untranslated region (UTR). Similar to ISO treatment, ectopic expression of miR-137 alone led to G0-G1 cell growth arrest and inhibition of anchorage-independent growth in human bladder cancer cells, which could be completely reversed by overexpression of GFP-Sp1. The inhibition of miR-137 expression attenuated ISO-induced inhibition of Sp1/Cyclin D1 expression, induction of G0-G1 cell growth arrest, and suppression of cell anchorage-independent growth. Taken together, our studies have demonstrated that miR-137 induction by ISO targets Sp1 mRNA 3'-UTR and inhibits Sp1 protein translation, which consequently results in reduction of Cyclin D1 expression, induction of G0-G1 growth arrest, and inhibition of anchorage-independent growth in vitro and in vivo. Our results have provided novel insights into understanding the anticancer activity of ISO in the therapy of human bladder cancer. ©2016 American Association for Cancer Research.