WorldWideScience

Sample records for sp eum1 pleurotus

  1. Morphological and enzymatic response of the thermotolerant fungus Fomes sp. EUM1 in solid state fermentation under thermal stress.

    Science.gov (United States)

    Ordaz-Hernández, Armando; Ortega-Sánchez, Eric; Montesinos-Matías, Roberto; Hernández-Martínez, Ricardo; Torres-Martínez, Daniel; Loera, Octavio

    2016-08-01

    Thermotolerance of the fungus Fomes sp. EUM1 was evaluated in solid state fermentation (SSF). This thermotolerant strain improved both hyphal invasiveness (38%) and length (17%) in adverse thermal conditions exceeding 30°C and to a maximum of 40°C. In contrast, hyphal branching decreased by 46% at 45°C. The production of cellulases over corn stover increased 1.6-fold in 30°C culture conditions, xylanases increased 2.8-fold at 40°C, while laccase production improved 2.7-fold at 35°C. Maximum production of lignocellulolytic enzymes was obtained at elevated temperatures in shorter fermentation times (8-6 days), although the proteases appeared as a thermal stress response associated with a drop in lignocellulolytic activities. Novel and multiple isoenzymes of xylanase (four bands) and cellulase (six bands) were secreted in the range of 20-150 kDa during growth in adverse temperature conditions. However, only a single laccase isoenzyme (46 kDa) was detected. This is the first report describing the advantages of a thermotolerant white-rot fungus in SSF. These results have important implications for large-scale SSF, where effects of metabolic heat are detrimental to growth and enzyme production, which are severely affected by the formation of high temperature gradients. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Interaction of uranium with Pleurotus sp

    International Nuclear Information System (INIS)

    Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

    2002-01-01

    Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

  3. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  4. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

    Directory of Open Access Journals (Sweden)

    Sunil S. More

    2011-01-01

    Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax⁡ values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.

  5. VALOR NUTRICIONAL DEL HENO DE TRANSVALA INOCULADO CON EL HONGO Pleurotus ostreatus sp

    Directory of Open Access Journals (Sweden)

    Rodolfo WingChing-Jones

    2009-01-01

    Full Text Available Se analizó el valor nutricional del heno de Transvala utilizado en la producción del hongo comestible Pleurotus ostreatus. El heno fue analizado antes de inocular el hongo y después de la cosecha. Se determinó: materia seca (MS, proteína cruda (PC, extracto etéreo (EE, ceniza (Ce, digestibilidad in vitro de la MS (DIVMS, carbohidratos no fibrosos (CNF, fibra detergente neutro (FDN, fibra detergente ácido (FDA, lignina, nitrógeno ligado a la fibra detergente neutro (N-FDN y a la fibra detergente ácida (N-FDA, nutrimentos digestibles totales (NDT (1X, energía digestible (ED, energía metabolizable (EM, energía neta de lactancia (ENl, energía de mantenimiento (ENm y energía neta de ganancia (ENg. Sobresalen niveles bajos de PC, DIVMS y NDT; y valores altos de lignina, FDN y FDA. El contenido de MS, FDN, hemicelulosa (He, lignina, CNF y EE presentó diferencias significativas, debidas al crecimiento del hongo. La variación en calidad en estas variables fue de (- 48,75%, (- 24,76%, (- 80,22%, (- 27,94%, (+ 51,52% y (- 26,13%, respectivamente. La mejoría en la calidad nutricional del heno, después de la cosecha del hongo, no es tan significativa como para cambiar la perspectiva en su uso dentro de la ración total de rumiantes, por lo que el beneficio del heno se basa más en aspectos físicos que nutricionales.

  6. Characterization of the rcsA Gene from Pantoea sp. Strain PPE7 and Its Influence on Extracellular Polysaccharide Production and Virulence on Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Min Keun Kim

    2017-06-01

    Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.

  7. Pleurotus sajor caju

    African Journals Online (AJOL)

    Administrator

    The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

  8. DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)

    OpenAIRE

    Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.

    2014-01-01

    The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...

  9. Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...

    African Journals Online (AJOL)

    PROF HORSFALL

    pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.

  10. Laccase Enzymes in Inocula Pleurotus spp

    Directory of Open Access Journals (Sweden)

    Nora García-Oduardo

    2017-01-01

    Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

  11. The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

    Science.gov (United States)

    Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

    2015-12-01

    Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

  12. Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...

    African Journals Online (AJOL)

    Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...

  13. Comparison of mushroom yield for Pleurotus Sajor Caju and Pleurotus Florida in different number of flushes

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom

    2006-01-01

    This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)

  14. Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

    Directory of Open Access Journals (Sweden)

    Hanan Aref Hasan

    2018-04-01

    Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

  15. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  16. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  17. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

    2015-01-01

    We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  18. Cultivation Techniques and Medicinal Properties of Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Andrej Gregori

    2007-01-01

    Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

  19. Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

    African Journals Online (AJOL)

    The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

  20. nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

    African Journals Online (AJOL)

    DJFLEX

    The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

  1. Improving the feeding value of straws with Pleurotus ostreatus

    NARCIS (Netherlands)

    Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

    2015-01-01

    The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

  2. Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

    African Journals Online (AJOL)

    Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

  3. Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

    African Journals Online (AJOL)

    An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

  4. Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

    African Journals Online (AJOL)

    Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

  5. Preliminary investigation into the use of Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

  6. (Pleurotus pulmonarius) grown on cotton waste and cassava peel

    African Journals Online (AJOL)

    This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

  7. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Czech Academy of Sciences Publication Activity Database

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  8. DNA marking of some quantitative trait loci in the cultivated edible mushroom Pleurotus ostreatus (Fr.) Kumm

    NARCIS (Netherlands)

    Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.

    2012-01-01

    Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.

  9. Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

    Science.gov (United States)

    Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

    2014-11-01

    Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA

    Directory of Open Access Journals (Sweden)

    Jamile Rosa RAMPINELLI

    2010-11-01

    Full Text Available

    Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.

  11. Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2016-09-01

    Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

  12. Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

    OpenAIRE

    Albuquerque, Margeli Pereira de

    2010-01-01

    As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

  13. Electrical stimulation in white oyster mushroom (Pleurotus florida) production

    Science.gov (United States)

    Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

    2017-09-01

    White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

  14. Diseases and pests noxious to Pleurotus spp. mushroom crops.

    Science.gov (United States)

    Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

    The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  15. Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

    International Nuclear Information System (INIS)

    Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

    2012-01-01

    Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

  16. Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

    Energy Technology Data Exchange (ETDEWEB)

    Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

  17. Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

    2016-01-01

    Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

  18. Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

    Science.gov (United States)

    This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

  19. Studies on the aroma of different species and strains of Pleurotus measured by GC/MS, sensory analysis and electronic nose

    OpenAIRE

    Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz

    2009-01-01

    The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...

  20. Cultivation of Pleurotus ostreatus and other edible mushrooms.

    Science.gov (United States)

    Sánchez, Carmen

    2010-02-01

    Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

  1. Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    O. M. Alekseenko

    2010-07-01

    Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

  2. Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

    Science.gov (United States)

    Guan, Qinlan; Gong, Mingfu; Tang, Mei

    2018-04-01

    The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

  3. Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

    Institute of Scientific and Technical Information of China (English)

    Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

    2004-01-01

    @@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

  4. Evaluation of biomass of some invasive weed species as substrate for oyster mushroom (Pleurotus spp.) cultivation.

    Science.gov (United States)

    Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha

    2014-01-15

    This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.

  5. ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

    Directory of Open Access Journals (Sweden)

    Gabriela Popa

    2016-11-01

    Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

  6. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  7. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  8. Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

    Science.gov (United States)

    Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

    2008-07-01

    Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

  9. Exopolysaccharides from Pleurotus pulmonarius: Fermentation Optimization, Characterization and Antioxidant Activity

    Directory of Open Access Journals (Sweden)

    Jin-Wen Shen

    2013-01-01

    Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.

  10. Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    2012-12-01

    Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

  11. Nutriceutical potential of Pleurotus tuber-regium sclerotium

    Directory of Open Access Journals (Sweden)

    R. C. Ohiri

    2018-04-01

    Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

  12. Establishment of an efficient transformation system for Pleurotus ostreatus.

    Science.gov (United States)

    Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

    2017-11-21

    Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

  13. Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  14. New lipases by mining of Pleurotus ostreatus genome.

    Directory of Open Access Journals (Sweden)

    Alessandra Piscitelli

    Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.

  15. Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

    NARCIS (Netherlands)

    Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

    2006-01-01

    When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

  16. Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

  17. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  18. Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

    2002-01-01

    Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  19. Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

    African Journals Online (AJOL)

    Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

  20. Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    SERVER

    2008-01-04

    Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

  1. Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production

    Science.gov (United States)

    Slavens, Shelyn Gehle

    Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass

  2. Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

    Science.gov (United States)

    Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

    2017-06-01

    Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

  3. Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

    Directory of Open Access Journals (Sweden)

    M. Abu Sayeed

    2014-01-01

    Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

  4. Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

    Directory of Open Access Journals (Sweden)

    Eduardo Bernardi

    2009-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

  5. Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    OpenAIRE

    Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

    2007-01-01

    Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

  6. Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

    International Nuclear Information System (INIS)

    Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

    2011-01-01

    Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

  7. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    OpenAIRE

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

  8. Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

    OpenAIRE

    Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

    2011-01-01

    A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

  9. USO DE HOJARASCA DE ROBLE y BAGAZO DE CAÑA EN LA PRODUCCIÓN DE Pleurotus ostreatus USO DA SERAPILHEIRA DE CARVALHO E BAGAÇO DA CANA NA PRODUÇÃO DO Pleurotus ostreatus USE OF THE OAK DEAD LEAVES AND SUGAR CANE BAGASSE IN THE Pleurotus ostreatus PRODUCTION

    Directory of Open Access Journals (Sweden)

    PILAR SUDIANY VARGAS

    2012-06-01

    Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos

  10. Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

    Directory of Open Access Journals (Sweden)

    Yueting Dai

    2017-11-01

    Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

  11. Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

    International Nuclear Information System (INIS)

    Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

  12. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  13. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  14. Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds

    Directory of Open Access Journals (Sweden)

    Sorina Ropciuc

    2016-10-01

    Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.

  15. Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

    Science.gov (United States)

    Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

    2017-01-01

    Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

  16. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Herminio Paredes Valencia

    2010-01-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

  17. Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

    Directory of Open Access Journals (Sweden)

    Maura Téllez-Téllez

    2016-03-01

    Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

  18. Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

    Science.gov (United States)

    Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

    2009-07-30

    This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

  19. BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

    Directory of Open Access Journals (Sweden)

    W.A. Tapie

    2016-08-01

    Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

  20. Crescimento micelial de Pleurotus ostreatus em resíduo de Simarouba amara Mycelial growth of Pleurotus ostreatus in Simarouba amara sawdust

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2008-11-01

    Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.

  1. Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

    Directory of Open Access Journals (Sweden)

    Ahmed I. El-Batal

    2015-03-01

    Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

  2. Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Seyma Ozcirak Ergun

    2017-06-01

    Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

  3. Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

    Science.gov (United States)

    Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

    Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

  4. UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

    Directory of Open Access Journals (Sweden)

    JOSE MIGUEL CAMPO GAVIRIA

    2017-12-01

    Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

  5. Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

    Science.gov (United States)

    Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

    2016-08-01

    This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  6. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  7. Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

    International Nuclear Information System (INIS)

    Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

    2002-01-01

    This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

  8. The effect of repair inhibitor on radiation damages of pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yang Zongqu; Wang Bonan; Li Xuzhao

    1996-01-01

    The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA

  9. SP. Pescado

    Directory of Open Access Journals (Sweden)

    Renato Gendre

    2003-12-01

    Full Text Available Nell'occhiello di un articolo dal titolo Il Peru dei de[Jini rosa e de/la grande pioggia si legge: "da una partenza  in aereo al «pescado»  che ti  sfamera."1 Questa parola spagnola, giustamente chiusa tra caporali, a noi pare molto interes­ sante, perche, nonostante l'apparenza, non ha nulla da spartire sotto i1 profilo se­ mantico con l'it. pescato. lnfatti, tutti i piu importanti dizionari della lingua italiana, di ieri e di oggi, etimologici e non 2, registrano  accanto a pescata,  ii lemma pescato, 3 ma lo spiegano come "quantita di pesce catturato nel corso di una battuta o di una stagione di pesca",4 mentre lo sp. pescado  indica i1 "pesce (solo nel senso di: pesGe pescato da mangiare [...]".s

  10. Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

    Directory of Open Access Journals (Sweden)

    Nelson Menolli Junior

    2010-04-01

    Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

  11. Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833

    Directory of Open Access Journals (Sweden)

    Heloisa Helena Batista da Silva

    2009-12-01

    Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.

  12. Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

    Science.gov (United States)

    Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

    2015-10-01

    Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  14. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  15. Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

    Directory of Open Access Journals (Sweden)

    Akpaja EO

    2012-02-01

    Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

  16. [The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

    Science.gov (United States)

    Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

    2009-01-01

    The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

  17. The potential of Pleurotus-treated olive mill solid waste as cattle feed.

    Science.gov (United States)

    Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

    2009-12-01

    The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

  18. Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme

    International Nuclear Information System (INIS)

    Hassan Hamdani Mutaat; Mat Rasol Awang

    2004-01-01

    The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)

  19. Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rossana Liguori

    2015-01-01

    Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.

  20. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

  1. Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

    Science.gov (United States)

    Jayakumar, T; Ramesh, E; Geraldine, P

    2006-12-01

    This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

  2. Biomass production of pleurotus sajor-caju by submerged culture fermentation

    International Nuclear Information System (INIS)

    Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.

    2006-01-01

    The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)

  3. Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.

    Science.gov (United States)

    Plagemann, Ina; Krings, Ulrich; Berger, Ralf G

    2014-01-01

    The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.

  4. Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

    Science.gov (United States)

    Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

    2011-10-01

    Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Gómez Carabalí Arnulfo

    2010-03-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y ‘estopa’ de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

  6. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Herminio Paredes Valencia

    2010-01-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

  7. Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

    Science.gov (United States)

    Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

    2014-01-01

    Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

  8. EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

    Directory of Open Access Journals (Sweden)

    S. N. FASEHAH

    2017-04-01

    Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

  9. [Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

    Science.gov (United States)

    Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

    Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  10. Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

    International Nuclear Information System (INIS)

    Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

    2007-01-01

    The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

  11. Draft genome sequences of six neonatal meningitis-causing escherichia coli isolates (SP-4, SP-5, SP-13, SP-16, SP-46, and SP-65)

    Science.gov (United States)

    Neonatal meningitis Escherichia coli isolates (SP-4, SP-5, SP-13, SP-16, SP-46, and SP-65) were recovered from infants in the Netherlands from 1989 to 1997. Here, we report the draft genome sequences for these six E. coli isolates, which are currently being used to validate food safety processing te...

  12. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

    Directory of Open Access Journals (Sweden)

    Marli Camassola

    2013-01-01

    Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

  13. Tratamento do feno de braquiária pelo fungo Pleurotus ostreatus Pretreatment effects on fiber degradation of brachiaria hay by Pleurotus ostreatus fungus

    Directory of Open Access Journals (Sweden)

    Patrick Schmidt

    2003-12-01

    Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus

  14. Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

    Directory of Open Access Journals (Sweden)

    javad janpoor

    2018-03-01

    Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

  15. Pleurotus ostreatus

    African Journals Online (AJOL)

    badr

    2011-11-07

    Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

  16. Pleurotus ostreatus and Pleurotus pulmonarius

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-15

    Mar 15, 2010 ... was maintained on plate of potato dextrose agar (PDA). Degradation of ... 40% concentrate feed (40% corn, 10% wheat offal, 10% palm kernel cake, 20% ... meal) and 60% Pannicum maximum at 5% body weight. The rumen.

  17. Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

    International Nuclear Information System (INIS)

    Khalaf, M.A.; Atia, A.I.

    2009-01-01

    Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

  18. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  19. Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

    Science.gov (United States)

    Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

    2016-12-01

    Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

  20. Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2017-01-01

    Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

  1. Maize Residue as a Viable Substrate for Farm Scale Cultivation of Oyster Mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Abena O. Adjapong

    2015-01-01

    Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.

  2. Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-05-01

    One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

  3. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  4. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Science.gov (United States)

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  5. Effect of agroforestry residues partially biodegraded by pleurotus ostreatus (pleurotaceae) on tomato seedlings development

    International Nuclear Information System (INIS)

    Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel

    2013-01-01

    It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.

  6. Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts

    Directory of Open Access Journals (Sweden)

    Milovanović Ivan

    2014-01-01

    Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032

  7. Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

    Directory of Open Access Journals (Sweden)

    Čeněk Novotný

    2016-07-01

    Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.

  8. Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

    Science.gov (United States)

    Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

    2018-07-25

    The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Effect of Pleurotus eryngii stalk residue on the oxidative status and meat quality of broiler chickens.

    Science.gov (United States)

    Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi

    2012-11-07

    Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.

  10. A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

    2015-03-01

    In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

  11. Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

    Science.gov (United States)

    Akpinar, Merve; Urek, Raziye Ozturk

    2012-01-01

    Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

  12. Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

    Directory of Open Access Journals (Sweden)

    Miriam HAIDUKOWSKI

    2017-05-01

    Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

  13. Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

    2014-01-01

    Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

  14. Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method

    Science.gov (United States)

    2014-01-01

    Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852

  15. Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

    Science.gov (United States)

    Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

    2012-10-01

    Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Heterologous production of the stain solving peptidase PPP1 from Pleurotus pulmonarius.

    Science.gov (United States)

    Leonhardt, Robin-Hagen; Krings, Ulrich; Berger, Ralf G; Linke, Diana

    2016-05-01

    A novel stain solving subtilisin-like peptidase (PPP1) was identified from the culture supernatant of the agaricomycete Pleurotus pulmonarius. It was purified to homogeneity using a sequence of preparative isoelectric focusing, anion exchange and size exclusion chromatography. Peptides were identified by ab initio sequencing (nLC-ESI-QTOF-MS/MS), characterizing the enzyme as a member of the subtilase family (EC 3.4.21.X). An expression system was established featuring the pPIC9K vector, an alternative Kozak sequence, the codon optimized gene ppp1 gene without the native signal sequence with C-terminal hexa-histidine tag, and Pichia pastoris GS115 as expression host. Intracellular active enzyme was obtained from cultivations in shake flasks and in a five liter bioreactor. With reaction optima of 40 °C and a pH > 8.5, considerable bleaching of pre-stained fabrics (blood, milk and India ink), and the possibility of larger-scale production, the heterologous enzyme is well suitable for detergent applications, especially at lower temperatures as part of a more energy- and cost-efficient washing process. Showing little sequence similarity to other subtilases, this unique peptidase is the first subtilisin-like peptidase from Basidiomycota, which has been functionally produced in Pichia pastoris.

  17. Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation

    Directory of Open Access Journals (Sweden)

    Silva Sueli Oliveira

    2002-01-01

    Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.

  18. Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

    Science.gov (United States)

    Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

    2016-11-01

    This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

    2014-09-03

    Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

  20. Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.

    Science.gov (United States)

    Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G

    2012-03-01

    Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

    2000-01-01

    Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

  2. Mutation breeding and submerged fermentation of a Pleurotus polysaccharide high-yield strain with low-energy heavy ions implantation

    International Nuclear Information System (INIS)

    Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian

    2010-01-01

    Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)

  3. New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-06-01

    Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

  4. EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

    Directory of Open Access Journals (Sweden)

    MARÍA DEL PILAR RÍOS

    2010-12-01

    Full Text Available Se evaluaron medios alternativos para la propagación de Pleurotus ostreatus y se comparó su comportamiento frente a un medio comercial. La respuesta a estos medios fue medida mediante la adaptación del hongo en cebada para la obtención de semilla comercial, y ésta a su vez en la respuesta a un sustrato a base de bagazo de caña para la obtención de orellanas. En la primera fase se obtuvo y sembró el hongo en un medio sólido de extracto de papa a dos concentraciones y tres valores de pH, utilizando un diseño factorial 2x3 (pH vs concentración de extracto de papa. En la segunda fase se midió el crecimiento de Pleurotus ostreatus inoculado en cebada hidratada esterilizada mediante un diseño completamente al azar 3x3. En la tercera se evaluó la colonización y fructificación del hongo en bagazo de caña usando parámetros como eficiencia biológica, rendimiento y tasa de producción semilla, con un diseño completamente al azar 3x3. El medio alternativo con pH 5,0 fue el más adecuado para el crecimiento del Pleurotus ostreatus, demostrando su adaptabilidad a medios con alto contenido de carbohidratos, cuyos rendimientos fueron apropiados para obtener niveles de producción competitivos en crecimiento y fructificación, disminuyendo así el tiempo de incubación y cosecha.Foram avaliados os meios alternativos para a propagação de fungos Pleurotus ostreatus e se comparou o seu comportamento em um ambiente comercial. A resposta a esses meios foi medida pela adaptação do fungo em cevada para a obtenção de sementes comerciais e este por sua vez, em resposta a um substrato a base de bagaço de cana para a produção de "Orellana". Na primeira fase foi obtida e plantou o fungo em meio sólido de extrato de batata a duas concentrações e três valores de pH, utilizando um design fatorial 2x3 (pH vs concentração de extrato de batata. Na segunda fase, mediu o crescimento de Pleurotus ostreatus inoculadas em cevada estéril úmida em 3x

  5. Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

    Science.gov (United States)

    Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

    2015-01-01

    The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

  6. Effect of Agroforestry Residues Partially Biodegraded by Pleurotus Ostreatus (Pleurotaceae on Tomato Seedlings Development

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Luna Fontalvo

    2013-05-01

    Se evaluó el desarrollo de plántulas de tomate (planta bioindicadora de toxicidad en suelos con aserrín y cascarilla de arroz parcialmente biodegradados por Pleurotus Ostreatus bajo condiciones de invernadero. Se determinaron los componentes orgánicos (carbono, celulosa, lignina, extraíbles y materia orgánica e inorgánicos (nitrógeno, fósforo y pH antes y después de inocular el hongo en el aserrín y la cascarilla de arroz. Se realizaron mezclas de cada sustrato con un suelo pobre en nutrientes en proporciones iguales (1:1 y se les determinó el porcentaje de humedad. El experimento estuvo constituido por un diseño completamente aleatorio, con dos grupos de seis tratamientos para cada sustrato, a los 30 días se determinaron los parámetros de crecimiento y desarrollo de las plántulas. Los sustratos biodegradados reportaron bajo contenido de C, N y P. El tratamiento aserrín biodegradado + suelo fertilizado (ASB + SF, presentó los mejores resultados en número de hojas (12,9, altura de las plantas (25,94 cm, longitud radical (5,92 cm, peso seco (0,138 g y peso fresco (1,012 g. El sustrato ASB + SF puede funcionar como sustrato favorable para el cultivo de plántulas de tomate debido a que aporta los nutrientes necesarios para el buen crecimiento de las plántulas. En la cascarilla de arroz las plantas no crecieron adecuadamente para conseguir ser trasplantadas.

  7. Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Idrus Kadir

    2010-01-01

    Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)

  8. Biodegradation of toxic chemicals by Pleurotus eryngii in submerged fermentation and solid-state fermentation.

    Science.gov (United States)

    Chang, Bea-Ven; Chang, Yi-Ming

    2016-04-01

    The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.

  9. Antihyperlipidemic activities of Pleurotus ferulae on biochemical and histological function in hypercholesterolemic rats

    Directory of Open Access Journals (Sweden)

    Nuhu Alam

    2011-01-01

    Full Text Available Background: Pleurotus ferulae is an edible mushroom has been widely used for nutritional and medicinal purposes. Irrespective of the medicinal importance or therapeutic potentials of P. ferulae, there have not been studies on anti-hyperlipidemic properties. Therefore, the present study investigates the effects of dietary P. ferulae fruiting bodies on plasma and feces biochemical and on the liver histological status in hypercholesterolemic rats. Methods: Six weeks old female Sprague-Dawley albino rats were divided into three groups of 10 rats each. Then biochemical and histological examinations were performed. Results: Feeding of a diet containing 5% P. ferulae fruiting bodies to hypercholesterolemic rat reduced plasma total cholesterol, triglyceride, low-density lipoprotein (LDL, total lipid, phospholipids, and LDL/high-density lipoprotein ratio by 30.02, 49.31, 71.15, 30.23, 21.93, and 65.31%, respectively. Mushroom also significantly reduced body weight in hypercholesterolemic rats. However, it had no adverse effects on plasma albumin, total bilirubin, direct bilirubin, creatinin, blood urea nitrogen, uric acid, glucose, total protein, calcium, sodium, potassium, chloride, inorganic phosphate, magnesium, and enzyme profiles. Feeding mushroom increased total lipid and cholesterol excretion in feces. The plasma lipoprotein fraction, separated by agarose gel electrophoresis, indicated that P. ferulae significantly reduced plasma β and pre-β-lipoprotein, while increased the α-lipoprotein. A histological study of hepatic cells by conventional hematoxylin-eosin and oil red O staining showed normal findings for mushroom-fed hypercholesterolemic rats. Conclusions: The present study suggests that 5% P. ferulae diet supplement provides health benefits, at least partially, by acting on the atherogenic lipid profile in hypercholesterolemic rats.

  10. Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

    Directory of Open Access Journals (Sweden)

    Juliet B. Akinyele

    2012-09-01

    Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

  11. Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation

    Directory of Open Access Journals (Sweden)

    Gian Luigi Rana

    2013-03-01

    Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.

  12. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  13. Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

    Directory of Open Access Journals (Sweden)

    Savić Milena D.

    2009-01-01

    Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

  14. Development and evaluation of Pleurotus tuber-regium-cornstarch composite as a direct compression multifunctional excipient.

    Science.gov (United States)

    Okoye, Ebere I; Onyekweli, Anthony O

    2016-01-01

    The aim was to develop a novel excipient from Pleurotus tuber-regium (PT)-cornstarch (CS) mixture and evaluate its multifunctional characteristics in tablet formulation. Composites were generated from dephytochemicalized PT and CS combined at 1:1 to 4:1 ratios and pregelatinized in a hot water bath at 65°C ± 2°C for 5 min. The paste was dried, pulverized, and screened through 150-μm sieve. PT-CS physical mixtures were prepared and their characteristics/functionalities in tableting chloroquine were compared to those of composites and microcrystalline cellulose (Avicel(®)). PT ash value was 0.40 ± 0.09% and heavy metal contents were below official limits. PT's differential scanning calorimetric (DSC) thermogram depicted broad melting peak at 329.5°C; this peak was attenuated by the presence of CS. Fourier transform infrared (FTIR) spectra predicted compatibility between PT and CS. Composites consolidated better and also flowed better than physical mixtures and Avicel(®). Increasing PT content enhanced the excipients' swellabilities, and composites possessed significantly (P plastic deformation with yield pressures significantly (P plastic deformation. The mechanical properties of chloroquine tablets were acceptable, with the 1:4 (PT:CS) imparting the best properties. Mean disintegration times for the commercial comparator and Avicel(®) -containing tablets were significantly higher (P < 0.05) than those of composites. Drug release from tablets formulated with composites were similar to the commercial comparator, but significantly higher (P < 0.05) than those of Avicel(®). The novel composites are excellent multifunctional excipients, the best (PT:CS 1:4) one showcasing potentially better mechanical functionality than Avicel(®), a popular multifunctional excipient.

  15. High temperature induced disruption of the cell wall integrity and structure in Pleurotus ostreatus mycelia.

    Science.gov (United States)

    Qiu, Zhiheng; Wu, Xiangli; Gao, Wei; Zhang, Jinxia; Huang, Chenyang

    2018-05-30

    Fungal cells are surrounded by a tight cell wall to protect them from harmful environmental conditions and to resist lysis. The synthesis and assembly determine the shape, structure, and integrity of the cell wall during the process of mycelial growth and development. High temperature is an important abiotic stress, which affects the synthesis and assembly of cell walls. In the present study, the chitin and β-1,3-glucan concentrations in the cell wall of Pleurotus ostreatus mycelia were changed after high-temperature treatment. Significantly higher chitin and β-1,3-glucan concentrations were detected at 36 °C than those incubated at 28 °C. With the increased temperature, many aberrant chitin deposition patches occurred, and the distribution of chitin in the cell wall was uneven. Moreover, high temperature disrupts the cell wall integrity, and P. ostreatus mycelia became hypersensitive to cell wall-perturbing agents at 36 °C. The cell wall structure tended to shrink or distorted after high temperature. The cell walls were observed to be thicker and looser by using transmission electron microscopy. High temperature can decrease the mannose content in the cell wall and increase the relative cell wall porosity. According to infrared absorption spectrum, high temperature broke or decreased the glycosidic linkages. Finally, P. ostreatus mycelial cell wall was easily degraded by lysing enzymes after high-temperature treatment. In other words, the cell wall destruction caused by high temperature may be a breakthrough for P. ostreatus to be easily infected by Trichoderma.

  16. EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Ummu Kalsum

    2011-09-01

    Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

  17. Optimization of cultural conditions for biosurfactant production by Pleurotus djamor in solid state fermentation.

    Science.gov (United States)

    Velioglu, Zulfiye; Ozturk Urek, Raziye

    2015-11-01

    Being eco-friendly, less toxic, more biodegradable and biocompatible, biological surfactants have higher activity and stability compared to synthetic ones. In spite of the fact that there are abundant benefits of biosurfactants over the synthetic congeners, the problem related with the economical and large scale production proceeds. The utilization of several industrial wastes in the production media as substrates reduces the production cost. This current study aims optimization of biosurfactant production conditions by Pleurotus djamor, grown on sunflower seed shell, grape wastes or potato peels as renewable cheap substrates in solid state fermentation. After determination of the best substrate for biosurfactant production, we indicate optimum size and amount of solid substrate, volume of medium, temperature, pH and Fe(2+) concentrations on biosurfactant production. In optimum conditions, by reducing water surface tension to 28.82 ± 0.3 mN/m and having oil displacement diameter of 3.9 ± 0.3 cm, 10.205 ± 0.5 g/l biosurfactant was produced. Moreover, chemical composition of biosurfactant produced in optimum condition was determined by FTIR. Lastly, laboratory's large-scale production was carried out in optimum conditions in a tray bioreactor designed by us and 8.9 ± 0.5 g/l biosurfactant was produced with a significant surface activity (37.74 ± 0.3 mN/m). With its economical suggestions and applicability of laboratory's large-scale production, this work indicates the possibility of using low cost agro-industrial wastes as renewable substrates for biosurfactant production. Therefore, using economically produced biosurfactant will reduce cost in several applications such as bioremediation, oil recovery and biodegradation of toxic chemicals. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

    International Nuclear Information System (INIS)

    Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

    2005-01-01

    A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

  19. Performance of Pleurotus pulmonarius mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    2017-10-01

    Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.

  20. Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

    Science.gov (United States)

    Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

    2010-10-01

    Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

  1. Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

  2. DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

    Directory of Open Access Journals (Sweden)

    Hamid Akbarirad

    2013-06-01

    Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

  3. ExaSP2

    Energy Technology Data Exchange (ETDEWEB)

    2017-09-08

    ExaSP2 is a reference implementation of typical linear algebra algorithms and workloads for a quantum molecular dynamics (QMD) electronic structure code. The algorithm is based on a recursive second-order Fermi-Operator expansion method (SP2) and is tailored for density functional based tight-binding calculations of material systems.

  4. Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

    Directory of Open Access Journals (Sweden)

    Eustáquio Souza Dias

    2003-12-01

    Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

  5. Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

    Directory of Open Access Journals (Sweden)

    Maria Teresa Branà

    Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

  6. Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Cristina Ramos

    2011-01-01

    Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

  7. Caracterización de la lacasa obtenida por dos métodos de producción con Pleurotus ostreatus Characterising laccase obtained by two production methods using Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Martínez César

    2003-12-01

    Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000

  8. In Vitro Antimicrobial and Antioxidant Activities of Ethanolic Extract of Lyophilized Mycelium of Pleurotus ostreatus PQMZ91109

    Directory of Open Access Journals (Sweden)

    Emanuel Vamanu

    2012-03-01

    Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.

  9. Biological transformation of anthracene in soil by Pleurotus ostreatus under solid-state fermentation conditions using wheat bran and compost

    International Nuclear Information System (INIS)

    Vargas, M C; Rodriguez, R; Sanchez, F; Ramirez, N

    2001-01-01

    Pleurotus ostreatus was grown in a soil mixture contaminated with anthracene, wheat bran and compost, in varying combinations. Assays with added bacteria and reinoculation of the fungus were also included. The results indicated that in many of the combinations, most of the anthracene was removed at the earliest sample time, 15 days. The most effective combination was spiked (anthracene-added) soil, fungus and compost and the addition of acclimated bacteria to this mixture inhibited anthracene removal. Analyses of extract by high-pressure liquid chromatography HPLC indicated that - anthraquinone, was the major metabolite formed. The results of this study indicate that solid-state fermentation of anthracene-contaminated soils using P. ostreatus in combination with wheat bran and compost additives can produce an accelerated rate of biological removal of anthracene from the soil

  10. Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

    Science.gov (United States)

    Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

    2017-01-01

    Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

  11. The fungistatic activity of organic selenium and its application to the production of cultivated mushrooms Agaricus bisporus and Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Savic Milena

    2012-01-01

    Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001

  12. Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

    Directory of Open Access Journals (Sweden)

    Petcharat, V. and

    2004-09-01

    Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

  13. Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

    OpenAIRE

    Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

    2014-01-01

    Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

  14. A Macrosphelide as the Unexpected Product of a Pleurotus ostreatus Strain-Mediated Biotransformation of Halolactones Containing the gem-Dimethylcyclohexane Ring. Part 1

    Directory of Open Access Journals (Sweden)

    Katarzyna Wińska

    2016-06-01

    Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.

  15. Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

    Science.gov (United States)

    Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

    2012-01-01

    Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

  16. Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

    Directory of Open Access Journals (Sweden)

    Alfonso Soto-Sánchez

    2015-09-01

    Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

  17. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation

    International Nuclear Information System (INIS)

    Moda, Evelise Moncaio

    2008-01-01

    The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 ± 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 ± 1 deg C and 90% UR for 8 days. CO 2 was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b * and enzymatic activity values in all treatments at the end of the storage period

  18. SP-100 Program overview

    International Nuclear Information System (INIS)

    Truscello, V.C.

    1984-01-01

    The SP-100 Program is expected to go through three phases: technology assessment and advancement, ground testing, and flight qualification. Currently the program is in the two- to three-year technology assessment and advancement stage. Goals are to identify the space nuclear power system concept that best meets anticipated requirements of future space missions, assess the technical feasibility of that concept, and establish a cost and schedule for developing the concept. The SP-100 Project Office has begun the implementation activities needed to meet these goals. With regard to refractory alloys, a better data base will be required before we move ahead in the program from technology assessment to ground demonstration

  19. Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Kátia Maria Gomes Machado

    2006-12-01

    Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

  20. Cryptosporidium sp. in lizards

    Czech Academy of Sciences Publication Activity Database

    Koudela, Břetislav; Modrý, D.

    1998-01-01

    Roč. 45, č. 1 (1998), s. 8 ISSN 1066-5234. [Cryptosporidium sp. in lazards. 01.01.1998-02.01.1998, Praha] R&D Projects: GA ČR GA508/95/0273; GA AV ČR IPP2020702 Subject RIV: fp - Other Medical Disciplines

  1. USO DEL BAGAZO ENRIQUECIDO CON EL HONGO Pleurotus ostreatus, EN DIETAS PARA BOVINOS ESTABULADOS EN CEBA UTILIZAÇÃO DO BAGAÇO ENRIQUECIDO COMO FUNGO Pleurotus ostreatus, EM DIETAS PARA BOVINOS ESTABULADOS EM ENGORDA Pleurotus ostreatus ENRICHED SUGAR CANEHUSKS UTILIZATION ON INDOOR CATTLEFATTENING DIETS

    Directory of Open Access Journals (Sweden)

    NATALIA LIZETTE CASTAÑO

    2012-12-01

    Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen

  2. Bioavailability and Digestibility of Nutrients from the Dried Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes): In Vivo Experiments.

    Science.gov (United States)

    Regula, Julita; Suliburska, Joanna; Siwulski, Marek

    2016-01-01

    There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.

  3. Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

    Energy Technology Data Exchange (ETDEWEB)

    Awang, M.R.; Mutaat, H.H.; Mahmud, M.S. (Ministry of Science, Technology and the Environment (Malaysia). Nuclear Energy Unit) (and others)

    In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm Empty Fruit Bunch (EFB) fibre leaving 70% useful materials. Conditions under which fermentation occurred were investigated. It was found that, in the temperature range 25-28[sup o]C, relative pH 6-8, moisture 60-70% and medium composition of CaCO[sub 3]: were the optimum conditions. The results showed in fermented products that there were substantial reductions in cellulosic component such as crude fibre (CF, 18%); acid detergent fibre (ADF, 45%), neutral detergent fibre (NDF, 61%) and acd detergent lignin (ADL, 14%). However, crude protein (CP, 10%) increase resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in the fermentation process corresponds to CO[sub 2] released during fermentation. A digestibility study has been carried out to determine the usefulness of this product to ruminants. Aflatoxin content was low in both the initial substrates and products. Based on nutritional value and low content of aflatoxins, the product is useful as a source of roughage to ruminants. (author).

  4. Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

    International Nuclear Information System (INIS)

    Awang, M.R.; Mutaat, H.H.; Mahmud, M.S.

    1993-01-01

    In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm Empty Fruit Bunch (EFB) fibre leaving 70% useful materials. Conditions under which fermentation occurred were investigated. It was found that, in the temperature range 25-28 o C, relative pH 6-8, moisture 60-70% and medium composition of CaCO 3 : were the optimum conditions. The results showed in fermented products that there were substantial reductions in cellulosic component such as crude fibre (CF, 18%); acid detergent fibre (ADF, 45%), neutral detergent fibre (NDF, 61%) and acd detergent lignin (ADL, 14%). However, crude protein (CP, 10%) increase resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in the fermentation process corresponds to CO 2 released during fermentation. A digestibility study has been carried out to determine the usefulness of this product to ruminants. Aflatoxin content was low in both the initial substrates and products. Based on nutritional value and low content of aflatoxins, the product is useful as a source of roughage to ruminants. (author)

  5. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  6. Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

    Science.gov (United States)

    Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

    2016-11-01

    Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

  7. Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

    Science.gov (United States)

    Awang, Mat Rasol; Mutaat, Hassan Hamdani; Mahmud, Mohd. Shukri; Wan Husain, Wan Badrin; Osman, Tajuddin; Bakar, Khomsaton Abu; Kassim, Asmahwati; Wan Mahmud, Zal U'yun; Manaf, Ishak; Kume, Tamikazu; Hashimoto, Shoji

    1993-10-01

    In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm empty Fruit Bunch (EFB) fibre leaving 70 % useful materials. Conditions under which fermentation carried out were investigated. It was found that, in the temperature range between 25- 28 °C, relative ph between 6-8, moisture between 60-70 % and medium composition of CaCO 3: rice bran 2 %: 5 % were the optimum conditions. The results showed in fermented products that, there were substantial reduction in cellulosic component such as Crude Fiber (CF, 18 %); Acid Detergent Fibre (ADF, 45 %), Neutral Detergent Fibre (NDF, 61 %) and Acid Detergent Lignin (ADL, 14 %). However, Crude Protein (CP, 10%) increased resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in fermentation process corresponds to the CO 2 released during fermentation. Hence, attributable to the decreased in content of CF, ADF, NDF, and ADL. The digestibility study has also been carried out to determine the useful level of this product to ruminant. Aflatoxin content was detected low in both the initial substrates and products. Based on nutritional value and low content of aflatoxin, the product is useful as a source of roughage to ruminant.

  8. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  9. Analysis of Major Nutritional Components of Pleurotus pulmonarius During the Cultivation in Different Indoor Environmental Conditions on Sawdust

    Directory of Open Access Journals (Sweden)

    Tariqul Islam

    2017-03-01

    Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.

  10. Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

    Directory of Open Access Journals (Sweden)

    Ayşenur Yılmaz

    2017-01-01

    Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

  11. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Nam Wai Lun

    2017-01-01

    Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  12. Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

    Science.gov (United States)

    Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

    2014-12-01

    Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

  13. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

    Science.gov (United States)

    Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

    2017-11-01

    Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  14. Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

    Science.gov (United States)

    Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

    2014-01-01

    Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

  15. Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

    Directory of Open Access Journals (Sweden)

    Ira Djajanegara

    2012-02-01

    Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

  16. Intrastrain Comparison of the Chemical Composition and Antioxidant Activity of an Edible Mushroom, Pleurotus giganteus, and Its Potent Neuritogenic Properties

    Directory of Open Access Journals (Sweden)

    Chia-Wei Phan

    2014-01-01

    Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.

  17. Kinetics, equilibrium and thermodynamic studies on biosorption of Ag(I) from aqueous solution by macrofungus Pleurotus platypus.

    Science.gov (United States)

    Das, Devlina; Das, Nilanjana; Mathew, Lazar

    2010-12-15

    Reports are available on silver binding capacity of some microorganisms. However, reports on the equilibrium studies on biosorption of silver by macrofungi are seldom known. The present study was carried out in a batch system using dead biomass of macrofungus Pleurotus platypus for the sorption of Ag(I). P. platypus exhibited the highest silver uptake of 46.7 mg g(-1) of biomass at pH 6.0 in the presence of 200 mg L(-1) Ag(I) at 20°C. Kinetic studies based on fractional power, zero order, first order, pseudo-first order, Elovich, second order and pseudo-second order rate expressions have been carried out. The results showed a very good compliance with the pseudo-first order model. The experimental data were analyzed using two parameter isotherms (Langmuir, Freundlich, Dubinin-Radushkevich, Temkin and Halsey), three parameter isotherms (Redlich-Peterson, Sips, Khan, Koble-Corrigan, Hill, Toth, Radke-Prausmitz, Jossens, Langmuir-Freundlich), four parameter isotherms (Weber-van Vliet, Fritz-Schlunder, Baudu) and five parameter isotherm (Fritz-Schlunder). Thermodynamic parameters of the biosorption (ΔG, ΔH and ΔS) were also determined. The present study confirmed that macrofungus P. platypus may be used as a cost effective efficient biosorbent for the removal of Ag(I) ions from aqueous solution. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Separation of active laccases from Pleurotus sapidus culture supernatant using aqueous two-phase systems in centrifugal partition chromatography.

    Science.gov (United States)

    Schwienheer, C; Prinz, A; Zeiner, T; Merz, J

    2015-10-01

    For the production of bio active compounds, e.g., active enzymes or antibodies, a conserved purification process with a minimum loss of active compounds is necessary. In centrifugal partition chromatography (CPC), the separation effect is based on the different distribution of the components to be separated between two immiscible liquid phases. Thereby, one liquid phase is kept stationary in chambers by a centrifugal field and the mobile phase is pumped through via connecting ducts. Aqueous two phase systems (ATPS) are known to provide benign conditions for biochemical products and seem to be promising when used in CPC for purification tasks. However, it is not known if active biochemical compounds can "survive" the conditions in a CPC where strong shear forces can occur due to the two-phasic flow under centrifugal forces. Therefore, this aspect has been faced within this study by the separation of active laccases from a fermentation broth of Pleurotus sapidus. After selecting a suitable ATPS and operating conditions, the activity yield was calculated and the preservation of the active enzymes could be observed. Therefore, CPC could be shown as potentially suitable for the purification of bio-active compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

    Directory of Open Access Journals (Sweden)

    Islam Md. Tariqul

    2017-01-01

    Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

  20. Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rosa María Espinosa-Valdemar

    2015-05-01

    Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

  1. Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

    Directory of Open Access Journals (Sweden)

    Wei-Jie Wu

    Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

  2. Insight into the impact of two structural calcium ions on the properties of Pleurotus eryngii versatile ligninolytic peroxidase.

    Science.gov (United States)

    Gao, Yu; Zheng, Lanyan; Li, Jian-Jun; Du, Yuguang

    2016-12-15

    Two structural Ca 2+ (proximal and distal) is known to be important for ligninolytic peroxidases. However, few studies toward impact of residues involved in two Ca 2+ on properties of ligninolytic peroxidases have been done, especially the proximal one. In this study, mutants of nine residues involved in liganding two Ca 2+ of Pleurotus eryngii versatile peroxidase (VP) were investigated. Most mutants almost completely lost activities, except the mutants of proximal Ca 2+ - S170A and V192T. In comparison with WT (wild type), optimal pH values of S170A, S170D, and V192T shifted from pH 3.0 to pH 3.5. The order of thermal and pH stabilities of WT, V192T, S170A, and S170D is similar to that of their specific activities: WT > V192T > S170A > S170D. The CD (circular dichroism) results of WT and several mutants indicated that mutations had some effects on secondary structures. For the first time, it was observed that the thermostability of ligninolytic peroxidases is related with proximal Ca 2+ too, and the mutant containing distal Ca 2+ only was obtained. Our results clearly demonstrated that enzymatic activities, pH and thermal stabilities, Ca 2+ content, and secondary structures of VP have close relationship with the residues involved in two structural Ca 2+ . Copyright © 2016 Elsevier Inc. All rights reserved.

  3. PRODUKTIVITAS JAMUR TIRAM PUTIH (Pleurotus ostreatus PADA MEDIA LIMBAH SEKAM PADI DAN DAUN PISANG KERING SEBAGAI MEDIA ALTERNATIF

    Directory of Open Access Journals (Sweden)

    Suparti Suparti

    2015-08-01

    Full Text Available Jamur tiram putih (Pleurotus ostreatus merupakan jenis jamur pangan yang banyak dikonsumsi mengandung protein 27%. Kandungan protein pada jamur tiram putih dapat dipengaruhi oleh komposisi media tanam seperti selulosa, hemiselulosa, lignin dan nutrisi tambahan. Sekam padi dan daun pisang kering merupakan salah satu limbah organik yang dapat digunakan sebagai media alternatif untuk meningkatkan produktivitas jamur tiram putih.Tujuan penelitian ini adalah untuk mengetahui produktivitas jamur tiram putih yang ditumbuhkan pada media  limbah sekam padi dan daun pisang kering sebagai media alternatif. Jenis penelitian eksperimen dengan metode rancangan acak lengkap (RAL dua faktor yaitu faktor 1 penambahan sekam padi dan faktor 2 daun pisang kering (0%, 5%, 10%, 15%, masing-masing  dengan empat perlakuan dan dua kali ulangan.  Hasil analisis data menunjukkan bahwa penambahan sekam padi dan daun pisang kering  15% (S3T3 memberikan pengaruh nyata terhadap lama penyebaran miselium, jumlah badan buah dan berat segar jamur tiram putih.Perlakuan yang paling baik untuk pertumbuhan jamur pada perlakuan S3T3, dengan rata-rata lama penyebaran miselium 25,5 hari, jumlah badan buah 64,5 buah dan berat segar yang dihasilkan 402,5. Hasil data tersebut lebih tinggi dibandingkan dengan perlakuan yang lain.

  4. A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

    Energy Technology Data Exchange (ETDEWEB)

    Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

    2008-07-15

    Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

  5. Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

    Science.gov (United States)

    Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

    2018-04-01

    Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

  6. Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

    Science.gov (United States)

    Thongsook, T; Kongbangkerd, T

    2011-08-01

    Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

  7. A dioxygenase of Pleurotus sapidus transforms (+)-valencene regio-specifically to (+)-nootkatone via a stereo-specific allylic hydroperoxidation.

    Science.gov (United States)

    Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G

    2010-01-01

    A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.

  8. β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.

    Science.gov (United States)

    Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang

    2017-01-01

    Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.

  9. Mutation induction of pleurotus ferulae by low-energy N+ ion implantation and characters of the selected mutant

    International Nuclear Information System (INIS)

    Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian

    2008-01-01

    In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)

  10. Pengaruh Campuran Ampas Tebu Dan Alang-Alang (Imperata Cylindrica) Sebagai Media Pertumbuhan Terhadap Kandungan Nutrisi Jamur Tiram Putih (Pleurotus Ostreatus)

    OpenAIRE

    Naila, Ishmatun; Purnomo, Adi Setyo

    2016-01-01

    Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...

  11. Incidencia del medio y de las condiciones de cultivo en el potencial como nutriceútico de tres especies del genero Pleurotus

    OpenAIRE

    Chegwin Angarita, Carolina

    2014-01-01

    El cultivo biotecnológico empleando fermentaciones en estado líquido de hongos del género Pleurotus, usando salvado de trigo y harinas de cereales y leguminosas como fuentes de carbono no convencionales, en busca de evaluar el efecto del cambio de algunas condiciones del proceso sobre la composición tanto de los micelios como de los caldos agotados y por ende del potencial como nutriceútico del mismo, para posteriormente evaluar la aplicabilidad de dicho producto en la obtención de fructifica...

  12. Control of Branchionus sp. and Amoeba sp. in cultures of Arthrospira sp. Control de Branchionus sp. y Amoeba sp. en cultivos de Arthrospira sp.

    Directory of Open Access Journals (Sweden)

    Carlos Méndez

    2012-09-01

    Full Text Available Cultivation of cyanobacterium Arthrospira sp. has been developed in many countries for the production of proteins, pigments and other compounds. Outdoor mass cultures are often affected by biological contamination, drastically reducing productivity as far as bringing death. This study evaluates the control of Branchionus sp. and Amoeba sp. with two chemical compounds: urea (U and ammonium bicarbonate (AB, in laboratory conditions and outdoor mass culture of Arthrospira sp. The lethal concentration 100 (LC100 at 24 h for Branchionus sp. and Amoeba sp. determined was of 60-80 mg L-1 (U and 100-150 mg L-1 (AB. The average effective inhibition concentration for 50% of the population (IC50 in Arthrospira sp., after 72 h, was 80 mg L-1 (U and 150 mg L-1 (AB. The application of doses of 60 mg L-1 (U or 100 mg L-1 (AB in the outdoor mass culture of this contaminated microalga, completely inhibited grazing and did not affect the growth of Arthrospira sp. but rather promoted rapid recovery of algal density at levels prior to infestation. These compounds provided an economical and effective control of predators in cultures of Arthrospira sp.El cultivo de la cianobacteria Arthrospira sp. ha sido desarrollado en muchos países para la obtención de proteínas, pigmentos y otros compuestos. Cultivo que a nivel industrial se ve afectado frecuentemente por contaminación biológica, reduciendo drásticamente la productividad hasta causar la muerte. Este estudio evalúa el control de Branchionus sp. y de Amoeba sp. con dos compuestos químicos, la urea (U y bicarbonato de amonio (AB en cultivos de Arthrospira sp. La concentración letal 100 (LC100 determinada a las 24 h para Branchionus sp. y Amoeba sp. fue de 60-80 mg L-1 (U y 100-150 mg L-1 (AB. La concentración media de inhibición efectiva, después de 72 h, para el 50% de la población (IC50 en Arthrospira fue de 80 mg L-1 (U y 150 mg L-1 (AB. La aplicación de dosis de 60 mg L-1 (U ó 100 mg L-1 (AB en

  13. ALTERNATIVE NOURISHMENT BESIDE VEGETABLE AND FRUIT IN OUR COUNTRY SOURCE: WILD MUSHROOM (Pleurotus eryngii var. ferulae

    Directory of Open Access Journals (Sweden)

    Mehmet Akyüz

    2007-04-01

    Full Text Available P. eryngii var. ferulae which is known very well in Eastern Anatolia Region and picked up from the nature in spring months is sold by the side of the roads and in neighbour markets with the name of ‘’ çaşır, çakşır, çaşur, heliz, kırkor, göbek, göbelek and mendik’’ mushroom. As a member of Apiaceae family; Ferulae sp. that preads at the slope of the mountains, grows up naturally on the roots of its species that remained from the previous year especially at the altitude of 1000-2500 meters on high mountains. It is known that local people has benefited from the natural products special to periodic times. It is seen that it is not benefited from alternative natural nourishment resources like cultuıre vegetables and fruit with their important features and effective nutritive value. In our opinion, this article will be useful for mentioning the importance of the mushroom beside the vegetables and fruits which are vital for our life. It will be useful to expose the medical features, nourishment content and effective nutritive valu and effective nutritious features of mushroom. Furthermore, It is determined that it is necessary to describe P. eryngii and its similarities with the identification of scientific facts as species, subspecies, variety, taxa or synonym in our country.

  14. SP mountain data analysis

    Science.gov (United States)

    Rawson, R. F.; Hamilton, R. E.; Liskow, C. L.; Dias, A. R.; Jackson, P. L.

    1981-01-01

    An analysis of synthetic aperture radar data of SP Mountain was undertaken to demonstrate the use of digital image processing techniques to aid in geologic interpretation of SAR data. These data were collected with the ERIM X- and L-band airborne SAR using like- and cross-polarizations. The resulting signal films were used to produce computer compatible tapes, from which four-channel imagery was generated. Slant range-to-ground range and range-azimuth-scale corrections were made in order to facilitate image registration; intensity corrections were also made. Manual interpretation of the imagery showed that L-band represented the geology of the area better than X-band. Several differences between the various images were also noted. Further digital analysis of the corrected data was done for enhancement purposes. This analysis included application of an MSS differencing routine and development of a routine for removal of relief displacement. It was found that accurate registration of the SAR channels is critical to the effectiveness of the differencing routine. Use of the relief displacement algorithm on the SP Mountain data demonstrated the feasibility of the technique.

  15. Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

    Science.gov (United States)

    Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

    2018-03-01

    Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

  16. An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

    Science.gov (United States)

    Panjikkaran, Seeja Thomachan; Mathew, Deepu

    2013-03-15

    The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

  17. Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

    Science.gov (United States)

    Suseem, S R; Saral, Mary

    2015-07-01

    To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

  18. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    Science.gov (United States)

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii.

    Science.gov (United States)

    Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

    2014-01-01

    Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.

  20. Use of Pleurotus sajor-caju in upgrading green jute plants and jute sticks as ruminant feed

    Directory of Open Access Journals (Sweden)

    Zinat Mahal

    2013-01-01

    Full Text Available In this study, superfluous jute plants and jute stick were converted into upgraded animal feed by solid state fermentation (SSF using a cellulolytic fungus, Pleurotus sajor-caju. Prior to fermentation, substrates were subjected to several pretreatments such as soaking with water overnight and alkali or lime pretreatment. SSF was carried out with 20 g of substrate in 100 ml conical flask and was incubated at 30C for 8 weeks. In all treatments, the highest amount of reducing sugar, soluble protein as well as the cellulolytic activities of three enzymes viz. cellobiase, carboxymethyl cellulase and avicelase were obtained at 6th week of fermentation. Compared to raw, unsoaked substrates, soaking treatment alone could produce 10% more soluble protein in both substrates whereas reducing sugar increment was 5% and 6% in jute sticks and jute plants, respectively. From all treatments, combination of soaking and lime treatment in green jute plants yielded higher value than jute sticks in terms of reducing sugar, soluble protein and enzymatic activity. The radiation doses at 20, 30 and 40 kGy appeared to have no effect on sugar and protein accretion. During eight weeks of fermentation, relatively higher cellobiase activity was found compared to that of carboxymethyl cellulase and avicelase. The present investigation indicates that fungal conversion with pretreatment can turn these lignocellulosic agro-wastes to a nutritionally enriched animal feed by increasing the crude protein and reducing sugar content. However, further research is necessary to develop strategies for industrial scale production to overcome the crisis of nutritionally improved animal feed.

  1. Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

    Directory of Open Access Journals (Sweden)

    Nualsri, C.

    2005-01-01

    Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

  2. The production of Pleurotus sajor-caju in peach palm leaves (Bactris gasipaes and evaluation of its use to enrich wheat flour

    Directory of Open Access Journals (Sweden)

    Paula Fernanda Bomfim Oliveira Cogorni

    2014-06-01

    Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.

  3. Effect of gamma irradiation on the structure of corn stalks and their subsequent bioconversion into protein-rich mycelial biomass of pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Awafo, V [Quebec Univ., Montreal, PQ (Canada)

    1994-12-31

    Lignocellulosic biomass like corn stalk is an abundant and renewable resource from which food, feed and chemicals may be derived. Enzymatic hydrolysis of native lignocellulosic material is prohibitively slow due to their compositional heterogeneity and structural complexity. In this work, ground corn stalks (20 mesh) were subjected to gamma irradiation (10-170 Mrads) as pretreatments to make them more susceptible for bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757. The irradiation was carried out in air in a {sup 60}Co Underwater Calibrator (UC-15, Nordion International) at a dose rate of 2.5 Mrads/h as measured by Fricke dosimetry. No apparent structural differences were observed under the light microscope. However, the protein synthesis and the proportion of mycelial biomass increased with the increase in both the dose of irradiation and time of fermentation during the bioconversion of 1% corn stalk into mycelial biomass of Pleurotus sajor-caju. Gamma irradiation at the dose of 50 Mrads or lower did not produce any appreciable increase in the amount of protein synthesised. At 170 Mrads, the final product contained 28% protein representing a 2-fold increase from non-irradiated corn stalk and an efficiency of 36% conversion of total utilizable polysaccharides of corn stalks into mycelial biomass. The lag phase during mycelial biomass production was much more prolonged at very high doses indicating possible production of some toxic substances during irradiation. (author). 2 tabs., 6 figs.

  4. The comparative study on screening of pleurotus polysaccharide high-yield strains by use of ion beam implantation and composite mutagenesis

    International Nuclear Information System (INIS)

    Wang Lianfeng; Chen Henglei; Zhang Jun; Zeng Xianxian

    2009-01-01

    In order to screen pleurotus mycelium polysaccharide high-yield strains, the comparative study was made by use of ion beam implantation and composite mutagenesis before screening. The treating mycelium pellet of pleurotus ferulae tentatively with ion beam implantation was performed at the first. Two polysaccharide high-yield strains, PFPH-1and PFPH-2, were selected using fermentation quantitative screening after auxotrophy qualitative primary screening. It has been found that the polysaccharide yield of the mutants is 551.80mg/L and 659.46mg/L respectively,which increases by 46.55% and 75.14% respectively compared to that of initial strain. Then PFPH-1and PFPH-2, as the original strain, is exposed to ultraviolet light and is suffered by additive of LiCl respectively. The results indicate that the polysaccharide yield of strains 1,9 and 10 decreases by 27%, 38% and 37% respectively compared to that of PFPH-1 meanwhile the polysaccharide yield of strain 17 decreases by 28% compared to that of PFPH-2 after high-flux qualitative primary screening. In this study, composite mutagenesis with exposure of ultra-violet and additive of lithium chloride shows some negative effects. (authors)

  5. SP-100 Test Site

    International Nuclear Information System (INIS)

    Cox, C.M.; Mahaffey, M.K.; Miller, W.C.

    1988-01-01

    Preparatory activities are well under way at Hanford to convert the 309 Containment Building and its associated service wing to a 2.5 MWt nuclear test facility for the SP-100 Ground Engineering System (GES) test. Preliminary design is complete, encompassing facility modifications, a secondary heat transport system, a large vacuum system to enclose the high temperature reactor, a test assembly cell and handling system, control and data processing systems, and safety and auxiliary systems. The design makes extensive use of existing equipment to minimize technical risk and cost. Refurbishment of this equipment is 75% complete. The facility has been cleared of obstructing equipment from its earlier reactor test. Current activities are focusing on definitive design and preparation of the Preliminary Safety Analysis Report (PSAR) aimed at procurement and construction approvals and schedules to achieve reactor criticality by January 1992. 6 refs

  6. Análise química de corpos de frutificação de Pleurotus sajor-caju cultivado em diferentes concentrações de nitrogênio Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    Directory of Open Access Journals (Sweden)

    Evânia Geralda Silva

    2007-03-01

    Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.

  7. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  8. Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde: Nutritional value and in vitro neurite outgrowth activity in rat pheochromocytoma cells.

    Science.gov (United States)

    Phan, Chia-Wei; Wong, Wei-Lun; David, Pamela; Naidu, Murali; Sabaratnam, Vikineswary

    2012-07-19

    Drugs dedicated to alleviate neurodegenerative diseases like Parkinson's and Alzheimer's have always been associated with debilitating side effects. Medicinal mushrooms which harness neuropharmacological compounds offer a potential possibility for protection against such diseases. Pleurotus giganteus (formerly known as Panus giganteus) has been consumed by the indigenous people in Peninsular Malaysia for many years. Domestication of this wild mushroom is gaining popularity but to our knowledge, medicinal properties reported for this culinary mushroom are minimal. The fruiting bodies P. giganteus were analysed for its nutritional values. Cytotoxicity of the mushroom's aqueous and ethanolic extracts towards PC12, a rat pheochromocytoma cell line was assessed by using 3-[4,5-dimethythiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Neurite outgrowth stimulation assay was carried out with nerve growth factor (NGF) as control. To elucidate signaling mechanisms involved by mushroom extract-induced neurite outgrowth, treatment of specific inhibitor for MEK/ERK and PI3K signalling pathway was carried out. The fruiting bodies of P. giganteus were found to have high carbohydrate, dietary fibre, potassium, phenolic compounds and triterpenoids. Both aqueous and ethanolic extracts induced neurite outgrowth of PC12 cells in a dose- and time-dependant manner with no detectable cytotoxic effect. At day 3, 25 μg/ml of aqueous extract and 15 μg/ml of ethanolic extract showed the highest percentage of neurite-bearing cells, i.e. 31.7 ± 1.1% and 33.3 ± 0.9%; respectively. Inhibition treatment results suggested that MEK/ERK and PI3K/Akt are responsible for neurite outgrowth of PC12 cells stimulated by P. giganteus extract. The high potassium content (1345.7 mg/100 g) may be responsible for promoting neurite extension, too. P. giganteus contains bioactive compounds that mimic NGF and are responsible for neurite stimulation. Hence, this mushroom may be

  9. Cultivation of Pleurotus sajor-caju on banana stalk and Bahia grass based substrates Cultivo de Pleurotus sajor-caju em substratos a base de grama batatais e engaço de bananeira

    Directory of Open Access Journals (Sweden)

    Félix G de Siqueira

    2011-06-01

    Full Text Available Banana stalks and Bahia grass were utilized as basic starting materials for the production of the mushroom Pleurotus sajor-caju. Banana stalks were combined with other waste or supplement products (wheat bran, coast-cross hay, bean straw and cotton textile mill to obtain different nitrogen concentrations. Since Bahia grass is relatively rich in protein, it was combined with other substrates (banana stalk, coast-cross hay and bean straw to maintain a substrate nitrogen concentration of about 1.5%. Banana stalks and Bahia grass were both more efficient in the production of the mushroom P. sajor-caju when utilized without the addition of other substrates, with biological efficiencies of 74.4% and 74.12%, respectively. When combined with other substrates or grasses, there was a drop in biological efficiency, independent of the concentration of nitrogen. Furthermore, the addition of protein-rich waste to banana stalks resulted in a decrease or absence of fructification, which indicates that high concentrations of nitrogen in the cultivation substrate may hinder the cultivation of this mushroom. On the other hand, results reveal that the ideal concentration of nitrogen may depend on other physicochemical factors and these factors may determine the success in cultivating P. sajor-caju. Therefore, we conclude that P. sajor-caju may be cultivated on banana stalk and Bahia grass as pure substrates, not being necessary their supplementation or combine them with another substrates.O engaço de bananeira e a grama batatais foram utilizados como matérias-primas básicas para a produção do substrato de cultivo do cogumelo Pleurotus sajor-caju. O engaço de bananeira foi combinado com outros resíduos (farelo de trigo, capim "Coast-cross", palha de feijão e resíduo de lixadeira de algodão, com o objetivo de se obter substratos com diferentes concentrações de nitrogênio. Como a grama batatais é relativamente rica em proteína, a mesma foi combinada com

  10. Substratum formulation for laccase and mycelial biomass production of Pleurotus ostreatusFormulação de substratos na produção de biomassa micelial e de lacase de Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Juliana Silveira do Valle

    2012-10-01

    Full Text Available Pleurotus ostreatus is a producer of biomass and laccase, an enzyme used in fermentation processes for the hydrolysis of lignocellulosic substrate, with potential use in biofuel production and animal feed. Thus, there is a need to seek more appropriate regional substrate for the production of mycelial biomass and laccase. Hence, the aim of this study was to evaluate the effect of physical and chemical characteristics of agro-industrial byproducts in a substratum formulation for the mycelial growth and laccase production by P. ostreatus. The experiment was conducted with the milled raw materials: soy fiber, wheat bran, rice bran, corn grain and corn cob that were separated according to size and analyzed for carbon/nitrogen (C/N ratio. Mycelial growth was evaluated on substratum in cylindrical tubes of borosilicate. Then laccase production was assessed using a 26-2 fractional factorial design with the variables: raw material granulometry and addition of minerals (copper, zinc, iron, cadmium and magnesium in the substrate. The production of laccase was determined by oxidation of ABTS (2,2’-bisazin-(3-ethylbenzothiazoline-6-sulfonic acid. The results indicate that the most important factor for mycelial growth is the holding capacity of oxygen in the substratum. For mycelial growth of P. ostreatus the corn cob and wheat bran are the best components for the substrate. The other raw materials reduced the mycelial growth. However the most important factor for the induction of laccase production is the reduction of particle size, increasing the contact area between the mycelium and the substratum. Pleurotus ostreatus é um produtor de biomassa e lacase, enzima utilizada em processos fermentativos para a hidrólise de substratos lignocelulósicos, com potencial de utilização na produção de biocombustíveis e na alimentação animal. Desta forma, há a necessidade de buscar substratos regionais mais apropriados para a produção de biomassa micelial

  11. Bradysia sp. em morangueiro Bradysia sp. in strawberry

    Directory of Open Access Journals (Sweden)

    Bernadete Radin

    2009-04-01

    Full Text Available No trabalho, relatam-se os primeiros registros de Bradysia sp. (Insecta: Diptera: Sciaridae em morangueiro (Fragaria x ananassa Duch., cultivado no Município de Eldorado do Sul, RS. O cultivo foi realizado em sacolas com três metros de comprimento, preenchidas com substrato composto de casca de arroz e turfa, dispostas horizontalmente sobre bancadas de madeira, em ambiente protegido. A presença de Bradysia sp. foi observada na segunda quinzena de agosto de 2005. Neste trabalho, estão descritos os sintomas apresentados no morangueiro pela praga, prováveis conseqüências sobre o aparecimento de doenças e uma breve descrição morfológica da Bradysia sp., adulto e fase larval.This paper describes the first record of Bradysia sp. (Insecta; Diptera; Sciaridae in strawberry (Fragaria x ananassa, cultivated in the city of Eldorado do Sul, RS, Brazil. Strawberry was planted in plastic bags filled with a mixture of burnt rice hulls and peat and cultivated in a greenhouse. The presence of Bradysia sp was noticed in the second fortnight of August, 2005. The symptoms in strawberry and the probable consequences in terms of disease arising were described in the present study, as well as the morphological characterization of Bradysia sp. and its illustrations.

  12. Yersinia pekkanenii sp. nov.

    Science.gov (United States)

    Murros-Kontiainen, Anna; Johansson, Per; Niskanen, Taina; Fredriksson-Ahomaa, Maria; Korkeala, Hannu; Björkroth, Johanna

    2011-10-01

    The taxonomic position of three strains from water, soil and lettuce samples was studied by using a polyphasic taxonomic approach. The strains were reported to lack the virulence-encoding genes inv and virF in a previous study. Controversially, API 20 E and some other phenotypic tests suggested that the strains belong to Yersinia pseudotuberculosis, which prompted this polyphasic taxonomic study. In both the phylogenetic analyses of four housekeeping genes (glnA, gyrB, recA and HSP60) and numerical analyses of HindIII and EcoRI ribopatterns, the strains formed a separate group within the genus Yersinia. Analysis of the 16S rRNA gene sequences showed that the strains were related to Yersinia aldovae and Yersinia mollaretii, but DNA-DNA hybridization analysis differentiated them from these species. Based on the results of the phylogenetic and DNA-DNA hybridization analyses, a novel species, Yersinia pekkanenii sp. nov., is proposed. The type strain is ÅYV7.1KOH2(T) ( = DSM 22769(T)  = LMG 25369(T)).

  13. Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

    Directory of Open Access Journals (Sweden)

    Carol Daniela Coello-Loor

    2017-12-01

    Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

  14. Antimicrobial peptides from Capsicum sp.

    African Journals Online (AJOL)

    ajl yemi

    2011-12-30

    Dec 30, 2011 ... Key words: Antimicrobial peptides, Capsicum sp, Capsicum chinense, chili pepper, agronomical options, ..... of this human activity is resumed by the simple phrase: produce .... It will be interesting to scale the AMPs extraction.

  15. The effect of temperature on the nutritional quality of feed from biological treated oil palm empty fruit bunch by Pleurotus sajor caju

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Hassan Hamdani Mutaat; Yusri Atan; Tamikazu Kume; Shoji Hashimoto; Shinpei Matsuhashi

    1998-01-01

    In solid state fermentation, Pleurotus sajor caju degrades oil palm Empty Fruit Bunch (EFB) fibre to give a useful feed material (1). Its chemical composition, dry matter digestibility both in vitro and in vivo have been characterised and described previously (2). However, the performance of this microorganism in degradation activity has not been described. Since CO sub 2 is the most important metabolic product of this fermentation, the microbial degradation activity is directly related to the rate and total CO sub 2 evolved in the fermentation. In this work a range of temperature were selected for fermentation, aiming to suit its practical application for countries of tropical climate in general, particularly Malaysia. The nutritional quality of fermented products obtained from the fermentation at different temperature were analysed and discussed

  16. Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

    International Nuclear Information System (INIS)

    Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

    2013-01-01

    The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

  17. Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

    2013-01-01

    Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

  18. Elucidation of the regio- and chemoselectivity of enzymatic allylic oxidations with Pleurotus sapidus – conversion of selected spirocyclic terpenoids and computational analysis

    Directory of Open Access Journals (Sweden)

    Verena Weidmann

    2013-10-01

    Full Text Available Allylic oxidations of olefins to enones allow the efficient synthesis of value-added products from simple olefinic precursors like terpenes or terpenoids. Biocatalytic variants have a large potential for industrial applications, particularly in the pharmaceutical and food industry. Herein we report efficient biocatalytic allylic oxidations of spirocyclic terpenoids by a lyophilisate of the edible fungus Pleurotus sapidus. This ‘’mushroom catalysis’’ is operationally simple and allows the conversion of various unsaturated spirocyclic terpenoids. A number of new spirocyclic enones have thus been obtained with good regio- and chemoselectivity and chiral separation protocols for enantiomeric mixtures have been developed. The oxidations follow a radical mechanism and the regioselectivity of the reaction is mainly determined by bond-dissociation energies of the available allylic CH-bonds and steric accessibility of the oxidation site.

  19. Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

    Directory of Open Access Journals (Sweden)

    I MADE SUDARMA

    2015-09-01

    Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

  20. Influence of gaseous phase, light and substrate pretreatment on fruit-body formation, lignin degradation and in vitro digestibility of wheat straw fermented with Pleurotus spp

    Energy Technology Data Exchange (ETDEWEB)

    Kamra, D.N.; Zadrazil, F.

    1986-01-01

    Wheat straw was fermented in the solid state with Pleurotus sajor-caju and P. eryngii at 25 degrees C under different concentrations of oxygen and carbon dioxide. Lower than 20% oxygen in the gaseous phase adversely affected the loss of organic matter, the lignin degradation and the change in straw digestibility with both species of Pleurotus. Higher concentrations (10%-30%) of carbon dioxide, with 20% oxygen in the atmospshere, slightly decreased the loss of lignin and organic matter when compared with the losses under oxygen or air. In spite of better lignin degradation by P. sajor-caju, the process efficiency with P. eryngii was higher, because of lower loss of organic matter during the fermentation. Fruit-bodies were not formed by P. eryngii during the period of experiment in any of the treatments. In P. sajor-caju, fruit-bodies were only formed either in flasks closed with cotton plugs or supplied with a continuous flow of sterile air. Carbon dioxide inhibited the process of primordia initiation and fruit-body development. A short exposure (20 minutes per day) to light was essential for primordia and fruit-body formation. The substrate changes and process efficiency with respect to increase in digestibility were much higher in darkness than in light. Light leads to intensive fruit-body production and a different pattern of substrate degradation. The indigenous microflora of wheat straw inhibited fruit-body formation and caused a higher organic matter loss, accompanied by a decrease in digestibility of the fermented wheat straw. 33 references.

  1. Extracellular polysaccharide production by a strain of Pleurotus djamor isolated in the south of Brazil and antitumor activity on Sarcoma 180

    Directory of Open Access Journals (Sweden)

    Gisele Martini Borges

    2013-12-01

    Full Text Available Polysaccharides with medicinal properties can be obtained from fruiting bodies, mycelium and culture broth of several fungus species. This work was carried out in batch culture using a stirred tank reactor with two different initial glucose concentrations (40-50 g/L and pH values (3.0-4.0 to enhance extracellular polysaccharides production by Pleurotus djamor UNIVILLE 001 and evaluate antitumor effect of intraperitonial administration of Pleurotus djamor extract on sarcoma 180 animal model. According to factorial design, the low pH value (pH 3.0 led to a gain of 1.6 g/L on the extracellular polysaccharide concentration, while glucose concentration in the tested range had no significant effect on the concentration of polysaccharide. With 40 g/L initial glucose concentration and pH 3.0, it was observed that yield factor of extracellular polysaccharide on substrate (Y P/S = 0.072 and maximum extracellular polysaccharide productivity (Q Pmax = 11.26 mg/L.h were about 188% and 321% respectively higher than those obtained in the experiment performed at pH 4.0. Under these conditions, the highest values of the yield factor of biomass on substrate (Y X/S = 0.24 and maximal biomass productivity (Q Xmax = 32.2 mg/L.h were also reached. In tumor response study, mean tumor volume on the 21th day was 35.3 cm³ in untreated group and 1.6 cm³ in treated group (p = 0.05 with a tumor inhibition rate of 94%. These impressive results suggests an inhibitory effect of P.djamor extract on cancer cells.

  2. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation;Aumento da vida util de cogumelos Pleurotus sajor-caju in natura com aplicacao de radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Moda, Evelise Moncaio

    2008-07-01

    The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 +- 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 +- 1 deg C and 90% UR for 8 days. CO{sub 2} was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b{sup *} and enzymatic activity values in all treatments at the end of the storage

  3. Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

    Directory of Open Access Journals (Sweden)

    Simone Parola

    2017-10-01

    Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

  4. Seroprevalencia de Leptospira sp., Rickettsia sp. Ehrlichia sp. en trabajadores rurales del departamento de Sucre, Colombia Seroprevalence of Leptospira sp., Rickettsia sp. and Ehrlichia sp. in rural workers of Sucre, Colombia

    Directory of Open Access Journals (Sweden)

    Rodrigo Ríos

    2008-06-01

    Full Text Available Objective. Determinar la seroprevalencia de Leptospira sp., Rickettsia sp. y Ehrlichia sp. en trabajadores de áreas rurales del departamento de Sucre. Material y métodos. Se realizó un estudio escriptivo, prospectivo, de corte transversal, que pretendió determinar la seroprevalencia e Leptospira sp., Rickettsia sp. y Ehrlichia sp. en 90 trabajadores de áreas rurales del departamento de Sucre. Se estableció la presencia de anticuerpos séricos anti-IgM específicos anti-Leptospira por la técnica de ELISA indirecta. Para la determinación de Rickettsia sp. y Ehrlichia sp. se uso la técnica de inmunofluorescencia indirecta. Resultados. La población evaluada estaba compuesta por 27 (30% ordeñadores, 21 (23% jornaleros, 18 (20% profesionales del campo y 24 (27% que realizaban otras actividades. Ventidós (24% muestras resultaron positivas en alguna de las pruebas. De éstas, 12 (13,3% fueron positivas para Leptospira sp., 7 (7,8% para Rickettsia sp. y 3 (3,3% ara Ehrlichia sp. Conclusión. Este fue el primer estudio que se llevó a cabo en el departamento de Sucre y permitió demostrar que existe una prevalencia importante de Leptospira p.,Rickettsia sp. y Ehrlichia sp.. Los factores de riesgo ocupacional fueron factores determinantes en la seropositividad.Objective. To determine the seroprevalence of Leptospira sp., Rickettsia sp. and Ehrlichia sp. in agricultural workers of Sucre. Methods. A descriptive prospective cross-sectional study was conducted in ninety rural workers of Sucre. Presence of serum antibodies anti-IgM specific anti-Leptospira by indirect ELISA was established. For the determination of Rickettsia and Ehrlichia indirect inmunoflorescence was used. Results.The population was composed by 27 (30% milkers, 21 (23% day workers, 18 farm professionals (20% and 24 (26% workers in others activities. A total of 22 (24% samples were positive to some test. Twelve (13.3% were positive to Leptospira sp., seven (7.8% to Rickettsia sp

  5. SP-100 reactor cell activation

    International Nuclear Information System (INIS)

    Wilcox, A.D.

    1991-09-01

    There are plans to test the SP-100 space reactor for 2 yr in the test facility shown in Figure 1. The vacuum vessel will be in the reactor experiment (RX) cell surrounded by an inert gas atmosphere. It is proposed that the reactor test cell could contain removable-water- shielding tanks to reduce the residual activation dose rates in the test cell after the tests are completed. This reduction will allow the facility to be considered for other uses after the SP-100 tests are completed. The radiation dose rates in the test cell were calculated for several configurations of water-shielding tanks to help evaluate this concept

  6. Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2009-12-01

    Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

  7. Edible mushroom Pleurotus sajor-caju production on washed and supplemented sugarcane bagasse Produção do cogumelo comestível Pleurotus sajor-caju em bagaço de cana-de-açúcar lavado e suplementado

    Directory of Open Access Journals (Sweden)

    Evelise Moncaio Moda

    2005-04-01

    Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com

  8. Penicillium araracuarense sp. nov., Penicillium elleniae sp. nov., Penicillium penarojense sp. nov., Penicillium vanderhammenii sp. nov. and Penicillium wotroi sp. nov., isolated from leaf litter.

    Science.gov (United States)

    Houbraken, Jos; López-Quintero, Carlos A; Frisvad, Jens C; Boekhout, Teun; Theelen, Bart; Franco-Molano, Ana Esperanza; Samson, Robert A

    2011-06-01

    Several species of the genus Penicillium were isolated during a survey of the mycobiota of leaf litter and soil in Colombian Amazon forest. Five species, Penicillium penarojense sp. nov. (type strain CBS 113178(T) = IBT 23262(T)), Penicillium wotroi sp. nov. (type strain CBS 118171(T) = IBT 23253(T)), Penicillium araracuarense sp. nov. (type strain CBS 113149(T) = IBT 23247(T)), Penicillium elleniae sp. nov. (type strain CBS 118135(T) = IBT 23229(T)) and Penicillium vanderhammenii sp. nov. (type strain CBS 126216(T) = IBT 23203(T)) are described here as novel species. Their taxonomic novelty was determined using a polyphasic approach, combining phenotypic, molecular (ITS and partial β-tubulin sequences) and extrolite data. Phylogenetic analyses showed that each novel species formed a unique clade for both loci analysed and that they were most closely related to Penicillium simplicissimum, Penicillium janthinellum, Penicillium daleae and Penicillium brasilianum. An overview of the phylogeny of this taxonomically difficult group is presented, and 33 species are accepted. Each of the five novel species had a unique extrolite profile of known and uncharacterized metabolites and various compounds, such as penicillic acid, andrastin A, pulvilloric acid, paxillin, paspaline and janthitrem, were commonly produced by these phylogenetically related species. The novel species had a high growth rate on agar media, but could be distinguished from each other by several macro- and microscopical characteristics.

  9. Neues vom Heringsparasiten Ichthyophonus sp.

    OpenAIRE

    Lang, Thomas

    1994-01-01

    Seit dem Massensterben von Heringen entlang der schwedischen Südküste im Sommer 1991, aufgrund einer Infektion mit dem parasitischen Pilz Ichthyophonus sp., wird der Gesundheitszustand der Heringsbestände in den europäischen Seegebieten intensiv überwacht. Diese Untersuchungen, an denen sich auch die Bundesforschungsanstalt für Fischerei beteiligt, werden koordiniert von der "Arbeitsgruppe über Pathologie und Krankheiten mariner Organismen" des Internationalen Rates für Meeresforschung (IC...

  10. Effect of irradiation, as a pretreatment, on bioconversion of corn stover into protein-rich mycelial biomass of Pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Awafo, V.A.; Chahal, D.S.; Charbonneau, R. [Universite du Quebec (Canada). Applied Microbiology Research Center

    1995-10-01

    Application of irradiation for food preservation, for pretreatment of lignocellulosic materials for their hydrolysis and to increase the digestibility of lignocellulosic materials for rumen animals have been reported in the literature. In the present study, irradiation (100 KGy to 1.7 MGy) of corn stover as a pretreatment to make it susceptible for its bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757 has been compared with that of mild alkali treatment (0.01 to 0.15 g NaOH/g corn stover), the most commonly used pretreatment. Protein synthesis increased with the increase in doses of irradiation as well as with the increase in concentration of NaOH. Combination pretreatment with NaOH and {gamma}-irradiation reduced the quantity of NaOH and doses of irradiation required to get optimum yields of protein indicating a strong synergistic effect. The highest protein content of the final product, mycelial biomass, was about 45% on dry weight basis. More than 90% utilization of corn stover polysaccharides for the synthesis of protein-rich mycelial biomass of P. sajor-caju was recorded. (author).

  11. Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

    Science.gov (United States)

    Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

    2009-04-01

    The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

  12. Effect of irradiation, as a pretreatment, on bioconversion of corn stover into protein-rich mycelial biomass of Pleurotus sajor-caju

    International Nuclear Information System (INIS)

    Awafo, V.A.; Chahal, D.S.; Charbonneau, R.

    1995-01-01

    Application of irradiation for food preservation, for pretreatment of lignocellulosic materials for their hydrolysis and to increase the digestibility of lignocellulosic materials for rumen animals have been reported in the literature. In the present study, irradiation (100 KGy to 1.7 MGy) of corn stover as a pretreatment to make it susceptible for its bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757 has been compared with that of mild alkali treatment (0.01 to 0.15 g NaOH/g corn stover), the most commonly used pretreatment. Protein synthesis increased with the increase in doses of irradiation as well as with the increase in concentration of NaOH. Combination pretreatment with NaOH and γ-irradiation reduced the quantity of NaOH and doses of irradiation required to get optimum yields of protein indicating a strong synergistic effect. The highest protein content of the final product, mycelial biomass, was about 45% on dry weight basis. More than 90% utilization of corn stover polysaccharides for the synthesis of protein-rich mycelial biomass of P. sajor-caju was recorded. (author)

  13. Effect of irradiation, as a pretreatment, on bioconversion of corn stover into protein-rich mycelial biomass of Pleurotus sajor-caju

    International Nuclear Information System (INIS)

    Awafo, V.A.; Chahal, D.S.; Charbonneau, R.

    1995-01-01

    Application of irradiation for food preservation, for pretreatment of lignocellulosic materials for their hydrolysis and to increase the digestibility of lignocellulosic materials for rumen animals have been reported in the literature. In the present study, irradiation (100 KGy to 1.7 MGy) of corn stover as a pretreatment to make it susceptible for its bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757 has been compared with that of mied alkali treatment (0.01 to 0.15 g NaOH/g corn stover), the most commonly used pretreatment. Protein synthesis increased with the increase in doses of irradiation as well as with the increase in concentration of NaOH. Combination pretreatment with NaOH and γ-irradiation reduced the quantity of NaOH and doses of irradiation required to get optimum yields of protein indicating a strong synergistic effect. This highest protein content of the final product, mycelial biomass, was about 45% on dry weight basis. More than 90% utilization of corn stover polysaccharides for the synthesis of protein-rich mycelial biomass of P.sajor-caju was recorded. (author)

  14. Pengaruh jamur tiram putih (pleurotus ostreatus terhadap kadar glukosa darah, profil lipid dan kadar MDA pada tikus (rattus norvegicus diabetes melitus

    Directory of Open Access Journals (Sweden)

    Purbowati Purbowati

    2016-06-01

    Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.

  15. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  16. Effects of Cooking and In Vitro Digestion on Antioxidant Properties and Cytotoxicity of the Culinary-Medicinal Mushroom Pleurotus ostreatoroseus (Agaricomycetes).

    Science.gov (United States)

    Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2018-01-01

    In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.

  17. Production of versatile peroxidase from Pleurotus eryngii by solid-state fermentation using agricultural residues and evaluation of its catalytic properties.

    Science.gov (United States)

    Palma, C; Lloret, L; Sepúlveda, L; Contreras, E

    2016-01-01

    Interest in production of ligninolytic enzymes has been growing over recent years for their use in various applications such as recalcitrant pollutants bioremediation; specifically, versatile peroxidase (VP) presents a great potential due to its catalytic versatility. The proper selection of the fermentation mode and the culture medium should be an imperative to ensure a successful production by an economic and available medium that favors the process viability. VP was produced by solid-state fermentation (SSF) of Pleurotus eryngii, using the agricultural residue banana peel as growth medium; an enzymatic activity of 10,800 U L(-1) (36 U g(-1) of substrate) was detected after 18 days, whereas only 1800 U L(-1) was reached by conventional submerged fermentation (SF) with glucose-based medium. The kinetic parameters were determined by evaluating the H2O2 and Mn(2+) concentration effects on the Mn(3+)-tartrate complex formation. The results indicated that although the H2O2 inhibitory effect was observed for the enzyme produced by both media, the reaction rates for VP obtained by SSF were less impacted. This outcome suggests the presence of substances released from banana peel during the fermentation, which might exhibit a protective effect resulting in an improved kinetic behavior of the enzyme.

  18. Additive effects of CuSO4 and aromatic compounds on laccase production by Pleurotus sajor-caju PS-2001 using sucrose as a carbon source

    Directory of Open Access Journals (Sweden)

    F. Bettin

    2014-06-01

    Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.

  19. Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

    Science.gov (United States)

    Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

    2016-11-01

    In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

  20. Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

    Science.gov (United States)

    Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

    2011-01-01

    Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

  1. Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

    Science.gov (United States)

    Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

    2014-10-15

    Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  3. Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

    Science.gov (United States)

    Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

    2018-04-20

    Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  4. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

    Science.gov (United States)

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

  5. Biochemical and microstructural Ccharacteristics of insoluble and soluble dietary fiber prepared from mushroom sclerotia of Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos.

    Science.gov (United States)

    Wong, Ka-Hing; Cheung, Peter C K; Wu, Jin-Zhong

    2003-11-19

    The proximate composition of sclerotia of Pleurotus tuber-regium, Polyporus rhinoceros, and Wolfiporia cocos, together with the yield, purity, monosaccharide profile, and microstructure of their insoluble dietary fiber (IDF) and soluble dietary fiber (SDF) fractions prepared from AOAC enzymatic-gravimetric methods were investigated and compared. All three sclerotia were typical carbohydrate rich sclerotia [ranging from 90.5 to 98.1% dry matter (DM)] with an exceptionally low amount of crude lipid content (ranging from 0.02 to 0.14% DM). Besides, all three sclerotia possessed substantial amounts of IDF (ranging from 77.4 to 94.6% DM) with notably high levels of nonstarch polysaccharides (NSP) (89.9-92.2% DM) in which glucose was the predominant sugar residue (90.6-97.2% of NSP DM). On the contrary, both the yield (only ranging from 1.45 to 2.50% DM) and the amount of NSP (ranging from 22.4 to 29.6% DM) of the three sclerotial SDF fractions were very low. Scanning electron micrographs showed fragments of interwoven hyphae and insoluble materials in the three sclerotial IDF fractions, but only an amorphous structure of soluble materials was observed in the SDF fractions. The potential use of these fiber preparations was discussed.

  6. DESIGN OF OYSTER (PLEUROTUS OSTREATUS PRODUCTION UNIT TAKING INTO ACCOUNT ITS AGROTECHNIC OF GROWIGN AND QUALITY AND QUANTITY OF ITS PRODUCTION

    Directory of Open Access Journals (Sweden)

    Marcel Golian

    2015-02-01

    Full Text Available According to influence of population increasing followed by agricultural soils decreasing there is noticed a necessity of individual food commodities production intensification. There is also needed to think about some new unconventional and alternative sort of food-stuff. An edible mushroom growing is one of the relatively new agricultural branches, whereby on a large scale there are grown species which belong to saprophytic group. The aim of task was the building – technological and equipment – technological proposal of oyster (Pleurotus ostreatus, Jacq. P. Kumm production unit with taking account to its specific agro technical requirements and valid legislative. In the next part of task there were evaluated and compared qualitative and quantitative parameters of sporocarps from two variants which were collected in the first growth wave and accuracy of the proposed oyster production unit. In case of variant A there were used sacks with substrates, which have been exposed to cold shock by 6°C temperature for 4 days and in variant B were used substrates without cold shock. According to reached results the cold shock had almost neither influence on production quantity. There was found out an important fact that crop height from first growth wave wasn´t identical with well-known literature sources. The low crop is connected with high CO2 content in oyster production unit room, according to our opinion. Other equipment aimed to air humidity regulation, air temperature regulation and room lights was designed correctly.

  7. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  8. Development of natural cellulase inhibitor mediated intensified biological pretreatment technology using Pleurotus florida for maximum recovery of cellulose from paddy straw under solid state condition.

    Science.gov (United States)

    Naresh Kumar, Manickam; Ravikumar, Rajarathinam; Thenmozhi, Senniyappan; Kirupa Sankar, Muthuvelu

    2017-11-01

    Inhibitor mediated intensified bio-pretreatment (IMBP) technology using natural cellulase inhibitor (NCI) for maximum cellulose recovery from paddy straw was studied. Pretreatment was carried out under solid state condition. Supplementation of 8% NCI in pretreatment medium improves cellulose recovery and delignification by 1.2 and 1.5-fold respectively, compared to conventional bio-pretreatment due to inhibition of 61% of cellulase activity in IMBP. Further increase in NCI concentration showed negative effect on Pleurotus florida growth and suppress the laccase productivity by 1.1-fold. Laccase activity in IMBP was found to be 2.0U/mL on 19 th day, which is higher than (1.5U/mL) conventional bio-pretreatment. Physico-chemical modifications in paddy straw before and after pretreatment were analysed by SEM, ATR-FTIR, XRD and TGA. According to these findings, the IMBP technology can be a viable eco-friendly technology for sustainable production of bioethanol with maximum cellulose recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Evaluation of the Synergistic Effect of Mixed Cultures of White-Rot Fungus Pleurotus ostreatus and Biosurfactant-Producing Bacteria on DDT Biodegradation.

    Science.gov (United States)

    Purnomo, Adi Setyo; Ashari, Khoirul; Hermansyah, Farizha Triyogi

    2017-07-28

    DDT (1,1,1-trichloro-2,2- bis (4-chlorophenyl) ethane) is one of the organic synthetic pesticides that has many negative effects for human health and the environment. The purpose of this study was to investigate the synergistic effect of mixed cutures of white-rot fungus, Pleurotus ostreatus , and biosurfactant-producing bacteria, Pseudomonas aeruginosa and Bacillus subtilis , on DDT biodegradation. Bacteria were added into the P. ostreatus culture (mycelial wet weight on average by 8.53 g) in concentrations of 1, 3, 5, and 10 ml (1 ml ≈ 1.25 × 10 9 bacteria cells/ml culture). DDT was degraded to approximately 19% by P. ostreatus during the 7-day incubation period. The principal result of this study was that the addition of 3 ml of P. aeruginosa into P. ostreatus culture gave the highest DDT degradation rate (approximately 86%) during the 7-day incubation period. This mixed culture combination of the fungus and bacteria also gave the best ratio of optimization of 1.91. DDD (1,1-dichloro-2,2- bis (4-chlorophenyl) ethane), DDE (1,1-dichloro-2,2- bis (4-chlorophenyl) ethylene), and DDMU (1-chloro-2,2- bis (4-chlorophenyl) ethylene) were detected as metabolic products from the DDT degradation by P. ostreatus and P. aeruginosa . The results of this study indicate that P. aeruginosa has a synergistic relationship with P. ostreatus and can be used to optimize the degradation of DDT by P. ostreatus .

  10. Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

    Directory of Open Access Journals (Sweden)

    Ricardo Sposina S. Teixeira

    2010-01-01

    Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

  11. Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

    Science.gov (United States)

    Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

    2017-10-01

    The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

  12. Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

    Science.gov (United States)

    Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

    2016-03-01

    Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

  13. SYNTHESIS OF AROMA COMPOUNDS BY Pleurotus ostreatus (Jacq.:Fr. Kumm. CULTURED ON VARIOUS SUBSTRATES E. N. Vlasenko, J. V. Stepnevskaya, O. V.

    Directory of Open Access Journals (Sweden)

    E. N. Vlasenko

    2017-08-01

    Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.

  14. Electrochemistry Combined with LC-HRMS: Elucidating Transformation Products of the Recalcitrant Pharmaceutical Compound Carbamazepine Generated by the White-Rot Fungus Pleurotus ostreatus.

    Science.gov (United States)

    Seiwert, Bettina; Golan-Rozen, Naama; Weidauer, Cindy; Riemenschneider, Christina; Chefetz, Benny; Hadar, Yitzhak; Reemtsma, Thorsten

    2015-10-20

    Transformation products (TPs) of environmental pollutants must be identified to understand biodegradation processes and reaction mechanisms and to assess the efficiency of treatment processes. The combination of oxidation by an electrochemical cell (EC) with analysis by liquid chromatography-high-resolution mass spectrometry (LC-HRMS) is a rapid approach for the determination and identification of TPs generated by natural microbial processes. Electrochemically generated TPs of the recalcitrant pharmaceutical carbamazepine (CBZ) were used for a target screening for TPs formed by the white-rot fungus Pleurotus ostreatus. EC with LC-HRMS facilitates detection and identification of TPs because the product spectrum is not superimposed with biogenic metabolites and elevated substrate concentrations can be used. A group of 10 TPs formed in the microbial process were detected by target screening for molecular ions, and another 4 were detected by screening on the basis of characteristic fragment ions. Three of these TPs have never been reported before. For CBZ, EC with LC-HRMS was found to be more effective than software tools in defining targets for the screening and faster than nontarget screening alone in TP identification. EC with LC-HRMS may be used to feed MS databases with spectra of possible TPs of larger numbers of environmental contaminants for an efficient target screening.

  15. Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

    Science.gov (United States)

    Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

    2017-06-01

    Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

  16. DISTRIBUSI Solen sp DI PERAIRAN KABUPATEN BANGKALAN

    Directory of Open Access Journals (Sweden)

    Eva Ari Wahyuni

    2016-03-01

    Full Text Available DISTRIBUTION OF Solen sp IN BANGKALAN WATERSSolen sp potential needs to be developed on the island of Madura, particularly in Bangkalan. Solen sp utilization has increased which has the potential to overfishing. Therefore, this study aims to determine the density of Solen sp and their ecology in the waters Modung village, Modung District, Bangkalan. The experiment was conducted in April 2015 using the descriptive method. The materials used include Solen sp and physico-chemical parameters of the environment (temperature, salinity, pH, and substrate. The analyzes were conducted at the Laboratory of Marine Science, Department of Marine Sciences, Trunojoyo University of Madura by using the tool grabsampler, sieveshaker, and pipetting with gravimetric method. The analysis shows the range of values of temperature between 29-300C, salinity between 31-32 ppt, pH were 7.9-8.0 and the type of substrate in the form of sandy mud, as well as the density of Solen sp from 8-10 individuals/m2. All measurement results indicate normal conditions and in accordance with the sea water quality standard for marine life, which can be a suitable habitat for the growth and development of Solen sp. This condition is thought to affect the density of Solen sp.Keywords: Bangkalan, density, distribution, Solen sp, substrate.ABSTRAKPotensi Solen sp perlu dikembangkan di pulau Madura, khususnya di Kabupaten Bangkalan. Pemanfaatan Solen sp mengalami peningkatan sehingga berpotensi overfishing. Untuk itu, penelitian ini bertujuan untuk mengetahui kepadatan Solen sp dan ekologinya di perairan desa Modung, Kecamatan Modung, Kabupaten Bangkalan. Penelitian dilaksanakan pada bulan April 2015 dengan metode deskriptif. Materi dan bahan yang digunakan diantaranya Solen sp dan parameter fisika-kimia lingkungan (suhu, salinitas, pH, dan substrat. Analisa dilakukan di Laboratorium Ilmu Kelautan, Program studi/Jurusan Ilmu Kelautan Universitas Trunojoyo Madura dengan menggunakan alat

  17. Introduction to the SP theory of intelligence

    OpenAIRE

    Wolff, J Gerard

    2018-01-01

    This article provides a brief introduction to the "Theory of Intelligence" and its realisation in the "SP Computer Model". The overall goal of the SP programme of research, in accordance with long-established principles in science, has been the simplification and integration of observations and concepts across artificial intelligence, mainstream computing, mathematics, and human learning, perception, and cognition. In broad terms, the SP system is a brain-like system that takes in "New" infor...

  18. Evaluation of antioxidant and cytotoxic properties of Cynobacteria, Limnothrix sp. and Leptolyngbya sp. from Arabian sea

    Digital Repository Service at National Institute of Oceanography (India)

    Anas, A.; Vinothkumar, S.; Gupta, S.; Jasmin, C.; Joseph, V.; Parameswaran, P.S.; Nair, S.

    The hexane fractions of the marine cyanobacteria: Leptolyngbya sp. and Limnothrix sp., collected from Arabian Sea were found to display promising antioxidant properties than their ethyl acetate fraction during radical scavenging ABTS/DPPH assays (IC...

  19. Xylanolytic enzyme systems in Arthrobacter sp MTCC 5214 and Lactobacillus sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Khandeparker, R.; Jalal, T.

    The production of extracellular xylanolytic enzymes such as xylanase, alfa-L-arabinofuranosidase (alfa-l-AFase), and acetyl xylan esterase (Axe) by marine Arthrobacter sp and Lactobacillus sp was investigated using different carbon sources Induction...

  20. Pengendalian Hayati Penyakit Layu Fusarium Pisang (Fusarium Oxysporum F.sp. Cubense) dengan Trichoderma SP.

    OpenAIRE

    Sudirman, Albertus; Sumardiyono, Christanti; Widyastuti, Siti Muslimah

    2011-01-01

    The aim of this research was to study the inhibiting ability of Trichoderma sp. to control fusarium wilt of banana in greenhouse condition. The experiments consisted of the antagonism test between Trichoderma sp. and Fusarium oxysporum f.sp. cubense (Foc) in vitro using dual culture method and glass house experiment which was arranged in 3×3 Factorial Complete Randomized Design. First factor of the latter experiment was the dose of Trichoderma sp. culture (0, 25, and 50 g per polybag), second...

  1. Selective C(sp2)-C(sp) bond cleavage: the nitrogenation of alkynes to amides.

    Science.gov (United States)

    Qin, Chong; Feng, Peng; Ou, Yang; Shen, Tao; Wang, Teng; Jiao, Ning

    2013-07-22

    Breakthrough: A novel catalyzed direct highly selective C(sp2)-C(sp) bond functionalization of alkynes to amides has been developed. Nitrogenation is achieved by the highly selective C(sp2)-C(sp) bond cleavage of aryl-substituted alkynes. The oxidant-free and mild conditions and wide substrate scope make this method very practical. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. First report of Anisakis sp. in Epinephelus sp. in East Indonesia

    OpenAIRE

    Annytha Ina Rohi Detha; Diana Agustiani Wuri; Julianty Almet; Yuni Riwu; Christin Melky

    2018-01-01

    Objective: The present research was conducted to identify the prevalence of Anisakis sp. as fish-borne zoonoses in Epinephelus sp. in territorial waters of East Nusa Tenggara, Indonesia. Materials and methods: A total of 50 fish (Epinephelus sp.) were collected from Kupang Fish Market in East Nusa Tenggara. Identification of Anisakis sp. was performed based on morphological observations considering shape of ventriculus, boring tooth, and mucron using binocular microscope. Results: Prev...

  3. Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov.

    Science.gov (United States)

    Yang, Deok-Chun; Im, Wan-Taek; Kim, Myung Kyum; Lee, Sung-Taik

    2005-03-01

    Gram-negative, non-spore-forming, rod-shaped bacteria, T7-09(T) and TR6-08(T), were isolated from soil from a ginseng field in South Korea and characterized to determine their taxonomic position. 16S rRNA gene sequence analysis showed that the two isolates shared 99.5 % sequence similarity. Strains T7-09(T) and TR6-08(T) were shown to belong to the Proteobacteria and showed the highest levels of sequence similarity to Pseudoxanthomonas broegbernensis DSM 12573(T) (98.1 %), Pseudoxanthomonas mexicana AMX 26B(T) (97.4-97.5 %), Pseudoxanthomonas japonensis 12-3(T) (96.5-96.6 %), Pseudoxanthomonas taiwanensis ATCC BAA-404(T) (95.7 %) and Xanthomonas campestris ATCC 33913(T) (96.3-96.5 %). The sequence similarity values with respect to any species with validly published names in related genera were less than 96.5 %. The detection of a quinone system with Q-8 as the predominant compound and a fatty acid profile with C(15 : 0) iso as the predominant acid supported the assignment of the novel isolates to the order 'Xanthomonadales'. The two isolates could be distinguished from the established species of the genus Pseudoxanthomonas by the presence of quantitative unsaturated fatty acid C(17 : 1) iso omega9c and by their unique biochemical profiles. The results of DNA-DNA hybridization clearly demonstrated that T7-09(T) and TR6-08(T) represent separate species. On the basis of these data, it is proposed that T7-09(T) (=KCTC 12208(T)=IAM 15116(T)) and TR6-08(T) (=KCTC 12207(T)=IAM 15115(T)) be classified as the type strains of two novel Pseudoxanthomonas species, for which the names Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov., respectively, are proposed.

  4. High-Temperature Induced Changes of Extracellular Metabolites in Pleurotus ostreatus and Their Positive Effects on the Growth of Trichoderma asperellum.

    Science.gov (United States)

    Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia; Huang, Chenyang

    2018-01-01

    Pleurotus ostreatus is a widely cultivated edible fungus in China. Green mold disease of P. ostreatus which can seriously affect yield is a common disease during cultivation. It occurs mostly after P. ostreatus mycelia have been subjected to high temperatures. However, little information is available on the relationship between high temperature and green mold disease. The aim of this study is to prove that extracellular metabolites of P. ostreatus affected by high temperature can promote the growth of Trichoderma asperellum . After P. ostreatus mycelia was subjected to high temperature, the extracellular fluid of P. ostreatus showed a higher promoting effect on mycelial growth and conidial germination of T. asperellum . The thiobarbituric acid reactive substance (TBARS) content reached the maximum after 48 h at 36°C. A comprehensive metabolite profiling strategy involving gas chromatography-mass spectrometry (GC/MS) combined with liquid chromatography-mass spectrometry (LC/MS) was used to analyze the changes of extracellular metabolites in response to high temperature. A total of 141 differential metabolites were identified, including 84.4% up-regulated and 15.6% down-regulated. Exogenous metabolites whose concentrations were increased after high temperature were randomly selected, and nearly all of them were able to promote the mycelial growth and conidial germination of T. asperellum . The combination of all selected exogenous metabolites also has the promotion effects on the mycelial growth and conidial germination of T. asperellum in a given concentration range in vitro . Overall, these results provide a first view that high temperature affects the extracellular metabolites of P. ostreatus , and the extensive change in metabolites promotes T. asperellum growth.

  5. Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

    Science.gov (United States)

    Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

    2018-03-01

    As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

  6. Effects of Eryngii mushroom (Pleurotus eryngii) and Lactobacillus plantarum on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880).

    Science.gov (United States)

    Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa

    2016-10-01

    This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.

  7. Gamma radiation in increasing productivity of Agaricus bisporus and Pleurotus sajor-caju and enhancing storage life of P. sajor-caju

    International Nuclear Information System (INIS)

    Roy, M.K.; Chatterjee, S.R.; Bahukhandi, D.; Sharma, R.; Philips, A.S.

    2000-01-01

    Gamma radiation of spawn of Agaricus bisporus and pleurotus sajor-caju at doses of 0.1 to 0.3 kGy and 0.1 to 0.25 kGy respectively, reduced the mycelial spawn run time and exerted a stimulatory effect on the growth of these two mushrooms. Irradiation also increased yield of these mushrooms. In all cases of the former, the highest yield of 2.57g was recorded from spawn irradiated at 0.3 kGy, while with the latter, best yield of 1119 g was recorded from spawn treated with 0.25 kGy. The control (non-irradiated) spawns of A. bisporus and P. sajor-caju gave yields of 2.03 g and 565 g respectively. Thus, a major boost in yields could be achieved using this technology. The shelf life of P. sajor-caju could be extended up to 9 days by 0.5 kGy of radiation, when the treated fruit bodies were held at 15 deg C as against the un-irradiated ones which had a shelf-life of 6 days. This dose neither adversely affected the browning of the fruit bodies at 45 deg C, nor lowered their protein (protein + free amino acids) and carbohydrate contents. Irradiation, however, at all the doses from 0.1 to 0.75 kGy enhanced the rehydration ratio and total free amino acid contents. The rehydration ratio of 0.62 was the maximum, reached with a dose of 0.25 kGy as against the control, which showed a value of 5.0. Dehydration along with gamma radiation treatment could play an important role for long term storage of mushrooms. Weight loss of un-dehydrated fruit bodies also decreased as a result of irradiation. (author)

  8. Specialised predation by Palpimanus sp. (Araneae: Palpimanidae ...

    African Journals Online (AJOL)

    This is the first detailed report on the natural prey and the prey-capture tactics of a Palpimanus sp. from Entebbe (Uganda). Although this species fed occasionally on insects, its dominant prey in the field was other spiders, especially jumping spiders (Salticidae) and their eggs. Encounters between Palpimanus sp. and ...

  9. Kultivasi Scenedesmus SP. Pada Medium Air Limbah

    OpenAIRE

    Kawaroe, Mujizat

    2011-01-01

    Proses fotosintesis pada mikroalga membutuhkan CO2 dan cahaya matahari serta nutrien untuk pertumbuhannya. Kultivasi Scenedesmus sp. pada medium air limbah bertujuan guna mencukupi kebutuhan mikroalga akan nutrien dan mengurangi masukan dari bahan kimia yang terkandung dalam air limbah tersebut ke lingkungan. Kultivasi Scenedesmus sp. dilakukan selama tujuh hari pada medium air limbah industri tanpa penambahan nutri...

  10. Guide til gode spørgeskemaer

    DEFF Research Database (Denmark)

    Olsen, Henning

    Spørgeskemaundersøgelser bliver ofte brugt til at dokumentere forskellige forhold og begrunde politiske beslutninger. Men resultaterne kan være forbundet med stor usikkerhed. Det kræver omhu og stor sproglig formåen at udarbejde spørgeskemaer. Seniorforsker Henning Olsen har i flere år arbejdet med...... viden om, hvordan folk forstår sproglige meddelelser og genkalder sig informationer. I guiden behandles emner som fx styrende problemstillinger og spørgsmåls fokus og neutralitet, formulering af åbne eller lukkede spørgsmål og svarkategorier, tematiske spørgeforløb, aflastning af svarpersoners...

  11. Glyphosate catabolism by Pseudomonas sp

    International Nuclear Information System (INIS)

    Shinabarger, D.L.

    1986-01-01

    The pathway for the degradation of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. PG2982 has been determined using metabolic radiolabeling experiments. Radiorespirometry experiments utilizing [3- 14 C] glyphosate revealed that approximately 50-59% of the C3 carbon was oxidized to CO 2 . Fractionation of stationary phase cells labeled with [3- 14 C]glyphosate revealed that from 45-47% of the assimilated C3 carbon is distributed to proteins and that amino acids methionine and serine are highly labeled. The nucleic acid bases adenine and guanine received 90% of the C3 label that was incorporated into nucleic acids, and the only pyrimidine base labeled was thymine. Pulse labeling of PG2982 cells with [3- 14 C]glyphosate revealed that [3- 14 C]sarcosine is an intermediate in glyphosate degradation. Examination of crude extracts prepared from PG2982 cells revealed the presence of an enzyme that oxidizes sarcosine to glycine and formaldehyde. These results indicate that the first step in glyphosate degradation by PG2982 is cleavage of the carbon-phosphorus bond, resulting in the release of sarcosine and a phosphate group. The phosphate group is utilized as a source of phosphorus, and the sarcosine is degraded to glycine and formaldehyde. Phosphonate utilization by Pseudomonas sp. PG2982 was investigated. Each of the ten phosphonates tested were utilized as a sole source of phosphorus by PG2982. Representative compounds tested included alkylphosphonates, 1-amino-substituted alkylphosphonates, amino-terminal phosphonates, and an arylphosphonate. PG2982 cultures degraded phenylphosphonate to benzene and produced methane from methylphosphonate. The data indicate that PG2982 is capable of cleaving the carbon-phosphorus bond of several structurally different phosphonates

  12. Trichoderma sp. dalam Pengendalian Penyakit Layu Fusarium pada Tanaman Tomat

    OpenAIRE

    Novita, Trias

    2013-01-01

    Penelitian ini bertujuan untuk mengetahui peran Trichoderma sp dalam pengendalianpenyakit layu fusarium pada tanaman tomat. Penelitian dilaksanakan di Rumah Kaca FakultasPertanian Universitas Jambi, perlakuannya terdiri dari : t0 = tanpa Trichoderma sp; t1 = 25 gTrichoderma sp/8 kg media; t2 = 50 g Trichoderma sp/8 kg media; t3 = 75 g Trichoderma sp/8 kgmedia; dan t4 = 100 g Trichoderma sp /8 kg media. Hasil penelitian menunjukkan bahwa Trichodermasp berperan dalam mengendalikan penyakit layu...

  13. INTERAKSI ANTARA Trichoderma Harzianum, Penicillium SP. DAN Pseudomonas SP. SERTA KAPASITAS ANTAGONISMENYA TERHADAP Phytophthora CapsicilN VITRO*[Interaction Among Trichoderma Harzianum, Penicillium SP., Pseudomonas SP. and Antagonism Capacities Against Phy

    OpenAIRE

    Suharna, Nandang

    2003-01-01

    A preliminary study has been done to know antagonism capacities of three isolates of Trichoderma harzianum, two isolates of Penicillium sp.and one isolate of Pseudomonas sp.against Phytophthora capsici in vitro and interaction among those six antagonists.The highest antagonism capacity possessed by Penicillium sp. KN1, respectively followed by Penicillium sp.KN2,Pseudomonas sp. GH1 and the three T. harzianum isolates. Except for those three T. harzianum isolates, the two Penicillium sp.isolat...

  14. SP140L, an Evolutionarily Recent Member of the SP100 Family, Is an Autoantigen in Primary Biliary Cirrhosis

    Directory of Open Access Journals (Sweden)

    Mario Saare

    2015-01-01

    Full Text Available The SP100 family members comprise a set of closely related genes on chromosome 2q37.1. The widely expressed SP100 and the leukocyte-specific proteins SP110 and SP140 have been associated with transcriptional regulation and various human diseases. Here, we have characterized the SP100 family member SP140L. The genome sequence analysis showed the formation of SP140L gene through rearrangements of the two neighboring genes, SP100 and SP140, during the evolution of higher primates. The SP140L expression is interferon-inducible with high transcript levels in B cells and other peripheral blood mononuclear cells. Subcellularly, SP140L colocalizes with SP100 and SP140 in nuclear structures that are devoid of SP110, PML, or p300 proteins. Similarly to SP100 and SP140 protein, we detected serum autoantibodies to SP140L in patients with primary biliary cirrhosis using luciferase immunoprecipitation system and immunoblotting assays. In conclusion, our results show that SP140L is phylogenetically recent member of SP100 proteins and acts as an autoantigen in primary biliary cirrhosis patients.

  15. Avaliação do cultivo de Pleurotus sajor-caju (fries sing. sobre o resíduo de algodão da industria têxtil para a produção de cogumelos e para alimentação animal Evaluation of the cultivation of Pleurotus sajor-caju (fries sing. on cotton textile mill waste for mushroom production and animal feeding

    Directory of Open Access Journals (Sweden)

    Clenderson Corradi de Mattos Gonçalves

    2010-02-01

    Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste

  16. Fresh Water Cyanobacteria Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as an Anticancer Drug Resource

    OpenAIRE

    Srivastava, Akanksha; Tiwari, Ratnakar; Srivastava, Vikas; Singh, Tej Bali; Asthana, Ravi Kumar

    2015-01-01

    An increasing number of cancer patients worldwide, especially in third world countries, have raised concern to explore natural drug resources, such as the less explored fresh water filamentous cyanobacteria. Six strains of cyanobacteria (Phormidium sp. CCC727, Geitlerinema sp. CCC728, Arthrospira sp. CCC729, Phormidium sp. CCC731, Phormidium sp. CCC730, and Leptolyngbya sp. CCC732) were isolated (paddy fields and ponds in the Banaras Hindu University, campus) and five strains screened for ant...

  17. Antibacterial Actions and Potential Phototoxic Effects of Volatile oils of Foeniculum sp. (fennel, Salvia sp. (sage, Vitis sp. (grape, Lavandula sp. (lavender

    Directory of Open Access Journals (Sweden)

    Elif Ayse Erdogan Eliuz

    2016-09-01

    Full Text Available In the present study, the volatile compounds of essential oil of Foeniculum vulgare (fennel, Salvia officinalis (sage, Vitis vinifera (grape, Lavandula angustifolia (lavender were analysed by gas chromatography-mass spectrometry (GC-MS using the Nist and Willey libraries. It was determined that the main components of Foeniculum sp. were anethole (41.11%, carvacrol (9.18%. whereas main components of Salvia sp were 1.8 cineole (34.09%, caryophyllene (10.95%, camphor (9.44%, α-pinene (8.42%. Vitis sp. contained linoleic acid (36.98%, 2,4-decadienal (30.79%. Finally, volatile component of Lavandula sp. was linalool (33.57%, linalyl acetate (30.74%. Photoxic antibacterial activity of volatile oil of those plants against Escherichia coli (ATCC 25293, Klebsiella pneumoniae (10031, Salmonella thyphimurium, Bacillus subtilis (ATCC 6633, Staphylococcus aureus (ATCC 25925, Enterococcus feacalis (ATCC 29212 were examined by using disc diffusion method. We demonstrated that volatile oil effectively can be activated by a standard LED light. In vitro, significant phototoxicity was demonstrated by volatile oil of Foeniculum sp. and Vitis sp. (P < 0.05, while minor phototoxicity was induced by Lavandula sp. Therefore, volatile oil of plant can be considered as a potential photosensitizer in the photochemical therapy.

  18. TurboSP and the Topological Trigger

    CERN Document Server

    Belavin, Vladislav

    2016-01-01

    TurboSP was originally proposed as an alternative to Full stream in LHCb data flow. TurboSP is a data flow strategy which not only selects events that should be preserved, like in Full stream, but also provides selective persistence. This is achieved by saving candidates and subset of the reconstruction. During this summer project we investigated the physics viability of using TurboSP with the topological lines and found out a possibility to reduce the number of kept tracks per event by two times while keeping a ratio of fully picked up interesting decay modes on $\\sim 97 \\%$ level.

  19. Pengendalian Hayati Penyakit Layu Fusarium Pisang (Fusarium oxysporum f.sp. cubense dengan Trichoderma sp.

    Directory of Open Access Journals (Sweden)

    Albertus Sudirman

    2011-07-01

    Full Text Available The aim of this research was to study the inhibiting ability of Trichoderma sp. to control fusarium wilt of banana in greenhouse condition. The experiments consisted of the antagonism test between Trichoderma sp. and Fusarium oxysporum f.sp. cubense (Foc in vitro using dual culture method and glass house experiment which was arranged in 3×3 Factorial Complete Randomized Design. First factor of the latter experiment was the dose of Trichoderma sp. culture (0, 25, and 50 g per polybag, second factor was time of Trichoderma culture application (2 weeks before Foc inoculation, at same time with Foc inoculation and 2 weeks after Foc inoculation. Trichoderma sp. was cultured in mixed rice brand and chaff medium. The disease intensity was observed with scoring system of wilting leaves (0–4. The results showed that Trichoderma sp. was antagonistic against Foc in vitro and inhibited 86% of Foc colony development. Mechanism of antagonism between Trichoderma sp. and Foc was hyperparasitism. Trichoderma hyphae coiled around Foc hyphae. Lysis of Foc hyphae was occurred at the attached site of Trichoderma hyphae on Foc hyphae. Added banana seedling with Trichoderma sp. Culture reduced disease intensity of Fusarium wilt. Suggested dose of Trichoderma culture application in glass house was 25 g/polybag, given at the same time with Foc inoculation. Penelitian ini bertujuan untuk mengetahui kemampuan Trichoderma sp. untuk pengendalian penyakit layu fusarium pisang di rumah kaca. Penelitian meliputi pengujian daya hambat Fusarium oxysporum f.sp. cubense (Foc in vitro dan kemampuan menekan intensitas penyakit di rumah kaca. Penelitian in vitro meliputi uji antagonisme dan mekanismenya yang dilakukan secara dual culture. Uji pengaruh Trichoderma sp. terhadap penyakit layu Fusarium dilakukan di rumah kaca dengan Rancangan Acak Lengkap Faktorial. Faktor pertama adalah dosis biakan Trichoderma sp., dengan tiga aras (0, 25, 50 g/per bibit dalam polibag. Faktor kedua

  20. Detection of Salmonella sp., Vibrio sp. and total plate count bacteria on blood cockle (Anadara granosa)

    Science.gov (United States)

    Ekawati, ER; Yusmiati, S. N. H.

    2018-01-01

    Blood cockle (Anadara granosa) has high level of zinc and protein, which is beneficial for therapeutic function for malnourished particularly stunting case in children. Zinc in animal foods is more absorbable than that from vegetable food. Blood cockle (Anadara granosa) is rich in nutrient and an excellent environment for the growth of microorganisms. This research aimed to identify the contamination of Salmonella sp., Vibrio sp. and total plate count bacteria on blood cockle (Anadara granosa). This was observation research with laboratory analysis. Salmonella sp. and Vibrio sp. were detected from blood cockle. Total plate count was determine of the total amount of the bacteria. Results detected from 20 samples of blood cockle showed that all samples were negative of Salmonella sp. and 1 sample positive Vibrio sp. The result of total plate count bacteria was < 5 x 105 colony/g sample.

  1. Superhard sp2–sp3 hybrid carbon allotropes with tunable electronic properties

    Directory of Open Access Journals (Sweden)

    Meng Hu

    2016-05-01

    Full Text Available Four sp2–sp3 hybrid carbon allotropes are proposed on the basis of first principles calculations. These four carbon allotropes are energetically more favorable than graphite under suitable pressure conditions. They can be assembled from graphite through intralayer wrinkling and interlayer buckling, which is similar to the formation of diamond from graphite. For one of the sp2–sp3 hybrid carbon allotropes, mC24, the electron diffraction patterns match these of i-carbon, which is synthesized from shock-compressed graphite (H. Hirai and K. Kondo, Science, 1991, 253, 772. The allotropes exhibit tunable electronic characteristics from metallic to semiconductive with band gaps comparable to those of silicon allotropes. They are all superhard materials with Vickers hardness values comparable to that of cubic BN. The sp2–sp3 hybrid carbon allotroes are promising materials for photovoltaic electronic devices, and abrasive and grinding tools.

  2. Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus.

    Science.gov (United States)

    Kholif, A E; Khattab, H M; El-Shewy, A A; Salem, A Z M; Kholif, A M; El-Sayed, M M; Gado, H M; Mariezcurrena, M D

    2014-03-01

    The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health.

  3. Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus

    Science.gov (United States)

    Kholif, A. E.; Khattab, H. M.; El-Shewy, A. A.; Salem, A. Z. M.; Kholif, A. M.; El-Sayed, M. M.; Gado, H. M.; Mariezcurrena, M. D.

    2014-01-01

    The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health. PMID:25049962

  4. ROS-dependent mitochondria molecular mechanisms underlying antitumor activity of Pleurotus abalonus acidic polysaccharides in human breast cancer MCF-7 cells.

    Directory of Open Access Journals (Sweden)

    Xiaolong Shi

    Full Text Available BACKGROUND: A greater reduction in cancer risk associated with mushroom diet rich in fungus polysaccharides is generally accepted. Meanwhile, edible Pleurotus abalonus as a member of Abalone mushroom family is a popular nutritional supplement that purportedly prevents cancer occurrence. However, these anecdotal claims are supported by limited studies describing tumor-inhibitory responses to the promising polysaccharides, and the molecular mechanisms underlying these properties have not yet been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: We here fractionated the crude polysaccharide preparation from the fruiting bodies of P. abalonus into three fractions, namely PAP-1, PAP-2 and PAP-3, and tested these fractions for antiproliferative activity in human breast cancer MCF-7 cells. The largest PAP-3, an acidic polysaccharide fraction with a molecular mass of 3.68×10(5 Da, was the most active in inhibiting MCF-7 cancer cells with an IC50 of 193 µg/mL. The changes in cell normal morphology were observed by DAPI staining and the PAP-3-induced apoptosis was confirmed by annexin V/propidium iodide staining. The apoptosis was involved in mitochondria-mediated pathway including the loss of mitochondrial membrane potential (Δψm, the increase of Bax/Bcl-2 ratio, caspase-9/3 activation, and poly(ADP-ribose polymerase (PARP degradation, as well as intracellular ROS production. PAP-3 also induced up-regulation of p53, and cell cycle arrest at the S phase. The incubation of MCF-7 cells with antioxidant superoxide dismutase (SOD and N-acetylcysteine (NAC significantly attenuated the ROS generation and apoptosis caused by PAP-3, indicating that intracellular ROS plays a pivotal role in cell death. CONCLUSIONS/SIGNIFICANCE: These findings suggest that the polysaccharides, especially acidic PAP-3, are very important nutritional ingredients responsible for, at least in part, the anticancer health benefits of P. abalonus via ROS-mediated mitochondrial apoptotic

  5. EOP Gold Coral (Gerardia sp.) Growth Measurements

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Gold coral (Gerardia sp.) trees that were inspected years earlier on Pisces submersible dives were revisited and their change in size measured. The fishery for...

  6. Metabolites from marine fungus Aspergillus sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; Rajmanickam, R.; DeSouza, L.

    Chemical examination of a methanolic extract of the marine fungus, Aspergillus sp., isolated from marine grass environment, yielded a steroid, ergosterol peroxide (1), and a mixture of known glyceride esters (2,3) of unsaturated fatty acids...

  7. SP (4,R) symmetry in light nuclei

    International Nuclear Information System (INIS)

    Peterson, D.R.

    1979-01-01

    A classification of nuclear states according to the noncompact sympletic Lie algebras sp(2n,R), n = 1, 2, 3, is investigated. Such a classification has recently been shown to be physically meaningful. This classification scheme is the appropriate generalization fo Elliott's SU 3 model of rotational states in deformed light nuclei to include core excitations. A restricted classification according to the Lie algebra, sp(4,R), is motivated. Truncation of the model space to a single sp(4,R) irreducible representation allows the inclusion of states possessing very high excitation energy. An sp(4,R) model study is performed on S = T = 0 positive-parity rotational bands in the deformed light nuclei 16 O and 24 Mg. States are included in the model space that possess up to 10h ω in excitation energy. Results for the B(E2) transition rates compare favorable with experiment, without resort to effective charges

  8. Progress in SP-100 tribological coatings

    International Nuclear Information System (INIS)

    Ring, P.J.; Roy, P.; Schuster, G.B.; Busboom, H.J.

    1992-01-01

    The SP-100 reactor will operate at temperatures up to 1500K in high vacuum. To address the SP-100 needs, a tribology development program has been established at GE to investigate candidate coating materials. Materials were selected based on their high thermodynamic stability, high melting point, compatibility with the substrate, and coefficients of thermal expansion similar to niobium-1% zirconium-the candidate structural material for SP-100. An additional requirement was that the deposition processes should be commercially available to coat large components. This paper presents the details regarding the SP-100 Tribology Development Program including background information, specific bearing requirements, basis for coating material selection, testing methods and the initial results covering the early years of this program

  9. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  10. Cellulose powder from Cladophora sp. algae.

    Science.gov (United States)

    Ek, R; Gustafsson, C; Nutt, A; Iversen, T; Nyström, C

    1998-01-01

    The surface are and crystallinity was measured on a cellulose powder made from Cladophora sp. algae. The algae cellulose powder was found to have a very high surface area (63.4 m2/g, N2 gas adsorption) and build up of cellulose with a high crystallinity (approximately 100%, solid state NMR). The high surface area was confirmed by calculations from atomic force microscope imaging of microfibrils from Cladophora sp. algae.

  11. Avaliação de resíduos lignocelulósicos para a produção de Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes

    OpenAIRE

    Claudia Paganelli Lacerda de Azevedo

    2000-01-01

    Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes foram produzidos, em condições controladas, com resíduos lignocelulósicos em seis composições; (1) resíduo sólido de indústria de cerveja+ bagaço de cana de açúcar + sais minerais (2) resíduo sólido de indústria de cerveja + serragem de euca/yptus + sais minerais (3) resíduo sólido de indústria de cerveja + palha de arroz + sais minerais (4) resíduo sólido de indústria de cerveja + bagaço de cana de açúcar (5) resíduo sólido de indústr...

  12. Crescimento e capacidade de biosorção de metais por Pleurotus sajor-caju, em cultivo líquido e em cultivo sólido

    OpenAIRE

    Silva, Stela Maris da

    2007-01-01

    Neste trabalho, avaliaram-se o crescimento e a capacidade de biosorção de metais de Pleurotus sajor-caju PS 2001, em meios de cultivo líquido e sólido, contendo sulfatos de cobre II, de ferro II, de alumínio, de zinco, de cromo II e de níquel II, em concentrações de 30 ou 60mg.100mL-1 . O crescimento e a massa micelial foram avaliados aos 7, 14 e 21 dias de desenvolvimento para cultivo líquido sendo que para cada etapa de desenvolvimento foram retiradas amostras que foram submetidas a metodol...

  13. Penggunaan Jamur Antagonis Trichoderma SP. Dan Gliocladium SP. Untuk Mengendalikan Penyakit Layu Fusarium Pada Tanaman Bawang Merah (Allium Ascalonicum L.)

    OpenAIRE

    Arie Ramadhina, Arie Ramadhina; Lisnawita, Lisnawita; Lubis, Lahmuddin

    2013-01-01

    The use of antagonism fungus of Trichoderma sp. and Gliocladium sp. for controlling wilt(Fusarium oxysporum) in red onion plants. The aim of the research was to know the effectiviness ofantagonism fungus of Trichoderma sp. and Gliocladium sp. in controlling wilt in red onion plants.The research used non-factorial RAK (random group design) with eight treatments: control, 10grams of F. oxysporum, 12 grams of Trichoderma sp., 18 grams of Trichoderma sp., 24 grams ofTrichoderma sp., and 12 grams ...

  14. Utilização do composto exaurido de Pleurotus sajor caju em rações de frangos de corte e seus efeitos no desempenho dessas aves - DOI: 10.4025/actascianimsci.v31i2.4811 Utilization of the spent substrate of Pleurotus sajor caju mushroom in broiler chicks ration and the effect on broiler chicken performance - DOI: 10.4025/actascianimsci.v31i2.4811

    Directory of Open Access Journals (Sweden)

    Antônio Gilberto Bertechini

    2009-08-01

    Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and

  15. Taxonomy Icon Data: Synechocystis sp.PCC 6803 [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available Synechocystis sp.PCC 6803 Synechocystis sp.PCC 6803 Synechocystis_sp_PCC_6803_L.png Synecho...cystis_sp_PCC_6803_NL.png Synechocystis_sp_PCC_6803_S.png Synechocystis_sp_PCC_6803_NS.png http://bi...osciencedbc.jp/taxonomy_icon/icon.cgi?i=Synechocystis+sp%2ePCC+6803&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Synecho...cystis+sp%2ePCC+6803&t=NL http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Synecho...cystis+sp%2ePCC+6803&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Synechocystis

  16. Five novel Wickerhamomyces- and Metschnikowia-related yeast species, Wickerhamomyces chaumierensis sp. nov., Candida pseudoflosculorum sp. nov., Candida danieliae sp. nov., Candida robnettiae sp. nov. and Candida eppingiae sp. nov., isolated from plants

    NARCIS (Netherlands)

    Groenewald, Marizeth; Robert, Vincent; Smith, Maudy Th

    On the basis of nucleotide divergences in the D1/D2 domain of the 26S rRNA gene and the internal transcribed spacers (ITS) domain of the rRNA gene, five novel yeast species, Wickerhamomyces chaumierensis sp. nov. (CBS 8565(T)  = JCM 17246(T)), Candida pseudoflosculorum sp. nov. (CBS 8584(T)  = JCM

  17. SP2Bench: A SPARQL Performance Benchmark

    Science.gov (United States)

    Schmidt, Michael; Hornung, Thomas; Meier, Michael; Pinkel, Christoph; Lausen, Georg

    A meaningful analysis and comparison of both existing storage schemes for RDF data and evaluation approaches for SPARQL queries necessitates a comprehensive and universal benchmark platform. We present SP2Bench, a publicly available, language-specific performance benchmark for the SPARQL query language. SP2Bench is settled in the DBLP scenario and comprises a data generator for creating arbitrarily large DBLP-like documents and a set of carefully designed benchmark queries. The generated documents mirror vital key characteristics and social-world distributions encountered in the original DBLP data set, while the queries implement meaningful requests on top of this data, covering a variety of SPARQL operator constellations and RDF access patterns. In this chapter, we discuss requirements and desiderata for SPARQL benchmarks and present the SP2Bench framework, including its data generator, benchmark queries and performance metrics.

  18. The gamma ray spectrometer GA.SP

    Energy Technology Data Exchange (ETDEWEB)

    Bazzacco, D [Instituto Nazionale di Fisica Nucleare, Sezione di Padova, Padova (Italy)

    1992-08-01

    GA.SP is a general purpose 4{pi} detector array for advanced {gamma}-spectroscopy and, in the same time, a suitable system for reaction mechanism studies. The detector is sited at the LNL Tandem+Linac accelerator and has been built as a joint project of INFN Padova, LNL, Milano and Firenze. The array consists of 40 Compton suppressed HPGe detectors and of a 4{pi} calorimeter composed of 80 BGO crystals. The detector houses a reaction chamber of 34 cm diameter where a charged particles multiplicity filter composed of 40 Si detectors is going to be installed. Evaporation residues produced in the centre of GA.SP can be injected into the recoil mass spectrometer (RMS, named CAMEL) in use at LNL, without the need to remove any of the gamma detectors. The coupled operation of GA.SP, RMS and Si ball will give a unique instrument for identification and study of weak reaction channels. (author). 6 figs.

  19. The gamma ray spectrometer GA.SP

    International Nuclear Information System (INIS)

    Bazzacco, D.

    1992-01-01

    GA.SP is a general purpose 4π detector array for advanced γ-spectroscopy and, in the same time, a suitable system for reaction mechanism studies. The detector is sited at the LNL Tandem+Linac accelerator and has been built as a joint project of INFN Padova, LNL, Milano and Firenze. The array consists of 40 Compton suppressed HPGe detectors and of a 4π calorimeter composed of 80 BGO crystals. The detector houses a reaction chamber of 34 cm diameter where a charged particles multiplicity filter composed of 40 Si detectors is going to be installed. Evaporation residues produced in the centre of GA.SP can be injected into the recoil mass spectrometer (RMS, named CAMEL) in use at LNL, without the need to remove any of the gamma detectors. The coupled operation of GA.SP, RMS and Si ball will give a unique instrument for identification and study of weak reaction channels. (author). 6 figs

  20. SP-100/Brayton power system concepts

    International Nuclear Information System (INIS)

    Owen, D.F.

    1989-01-01

    Use of closed Brayton cycle (CBC) power conversion technology has been investigated for use with SP-100 reactors for space power systems. The CBC power conversion technology is being developed by Rockwell International under the Dynamic Isotype Power System (DIPS) and Space Station Freedom solar dynamic power system programs to provide highly efficient power conversion with radioisotype and solar collector heat sources. Characteristics including mass, radiator area, thermal power, and operating temperatures for systems utilizing SP-100 reactor and CBC power conversion technology were determined for systems in the 10-to 100-kWe power range. Possible SP-100 reactor/CBC power system configurations are presented. Advantages of CBC power conversion technology with regard to reactor thermal power, operating temperature, and development status are discussed

  1. Modifications of Sp(2) covariant superfield quantization

    Energy Technology Data Exchange (ETDEWEB)

    Gitman, D.M.; Moshin, P.Yu

    2003-12-04

    We propose a modification of the Sp(2) covariant superfield quantization to realize a superalgebra of generating operators isomorphic to the massless limit of the corresponding superalgebra of the osp(1,2) covariant formalism. The modified scheme ensures the compatibility of the superalgebra of generating operators with extended BRST symmetry without imposing restrictions eliminating superfield components from the quantum action. The formalism coincides with the Sp(2) covariant superfield scheme and with the massless limit of the osp(1,2) covariant quantization in particular cases of gauge-fixing and solutions of the quantum master equations.

  2. SP-100 converter multicouple thermoelectric cell

    International Nuclear Information System (INIS)

    Kull, R.A.; Terrill, W.R.

    1990-01-01

    The General Electric Company is under contract to DOE to design, fabricate, and test an SP-100 Ground Engineering System. This paper provides a description of the SP-100 space reactor power system configuration, and a more detailed description of the power conversion subsystem (PCSS) and the key building block of the power converter, the thermoelectric cell. The functions of the various elements of the PCSS and the cells are also presented. These cells convert the thermal energy from the reactor into electrical power at the desired voltage while being conductively coupled to the hot and cold side heat exchangers to maximize the power output and system specific power

  3. Fatty acid composition of Spirulina sp., Chlorella sp. and Chaetoceros sp. microalgae and introduction as potential new sources to extinct omega 3 and omega 6

    Directory of Open Access Journals (Sweden)

    Homan Gorjzdadeh

    2016-05-01

    Full Text Available Background: This study was carried out to determine the oil fatty acids from two special species of microalgae; Spirulina sp.,Chlorella sp. and also Chaetoceros sp. collected from Bahmanshir River. Materials and Methods: Sampling of microalgae Chaetoceros sp. from Bahmanshir River was under taken using bottle samplers during spring season of 2013. Microalgae Spirulina sp. and Chlorella sp. were supplied from Shrimp Research Institute of Iran in Bushehr Province. Samples then were cultured under controlled laboratory conditions and mass culture for 100 liters was undertaken. Isolation of microalgae species from water of cultured media was carried out using filtration and centrifugation methods. The fatty acid compositions were determined by Gas – FID chromatography. Results: Results showed that regarding Saturated Fatty Acids (SFA obtained from purified culture of Chaetoceros sp., Spirulina sp. and Chlorella sp. the maximum amount of total fatty acids were belonged to palmitic acids (C16:0 with 15.21%, 30.1% and 25.17% of total fatty acids  respectively. Analysis of Mono Unsaturated Fatty Acids (MUFA showed that in the Oleic acid was maximum amount of 34% in Spirulina sp. In addition the amount of MUFA in Chlorella sp. was 16.37% of total fatty acids. On the other hand the amount of palmeotic acid in purified culture of Chaetoceros sp. was 30.33% from total content of fatty acids. Analysis of Poly Unsaturated Fatty Acids (PUFA, Linoleic acid (C18:2 (Omega 6, revealed maximum percentage in Spirulina sp. with 18.8%. Results of Alpha linoleic acid (C18:3 (Omega3 analysis showed maximum amount of 9.66% in Chlorella sp. compared to other microalgae with lower omega 3 contents. Spirulina sp. contained maximum amount of Linoleic acid (C18:2 with 18.8% of total fatty acids. Therefore, Spirulina sp. can be considered as a rich source of omega 6 for the purpose of fatty acid extractions. The presence of PUFA in Chlorella sp. and Spirulina sp. was

  4. Halobacterium sp. SP1(1) as a starter culture for accelerating fish sauce fermentation.

    Science.gov (United States)

    Akolkar, A V; Durai, D; Desai, A J

    2010-07-01

    Application of Halobacterium sp. SP1(1) for the acceleration of fish sauce fermentation. Traditional fish sauce fermentation was mimicked using Halobacterium sp. SP1(1) as starter culture. Protease activity, peptide release and α-amino content (parameters used to monitor the progress of the fermentation) were high at day 10 in tests and day 20 in un-inoculated controls. The total protein and nitrogen contents were also high in tests compared with controls. The amino acid profile observed at the end of fermentation in experimental samples, when compared with the commercial sauce preparation, was found to be better with respect to flavour and aroma contributing amino acids as well as essential amino acid lysine. Microflora analysis of the final fish sauce revealed the absence of any nonhalophilic or halotolerant micro-organisms. The protease-producing halophilic isolates obtained from the fish sauce of eviscerated and uneviscerated controls were identified as Halobacterium sp. F1 and F2, respectively, by 16S rDNA sequence analysis. Exogenous augmentation of Halobacterium sp. SP1(1) accelerated the fish sauce fermentation process with an additive effect on the existing natural microflora present in the fish during fermentation. Halobacterium sp SP1(1), therefore, can be used as an important starter culture for accelerating the fish fermentation process, which is attributed to its extracellular protease. The present study is the first report on use of Halobacterium species as a starter culture for accelerating fish sauce fermentation. Use of halobacterial starter cultures may revolutionize the process in fish sauce industries by reducing the fermentation time and making the process more economical with improved nutritive value of product. Journal compilation © 2009 The Society for Applied Microbiology. No claim to Indian Government works.

  5. 76 FR 56876 - Proposed Collection; Comment Request for Forms 9779, 9779(SP), 9783, 9783(SP), 9787, 9787(SP...

    Science.gov (United States)

    2011-09-14

    ... and 9789(SP), Electronic Federal Tax Payment System (EFTPS). DATES: Written comments should be received on or before November 14, 2011 to be assured of consideration. ADDRESSES: Direct all [email protected] . SUPPLEMENTARY INFORMATION: Title: Electronic Federal Tax Payment System (EFTPS). OMB...

  6. SP-A binding sites on bovine alveolar macrophages.

    Science.gov (United States)

    Plaga, S; Plattner, H; Schlepper-Schaefer, J

    1998-11-25

    Surfactant protein A (SP-A) binding to bovine alveolar macrophages was examined in order to characterize SP-A binding proteins on the cell surface and to isolate putative receptors from these cells that could be obtained in large amounts. Human SP-A, unlabeled or labeled with gold particles, was bound to freshly isolated macrophages and analyzed with ELISA or the transmission electron microscope. Binding of SP-A was inhibited by Ca2+ chelation, by an excess of unlabeled SP-A, or by the presence of 20 mg/ml mannan. We conclude that bovine alveolar macrophages expose binding sites for SP-A that are specific and that depend on Ca2+ and on mannose residues. For isolation of SP-A receptors with homologous SP-A as ligand we isolated SP-A from bovine lung lavage. SDS-PAGE analysis of the purified SP-A showed a protein of 32-36 kDa. Functional integrity of the protein was demonstrated. Bovine SP-A bound to Dynabeads was used to isolate SP-A binding proteins. From the fractionated and blotted proteins of the receptor preparation two proteins bound SP-A in a Ca2+-dependent manner, a 40-kDa protein showing mannose dependency and a 210-kDa protein, showing no mannose sensitivity. Copyright 1998 Academic Press.

  7. Ovos de Toxocara sp. e larvas de Ancylostoma sp. em praça pública de Lavras, MG Toxocara sp. eggs and Ancylostoma sp. larva in public parks, Brazil

    Directory of Open Access Journals (Sweden)

    Antônio Marcos Guimarães

    2005-04-01

    Full Text Available Larva migrans visceral e cutânea são zoonoses parasitárias causadas pela infecção da larva de Toxocara sp. e Ancylostoma sp., respectivamente. O objetivo do estudo foi verificar a contaminação por ovos de Toxocara sp. e ovos e larvas de Ancylostoma sp. em amostras de solos coletadas de praças públicas e de áreas de recreação infantil de Lavras, Estado de Minas Gerais, por meio da técnica de centrífugo-flutuação e do método de Baermann. A ocorrência de ovos de Toxocara sp. e, ovos e larvas de Ancylostoma sp. foi observada em 69,6% (16/23 das amostras de solo coletadas de praças públicas. A contaminação somente por ovos de Ancylostoma sp. em amostras de solo coletadas em escolas/creches foi de 22,2% (4/18. A percentagem de amostras de areia coletadas de escolas/creches contaminadas somente com larvas de Ancylostoma sp. foi de 11,1% (2/18. Praças públicas são as áreas com maior risco potencial de infecção por Toxocara sp. e Ancylostoma sp. Exame coproparasitológico realizado em 174 amostras de fezes de cães observou 58% e 23%, respectivamente, com ovos de Ancylostoma sp. e Toxocara sp.Visceral and cutaneous larva migrans are parasitic zoonoses caused by the infection of larval nematodes Toxocara sp. and Ancylostoma sp. respectively. The objective of this study was to investigate the contamination by Toxocara sp. eggs and Ancylostoma sp. eggs and larva of soil samples collected from public parks and children's playground areas in state of Minas Gerais, Brazil, using both Baermann's method and centrifugal flotation technique. Toxocara sp. and Ancylostoma sp. eggs were observed in soil samples collected from public squares in 17.4% (4/23 and 69.6 (16/23 respectively. In schools and child day care settings the contamination by Ancylostoma sp. larva in sand samples was 11.1% (2/18. Public parks are settings of more potential risk of Toxocara sp. eggs and Ancylostoma sp. infection. Stool parasitology testing of 174 stool

  8. Gilliamella intestini sp. nov., Gilliamella bombicola sp. nov., Gilliamella bombi sp. nov. and Gilliamella mensalis sp. nov.: Four novel Gilliamella species isolated from the bumblebee gut.

    Science.gov (United States)

    Praet, Jessy; Cnockaert, Margo; Meeus, Ivan; Smagghe, Guy; Vandamme, Peter

    2017-06-01

    Spectra of five isolates (LMG 28358 T , LMG 29879 T , LMG 29880 T , LMG 28359 T and R-53705) obtained from gut samples of wild bumblebees of Bombus pascuorum, Bombus lapidarius and Bombus terrestris were grouped into four MALDI-TOF MS clusters. RAPD analysis revealed an identical DNA fingerprint for LMG 28359 T and R-53705 which also grouped in the same MALDI-TOF MS cluster, while different DNA fingerprints were obtained for the other isolates. Comparative 16S rRNA gene sequence analysis of the four different strains identified Gilliamella apicola NCIMB 14804 T as nearest neighbour species. Average nucleotide identity values of draft genome sequences of the four isolates and of G. apicola NCIMB 14804 T were below the 96% threshold value for species delineation and all four strains and G. apicola NCIMB 14804 T were phenotypically distinct. Together, the draft genome sequences and phylogenetic and phenotypic data indicate that the four strains represent four novel Gilliamella species for which we propose the names Gilliamella intestini sp. nov., with LMG 28358 T as the type strain, Gilliamella bombicola sp. nov., with LMG 28359 T as the type strain, Gilliamella bombi sp. nov., with LMG 29879 T as the type strain and Gilliamella mensalis sp. nov., with LMG 29880 T as the type strain. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Biosorption of uranium by Azolla, SP, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, Ludmila C.; Alves, Eliakim G.; Marumo, Julio T., E-mail: lcvieira@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Ferreira, Rafael V. de P., E-mail: rafael@itatijuca.com [Itatijuca Biotech, Sao Paulo, SP (Brazil); Canevesi, Rafael L.S.; Silva, Edson A., E-mail: edson.silva2@unioeste.br [Universidade Estadual do Oeste Parana (UNIOESTE), Toledo, PR (Brazil)

    2015-07-01

    Radioactive liquid waste needs special attention and requires suitable treatment before deposition. Among the potential technologies under development for the treatment of liquid radioactive wastes the biosorption has been highlighted by being an efficient and low cost technique. Biosorption process involves the exchange of ions contained in the biomass matrix by others present in solution. There are many biomasses that could be applied in treatment of radioactive wastes, for example, agricultural residues and macrophyte. The aim of this study is evaluate the ability of the Azolla sp., a floating aquatic plant, to absorb uranium in solution. Azolla sp. is a macrophyte that has been used to treat effluents containing heavy metals. The biosorption capacity of uranium by Azolla sp. was experimentally determined and modeled by isotherms. Experiments were performed to determine metal uptake, and then the solutions were analyzed by inductively coupled plasma optical emission spectrometry (ICP-OES). The isotherms applied to model the data was Langmuir, Freundlich, Sips Toth, Redlich Peternson, Two-Site-Langmuir, Radke Prausnitz to develop a technique for the treatment of radioactive liquid waste generated at the Nuclear and Energy Research Institute (IPEN-CNEN/SP), Brazil. (author)

  10. Biosorption of uranium by Azolla, SP, Brazil

    International Nuclear Information System (INIS)

    Vieira, Ludmila C.; Alves, Eliakim G.; Marumo, Julio T.; Ferreira, Rafael V. de P.; Canevesi, Rafael L.S.; Silva, Edson A.

    2015-01-01

    Radioactive liquid waste needs special attention and requires suitable treatment before deposition. Among the potential technologies under development for the treatment of liquid radioactive wastes the biosorption has been highlighted by being an efficient and low cost technique. Biosorption process involves the exchange of ions contained in the biomass matrix by others present in solution. There are many biomasses that could be applied in treatment of radioactive wastes, for example, agricultural residues and macrophyte. The aim of this study is evaluate the ability of the Azolla sp., a floating aquatic plant, to absorb uranium in solution. Azolla sp. is a macrophyte that has been used to treat effluents containing heavy metals. The biosorption capacity of uranium by Azolla sp. was experimentally determined and modeled by isotherms. Experiments were performed to determine metal uptake, and then the solutions were analyzed by inductively coupled plasma optical emission spectrometry (ICP-OES). The isotherms applied to model the data was Langmuir, Freundlich, Sips Toth, Redlich Peternson, Two-Site-Langmuir, Radke Prausnitz to develop a technique for the treatment of radioactive liquid waste generated at the Nuclear and Energy Research Institute (IPEN-CNEN/SP), Brazil. (author)

  11. Carbon sp chains in graphene nanoholes

    DEFF Research Database (Denmark)

    Castelli, Ivano Eligio; Ferri, Nicola; Onida, Giovanni

    2012-01-01

    Nowadays sp carbon chains terminated by graphene or graphitic-like carbon are synthesized routinely in several nanotech labs. We propose an ab initio study of such carbon-only materials, by computing their structure and stability, as well as their electronic, vibrational and magnetic properties. ...

  12. Rhodotorula bloemfonteinensis sp. nov., Rhodotorula eucalyptica sp. nov., Rhodotorula orientis sp. nov. and Rhodotorula pini sp. nov., yeasts isolated from monoterpene-rich environments.

    Science.gov (United States)

    Pohl, Carolina H; Smit, Martha S; Albertyn, Jacobus

    2011-09-01

    Recent rDNA sequencing of 25 isolates from a previous study, during which limonene-utilizing yeasts were isolated from monoterpene-rich environments by using 1,4-disubstituted cyclohexanes as sole carbon sources, led to the identification of four hitherto unknown Rhodotorula species. Analyses of the 26S rDNA D1/D2 region as well as the internal transcribed spacer (ITS) domain indicated that two isolates (CBS 8499(T) and CBS 10736) were identical and were closely related to Rhodotorula cycloclastica, a previously described limonene-utilizing yeast. These novel isolates differed from known yeast species and could be distinguished from R. cycloclastica by standard physiological tests. The other three isolates represent three novel Rhodotorula species, closely related to Sporobolomyces magnisporus. These three species could also be distinguished from other Rhodotorula species by standard physiological tests. Based on these results, we suggest that the new isolates represent novel species, for which the names Rhodotorula eucalyptica sp. nov. (type strain CBS 8499(T)  = NRRL Y-48408(T)), Rhodotorula pini sp. nov. (type strain CBS 10735(T)  = NRRL Y-48410(T)), Rhodotorula bloemfonteinensis sp. nov. (type strain CBS 8598(T)  = NRRL Y-48407(T)) and Rhodotorula orientis sp. nov. (type strain CBS 8594(T)  = NRRL Y-48719(T)) are proposed. R. eucalyptica and R. pini can also utilize limonene.

  13. Test af spørgeskema

    DEFF Research Database (Denmark)

    Hermansen, Jonathan

    2017-01-01

    Denne bog gennemgår alle surveyarbejdets faser og giver en praktisk indføring i •design af undersøgelsen og udvælgelse af stikprøver, •formulering af spørgeskemaer samt indsamling og kodning af data, •metoder til at analysere resultaterne....

  14. Lipid contents of the sponge Haliclona sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Parameswaran, P.S.; Das, B.; Kamat, S.Y.

    Several fatty acids, sterols, batyl alcohol and its analogs and an N-acylated sphingosine (ceramide) have been isolated from the lipid fraction of the extract of the sponge Haliclona sp. The major sterol is found to be cholesterol (54%), followed...

  15. Optisk scanning af spørgeskemaer

    DEFF Research Database (Denmark)

    Paulsen, Aksel

    / 1000 felter= 0.370 (95% CI: 0.160-0.729), (p= 0.020)). Der var ingen statistisk forskel mellem optisk scanning (fejl/ 1000 felter= 0.046 (95% CI: 0.001-0.258)) og manuel dobbelt indtastning (p=1.000). Konklusioner: Optisk scanning er et godt alternativ til manuel dobbelt indtastning for spørgeskema med......Formål og baggrund: Patient rapporterede outcomes i form af spørgeskemaer bruges i øgende grad i sundhedssektoren både i klinisk praksis og forskning. Ofte bruges spørgeskemaer i papirformat. Manuel dobbelt indtastning er defineret som guld standard for overføring af data til et elektronisk format......, men processen er tidkrævende. Optisk scanning af spørgeskemaer med automatisk registrering af svar kan være et alternativ, men videre validering af metoden er nødvendig. Design: 200 patienter blev tilfældigt udvalgt fra en kohorte på 5777 patienter der tidligere havde svaret på to forskellige...

  16. Aerococcus sp. with an antimycobacterial effect

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... In this study, we reported data on a strain that was isolated from different areas of Fez. (Morocco), which ... sp. The antibacterial activity of the genus Aerococcus have .... able to amplify the 16S rRNA gene from eubacteria.

  17. Botrallin from the endophytic fungus Hyalodendriella sp ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... Bioassay-guided fractionation of the crude methanol extract of the mycelia from the endophytic fungus. Hyalodendriella sp. Ponipodef12, associated with the hybrid 'Neva' of Populus deltoides Marsh × P. nigra L., led to the isolation of one compound coded as P12-1 which was identified as botrallin (1,7-.

  18. The astaxanthin dideoxyglycoside biosynthesis pathway in Sphingomonas sp. PB304

    DEFF Research Database (Denmark)

    Kim, Se Hyeuk; Kim, Jin Ho; Lee, Bun Yeol

    2014-01-01

    A major carotenoid in Sphingomonas sp. PB304, originally isolated from a river in Daejon City, South Korea, was identified as astaxanthin dideoxyglycoside. Gene clusters encoding the astaxanthin dideoxyglycoside biosynthetic enzymes were identified by screening Sphingomonas sp. PB304 fosmid...

  19. SP-100 initial startup and restart control strategy

    Science.gov (United States)

    Halfen, Frank J.; Wong, Kwok K.; Switick, Dennis M.; Shukla, Jaikaran N.

    Startup control strategies for SP-100 are described. Revised control and operating strategies are discussed which have been developed and tested using the SP-100 dynamic simulation model Aries-GFS (Generic Flight System).

  20. Methylobacterium suomiense sp. nov. and Methylobacterium lusitanum sp. nov., aerobic, pink-pigmented, facultatively methylotrophic bacteria.

    Science.gov (United States)

    Doronina, Nina V; Trotsenko, Yuri A; Kuznetsov, Boris B; Tourova, Tatjana P; Salkinoja-Salonen, Mirja S

    2002-05-01

    Two aerobic, pink-pigmented, facultatively methylotrophic bacteria, strains F20T and RXM(T), are described taxonomically. On the basis of their phenotypic and genotypic properties, the isolates are proposed as novel species of the genus Methylobacterium, Methylobacterium suomiense sp. nov. (type strain F20T = VKM B-2238T = NCIMB 13778T) and Methylobacterium lusitanum sp. nov. (type strain RXMT = VKM B-2239T = NCIMB 13779T).

  1. Analisis Fosfor pada Cacing Tanah (Megascolex sp. dan Fridericia sp.) Secara Spektrofotometri Sinar Tampak

    OpenAIRE

    Safira, Cut Shafa

    2015-01-01

    Earthworm is natural resource which can be used for medication due to its highly amount of minerals. One of these minerals is phosphorus. The aim of this research are to identify, determine and know the difference content of phosphorus in Megascolex sp. and Fridericia sp. Qualitative analysis shows positive results with addition of ammonium molybdate 4% and BaCl2 5%. Quantitative analysis was done using visible spectrophotometer with ascorbic acid method, measuring blu-colored molybdenum ...

  2. Nanocrystalline sp{sup 2} and sp{sup 3} carbons: CVD synthesis and applications

    Energy Technology Data Exchange (ETDEWEB)

    Terranova, M. L. [Università degli Studi di Roma “Tor Vergata,” via Della Ricerca Scientifica, Dipartimento di Scienze e Tecnologie Chimiche—MinimaLab (Italy); Rossi, M. [Università degli Studi di Roma “Sapienza,” via A. Scarpa, Dipartimento di Scienze di Base e Applicate per l’Ingegneria and Centro di Ricerca per le Nanotecnologie Applicate all’Ingegneria (CNIS) (Italy); Tamburri, E., E-mail: emanuela.tamburri@uniroma2.it [Università degli Studi di Roma “Tor Vergata,” via Della Ricerca Scientifica, Dipartimento di Scienze e Tecnologie Chimiche—MinimaLab (Italy)

    2016-11-15

    The design and production of innovative materials based on nanocrystalline sp{sup 2}- and sp{sup 3}-coordinated carbons is presently a focus of the scientific community. We present a review of the nanostructures obtained in our labs using a series of synthetic routes, which make use of chemical vapor deposition (CVD) techniques for the selective production of non-planar graphitic nanostructures, nanocrystalline diamonds, and hybrid two-phase nanostructures.

  3. Differences in nutrient uptake capacity of the benthic filamentous algae Cladophora sp., Klebsormidium sp. and Pseudanabaena sp. under varying N/P conditions.

    Science.gov (United States)

    Liu, Junzhuo; Vyverman, Wim

    2015-03-01

    The N/P ratio of wastewater can vary greatly and directly affect algal growth and nutrient removal process. Three benthic filamentous algae species Cladophora sp., Klebsormidium sp. and Pseudanabaena sp. were isolated from a periphyton bioreactor and cultured under laboratory conditions on varying N/P ratios to determine their ability to remove nitrate and phosphorus. The N/P ratio significantly influenced the algal growth and phosphorus uptake process. Appropriate N/P ratios for nitrogen and phosphorus removal were 5-15, 7-10 and 7-20 for Cladophora sp., Klebsormidium sp. and Pseudanabaena sp., respectively. Within these respective ranges, Cladophora sp. had the highest biomass production, while Pseudanabaena sp. had the highest nitrogen and phosphorus contents. This study indicated that Cladophora sp. had a high capacity of removing phosphorus from wastewaters of low N/P ratio, and Pseudanabaena sp. was highly suitable for removing nitrogen from wastewaters with high N/P ratio. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Anomalous self potential (sp) log signatures observed in a water ...

    African Journals Online (AJOL)

    Geophysical logging was done after drilling had been completed in a water well at Okwudor, South Eastern Nigeria. Three electric logs were run viz: Self Potential (SP), Resistivity N16″ and N64″ logs. An anomaly was observed in the SP log. The SP results from this well show some deviation from the standard norm.

  5. Biosorption of chromium by mangrove-derived Aplanochytrium sp ...

    African Journals Online (AJOL)

    The microbial dried biomass of Thraustochytrids is used as bioadsorbent for the removal of the chromium in aqueous solution. In this investigation, three species of Thraustochydrids namely Aplanochytrium sp., Thraustochytrium sp. and Schizochytrium sp. were tested for the efficiency of chromium accumulation by culturing ...

  6. Babesia peircei sp. nov. from the jackass penguin

    African Journals Online (AJOL)

    1992-01-09

    Jan 9, 1992 ... An avian piroplasm, Babesia peircei sp. nov. is described from the jackass penguin Spheniscus demersus. Morphological differences between Babesia peircei sp. nov. and the other valid Babesia spp. are discussed together with the possible vectors. 'n Voal-piroplasma, Babesia peircei sp. nov. afkomstig ...

  7. Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.

    Science.gov (United States)

    Kiliç, Nur Koçberber; Dönmez, Gönül

    2008-06-15

    Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

  8. Remote sensing data of SP Mountain and SP Lava flow in North-Central Arizona

    Science.gov (United States)

    Schaber, G.G.; Elachi, C.; Farr, T.G.

    1980-01-01

    Multifrequency airborne radar image data of SP Mountain [Official name of feature (U.S. Geological Survey, 1970)] and SP flow (and vicinity) in north-central Arizona were obtained in diverse viewing directions and direct and cross-polarization, then compared with surface and aerial photography, LANDSAT multispectral scanner data, airborne thermal infrared imagery, surface geology, and surface roughness statistics. The extremely blocky, basaltic andesite of SP flow is significantly brighter on direct-polarization K-band (0.9-cm wavelength) images than on cross-polarized images taken simultaneously. Conversely, for the longer wavelength (25 cm) L-band radar images, the cross-polarization image returns from SP flow are brighter than the direct-polarized image. This effect is explained by multiple scattering and the strong wavelength dependence of polarization effects caused by the rectilinear basaltic andesite scatters. Two distinct types of surface relief on SP flow, one extremely blocky, the other subdued, are found to be clearly discriminated on the visible and thermal wavelength images but are separable only on the longer wavelength L-band radar image data. The inability of the K- and X- (3-cm wavelength) band radars to portray the differences in roughness between the two SP flow surface units is attributed to the radar frequency dependence of the surface-relief scale, which, described as the Rayleigh criterion, represents the transition between quasispecular and primarily diffuse backscatter. ?? 1980.

  9. Two new species of suctorians, Acineta satyanandani sp. nov. and Paracineta karunakarani sp. nov. epizoic on ostracods

    Digital Repository Service at National Institute of Oceanography (India)

    Santhakumari, V.

    Two, species of protozoic suctorians, Acineta satyanandani sp. nov. and Paracineta karunakarani sp. nov., are described. These were found attached on the body of the marine ostracod, Cypridina dentata (Muller), collected from the shelf and slope...

  10. Microbiologically influenced corrosion of galvanized steel by Desulfovibrio sp. and Desulfosporosinus sp. in the presence of Ag–Cu ions

    Energy Technology Data Exchange (ETDEWEB)

    Ilhan-Sungur, Esra, E-mail: esungur@istanbul.edu.tr [Istanbul University, Faculty of Science, Department of Biology, 34134 Vezneciler, Istanbul (Turkey); Unsal-Istek, Tuba [Istanbul University, Faculty of Science, Department of Biology, 34134 Vezneciler, Istanbul (Turkey); Cansever, Nurhan [Yıldız Technical University, Faculty of Chemistry-Metallurgy, Metallurgical and Materials Engineering Department, 34210 Esenler, Istanbul (Turkey)

    2015-07-15

    The effects of Ag–Cu ions on the microbiologically induced corrosion of galvanized steel in the presence of Desulfovibrio sp. and Desulfosporosinus sp. were investigated. The corrosion behavior of galvanized steel was analyzed by potentiodynamic polarization and electrochemical impedance spectroscopy. The biofilm, corrosion products and Ag–Cu ions on the surfaces were investigated by using scanning electron microscopy, energy dispersive X-ray spectrometry and elemental mapping. The biofilm layer formed by the Desulfovibrio sp. was stable covering the all surface of galvanized steel coupons, while that by Desulfosporosinus sp. was intermittent, highly porous and heterogeneous. It was found that both of the sulfate reducing bacteria species accelerated corrosion of the galvanized steel. However, it was detected that Desulfosporosinus sp. was more corrosive for galvanized steel than Desulfovibrio sp. Scanning electron microscopy images showed that Desulfovibrio sp. and Desulfosporosinus sp. in biofilm clustered into patches on the galvanized steel surface when the culture contained toxic Ag–Cu ions. The ions affected the growth of the sulfate reducing bacteria strains in different ways and hence the corrosion behaviors. It was observed that the Ag–Cu ions affected negatively growth of Desulfosporosinus sp. especially after 24 h of exposure leading to a decrease in the corrosion rate of galvanized steel. However, Desulfovibrio sp. showed more corrosive effect in the presence of the ions according to the ions-free culture. Energy dispersive X-ray spectrometry analysis showed that corrosion products on the surfaces were mainly composed of Zn, S, Na, O and P. - Highlights: • Galvanized steel was corroded by Desulfosporosinus sp. and Desulfovibrio sp. • Desulfosporosinus sp. is more corrosive than Desulfovibrio sp. • The Ag–Cu ions affected corrosion behavior of Desulfosporosinus sp. and Desulfovibrio sp. on galvanized steel.

  11. In vitro cytotoxicity evaluation of nano-carbon particles with different sp{sup 2}/sp{sup 3} ratios

    Energy Technology Data Exchange (ETDEWEB)

    Li, S.S.; Wu, B.J.; Deng, Q.Y. [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China); Guo, Y.B. [The Third People' s Hospital of Chengdu, Sichuan 610031 (China); Leng, Y.X., E-mail: yxleng@263.net [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China); Huang, N. [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China)

    2017-06-01

    Graphitization occurs during the long-term service of a diamond-like carbon (DLC) modified artificial joint. Then, DLC wear debris, which are carbon particles with different sp{sup 2}/sp{sup 3} ratios and sizes ranging from the nano- to micro-meter scale produced. In this paper, to promote the application of DLC coating for artificial joint modification, the cytotoxicity of DLC debris (nano-carbon particles, NCs) with different sp{sup 2}/sp{sup 3} ratios was studied. The microstructure and physical characteristics of NCs with different sp{sup 2}/sp{sup 3} ratios were investigated by Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), Transmission Electron Microscope (TEM) and Dynamic Light Scattering (DLS). Meanwhile, osteoblasts and macrophages were applied to characterize the cytotoxicity of the NCs. In vitro cytotoxicity assay results indicated that cells incubated with NCs of different sp{sup 2}/sp{sup 3} ratios had greater osteogenic capacity, and these particles caused a weaker immune response in comparison with CoCrMo particles. Taken together, the results indicated that NCs with different sp{sup 2}/sp{sup 3} ratios presented a good cytocompatibility than CoCrMo particles. But no significant differences were observed among NCs with different sp{sup 2}/sp{sup 3} ratios. The better cytocompatibility of NCs is mainly attributable to their surface charge. - Highlights: • NCs with different sp{sup 2}/sp{sup 3} ratios have been successfully prepared by annealing treatment. • NCs with different sp{sup 2}/sp{sup 3} ratios show good osteogenic capacity and lower immune response. • The good cytocompatibility of NCs is mainly dependent on its surface charge.

  12. Microbiologically influenced corrosion of galvanized steel by Desulfovibrio sp. and Desulfosporosinus sp. in the presence of Ag–Cu ions

    International Nuclear Information System (INIS)

    Ilhan-Sungur, Esra; Unsal-Istek, Tuba; Cansever, Nurhan

    2015-01-01

    The effects of Ag–Cu ions on the microbiologically induced corrosion of galvanized steel in the presence of Desulfovibrio sp. and Desulfosporosinus sp. were investigated. The corrosion behavior of galvanized steel was analyzed by potentiodynamic polarization and electrochemical impedance spectroscopy. The biofilm, corrosion products and Ag–Cu ions on the surfaces were investigated by using scanning electron microscopy, energy dispersive X-ray spectrometry and elemental mapping. The biofilm layer formed by the Desulfovibrio sp. was stable covering the all surface of galvanized steel coupons, while that by Desulfosporosinus sp. was intermittent, highly porous and heterogeneous. It was found that both of the sulfate reducing bacteria species accelerated corrosion of the galvanized steel. However, it was detected that Desulfosporosinus sp. was more corrosive for galvanized steel than Desulfovibrio sp. Scanning electron microscopy images showed that Desulfovibrio sp. and Desulfosporosinus sp. in biofilm clustered into patches on the galvanized steel surface when the culture contained toxic Ag–Cu ions. The ions affected the growth of the sulfate reducing bacteria strains in different ways and hence the corrosion behaviors. It was observed that the Ag–Cu ions affected negatively growth of Desulfosporosinus sp. especially after 24 h of exposure leading to a decrease in the corrosion rate of galvanized steel. However, Desulfovibrio sp. showed more corrosive effect in the presence of the ions according to the ions-free culture. Energy dispersive X-ray spectrometry analysis showed that corrosion products on the surfaces were mainly composed of Zn, S, Na, O and P. - Highlights: • Galvanized steel was corroded by Desulfosporosinus sp. and Desulfovibrio sp. • Desulfosporosinus sp. is more corrosive than Desulfovibrio sp. • The Ag–Cu ions affected corrosion behavior of Desulfosporosinus sp. and Desulfovibrio sp. on galvanized steel

  13. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    International Nuclear Information System (INIS)

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

    2010-01-01

    Research highlights: → Sp1 zinc fingers themselves interact with importin α. → Sp1 zinc finger domains play an essential role as a nuclear localization signal. → Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin α in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin α including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin α. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  14. Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

    2012-01-01

    Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

  15. A superhard sp3 microporous carbon with direct bandgap

    Science.gov (United States)

    Pan, Yilong; Xie, Chenlong; Xiong, Mei; Ma, Mengdong; Liu, Lingyu; Li, Zihe; Zhang, Shuangshuang; Gao, Guoying; Zhao, Zhisheng; Tian, Yongjun; Xu, Bo; He, Julong

    2017-12-01

    Carbon allotropes with distinct sp, sp2, and sp3 hybridization possess various different properties. Here, a novel all-sp3 hybridized tetragonal carbon, namely the P carbon, was predicted by the evolutionary particle swarm structural search. It demonstrated a low density among all-sp3 carbons, due to the corresponding distinctive microporous structure. P carbon is thermodynamically stable than the known C60 and could be formed through the single-walled carbon nanotubes (SWCNTs) compression. P carbon is a direct bandgap semiconductor displaying a strong and superhard nature. The unique combination of electrical and mechanical properties constitutes P carbon a potential superhard material for semiconductor industrial fields.

  16. Sp6 and Sp8 Transcription Factors Control AER Formation and Dorsal-Ventral Patterning in Limb Development

    Science.gov (United States)

    Haro, Endika; Delgado, Irene; Junco, Marisa; Yamada, Yoshihiko; Mansouri, Ahmed; Oberg, Kerby C.; Ros, Marian A.

    2014-01-01

    The formation and maintenance of the apical ectodermal ridge (AER) is critical for the outgrowth and patterning of the vertebrate limb. The induction of the AER is a complex process that relies on integrated interactions among the Fgf, Wnt, and Bmp signaling pathways that operate within the ectoderm and between the ectoderm and the mesoderm of the early limb bud. The transcription factors Sp6 and Sp8 are expressed in the limb ectoderm and AER during limb development. Sp6 mutant mice display a mild syndactyly phenotype while Sp8 mutants exhibit severe limb truncations. Both mutants show defects in AER maturation and in dorsal-ventral patterning. To gain further insights into the role Sp6 and Sp8 play in limb development, we have produced mice lacking both Sp6 and Sp8 activity in the limb ectoderm. Remarkably, the elimination or significant reduction in Sp6;Sp8 gene dosage leads to tetra-amelia; initial budding occurs, but neither Fgf8 nor En1 are activated. Mutants bearing a single functional allele of Sp8 (Sp6−/−;Sp8+/−) exhibit a split-hand/foot malformation phenotype with double dorsal digit tips probably due to an irregular and immature AER that is not maintained in the center of the bud and on the abnormal expansion of Wnt7a expression to the ventral ectoderm. Our data are compatible with Sp6 and Sp8 working together and in a dose-dependent manner as indispensable mediators of Wnt/βcatenin and Bmp signaling in the limb ectoderm. We suggest that the function of these factors links proximal-distal and dorsal-ventral patterning. PMID:25166858

  17. Analysis list: SP2 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available SP2 Blood,Liver,Pluripotent stem cell + hg19 http://dbarchive.biosciencedbc.jp/kyus...hu-u/hg19/target/SP2.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/SP2.5.tsv http://dbarchive....biosciencedbc.jp/kyushu-u/hg19/target/SP2.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/SP2.Blood.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/SP2.Liver.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/SP2.Pluripotent_stem_cell.tsv http://dbarchive.biosciencedbc

  18. Biodegradation of resorcinol byPseudomonas sp.

    Institute of Scientific and Technical Information of China (English)

    Nader Hajizadeh; Najibeh Shirzad; Ali Farzi; Mojtaba Salouti; Azra Momeni

    2016-01-01

    ABSTRACT Objective:To investigate the ability ofPseudomonas sp. isolated from East Azarbaijan, Iran in bioremediation of resorcinol. Methods: Resorcinol biodegradation was evaluated using spectrophotometry and confirmed by gas chromatography-mass spectroscopy. Results:This isolate was able to remove up to 37.12% of resorcinol from contaminated water. Reusability experiments had confirmed the biodegradation process which produced seven intermediate compounds. These intermediates were characterized by gas chromatography-mass spectroscopy technique. The products of resorcinol biodegradation were apparently 1, 4-cyclohexadiene, nonadecene, 2-heptadecanone, 1-isopropyl-2-methoxy-4-methylbenzene, hexadecanoic acid, 9-octadecenoic acid, phenol and 5-methyl-2-(1-methylethyl). Conclusions: The findings revealed thatPseudomonas sp. is able to degrade resorcinol. Because of being an indigenous organism, this isolate is more compatible with the climate of the northwest region of Iran and possibly will be used for degradation of other similar aromatic compounds.

  19. SP-100 space reactor power system readiness

    International Nuclear Information System (INIS)

    Josloff, A.T.; Matteo, D.N.; Bailey, H.S.

    1992-01-01

    This paper discusses the SP-100 Space Reactor Power System which is being developed by GE, under contract to the U.S. Department of Energy, to provide electrical power in the range of 10's to 100's of kW. The system represents an enabling technology for a wide variety of earth orbital and interplanetary science missions, nuclear electric propulsion (NEP) stages, and lunar/Mars surface power for the Space Exploration Initiative (SEI). The technology and design is now at a state of readiness to support the definition of early flight demonstration missions. Of particular importance is that SP-100 meets the demanding U.S. safety performance, reliability and life requirements. The system is scalable and flexible and can be configured to provide 10's to 100's of kWe without repeating development work and can meet DoD goals for an early, low-power demonstration flight in the 1996-1997 time frame

  20. Superfield quantization in Sp(2) covariant formalism

    CERN Document Server

    Lavrov, P M

    2001-01-01

    The rules of the superfield Sp(2) covariant quantization of the arbitrary gauge theories for the case of the introduction of the gauging with the derivative equations for the gauge functional are generalized. The possibilities of realization of the expanded anti-brackets are considered and it is shown, that only one of the realizations is compatible with the transformations of the expanded BRST-symmetry in the form of super translations along the Grassmann superspace coordinates

  1. Spøgelsets egne ord

    DEFF Research Database (Denmark)

    Gemzøe, Anker

    2012-01-01

    refleksioner over den gengangerscene, der åbner Shakespeares Hamlet. Ifølge Derridas ’hantologie’ opererer spøgelser i en eksistentiel tidslighed, der har at gøre med sorg, sprog og forvandling. Genremæssigt, tilføjer Gemzøe, har gengangeren det med at husere i tragedien. Med Derridas ’hantologie’ som en af de...

  2. Carbon sp chains in graphene nanoholes

    International Nuclear Information System (INIS)

    Castelli, Ivano E; Ferri, Nicola; Onida, Giovanni; Manini, Nicola

    2012-01-01

    Nowadays sp carbon chains terminated by graphene or graphitic-like carbon are synthesized routinely in several nanotech labs. We propose an ab initio study of such carbon-only materials, by computing their structure and stability, as well as their electronic, vibrational and magnetic properties. We adopt a fair compromise of microscopic realism with a certain level of idealization in the model configurations, and predict a number of properties susceptible to comparison with experiment. (paper)

  3. Carbon sp chains in graphene nanoholes

    Science.gov (United States)

    Castelli, Ivano E.; Ferri, Nicola; Onida, Giovanni; Manini, Nicola

    2012-03-01

    Nowadays sp carbon chains terminated by graphene or graphitic-like carbon are synthesized routinely in several nanotech labs. We propose an ab initio study of such carbon-only materials, by computing their structure and stability, as well as their electronic, vibrational and magnetic properties. We adopt a fair compromise of microscopic realism with a certain level of idealization in the model configurations, and predict a number of properties susceptible to comparison with experiment.

  4. Commercial technologies from the SP-100 program

    International Nuclear Information System (INIS)

    Truscello, V.C.; Fujita, T.; Mondt, J.F.

    1995-01-01

    For more than a decade, Jet Propulsion Labortory and Los Alamos have managed a multi-agency funded effort to develop a space reactor power system. This SP-100 Program has developed technologies required for space power systems that can be implemented in the industrial and commercial sectors to improve competitiveness in the global economy. Initial steps taken to transfer this technology from the laboratories to industrial and commercial entities within United States include: (1) identifying specific technologies having commercial potential; (2) distributing information describing the identified technologies and interacting with interested commercial and industrial entities to develop application-specific details and requirements; and (3) providing a technological data base that leads to transfer of technology or the forming of teaming arrangements to accomplish the transfer by tailoring the technology to meet application-specific requirements. SP-100 technologies having commercial potential encompass fabrication processes, devices, and components. Examples: a process for bonding refractory metals to graphite, a device to sense the position of an actuator and a component to enable rotating machines to operate without supplying lubrication (self-lubricating ball bearing). Shortly after the NASA Regional Technology Transfer Centers widely disseminated information covering SP-100 technologies, over one hundred expressions of interest were received, which indicate that there is a large potential benefit in transferring SP-100 technology. Interactions with industrial and commercial entities have identified a substantial need for creating teaming arrangements involving the interested entity and personnel from laboratories and their contractors, who have the knowledge and ability to tailor the technology to meet application-specific requirements. copyright 1995 American Institute of Physics

  5. Thermomucor abortosporangium sp. nov. (Fungi: Mucorales

    Directory of Open Access Journals (Sweden)

    A. Swathi Sri

    2012-03-01

    Full Text Available Thermomucor abortosporangium A. Swathi Sri & A. Subrahm., sp. nov. is described as the second species of Thermomucor. It differs from the type species of T. indicae-seudaticae in the branching pattern of sporangiophores, size and shape of sporangiospores and production of abortosporangia. Zygospores are reddish brown, globose, psilate, isogamic and formed at low (37°C temperature whilst the higher temperatures are prohibitive. The fungus grows well at 50°C on PDA, SMA and MEA.

  6. Optimization of cellulase production by Penicillium sp.

    Science.gov (United States)

    Prasanna, H N; Ramanjaneyulu, G; Rajasekhar Reddy, B

    2016-12-01

    The production of cellulolytic enzymes (β-exoglucanase, β-endoglucanase and β-glucosidase) by Penicillium sp. on three different media in liquid shake culture conditions was compared. The organism exhibited relatively highest activity of endoglucanase among three enzymes measured at 7-day interval during the course of its growth on Czapek-Dox medium supplemented with 0.5 % (w/v) cellulose. Cellulose at 0.5 %, lactose at 0.5 %, sawdust at 0.5 %, yeast extract at 0.2 % as a nitrogen source, pH 5.0 and 30 °C temperature were found to be optimal for growth and cellulase production by Penicillium sp. Yields of Fpase, CMCase and β-glucosidase, attained on optimized medium with Penicillium sp. were 8.7, 25 and 9.52 U/ml, respectively with increment of 9.2, 5.9 and 43.8-folds over titers of the respective enzyme on unoptimised medium. Cellulase of the fungal culture with the ratio of β-glucosidase to Fpase greater than one will hold potential for biotechnological applications.

  7. Biosorption of 241Am by Candida sp

    International Nuclear Information System (INIS)

    Luo Shunzhong; Zhang Taiming; Liu Ning; Yang Yuanyou; Jin Jiannan; Hua Xinfeng

    2003-01-01

    The biosorption of radionuclide 241 Am from solutions by Candida sp., and the influences of experimental conditions on the adsorption were studied. The results showed that the adsorption equilibrium was achieved within 4h and the optimum pH=2. No significant differences on 241 Am biosorption were observed at 10-45 degree C, or challenged with Au 3+ or Ag + , even 1500 times or 4500 times over 241 Am, respectively. The adsorption rate could reach 97.8% by dry Candida sp. of 0.82 g/L in 241 Am solutions (pH=2) of 5.6-111 MBq/L (44.04-873.0 μg/L) (C 0 ), with maximum adsorption capacity (W) of 63.5 MBq/g (501.8 μg/g), implying that the removal of 241 Am by Candida sp. from solutions was feasible. The relationship between activities (C 0 ) and adsorption capacities (W) of 241 Am indicated that the biosorption process could be described by Langmuir adsorption isotherm

  8. Biosorption of americium-241 by Candida sp

    International Nuclear Information System (INIS)

    Luo Shunzhong; Zhang Taiming; Liu Ning; Yang Yuanyou; Jin Jiannan; Liao Jiali

    2003-01-01

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high toxicity and long half-life. In this experiment, the biosorption of 241 Am from solution by Candida sp., and the effects of various experimental conditions on the adsorption were investigated. The preliminary results showed that the adsorption of 241 Am by Candida sp. was efficient. 241 Am could be removed by Candida sp. of 0.82 g/L (dry weight) from 241 Am solutions of 5.6-111 MBq/L (44.3-877.2 μg/L)(C 0 ), with maximum adsorption rate (R) of 98% and maximum adsorption capacities (W) of 63.5 MBq/g biomass (dry weight) (501.8 μg/g). The biosorption equilibrium was achieved within 4 hour and the optimum pH was pH = 2. No significant differences on 241 Am adsorption were observed at 10 C-45 C, or in solutions containing Au 3+ or Ag + , even 1500 times or 4500 times above the 241 Am concentration, respectively. The relationship between concentrations and adsorption capacities of 241 Am indicated the biosorption process should be described by a Langmuir adsorption isotherm. (orig.)

  9. Borrelia bissettiae sp. nov. and Borrelia californiensis sp. nov. prevail in diverse enzootic transmission cycles.

    Science.gov (United States)

    Margos, Gabriele; Lane, Robert S; Fedorova, Natalia; Koloczek, Johannes; Piesman, Joseph; Hojgaard, Andrias; Sing, Andreas; Fingerle, Volker

    2016-03-01

    Two species of the genus Borrelia , Borrelia bissettiae sp. nov. and Borrelia californiensis sp. nov., were first described by Postic and co-workers on the basis of genetic analyses of several loci. Multilocus sequence analysis of eight housekeeping loci confirmed that these two Borrelia genomospecies are distinct members of the Borrelia burgdorferi sensu lato complex. B. bissettiae sp. nov. was initially described in transmission cycles involving Neotoma fuscipes wood rats and Ixodes pacificus ticks in California, and Neotoma mexicana and Ixodes spinipalpis in Colorado. The preferred host of B. californiensis sp. nov. appears to be the California kangaroo rat, Dipodomys californicus ; Ixodes jellisoni , I. spinipalipis and I. pacificus ticks are naturally infected with it. Thus, the ecological associations of the two genomospecies and their genetic distance from all other known Borrelia genomospecies species justify their description as separate genomospecies: B. bissettiae sp. nov. (type strain DN127 T  = DSM 17990 T  =  CIP 109136 T ) and B. californiensis (type strain CA446 T  = DSM 17989 T  = ATCC BAA-2689 T ).

  10. EFEKTIFITAS DAYA HAMBAT BAKTERI Streptomyces sp TERHADAP Erwinia sp PENYEBAB PENYAKIT BUSUK REBAH PADA TANAMAN LIDAH BUAYA (Aloe barbadensis Mill

    Directory of Open Access Journals (Sweden)

    SARMILA TASNIM

    2013-05-01

    Full Text Available Streptomyces sp was conducted from December 2010 - June 2011 at the Laboratoryof Microbiology, Biology Department, Math and Science Faculty, UdayanaUniversity Bukit Jimbaran-Bali. Implementation stages of the research consisted ofisolation and testing of the antibiotic activity Streptomyces sp to inhibit growthbacterial pathogens Erwinia sp as a cause of disease in plants fallen foul (Soft rot ofAloe barbadensis Mill.The results of this study have eight isolates of Streptomyces spwith macroscopic and microscopic characters are varied. Furthermore, all isolateswere obtained and then tested against antibiotic activity to inhibit growth the bacteriaErwinia sp. Test results obtained by Streptomyces sp that has the most effective ininhibiting the ability of the bacteria Erwinia sp isolates are Streptomyces sp2for (45%.

  11. In Vitro Antioxidant and In Vivo Hypolipidemic Effects of the King Oyster Culinary-Medicinal Mushroom, Pleurotus eryngii var. ferulae DDL01 (Agaricomycetes), in Rats with High-Fat Diet-Induced Fatty Liver and Hyperlipidemia.

    Science.gov (United States)

    Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun

    2017-01-01

    We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.

  12. Nanoscale transformation of sp2 to sp3 of graphite by slow highly charged ion irradiation

    International Nuclear Information System (INIS)

    Meguro, T.; Hida, A.; Koguchi, Y.; Miyamoto, S.; Yamamoto, Y.; Takai, H.; Maeda, K.; Aoyagi, Y.

    2003-01-01

    Nanoscale transformation of electronic states by highly charged ion (HCI) impact on graphite surfaces is described. The high potential energy of slow HCI, which induces multiple emission of electrons from the surface, provides a strong modification of the electronic states of the local area upon graphite surfaces. The HCI impact and the subsequent surface treatment either by electron injection from a scanning tunneling microscopy tip or by He-Cd laser irradiation induce a localized transition from sp 2 to sp 3 hybridization in graphite, resulting in the formation of nanoscale diamond-like structures (nanodiamond) at the impact region. From Raman spectroscopic measurements on sp 2 related peaks, it is found that the HCI irradiation creates vacancy complexes in contrast to ions having a lower charge state, which generate single vacancies. It is of interest that a single impact of HCI creates one nanodiamond structure, suggesting potential applications of HCI in nanoscale material processing

  13. Burkholderia humisilvae sp. nov., Burkholderia solisilvae sp. nov. and Burkholderia rhizosphaerae sp. nov., isolated from forest soil and rhizosphere soil.

    Science.gov (United States)

    Lee, Jae-Chan; Whang, Kyung-Sook

    2015-09-01

    Strains Y-12(T) and Y-47(T) were isolated from mountain forest soil and strain WR43(T) was isolated from rhizosphere soil, at Daejeon, Korea. The three strains grew at 10-55 °C (optimal growth at 28-30 °C), at pH 3.0-8.0 (optimal growth at pH 6.0) and in the presence of 0-4.0% (w/v) NaCl, growing optimally in the absence of added NaCl. On the basis of 16S rRNA gene sequence analysis, the three strains were found to belong to the genus Burkholderia, showing the closest phylogenetic similarity to Burkholderia diazotrophica JPY461(T) (97.2-97.7%); the similarity between the three sequences ranged from 98.3 to 98.7%. Additionally, the three strains formed a distinct group in phylogenetic trees based on the housekeeping genes recA and gyrB. The predominant ubiquinone was Q-8, the major fatty acids were C16 : 0 and C17  : 0 cyclo and the DNA G+C content of the novel isolates was 61.6-64.4 mol%. DNA-DNA relatedness among the three strains and the type strains of the closest species of the genus Burkholderia was less than 50%. On the basis of 16S rRNA, recA and gyrB gene sequence similarities, chemotaxonomic and phenotypic data, the three strains represent three novel species within the genus Burkholderia, for which the names Burkholderia humisilvae sp. nov. (type strain Y-12(T)= KACC 17601(T) = NBRC 109933(T) = NCAIM B 02543(T)), Burkholderia solisilvae sp. nov. (type strain Y-47(T) = KACC 17602(T)= NBRC 109934(T) = NCAIM B 02539(T)) and Burkholderia rhizosphaerae sp. nov. (type strain WR43(T) = KACC 17603(T) = NBRC 109935(T) = NCAIM B 02541(T)) are proposed.

  14. Bifidobacterium reuteri sp. nov., Bifidobacterium callitrichos sp. nov., Bifidobacterium saguini sp. nov., Bifidobacterium stellenboschense sp. nov. and Bifidobacterium biavatii sp. nov. isolated from faeces of common marmoset (Callithrix jacchus) and red-handed tamarin (Saguinus midas).

    Science.gov (United States)

    Endo, Akihito; Futagawa-Endo, Yuka; Schumann, Peter; Pukall, Rüdiger; Dicks, Leon M T

    2012-03-01

    Five strains of bifidobacteria were isolated from faeces of a common marmoset (Callithrix jacchus) and a red-handed tamarin (Saguinus midas). The five isolates clustered inside the phylogenetic group of the genus Bifidobacterium but did not show high sequence similarities between the isolates and to known species in the genus by phylogenetic analysis based on 16S rRNA gene sequences. Sequence analyses of dnaJ1 and hsp60 also indicated their independent phylogenetic positions to each other in the Bifidobacterium cluster. DNA G+C contents of the species ranged from 57.3 to 66.3 mol%, which is within the values recorded for Bifidobacterium species. All isolates showed fructose-6-phosphate phosphoketolase activity. Based on the data provided, the five isolates represent five novel species, for which the names Bifidobacterium reuteri sp. nov. (type strain: AFB22-1(T) = JCM 17295(T) = DSM 23975(T)), Bifidobacterium callitrichos sp. nov. (type strain: AFB22-5(T) = JCM 17296(T) = DSM 23973(T)), Bifidobacterium saguini sp. nov. (type strain: AFB23-1(T) = JCM 17297(T) = DSM 23967(T)), Bifidobacterium stellenboschense sp. nov. (type strain: AFB23-3(T) = JCM 17298(T) = DSM 23968(T)) and Bifidobacterium biavatii sp. nov. (type strain: AFB23-4(T) = JCM 17299(T) = DSM 23969(T)) are proposed. Copyright © 2011 Elsevier GmbH. All rights reserved.

  15. Fermentation of Azolla sp. leaves and the utilization as a feed ingredient of tilapia Oreochromis sp.

    Directory of Open Access Journals (Sweden)

    Nur Bambang Priyo Utomo

    2015-03-01

    Full Text Available ABSTRACTThe objective of this study was to study the effect of incubation period on the nutritional content of Azolla sp. meal fermented by Trichoderma harzianum, and its optimum supplementation level in the feed of tilapia Oreochromis sp. In incubation period treatments, fermentation of Azolla meal was performed in two, six, eight, and ten days (AF2, AF6, AF8, AF10 using Trichoderma harzianum as the fermentor. The fish used in this study was tilapia Oreochromis sp. with an average weight of 10.59±1.29 g. The design of the feeding treatments was repeletting commercial feed with Azolla leaves by with different supplementation levels, i.e. 0% (A/control, 30% (B, 60% (C, and 90% (D. Faecal collection for digestibility measurement was conducted for 15 days and fish growth rate was observed for 40 days. Azolla meal fermented for two days (AF2 showed the best results among the other treatments with a crude fiber decrease of 37.19% and protein increase of 38.65%. The results of this study indicate that fermentation can increase the nutritional quality of Azolla meal and its most optimal supplementation level in the diet of tilapia is 30%.Keywords: crude fiber, Azolla sp., tilapiaABSTRAKPenelitian ini bertujuan untuk mengetahui pengaruh lama waktu fermentasi daun mata lele Azolla sp. menggunakan kapang Trichoderma harzianum serta dosis optimal dalam pakan ikan nila Oreochromis sp. Proses fermentasi tepung daun mata lele dilakukan selama dua, enam, delapan, dan sepuluh hari (AF2, AF6, AF8, AF10. Ikan uji pada penelitian ini menggunakan ikan nila Oreochromis sp. dengan bobot rata-rata 10,59±1,29 g yang ditebar sebanyak 6 ekor/akuarium berukuran 50×45×30 cm3. Sebagai pakan perlakuan yakni repeletting daun mata lele dengan pakan komersil pada tingkat suplementasi 0% (A/kontrol, 30% (B, 60% (C, dan 90% (D. Pemeliharaan ikan uji dan pengumpulan data dilakukan dengan mengumpulkan feses ikan untuk uji ketercernaan selama 15 hari dan mengamati pertumbuhan

  16. Isolation of C11 Cyclopentenones from Two Didemnid Species, Lissoclinum sp. and Diplosoma sp.

    Directory of Open Access Journals (Sweden)

    Katsuhiro Ueda

    2009-12-01

    Full Text Available A series of new C11 cyclopentenones 1-7 was isolated, together with four known metabolites 9/10, 12 and 13, from the extract of the didemnid ascidian Lissoclinum sp. The other didemnid ascidian Diplosoma sp. contained didemnenones 1, 2 and 5, and five known metabolites 8-12. The structures of 1-7 were elucidated by spectroscopic analyses. Cytotoxicity of the isolated compounds was evaluated against three human cancer cell lines (HCT116, A431 and A549.

  17. Role of surfactant protein A (SP-A)/lipid interactions for SP-A functions in the lung.

    Science.gov (United States)

    Casals, C

    2001-01-01

    Surfactant protein A (SP-A), an oligomeric glycoprotein, is a member of a group of proteins named collectins that contain collagen-like and Ca(2+)-dependent carbohydrate recognition domains. SP-A interacts with a broad range of amphipathic lipids (glycerophospholipids, sphingophospholipids, glycosphingolipids, lipid A, and lipoglycans) that are present in surfactant or microbial membranes. This review summarizes SP-A/lipid interaction studies regarding the lipid system used (i.e., phospholipid vesicles, phospholipid monolayers, and lipids immobilized on silica or adsorbed on a solid support). The effect of calcium, ionic strength, and pH on the binding of SP-A to lipids and the subsequent lipid aggregation process is discussed. Current evidence suggests that hydrophobic-binding forces are involved in the peripherical association of SP-A to membranes. It is also proposed that fluid and liquid-ordered phase coexistence in surfactant membranes might favor partition of SP-A into those membranes. The binding of SP-A to surfactant membranes containing hydrophobic surfactant peptides makes possible the formation of a membrane reservoir in the alveolar fluid that is protected by SP-A against inactivation and improves the rate of surfactant film formation. In addition, the interaction of SP-A with membranes might enhance the affinity of SP-A for terminal carbohydrates of glycolipids or glycoproteins on the surface of invading microorganisms.

  18. Fresh Water Cyanobacteria Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as an Anticancer Drug Resource.

    Directory of Open Access Journals (Sweden)

    Akanksha Srivastava

    Full Text Available An increasing number of cancer patients worldwide, especially in third world countries, have raised concern to explore natural drug resources, such as the less explored fresh water filamentous cyanobacteria. Six strains of cyanobacteria (Phormidium sp. CCC727, Geitlerinema sp. CCC728, Arthrospira sp. CCC729, Phormidium sp. CCC731, Phormidium sp. CCC730, and Leptolyngbya sp. CCC732 were isolated (paddy fields and ponds in the Banaras Hindu University, campus and five strains screened for anticancer potential using human colon adenocarcinoma (HT29 and human kidney adenocarcinoma (A498 cancer cell lines. Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 were the most potent as determined by examination of morphological features and by inhibition of growth by graded concentrations of crude extracts and thin-layer chromatography (TLC eluates. Cell cycle analysis and multiplex assays using cancer biomarkers also confirmed Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as cancer drug resources. Apoptotic studies in the cells of A498 (cancer and MCF-10A (normal human epithelial exposed to crude extracts and TLC fractions revealed no significant impact on MCF-10A cells emphasizing its importance in the development of anticancer drug. Identification of biomolecules from these extracts are in progress.

  19. Fresh Water Cyanobacteria Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as an Anticancer Drug Resource.

    Science.gov (United States)

    Srivastava, Akanksha; Tiwari, Ratnakar; Srivastava, Vikas; Singh, Tej Bali; Asthana, Ravi Kumar

    2015-01-01

    An increasing number of cancer patients worldwide, especially in third world countries, have raised concern to explore natural drug resources, such as the less explored fresh water filamentous cyanobacteria. Six strains of cyanobacteria (Phormidium sp. CCC727, Geitlerinema sp. CCC728, Arthrospira sp. CCC729, Phormidium sp. CCC731, Phormidium sp. CCC730, and Leptolyngbya sp. CCC732) were isolated (paddy fields and ponds in the Banaras Hindu University, campus) and five strains screened for anticancer potential using human colon adenocarcinoma (HT29) and human kidney adenocarcinoma (A498) cancer cell lines. Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 were the most potent as determined by examination of morphological features and by inhibition of growth by graded concentrations of crude extracts and thin-layer chromatography (TLC) eluates. Cell cycle analysis and multiplex assays using cancer biomarkers also confirmed Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as cancer drug resources. Apoptotic studies in the cells of A498 (cancer) and MCF-10A (normal human epithelial) exposed to crude extracts and TLC fractions revealed no significant impact on MCF-10A cells emphasizing its importance in the development of anticancer drug. Identification of biomolecules from these extracts are in progress.

  20. Dominancy of Trichodesmium sp. in the Biawak Island

    Science.gov (United States)

    Prihadi, D. J.

    2018-03-01

    The Biawak Island is one of the small islands in West Java Province with an abundance of marine biological resources. This research was conducted to collect the primary producer zooplankton and water quality parameters. Direct observation is done by field surveys and measurement in situ for plankton and environmental parameters such as temperature, water transparency, water current, salinity, dissolved oxygen, and pH. Trichodesmium sp. was found dominance in where some other types of zooplankton were found in the area, like Scenedesmus sp., Sagitta sp., Acartia sp. also occurred. Further, the most abundance of Trichodesmium sp. was found in southern of Biawak Island where mangroves, coral and seagrass ecosystem provide nutrients which indirectly support the abundance of planktons. Trichodesmium sp. is plankton that can survive in water with minimum nutrient.

  1. Green Decision Making: Sustainable Transport and Systemic Planning (SP)

    DEFF Research Database (Denmark)

    Leleur, Steen

    and infrastructure assessment and on the methodology and process of systemic planning (SP). SP theory development has interchanged with practical application and testing of the SP approach in a large number of cases. The word systemic in SP indicates that complex planning problems and provision of decision support...... in today’s strategic planning needs a focus on what may be addressed as systemic insights in balance with more conventional, systematically-based findings where causal linkages can be modelled and made use of. In practice this means that SP is based on a study-specific combination of hard (quantitative......) and soft (qualitative) operations research (OR) methods; especially the latter have a function as regards knowledge generation that relates to obtaining systemic insights. Furthermore, SP applies a process that drives group-based learning forward. The group should be formed with the different stakeholder...

  2. The SP Theory of Intelligence: An Overview

    Directory of Open Access Journals (Sweden)

    J Gerard Wolff

    2013-08-01

    Full Text Available This article is an overview of the SP theory of intelligence, which aims to simplify and integrate concepts across artificial intelligence, mainstream computing and human perception and cognition, with information compression as a unifying theme. It is conceived of as a brain-like system that receives "New" information and stores some or all of it in compressed form as "Old" information; and it is realised in the form of a computer model, a first version of the SP machine. The matching and unification of patterns and the concept of multiple alignment are central ideas. Using heuristic techniques, the system builds multiple alignments that are "good" in terms of information compression. For each multiple alignment, probabilities may be calculated for associated inferences. Unsupervised learning is done by deriving new structures from partial matches between patterns and via heuristic search for sets of structures that are "good" in terms of information compression. These are normally ones that people judge to be "natural", in accordance with the "DONSVIC" principle—the discovery of natural structures via information compression. The SP theory provides an interpretation for concepts and phenomena in several other areas, including "computing", aspects of mathematics and logic, the representation of knowledge, natural language processing, pattern recognition, several kinds of reasoning, information storage and retrieval, planning and problem solving, information compression, neuroscience and human perception and cognition. Examples include the parsing and production of language with discontinuous dependencies in syntax, pattern recognition at multiple levels of abstraction and its integration with part-whole relations, nonmonotonic reasoning and reasoning with default values, reasoning in Bayesian networks, including "explaining away", causal diagnosis, and the solving of a geometric analogy problem.

  3. Methyl (Sp-2-(diphenylphosphinoferrocene-1-carboxylate

    Directory of Open Access Journals (Sweden)

    Petr Štěpnička

    2009-10-01

    Full Text Available The title compound, [Fe(C5H5(C19H16O2P], obtained serendipitously during recrystallization of 1-hydroxybenzotriazolyl (Sp-2-(diphenylphosphinoferrocene-1-carboxylate from methanol, crystallizes in the chiral space group P212121. Its crystal structure not only confirms the anticipated absolute configuration but also establishes a rather regular geometry for the ferrocene unit, devoid of any significant deformation due to the attached substituents. In the crystal, symmetry-related molecules are linked via weak C—H...O interactions.

  4. Increasing rice plant growth by Trichoderma sp.

    Science.gov (United States)

    Doni, Febri; Isahak, Anizan; Zain, Che Radziah Che Mohd; Sulaiman, Norela; Fathurahman, F.; Zain, Wan Nur Syazana Wan Mohd.; Kadhimi, Ahsan A.; Alhasnawi, Arshad Naji; Anhar, Azwir; Yusoff, Wan Mohtar Wan

    2016-11-01

    Trichoderma sp. is a plant growth promoting fungi in many crops. Initial observation on the ability to enhance rice germination and vigor have been reported. In this study, the effectiveness of a local isolate Trichoderma asprellum SL2 to enhance rice seedling growth was assessed experimentally under greenhouse condition using a completely randomized design. Results showed that inoculation of rice plants with Trichoderma asprellum SL2 significantly increase rice plants height, root length, wet weight, leaf number and biomass compared to untreated rice plants (control). The result of this study can serve as a reference for further work on the application of beneficial microorganisms to enhance rice production.

  5. SP-100 radiator design trade study

    International Nuclear Information System (INIS)

    Ewell, R.

    1992-01-01

    This paper reports on a design trade study of the SP-100 heat rejection subsystem (HRSS) which was made. A system code was used to evaluate the sensitivity of the HRSS mass and performance to changes. Variations in heat pipe diameter and cross-section, fin length and thickness, armor thickness, and overall configuration and materials were evaluated. The analysis indicates that the minimum system mass occurs for the case with many small diameter heat pipes, with ducting that maximizes the fraction of the heat pipe evaporator perimeter in contract with it

  6. Prepare for an SpR interview.

    Science.gov (United States)

    Garner, J P; Heppell, P S J

    2003-03-01

    By the time you attend an interview for a military SpR number you should have no real problems but it pays to be prepared. Begin preparations early, reading widely and talk to as many people as possible. Your consultants will have a useful viewpoint on the proceedings and may be able to help you refine your answers to the common questions. Arrive at your interview in a smart and timely fashion and answer questions with confidence and common sense. Avoid confrontation and bluff and be courteous at all times, whatever you may be feeling inside and thank the interview panel as you leave.

  7. Amino Alcohols from the Ascidian Pseudodistoma sp.

    Directory of Open Access Journals (Sweden)

    Tae Hyung Won

    2014-06-01

    Full Text Available Seven new amino alcohol compounds, pseudoaminols A–G (1–7, were isolated from the ascidian Pseudodistoma sp. collected off the coast of Chuja-do, Korea. Structures of these new compounds were determined by analysis of the spectroscopic data and from chemical conversion. The presence of an N-carboxymethyl group in two of the new compounds (6 and 7 is unprecedented among amino alcohols. Several of these compounds exhibited moderate antimicrobial activity and cytotoxicity, as well as weak inhibitory activity toward Na+/K+-ATPase.

  8. PRODUCTION OF FIBRINOLYTIC ENZYME (NATTOKINASE) FROM BACILLUS SP.

    OpenAIRE

    Padma Singh, Rekha Negi*, Vani Sharma, Alka Rani, Pallavi and Richa Prasad

    2018-01-01

    During present study Nattokinase which is a novel fibrinolytic enzyme was produced by Bacillus sp. To screen and extract nattokinase enzyme from Bacillus sp. were isolated from soil of different agricultural field by serial dilution method. Out of 10 isolate, one strain i.e. B3 produced nattokinase on screening medium. B3 was identified by biochemical characterization. The caseinolytic activity of Nattokinase was 0.526 U/ml and the selected isolate Bacillus sp. could produce active nattokinas...

  9. Indirect Manganese Removal by Stenotrophomonas sp. and Lysinibacillus sp. Isolated from Brazilian Mine Water

    Directory of Open Access Journals (Sweden)

    Natália Rocha Barboza

    2015-01-01

    Full Text Available Manganese is a contaminant in the wastewaters produced by Brazilian mining operations, and the removal of the metal is notoriously difficult because of the high stability of the Mn(II ion in aqueous solutions. To explore a biological approach for removing excessive amounts of aqueous Mn(II, we investigated the potential of Mn(II oxidation by both consortium and bacterial isolates from a Brazilian manganese mine. A bacterial consortium was able to remove 99.7% of the Mn(II. A phylogenetic analysis of isolates demonstrated that the predominant microorganisms were members of Stenotrophomonas, Bacillus, and Lysinibacillus genera. Mn(II removal rates between 58.5% and 70.9% were observed for Bacillus sp. and Stenotrophomonas sp. while the Lysinibacillus isolate 13P removes 82.7%. The catalytic oxidation of Mn(II mediated by multicopper oxidase was not properly detected; however, in all of the experiments, a significant increase in the pH of the culture medium was detected. No aggregates inside the cells grown for a week were found by electronic microscopy. Nevertheless, an energy-dispersive X-ray spectroscopy of the isolates revealed the presence of manganese in Stenotrophomonas sp. and Lysinibacillus sp. grown in K medium. These results suggest that members of Stenotrophomonas and Lysinibacillus genera were able to remove Mn(II by a nonenzymatic pathway.

  10. Screening of biodiesel production from waste tuna oil (Thunnus sp.), seaweed Kappaphycus alvarezii and Gracilaria sp.

    Science.gov (United States)

    Alamsjah, Mochammad Amin; Abdillah, Annur Ahadi; Mustikawati, Hutami; Atari, Suci Dwi Purnawa

    2017-09-01

    Biodiesel has several advantages over solar. Compared to solar, biodiesel has more eco-friendly characteristic and produces lower greenhouse gas emissions. Biodiesel that is made from animal fats can be produced from fish oil, while other alternative sources from vegetable oils are seaweed Kappaphycus alvarezii and Gracilaria sp. Waste tuna oil (Thunnus sp.) in Indonesia is commonly a side product of tuna canning industries known as tuna precook oil; on the other hand, seaweed Gracilaria sp. and Kappaphycus alvarezii are commonly found in Indonesia's seas. Seaweed waste that was used in the present study was 100 kg and in wet condition, and the waste oil was 10 liter. The seaweed was extracted with soxhletation method that used n-hexane as the solvent. To produce biodiesel, trans esterification was performed on the seaweed oil that was obtained from the soxhletation process and waste tuna oil. Biodiesel manufactured from seaweed K. alvarezii obtained the best score in flash point, freezing point, and viscosity test. However, according to level of manufacturing efficiency, biodiesel from waste tuna oil is more efficient and relatively easier compared to biodiesel from waste K. alvarezii and Gracilaria sp.

  11. Biodegradation of hexavalent chromium (Cr+6) in wastewater using Pseudomonas sp. and Bacillus sp. bacterial strains

    Energy Technology Data Exchange (ETDEWEB)

    Qasim, Muhammad [Department of Chemical Engineering, American University of Sharjah (United Arab Emirates)

    2013-07-01

    The recovery of toxic metal compounds is a deep concern in all industries. Hexavalent chromium is particularly worrying because of its toxic influence on human health. In this paper, biodegradation of hexavalent chromium (Cr+6) present in wastewater has been studied using two different bacterial strains; Pseudomonas sp. and Bacillus sp. A chemostat (with and without recycle of cells) with 10 L liquid culture volume was used to study the substrate and the biomass cell concentrations with time. Also, the degree of substrate conversion was studied by the varying the dilution rate as an independent parameter. The dilution rate (ratio of feed flow rate to the culture volume) was varied by varying the feed volumetric rate from 110-170 mL/h for inlet hexavalent chromium concentrations of 70 mg/dm3. The results show that a chemostat with recycle gives a better performance in terms of substrate conversion than a chemostat without a recycle. Moreover, the degree of substrate conversion decreases as the dilution rate is increased. Also, Bacillus sp. was found to give higher conversions compared to pseudomonas sp.

  12. Genetic diversity in Fusarium oxysporum f.sp. dianthi and F. redolens f.sp. dianthi

    NARCIS (Netherlands)

    Baayen, R.P.; Dreven, van F.; Krijger, M.C.; Waalwijk, C.

    1997-01-01

    Pathogenic isolates were selected representing all known vegetative compatibility groups (VCGs) and races of Fusarium oxysporum sensu lato from Dianthus spp. On basis of differences in the internal transcribed spacer region of the ribosomal DNA, six VCGs were classified as F. oxysporum f.sp. dianthi

  13. SHEAR STRENGTH IN THE GLUE LINE OF Eucalyptus sp. AND Pinus sp.WOOD

    Directory of Open Access Journals (Sweden)

    Juliana Jerásio Bianche

    Full Text Available ABSTRACT To evaluate the adhesive efficiency on the union of glued joints in a particular temperature and humidity conditions for a specified time the adhesive must be submitted to specific load tests, such as shear in the glue line. The objective of this study was to evaluate the shear strength in the glue line of Eucalyptus sp and Pinus sp.woods. Five adhesives (castor oil, sodium silicate, modified silicate, , PVA and resorcinol-formaldehyde, three weights (150 g/m2, 200 g/m2, and 250 g/m2 and two species (Eucalyptus sp. and Pinus sp. of wood were used. Twelve specimens were obtained from each repetition per treatment, corresponding to 108 specimens that were conditioned at a temperature of 23 ± 1°C and relative humidity of 50 ± 2%. The interaction between the weight and type of adhesive was significant for the shear strength in the glue line of eucalyptus wood. However, no interaction between the weight and the adhesive was found for pinus, only the isolated from the adhesive effect. Chemical bonds originated in the polymerization of resorcinol-formaldehyde adhesives and castor bi-component conferred upon these adhesives the greatest resistance in the glue line. Castor and resorcinol-formaldehyde adhesives showed the highest shear strength values in the line of glue and wood failure. Castor adhesive presented satisfactory performance for bonding of eucalyptus and pine woods.

  14. Mineralization of a Malaysian crude oil by Pseudomonas sp. and Achromabacter sp. isolated from coastal waters

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, J.; Ahmad, M.F.

    1995-12-31

    Regarded as being a potentially effective tool to combat oil pollution, bioremediation involves mineralization, i.e., the conversion of complex hydrocarbons into harmless CO{sub 2} and water by action of microorganisms. Therefore, in achieving optimum effectiveness from the application of these products on crude oil in local environments, the capability of the bacteria to mineralize hydrocarbons was evaluated. The microbial laboratory testing of mineralization on local oil degraders involved, first, isolation of bacteria found at a port located on the west coast of Peninsular Malaysia. Subsequently, these bacteria were identified by means of Biomereux`s API 20E and 20 NE systems and later screened by their growth on a Malaysian crude oil. Selected strains of Pseudomonas sp. and Achromabacter sp. were then exposed individually to a similar crude oil in a mineralization unit and monitored for 16 days for release of CO{sub 2}. Pseudomonas paucimobilis was found to produce more CO{sub 2} than Achromobacter sp. When tested under similar conditions, mixed populations of these two taxa produced more CO{sub 2} than that produced by any individual strain. Effective bioremediation of local crude in Malaysian waters can therefore be achieved from biochemically developed Pseudomonas sp. strains.

  15. SP@CE - An SP-based programming model for consumer electronics streaming applications

    NARCIS (Netherlands)

    Varbanescu, Ana Lucia; Nijhuis, Maik; Escribano, Arturo González; Sips, Henk; Bos, Herbert; Bal, Henri

    2007-01-01

    Efficient programming of multimedia streaming applications for Consumer Electronics (CE) devices is not trivial. As a solution for this problem, we present SP@CE, a novel programming model designed to balance the specific requirements of CE streaming applications with the simplicity and efficiency

  16. Eficiencia de pseudomonas sp, rhodopseudomonas sp, micrococcus sp y bacillus sp empleados como cultivos individuales y en consorcio, en la degradación de petróleo diesel ii

    OpenAIRE

    Otiniano García, Nélida Milly Esther

    2010-01-01

    In order to evaluate the efficiency of Pseudomonas sp, Rhodopseudomonas sp, Micrococcus sp, Bacillus sp, and the consortium formed by these four microorganisms in the diesel II petroleum degradation, it was worked in 5 bioreactors of aerated and shaken tank of 1.5 litters of capacity, with speed agitation of 120 rpm, and air flow of 0.5 vvm; in which were placed; 940 mL of Minimum Broth of Davies pH 7.0; 50 mL of diesel II petroleum as source of carbon and 10 mL of a suspension of approx...

  17. Sp(2) covariant quantisation of general gauge theories

    Energy Technology Data Exchange (ETDEWEB)

    Vazquez-Bello, J L

    1994-11-01

    The Sp(2) covariant quantization of gauge theories is studied. The geometrical interpretation of gauge theories in terms of quasi principal fibre bundles Q(M{sub s}, G{sub s}) is reviewed. It is then described the Sp(2) algebra of ordinary Yang-Mills theory. A consistent formulation of covariant Lagrangian quantisation for general gauge theories based on Sp(2) BRST symmetry is established. The original N = 1, ten dimensional superparticle is considered as an example of infinitely reducible gauge algebras, and given explicitly its Sp(2) BRST invariant action. (author). 18 refs.

  18. Sp(2) covariant quantisation of general gauge theories

    International Nuclear Information System (INIS)

    Vazquez-Bello, J.L.

    1994-11-01

    The Sp(2) covariant quantization of gauge theories is studied. The geometrical interpretation of gauge theories in terms of quasi principal fibre bundles Q(M s , G s ) is reviewed. It is then described the Sp(2) algebra of ordinary Yang-Mills theory. A consistent formulation of covariant Lagrangian quantisation for general gauge theories based on Sp(2) BRST symmetry is established. The original N = 1, ten dimensional superparticle is considered as an example of infinitely reducible gauge algebras, and given explicitly its Sp(2) BRST invariant action. (author). 18 refs

  19. Enkapsulasi B. bassiana menggunakan maizena dan daya infeksinya terhadap larva Aedes aegypti, Anopheles sp., Culex sp.

    Directory of Open Access Journals (Sweden)

    Mutiara Widawati

    2015-12-01

    Full Text Available Abstract. Encapsulation formulae of mycoinsecticide have to be able to maintain fungus viability and pathogenicity. This mycoinsecticide was developed as an alternative way to control mosquito borne disease. The aim of this study was to encapsulate Beauveria bassiana as viable storage and have the capability to kill larvae of Aedes aegypti, Anopheles sp. and Culex sp. Mosquito larvae obtained from laboratory reared at health research laboratory; Loka Litbang P2B2 Ciamis. The treatments made in this study were the formu-lation of cornstarch and controls for comparison. This study showed potential formulation of cornstarch encapsulation as a biolarvacidal. Cornstarch formulations proven to be succeed in maintaining fungus viability, however, the pathogenicity of the microcapsule still not effective to kill Aedes, Culex and Anopheles larvae. Keywords: encapsulation, Beauveria bassiana, Ae.aegypti, Anopheles sp., Culex sp. Abstrak. Pembuatan formula bioinsektisida yang optimal sebagai salah satu alternatif untuk pengen-dalian nyamuk vektor perlu di kembangkan. Sediaan mikoinsektisida yang dibuat harus dapat memper-tahankan viabilitas jamur B. bassiana sehingga masih efektif pada saat penggunaannya. Salah satu cara yang digunakan untuk menjaga kestabilan sediaan mikoinsektisida yang berdampak langsung pada via-bilitas jamur adalah dengan menerapkan metode enkapsulasi. Penelitian ini bertujuan untuk meng-hasilkan sediaan mikokapsul dari Beauvaria bassiana melalui proses enkapsulasi menggunakan maizena yang memiliki kapabilitas tinggi sebagai penyimpan B. bassiana dan efektif dalam membunuh larva dan telur Aedes aegypti, Anopheles sp. dan Culex sp. Semua larva uji berasal dari insektarium laboratorium penelitian kesehatan Loka litbang P2B2 Ciamis. Pembuatan enkapsulasi dimulai dengan kultur dan pema-nenan B. bassiana, uji viabilitas, proses enkapsulasi serta uji larvasida di laboratorium. Uji dilakukan dengan satu perlakuan dan satu kontrol untuk

  20. Quality improvement on half-fin anchovy (Setipinna taty) fish sauce by Psychrobacter sp. SP-1 fermentation.

    Science.gov (United States)

    Zheng, Bin; Liu, Yu; He, Xiaoxia; Hu, Shiwei; Li, Shijie; Chen, Meiling; Jiang, Wei

    2017-10-01

    A method of improving fish sauce quality during fermentation was investigated. Psychrobacter sp. SP-1, a halophilic protease-producing bacterium, was isolated from fish sauce with flavor-enhancing properties and non-biogenic amine-producing activity. The performance of Psychrobacter sp. SP-1 in Setipinna taty fish sauce fermentation was investigated further. The inoculation of Psychrobacter sp. SP-1 did not significantly affect pH or NaCl concentration changes (P > 0.05), although it significantly increased total moderately halophilic microbial count, protease activity, total soluble nitrogen content and amino acid nitrogen content, and also promoted the umami taste and meaty aroma (P sauce quality by fermentation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  1. Penggunaan Streptomyces sp. Sebagai Biokontrol Penyakit Layu Pada Tanaman Cabai Merah (Capsicum annuum L. yang Disebabkan Oleh Fusarium oxysporum f.sp. capsici

    Directory of Open Access Journals (Sweden)

    ANINDA OKTAVIA RAHARINI

    2014-01-01

    Full Text Available A research has been conducted to find out Streptomyces bacteria at Bukit Jimbaran, to inhibitionpotency of Streptomyces sp. to pathogenic fungi Fusarium oxysporum f.sp. capsici, and to find outantifungal activity of Streptomyces filtrate to F.oxysporum f.sp. capsici in chili (Capsicum annuumL. plants. Streptomyces sp. isolation was done by platting method with selective media YMA (ISP4.Identification of Streptomyces sp. used Bergey’s book entitled Manual Determinative Bacteriology.Test inhibition against F.oxysporum f.sp. capsici and in vivo test used by dying the roots of the chili(C.annuum L. plant with F.oxysporum f.sp. capsici and after 30 seconds the roots were dying withStreptomyces sp. culture, furthermore sterile soil on polybag watered by F.oxysporum f.sp. capsicispore and Streptomyces sp. culture at the same time. The result found five isolates Streptomyces sp.with different morphological. The antagonis test showed Streptomyces sp. 4 had ability (82% againstFusarium, Streptomyces sp.1 (72%, Streptomyces sp.2 (64%, Streptomyces sp.3 (76%, andStreptomyces sp. 5 (32%. All Streptomyces suppressed the growth of Fusarium on chili plants inglass house (p<0,05. Streptomyces sp.4 suppressed Fusarium wilt disease in chili from 80% in controlto 8%.

  2. UTILIZAÇÃO DE ADESIVO PVA EM COMPENSADOS DE Pinus sp. E Eucalyptus sp. / UTILIZATION OF PVA ADHESIVES IN Pinus sp. and Eucalyptus sp. PLYWOOD

    Directory of Open Access Journals (Sweden)

    C. I. De Campos

    2014-12-01

    Full Text Available Estudos sobre novos adesivos ou resinas para colagem de madeira e derivados estão sendo realizados com a intenção de diminuir o impacto ambiental sem alterar suas propriedades. Por este motivo, novas formulações de adesivos PVA (Acetato de Polivinila vêm sendo desenvolvidas. Este trabalho testou a utilização deste adesivo na produção de compensado de Eucalyptus sp. e Pinus sp., com tempo e temperatura de prensagem, respectivamente, de 10 minutos e90°C. Foram realizados os ensaios físicos de densidade, teor de umidade e absorção, e os ensaios mecânicos de flexão estática e de resistência ao cisalhamento na linha de cola, todos de acordo com as normas ABNT. Obtiveram-se bons resultados com relação à resistência ao cisalhamento na linha de cola, a qual foi superior para os adesivos PVA, se comparados com compensados produzidos com ureia-formaldeído e o fenol-formaldeído, enquanto que os resultados de MOE e MOR apresentaram-se inferiores em ambos os casos. 

  3. Microbial transformation of citral by Penicillium sp..

    Science.gov (United States)

    Esmaeili, Akbar; Tavassoli, Afsaneh

    2010-01-01

    Thymol is present in the essential oils from herbs and spices, such as thyme. It is produced by these plant species as a chemical defense against phytopathogenic microorganisms. Therefore, this compound has attracted great attention in food industry, i.e., it has been used as a natural preservative in foods such as cheese to prevent fungal growth. Previous studies concerning the biotransformation of nerol by Penicillium sp. and microbial transformation of citral by sporulated surface cultures method (SSCM) of Penicillium digitatum have been reported. The objective of this research was to study the pathway involved during biotransformation of citral by Penicillium sp. using two methods. The culture preparation was done using different microbial methods and incubation periods to obtain Penicillium for citral biotransformation. The biotransformation products were identified by gas chromatography (GC) and gas chromatography/mass spectroscopy (GC/MS). A comparison of the two methods showed that SSCM was more effective, its major products were thymol (21.5 %), geranial (18.6 %) and nerol (13.7 %). LM produced only one compound — thymol — with a low efficiency.

  4. Burkholderia cordobensis sp. nov., from agricultural soils.

    Science.gov (United States)

    Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter

    2014-06-01

    Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.

  5. The Effect of Acupuncture to SP6 on Skin Temperature Changes of SP6 and SP10: An Observation of “Deqi”

    Directory of Open Access Journals (Sweden)

    Jia-Min Yang

    2014-01-01

    Full Text Available Background. Deqi sensation is a complex but an important component for acupuncture effect. In this study, we tried to observe the relationship between Deqi and skin temperature changes and whether there was some relativity between Deqi and needle stimulations on cold congealing and dysmenorrhea rat model. Thirty-two female Sprague Dawley (SD rats were randomly divided into four groups (Saline Control Group, Model Group, Group A with strong stimulation, and Group B with small stimulation. Group A and Group B were performed with different stimulations. We found that, compared with saline control group, model group, and Group B, Group A showed that the skin temperature changes on right acupoint SP6 and SP10 increased significantly at 5 min–10 min interval. The skin temperature changes on left SP6 decreased at instant–5 min interval. The skin temperature changes on right SP10 decreased significantly at instant–5 min interval and 10 min–20 min interval. Thermogenic action along Spleen Meridian of Foot Greater Yin was manifested as simultaneous skin temperature increase on right SP6 and SP10 at 5 min–10 min interval after needling SP6, which was helpful to illustrate the relationship between the characteristic of Deqi and needle stimulations.

  6. Integrative Gene Cloning and Expression System for Streptomyces sp. US 24 and Streptomyces sp. TN 58 Bioactive Molecule Producing Strains

    Directory of Open Access Journals (Sweden)

    Samiha Sioud

    2009-01-01

    Full Text Available Streptomyces sp. US 24 and Streptomyces sp. TN 58, two strains producing interesting bioactive molecules, were successfully transformed using E. coli ET12567 (pUZ8002, as a conjugal donor, carrying the integrative plasmid pSET152. For the Streptomyces sp. US 24 strain, two copies of this plasmid were tandemly integrated in the chromosome, whereas for Streptomyces sp. TN 58, the integration was in single copy at the attB site. Plasmid pSET152 was inherited every time for all analysed Streptomyces sp. US 24 and Streptomyces sp. TN 58 exconjugants under nonselective conditions. The growth, morphological differentiation, and active molecules production of all studied pSET152 integrated exconjugants were identical to those of wild type strains. Consequently, conjugal transfer using pSET152 integration system is a suitable means of genes transfer and expression for both studied strains. To validate the above gene transfer system, the glucose isomerase gene (xylA from Streptomyces sp. SK was expressed in strain Streptomyces sp. TN 58. Obtained results indicated that heterologous glucose isomerase could be expressed and folded effectively. Glucose isomerase activity of the constructed TN 58 recombinant strain is of about eighteenfold higher than that of the Streptomyces sp. SK strain. Such results are certainly of importance due to the potential use of improved strains in biotechnological process for the production of high-fructose syrup from starch.

  7. Effect of garlic solution to Bacillus sp. removal

    Science.gov (United States)

    Zainol, N.; Rahim, S. R.

    2018-04-01

    Biofilm is a microbial derived sessile community characterized by cells that are irreversibly attached to a substratum or interface to each other, embedded in a matrix of extracellular polymeric substances that they have produced. Bacillus sp. was used as biofilm model in this study. The purpose of this study is to determine the effect of Garlic solution in term of ratio of water and Garlic solution (W/G) and ratio of Garlic solution to Bacillus sp. (GS/B) on Bacillus sp removal. Garlic solution was used to remove Bacillus sp. In this study, Garlic solution was prepared by crushing the garlic and mixed it with water. the Garlic solution was added into Bacillus sp. mixture and mixed well. The mixture then was spread on nutrient agar. The Bacillus sp. weight on agar plate was measured by using dry weight measurement method. In this study, initially Garlic solution volume and Garlic solution concentration were studied using one factor at time (OFAT). Later two-level-factorial analysis was done to determine the most contributing factor in Bacillus sp. removal. Design Expert software (Version 7) was used to construct experimental table where all the factors were randomized. Bacilus sp removal was ranging between 42.13% to 99.6%. The analysis of the results showed that at W/G of 1:1, Bacillus sp. removal increased when more Garlic solution was added to Bacillus sp. Effect of Garlic solution to Bacillus sp. will be understood which in turn may be beneficial for the industrial purpose.

  8. Rhodotorula rosulata sp. nov., Rhodotorula silvestris sp. nov. and Rhodotorula straminea sp. nov., novel myo-inositol-assimilating yeast species in the Microbotryomycetes.

    Science.gov (United States)

    Golubev, Wladyslav I; Scorzetti, Gloria

    2010-10-01

    Three novel species are described as Rhodotorula rosulata sp. nov. (type strain VKM Y-2962(T) =CBS 10977(T)), Rhodotorula silvestris sp. nov. (type strain VKM Y-2971(T) =CBS 11420(T)) and Rhodotorula straminea sp. nov. (type strain VKM Y-2964(T) =CBS 10976(T)) based on the study of eight isolates from needle litter. The new species, phylogenetically located within the Microbotryomycetes, are related to glucuronate-assimilating species of the genus Rhodotorula. Sequencing of the D1/D2 domains of the LSU rDNA gene and the internal transcribed spacer (ITS) region, as well as physiological characterization, revealed their distinct taxonomic positions.

  9. Potential topical natural repellent against Ae. aegypti, Culex sp. and Anopheles sp. mosquitoes

    Directory of Open Access Journals (Sweden)

    Dewi Nur Hodijah

    2014-08-01

    Full Text Available AbstrakLatar belakang:Minyak atsiri daun sirih diketahui mempunyai daya proteksi. Dibuatkan losion berdasarkan pengantar sediaan farmasi yang ditambahkan minyak atsiri daun nilam. Sediaan losion dipilih agar dapat menempel lebih lama di permukaan kulit. Tujuan penelitian ini untuk membandingkan daya proteksi antara losion dengan penambahan minyak nilam dan losion tanpa penambahan minyak nilam dibandingkan daya proteksi dengan DEET. Metode: Penelitian ini merupakan penelitian eksperimental laboratorium. Semua nyamuk uji berasal dari insektarium laboratorium penelitian kesehatan Loka litbang P2B2 Ciamis. Konsentrasi minyak atsiri daun sirih dalam losion adalah 4%; konsentrasi minyak nilam sebagai zat pengikat adalah 0,4%. Formula yang digunakan yaitu formula dasar yang ada pada pengantar sediaan farmasi. Uji repelensi dilakukan dengan menggunakan metoda yang direkomendasikan oleh Komisi pestisida.Hasil: Dihasilkan formulasi losion yang stabil dan masih memenuhi standar formulasi sediaan. Berdasarkan hasil, diperoleh data bahwa DEET dan losion hasil modifikasi memiliki rata-rata daya proteksi di atas 90% selama 6 jam terhadap nyamuk Ae.aegypti dan Culex sp. Kesimpulan: Penambahan minyak nilam pada losion sirih dapat meningkatkan daya proteksi terhadap hinggapan nyamuk Ae. aegypti dan Culex sp. (Health Science Indones 2014;1:44-8Kata kunci:repelen alamiah, minyak atsiri, daun sirih, daun nilam, Ae. aegypti, Culex sp.AbstractBackground: Betel leaf essential oil lotion has been known to have insect repellent properties. A lotion was made based on a pharmaceutical formula from a monograph where patchouli leaf essential oil was added. A lotion preparation was intended to enhance adherence of the formula on the surface of the skin. The purpose of this study was to compare protection percentage of lotion with patchouli oil and without patchouli oil lotion compared to DEET.Methods: This study is an experimental laboratory-based research. All mosquitoes

  10. Kroyeria deetsi n.sp. (Kroyeriidae: Siphonostomatoida), a parasitic ...

    African Journals Online (AJOL)

    Kroyeria deetsi n.sp. (Kroyeriidae: Siphonostomatoida) is described from both sexes collected from the gills of spinner sharks, Carcharhinus brevipinna (Müller & Henle, 1839), captured in the Indian Ocean off the coast of South Africa. Kroyeria deetsi n.sp. can easily be distinguished from all of its congeners because the ...

  11. Enhancement of clavulanic acid production by Streptomyces sp MU ...

    African Journals Online (AJOL)

    Purpose: To enhance clavulanic acid production using UV-mutagenesis on Streptomyces sp. NRC77. Methods: UV-mutagenesis was used to study the effect of Streptomyces sp. NRC77 on CA production. Phenotypic and genotypic identification methods of the promising mutant strain were characterized. Optimization of the ...

  12. HANSENULA WICKERHAMII SP. N., A NEW YEAST FROM FINNISH SOIL

    Science.gov (United States)

    Capriotti, Augusto

    1961-01-01

    Capriotti, Augusto (l'Università di Perugia, Perugia, Italy). Hansenula wickerhamii sp. n., a new yeast from Finnish soil. J. Bacteriol. 82:259–360. 1961.—Hansenula wickerhamii sp. n. is described; it was isolated from a Finnish soil, and is named in honor of Lynferd J. Wickerham. Images PMID:13690638

  13. Truncated recombinant human SP-D attenuates emphysema and type II cell changes in SP-D deficient mice

    Directory of Open Access Journals (Sweden)

    Mühlfeld Christian

    2007-10-01

    Full Text Available Abstract Background Surfactant protein D (SP-D deficient mice develop emphysema-like pathology associated with focal accumulations of foamy alveolar macrophages, an excess of surfactant phospholipids in the alveolar space and both hypertrophy and hyperplasia of alveolar type II cells. These findings are associated with a chronic inflammatory state. Treatment of SP-D deficient mice with a truncated recombinant fragment of human SP-D (rfhSP-D has been shown to decrease the lipidosis and alveolar macrophage accumulation as well as production of proinflammatory chemokines. The aim of this study was to investigate if rfhSP-D treatment reduces the structural abnormalities in parenchymal architecture and type II cells characteristic of SP-D deficiency. Methods SP-D knock-out mice, aged 3 weeks, 6 weeks and 9 weeks were treated with rfhSP-D for 9, 6 and 3 weeks, respectively. All mice were sacrificed at age 12 weeks and compared to both PBS treated SP-D deficient and wild-type groups. Lung structure was quantified by design-based stereology at the light and electron microscopic level. Emphasis was put on quantification of emphysema, type II cell changes and intracellular surfactant. Data were analysed with two sided non-parametric Mann-Whitney U-test. Main Results After 3 weeks of treatment, alveolar number was higher and mean alveolar size was smaller compared to saline-treated SP-D knock-out controls. There was no significant difference concerning these indices of pulmonary emphysema within rfhSP-D treated groups. Type II cell number and size were smaller as a consequence of treatment. The total volume of lamellar bodies per type II cell and per lung was smaller after 6 weeks of treatment. Conclusion Treatment of SP-D deficient mice with rfhSP-D leads to a reduction in the degree of emphysema and a correction of type II cell hyperplasia and hypertrophy. This supports the concept that rfhSP-D might become a therapeutic option in diseases that are

  14. Pleurotus giganteus (Berk. Karun & Hyde), the giant oyster mushroom inhibits NO production in LPS/H2O2 stimulated RAW 264.7 cells via STAT 3 and COX-2 pathways.

    Science.gov (United States)

    Baskaran, Asweni; Chua, Kek Heng; Sabaratnam, Vikineswary; Ravishankar Ram, Mani; Kuppusamy, Umah Rani

    2017-01-13

    Pleurotus giganteus (Berk. Karunarathna and K.D. Hyde), has been used as a culinary mushroom and is known to have medicinal properties but its potential as an anti-inflammatory agent to mitigate inflammation triggered diseases is untapped. In this study, the molecular mechanism underlying the protective effect of ethanol extract of P. giganteus (EPG) against lipopolysaccharide (LPS) and combination of LPS and hydrogen peroxide (H 2 O 2 )-induced inflammation on RAW 264.7 macrophages was investigated. The effect of EPG on nitric oxide (NO) production as an indicator of inflammation in RAW 264.7 macrophages was estimated based on Griess reaction that measures nitrite level. The expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), NF-kB activating protein (NKAP), signal transducer and activator of transcription 3 protein (STAT 3) and glutathione peroxidase (GPx) genes were assessed using real time reverse transcription polymerase chain reaction (RT-PCR) approach. EPG (10 μg/ml) showed the highest reduction in the LPS-induced NO production in RAW 264.7 macrophages and significantly suppressed (p < 0.05) the expression iNOS, STAT 3 and COX-2. There was a significant increase (p < 0.05) in combination of LPS and H 2 O 2 - induced iNOS production when compared to the LPS-induced iNOS production in RAW 264.7 macrophages and this concurred with the NO production which was attenuated by EPG at 10 μg/ml. A significant (p < 0.05) down regulation was observed in the combination of LPS and H 2 O 2 -induced iNOS and GPx expression by EPG. Our data suggest that the anti-inflammatory activity of EPG is mediated via the suppression of the STAT 3 and COX-2 pathways and can serve as potential endogenous antioxidant stimulant.

  15. Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

    Science.gov (United States)

    Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

    2014-01-01

    The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

  16. Evaluación de la capacidad productiva de Pleurotus ostreatus utilizando hoja de plátano deshidratada (Musa paradisiaca L., en relación con otros sustratos agrícolas

    Directory of Open Access Journals (Sweden)

    Omar Romero

    2010-01-01

    Full Text Available El objetivo de este estudio fue evaluar la producción de la cepa CP-50 de P. ostreatus en residuos de hoja de plátano deshidratada en contraste con otros sustratos agrícolas de desecho del Municipio de Tetela de Ocampo-Puebla. Las hojas de plátano (M. paradisiaca fueron colectadas en la zona de Martínez de la Torre, Veracruz- México y los demás sustratos agrícolas como paja de trigo (T. aestivum, paja de cebada (H. vulgare, pajilla de frijol (P. vulgaris y rastrojo de maíz (Z. mays se adquirieron en la región de Tetela de Ocampo, Puebla, México, para la obtención de fructificaciones en condiciones rurales. La cepa CP-50 demostró un adecuado crecimiento de aéreas miceliales sobre la hoja de plátano deshidratada con una tasa de producción de 1,5±0,1%. La mayor eficiencia biológica (EB se obtuvo en el sustrato paja de trigo, con 129,34±9,1%, la hoja de plátano deshidratada con 123,30±0,7%, y la pajilla de frijol obtuvo la EB más baja de 82,91±0,4%. Los resultados demostraron la factibilidad de cultivar la cepa CP-50 de Pleurotus ostreatus bajo condiciones rústicas en la sierra norte del estado de Puebla, al aprovechar los residuos de la cosecha de plátano de las regiones aledañas del municipio.

  17. Solar drying of rose (Rosa sp.) petals

    Energy Technology Data Exchange (ETDEWEB)

    Balladin, D.A.; Headley, Oliver [University of the West Indies, Center for Resource Management and Environmental Studies, St. Michael (Barbados)

    1999-10-01

    The rose (Rosa sp.) petals can be dried after 2 days at about 30degC reaching an equilibrium moisture content after 16 h using the solar wire basket dryer. The initial moisture content (wet wt basis) and final moisture content (dry wt basis), determined by the Dean-Stark toluene were 65.7 and 25.2% respectively. The intensity of the rose red coloured pigment (pelargonidin) decreased by a factor of 2.5 after drying. The pelargonidin ethanoic extract as an acid-base indicator, has a K{sub 4} value of 1 x 10{sup -4} mol 1{sup -1} and pH of end point 4 and imbibed on filter paper and allowed to air dry for 5 min showed excellent properties as acid-based test tapes. (Author)

  18. Electron microscope study of Sarcocystis sp

    Science.gov (United States)

    Zeve, V.H.; Price, D.L.; Herman, C.M.

    1966-01-01

    Sarcocystis sp. obtained from wild populations of grackles, Quiscalus quiscula (Linn.), were examined to clarify the effect of the parasite on the host. Electron micrographs are presented to show areas of muscle destruction adjacent to the parasite which appear to be mechanically produced by the parasite. The microtubules within the villus-like projections of the cyst suggest that their possible function is absorptive and/or conductive with regard to the production of a toxin or the conveyance of nutritive material to the developing cells. The proposed function of submembranous filaments and their relation to the conoid is discussed. Similarities in the ultrastructure to Toxoplasma and other protozoa tend to negate the relegation of Sarcocystis to the fungi and further emphasize its protozoan nature.

  19. Polyhydroxybutyrate accumulation by a Serratia sp.

    Science.gov (United States)

    Lugg, Harriet; Sammons, Rachel L; Marquis, Peter M; Hewitt, Christopher J; Yong, Ping; Paterson-Beedle, Marion; Redwood, Mark D; Stamboulis, Artemis; Kashani, Mitra; Jenkins, Mike; Macaskie, Lynne E

    2008-03-01

    A strain of Serratia sp. showed intracellular electron-transparent inclusion bodies when incubated in the presence of citrate and glycerol 2-phosphate without nitrogen source following pre-growth under carbon-limitation in continuous culture. About 1.3 mmol citrate were consumed per 450 mg biomass, giving a calculated yield of maximally 55% of stored material per g of biomass dry wt. The inclusion bodies were stained with Sudan Black and Nile Red (NR), suggesting a lipid material, which was confirmed as polyhydroxybutyrate (PHB) by analysis of molecular fragments by GC and by FTIR spectroscopy of isolated bio-PHB in comparison with reference material. Multi-parameter flow cytometry in conjunction with NR fluorescence, and electron microscopy, showed that not all cells contained heavy PHB bodies, suggesting the potential for increasing the overall yield. The economic attractiveness is enhanced by the co-production of nanoscale hydroxyapatite (HA), a possible high-value precursor for bone replacement materials.

  20. In vitro rootting of Dioscoreas sp.

    Directory of Open Access Journals (Sweden)

    Irma Quintero

    2003-07-01

    Full Text Available The Universidad de Córdoba s Vegetal Tissue Culture Laboratory evaluated the effect of naphthalenacetic acid (NAA on in vitro rooting of three yam cultivars (Dioscorea sp. in 2000. The effect of four hormone levels (0, 0.3, 0.6 and 0.9 mg/1 was studied on three yam cultivars (Diamantes-22,003 and 005. A random experimental design was used employing 4x3 factorial arrangement and 20 repetitions; each experimental unit consisted of a glass receptacle containing the culture medium and the explant (one segment nodal. The variables considered were the number of roots and their thickness, culture medium oxidation and callus production. Findings showed that both the hormone and genotype had an effect on all those variables considered in the study and interaction was significant (P

  1. Predicting fuel performance for SP-100 conditions

    International Nuclear Information System (INIS)

    Baars, R.E.

    1985-01-01

    This paper reports on methods for analyzing fuel designs proposed for the thermionic and thermoelectric concepts for SP-100 application. The proposed fuel design for the thermionic concept consisted of fully-enriched oxide fuel clad in chemical vapor deposition (CVD) tungsten, which also served as the emitter for the thermionic fuel element (TFE). The fuel density was 95% of theoretical with the linear heat rate flattened radially by removing fuel from the center of the fuel pellet. The fuel inner diameter varied from approx.0.45 in. at the core center to zero at the edge of the core. The as-fabricated gap between fuel and emitter was 10 mils radial. The emitter thickness was 80 mils, and the outer diameter was 1.099 in. The LIFE-4 code was used for evaluation of this concept after extensive review of the code and development of a procedure that corrects certain deficiencies noted in analysis of several tests

  2. Aspergillus waksmanii sp. nov. and Aspergillus marvanovae sp. nov., two closely related species in section Fumigati

    DEFF Research Database (Denmark)

    Hubka, Vit; Peterson, Stephen W.; Frisvad, Jens Christian

    2013-01-01

    Two new and phylogenetically closely related species in Aspergillus section Fumigati are described and illustrated. Homothallic Aspergillus waksmanii sp. nov. was isolated from New Jersey soil (USA) and is represented by the ex-type isolate NRRL 179T (=CCF 4266T=Thom 4138.HS2T=IBT 31900T......). Aspergillus marvanovae sp. nov. was isolated from water with high boracic acid anions content in Dukovany nuclear power station (Czech Republic). The sexual stage of this species is unknown, but the MAT1-1 locus was successfully amplified suggesting that the species is probably heterothallic and teleomorphic...... but is represented by only the ex-type isolate CCM 8003T (=CCF 4037T=NRRL 62486T=IBT 31279T=IFM 60873T). Both species can be distinguished from all previously described species in section Fumigati based on morphology, maximum growth temperature, sequence data from five unlinked loci and unique secondary metabolites...

  3. Six New Polyacetylenic Alcohols from the Marine Sponges Petrosia sp. and Halichondria sp.

    Science.gov (United States)

    Gabriel, Adeyemi Francis; Li, Zhen; Kusuda, Ryouhei; Tanaka, Chiaki; Miyamoto, Tomofumi

    2015-01-01

    Six new polyacetylenic alcohols, termed strongylotriols A and B; pellynols J, K, and L; and isopellynol A, together with three known polyacetylenic alcohols, pellynols A, B, and C were isolated from the marine sponges Petrosia sp., and Halichondria sp. collected in Okinawa, Japan. Their planer structures were determined based on 2D-NMR and mass spectrometric analysis of the degraded products by RuCl3 oxidation. The absolute stereochemistry of isolates was examined by their Mosher's esters. The strongylotriols were found to be optically pure compounds, whereas the pellynols are diastereomeric mixtures at the C-6 position. Proliferation experiments using the HeLa and K562 cell lines suggested that the essential structural units for activity are the "hexa-2,4-diyn-1,6-diol" and "pent-1-en-4-yn-3-ol" on the termini.

  4. Kinerja probiotik Bacillus sp. pada pendederan benih ikan lele Clarias sp. yang diinfeksi Aeromonas hydrophila

    Directory of Open Access Journals (Sweden)

    , Sukenda

    2016-12-01

    Full Text Available ABSTRACT This experiment was conducted to assess performance of Bacillus sp. probiotic on catfish juvenile Clarias sp. infected by Aeromonas hydrophila. The probiotic content in the diets were 0% (K+ and K-, 1%, and 2% in duplicates. This experiment used randomized design with four treatments and two replications. Juveniles with average body weight of 3.22±0.15 g/fish were reared in the 1.5×2.8×0.5 m3 pond with density of 800 fish/pond. Fish were reared for 30 days and fed three times a day at rate 8% of  total body weight. At day 31, catfish were challenged by A. hydrophila 0.1 mL (106 cfu/mL. Post infection observation was carried out ten days with density 10 fish/aquaria. The result showed that fish fed diet containing 2% probiotic gave the best probiotic performance with survival rate of catfish 83.33% after challenged, spesific growth rate 5.40%, and 0,75 of feed conversion ratio. The results of the blood profile showed significantly better results in the treatment of probiotics compared to the positive control after challenge test A. hydrophila. Probiotic Bacillus sp. has given as much as 2% on feed provides better performance on catfish juvenile. Keywords: probiotic, Bacillus sp., A. hydrophila, catfish juvenille, growth  ABSTRAK Penelitian ini bertujuan untuk menguji kinerja probiotik Bacillus sp. dalam pakan pada pendederan benih ikan lele Clarias sp. yang diinfeksi bakteri Aeromonas hydrophila. Penelitian ini menggunakan rancangan acak lengkap dengan empat perlakuan yaitu kandungan probiotik dalam pakan perlakuan yaitu 0% (K+ dan K-, 1%,  dan 2%, masing-masing dengan dua ulangan. Ikan lele yang digunakan memiliki bobot rata-rata 3,22±0,15 g/ekor, dipelihara dalam kolam terpal berukuran 1,5×2,8×0,5 m3 dengan kepadatan 800 ekor/kolam. Ikan dipelihara selama 30 hari dengan frekuensi pemberian pakan tiga kali sehari sebanyak 8% dari bobot tubuh ikan. Hari ke-31 benih lele diinjeksi bakteri A. hydrophila dosis 0,1 m

  5. Descriptions of Deladenus albizicus n. sp. and D. processus n. sp. (Nematoda: Hexatylina) from Haryana, India.

    Science.gov (United States)

    Tomar, V V S; Somvanshi, Vishal S; Bajaj, Harish K

    2015-03-01

    Two different nematodes were isolated from the bark of Albizia lebbeck trees; one from insect infested and another from noninfested, healthy tree. Based on the biological, morphological, and molecular evidences, the nematodes are described as Deladenus albizicus n. sp. and D. processus n. sp. (Nematoda: Hexatylina). Deladenus albizicus n. sp., isolated from insect-infested tree, multiplied on the fungus Nigrospora oryzae. Myceliophagous females of this nematode reproduced by parthenogenesis and spermathecae were indistinct. Infective females, readily produced in the cultures, are dorsally curved. Only one type of males containing small-sized sperms in their genital tracts were produced in the culture. Myceliophagous females: L = 0.75 to 1.71 mm, a = 32.3 to 50.8, b = 9.3 to 11.2, b' = 5.2 to 7.3, c = 27.2 to 35.6, V = 91.0 to 93.3, c' = 2.0 to 2.9, stylet = 11 to 12 µm, excretory pore in the region of median pharyngeal bulb, 43 to 47 µm anterior to hemizonid. Deladenus processus n. sp., isolated from bark of healthy A. lebbeck tree, was cultured on Alternaria alternata. Myceliophagous females reproduced by amphimixis and their spermathecae contained rounded sperms. Infective females were never produced, even in old cultures. Myceliophagous females: L = 0.76 to 0.99 mm, a = 34 to 49, b = 13.3 to 17.7, b' = 3.8 to 5.8, c = 19.6 to 22.8, V = 92.2 to 93.5, c' = 2.7 to 3.5, stylet = 6 to 7 µm, excretory pore in the proximity of hemizonid, tail conoid, tapering from both sides to a long pointed central process. It is proposed to classify Deladenus species in three groups: durus, siricidicola, and laricis groups based on female and spermatogonia dimorphism, mode of reproduction, and insect parasitism.

  6. Neorickettsia risticii, Rickettsia sp. and Bartonella sp. in Tadarida brasiliensis bats from Buenos Aires, Argentina.

    Science.gov (United States)

    Cicuttin, Gabriel L; De Salvo, María N; La Rosa, Isabel; Dohmen, Federico E Gury

    2017-06-01

    Bats are potential reservoirs of many vector-borne bacterial pathogens. The aim of the present study was to detect species of Anaplasma, Ehrlichia, Neorickettsia, Rickettsia, Borrelia and Bartonella in Brazilian free-tailed bats (Tadarida brasiliensis, Molossidae) from Buenos Aires city, Argentina. Between 2012 and 2013, 61 T. brasiliensis from urban areas of Buenos Aires city were studied. The samples were molecularly screened by PCR and sequencing. Five bats (8.2%) were positive to Neorickettsia risticii, one (1.6%) was positive to Rickettsia sp. and three bats (4.9%) to Bartonella sp. For molecular characterization, the positive samples were subjected to amplification and sequencing of a fragment of p51 gene for N. risticii, a fragment of citrate synthase gene (gltA) for Rickettsia genus and a fragment of gltA for Bartonella genus. Phylogenetic tree was constructed using the maximum-likelihood method. Phylogenetic analysis of N. risticii detect in our study revealed that it relates to findings in the USA West Coast; Rickettsia sp. detected is phylogenetically within R. bellii group, which also includes many other Rickettsia endosymbionts of insects; and Bartonella sp. found is related to various Bartonella spp. described in Vespertilionidae bats, which are phylogenetically related to Molossidae. Our results are in accordance to previous findings, which demonstrate that insectivorous bats could be infected with vector-borne bacteria representing a potential risk to public health. Future research is necessary to clarify the circulation of these pathogens in bats from Buenos Aires. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Endosulfan induced alteration in bacterial protein profile and RNA yield of Klebsiella sp. M3, Achromobacter sp. M6, and Rhodococcus sp. M2.

    Science.gov (United States)

    Singh, Madhu; Singh, Dileep Kumar

    2014-01-30

    Three bacterial strains identified as Klebsiella sp. M3, Achromobacter sp. M6 and Rhodococcus sp. M2 were isolated by soil enrichment with endosulfan followed by shake flask enrichment technique. They were efficiently degrading endosulfan in the NSM (non sulfur medium) broth. Degradation of endosulfan was faster with the cell free extract of bacterial cells grown in the sulfur deficient medium (NSM) supplemented with endosulfan than that of nutrient rich medium (Luria Bertani). In the cell free extract of NSM supplemented with endosulfan as sole sulfur source, a unique band was visualized on SDS-PAGE but not with magnesium sulfate as the sole sulfur source in NSM and LB with endosulfan. Expression of a unique polypeptide band was speculated to be induced by endosulfan under sulfur starved condition. These unique polypeptide bands were identified as OmpK35 protein, sulfate binding protein and outer membrane porin protein, respectively, in Klebsiella sp. M3, Achromobacter sp. M6 and Rhodococcus sp. M2. Endosulfan showed dose dependent negative effect on total RNA yield of bacterial strains in nutrient rich medium. Absence of plasmid DNA indicated the presence of endosulfan metabolizing gene on genomic DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. From spent graphite to amorphous sp2+sp3 carbon-coated sp2 graphite for high-performance lithium ion batteries

    Science.gov (United States)

    Ma, Zhen; Zhuang, Yuchan; Deng, Yaoming; Song, Xiaona; Zuo, Xiaoxi; Xiao, Xin; Nan, Junmin

    2018-02-01

    Today, with the massive application of lithium ion batteries (LIBs) in the portable devices and electric vehicles, to supply the active materials with high-performances and then to recycle their wastes are two core issues for the development of LIBs. In this paper, the spent graphite (SG) in LIBs is used as raw materials to fabricate two comparative high-capacity graphite anode materials. Based on a microsurgery-like physical reconstruction, the reconstructed graphite (RG) with a sp2+sp3 carbon surface is prepared through a microwave exfoliation and subsequent spray drying process. In contrast, the neural-network-like amorphous sp2+sp3 carbon-coated graphite (AC@G) is synthesized using a self-reconfigurable chemical reaction strategy. Compared with SG and commercial graphite (CG), both RG and AC@G have enhanced specific capacities, from 311.2 mAh g-1 and 360.7 mAh g-1 to 409.7 mAh g-1 and 420.0 mAh g-1, at 0.1C after 100 cycles. In addition, they exhibit comparable cycling stability, rate capability, and voltage plateau with CG. Because the synthesis of RG and AC@G represents two typical physical and chemical methods for the recycling of SG, these results on the sp2+sp3 carbon layer coating bulk graphite also reveal an approach for the preparation of high-performance graphite anode materials derived from SG.

  9. Wnt-mediated down-regulation of Sp1 target genes by a transcriptional repressor Sp5

    Czech Academy of Sciences Publication Activity Database

    Fujimura, Naoko; Vacík, Tomáš; Machoň, Ondřej; Vlček, Čestmír; Scalabrin, S.; Speth, M.; Diep, D.; Krauss, S.; Kozmik, Zbyněk

    2007-01-01

    Roč. 282, č. 2 (2007), s. 1225-1237 ISSN 0021-9258 Institutional research plan: CEZ:AV0Z50520514 Keywords : Wnt -mediated signaling * Sp5 transcription factor * Sp1 target genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.581, year: 2007

  10. Structural Analysis of Planar sp3 and sp2 Films: Diamond-Like Carbon and Graphene Overlayers

    KAUST Repository

    Mansour, Ahmed

    2011-01-01

    pure sp2 as in graphene, carbon nanotubes and fullerenes, to pure sp3 as in diamond. Amorphous and diamond-like carbon consists of a mixture of both hybridizations. This variation in hybridization in carbon materials enables a wide spectrum

  11. Formulation of a minimal nutritional medium for enhanced lipid productivity in Chlorella sp. and Botryococcus sp. using response surface methodology.

    Science.gov (United States)

    Vishwakarma, Rashi; Dhar, Dolly Wattal; Pabbi, Sunil

    2018-03-01

    Chlorella sp. MCC 7 and Botryococcus sp. MCC 31 were investigated to enable large-scale biodiesel production from minimal constituents in the growth medium. Response surface methodology (RSM) was used to maximise the biomass productivity and lipid yield using only nitrogen (N), phosphorus (P) and potassium (K) as urea, single super phosphate and muriate of potash. The optimum values were 0.42 g/L nitrogen; 0.14 g/L phosphorus and 0.22 g/L potassium for Chlorella sp.; and 0.46 g/L; 0.14 g/L and 0.25 g/L for Botryococcus sp. Lipid yield of 42% for Chlorella sp. and 52% in Botryococcus sp. was observed. An enhancement in lipid yield by approximately 55% for Chlorella sp. and 73% for Botryococcus sp. was registered as compared to original nutrient medium. Fourier transform infrared (FTIR) analysis of extracted lipids revealed characteristic bands for triglycerides. This study provided utilisation of a practicable nutrient recipe in the form of N, P, K input for enhanced lipid yield from the selected microalgal strains.

  12. Elevated expression and potential roles of human Sp5, a member of Sp transcription factor family, in human cancers

    International Nuclear Information System (INIS)

    Chen Yongxin; Guo Yingqiu; Ge Xijin; Itoh, Hirotaka; Watanabe, Akira; Fujiwara, Takeshi; Kodama, Tatsuhiko; Aburatani, Hiroyuki

    2006-01-01

    In this report, we describe the expression and function of human Sp5, a member of the Sp family of zinc finger transcription factors. Like other family members, the Sp5 protein contains a Cys2His2 zinc finger DNA binding domain at the C-terminus. Our experiments employing Gal4-Sp5 fusion proteins reveal multiple transcriptional domains, including a N-terminal activity domain, an intrinsic repressive element, and a C-terminal synergistic domain. Elevated expression of Sp5 was noted in several human tumors including hepatocellular carcinoma, gastric cancer, and colon cancer. To study the effects of the Sp5 protein on growth properties of human cancer cells and facilitate the identification of its downstream genes, we combined an inducible gene expression system with microarray analysis to screen for its transcriptional targets. Transfer of Sp5 into MCF-7 cells that expressed no detectable endogenous Sp5 protein elicited significant growth promotion activity. Several of the constitutively deregulated genes have been associated with tumorigenesis (CDC25C, CEACAM6, TMPRSS2, XBP1, MYBL1, ABHD2, and CXCL12) and Wnt/β-Catenin signaling pathways (BAMBI, SIX1, IGFBP5, AES, and p21 WAF1 ). This information could be utilized for further mechanistic research and for devising optimized therapeutic strategies against human cancers

  13. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    Science.gov (United States)

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  14. PENGGUNAAN EKSTRAK BIOTA LAUTAGLAOPHENIA SP. UNTUK MENGENDALIKANFUSARIUM OXYSPORUM F.SP.VANILLAE PENYEBAB BUSUK BATANG VANILI

    Directory of Open Access Journals (Sweden)

    I KETUT SUADA

    2012-11-01

    Full Text Available The Use of Aglaophenia sp. Marine Biota Extract to Control Fusarium oxysporum f. sp. vanillae, a Pathogen of Vanilla Stem Rot The use of marine biota for organic fungicide material has enormous potential to be developed. The organic fungicide was directed to substitute synthetic fungicide for vanilla cultivation. Application of synthetic fungicide degraded environmental quality, therefore its applications does not support sustainable agriculture. The objective of this research was to know the potence of Aglaopheniain suppressing the growth of F. oxysporum f. sp.vanillae, the pathogen of vanilla stem rot. The research was done in green house in order to find the best substance for formulation of the extract. The substances screened were water, tween-80, and detergents with two different concentrations. Subsequently, two best formulas were chosen to apply in endemic area in Tabanan. The green house and field trial research used Randomized Completely Design with three and five replications respectively. Results showed that tween was the best substance used for formulation and concentration of 0.2% was better than other concentrations. The extract diluted in tween-80 on the concentration of 0.2% showed the lowest rot on stem, longest shoot, and the most leaves on vanilla shoot. Because of its significant performance, the 0.1% extract ofAglaopheniain 0.1% tween-80 was proposed to be the best formula to suppress the vanilla stem rot disease.

  15. A sp2+sp3 hybridized carbon allotrope transformed from AB stacking graphyne and THD-graphene

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2018-01-01

    Full Text Available New carbon allotropes can be designed by combining sp, sp2 and sp3 three hybridization states. And the hybridization states or coordination numbers of carbon atoms can be changed by applying high pressure on carbon materials. In this study, a common high pressure phase (named as TBBC transformed from AB-stacking graphyne or THD-graphene is predicted. Its kinetic stability is examined using finite displacement method. We find that the sp2 and sp3 hybridized carbon atoms behave different vibration features at high frequency region. Both graphene-like and diamond-like vibration peaks occurs. Phase transition energy barriers from both graphyne and THD-graphene to TBBC are estimated. Electronic structure calculations show that the TBBC is an indirect semiconductor with a bandgap of 0.66 eV. The ideal tensile strength of TBBC is high in [0001] and [11¯00] directions, but is weak along [12¯10] direction.

  16. Kinetics of petroleum oil biodegradation by a consortium of three protozoan isolates (Aspidisca sp., Trachelophyllum sp. and Peranema sp.

    Directory of Open Access Journals (Sweden)

    L. Kachieng’a

    2017-09-01

    Full Text Available Petroleum oil is a complex mixture of substances, the majority of which are hydrocarbons; the latter represent an extremely important and heterogeneous group of compounds that find their way into water resources by anthropogenic or natural ways. The majority of toxic hydrocarbon components of petroleum are biodegradable, where bioremediation using microbial species has become an integral process for the restoration of oil-polluted areas. In this study, three bioremediation processes, namely natural attenuation, nutrient supplementation by adding glucose and biostimulation by adding Tween® 80, were carried out in various petroleum hydrocarbon concentrations in polluted water media using a consortium of three protozoan isolates (Aspidisca sp., Trachelophyllum sp. and Peranema sp.. A first-order kinetics model was fitted to the biodegradation data to evaluate the biodegradation rate and to determine the corresponding half-life time. First-order kinetics satisfactorily described the biodegradation of the petroleum-based contaminants under abiotic conditions. The results showed an increase in the percentage removal of petroleum oil at the lower petroleum concentrations and a gradual percentage decrease in removing petroleum oil residues occurred when there was an increase in the initial concentrations of the petroleum oil: 39%, 27%, 22%, 12%, 10% for various petroleum oil concentrations of 50, 100, 150, 200, 250 mg/L, respectively. A similar trend was also observed in the glucose-supplemented culture media where the reduction was 45% and 78% for petroleum concentrations of 250 mg/L and 50 mg/L, respectively. Biodegradation of between 33 and 90% was achieved at a Tween® 80 concentration of between 50 mg/L and 250 mg/L. The degradation rate constants for the natural attenuation process ranged between ≥0 to ≤0.50, ≥0 to ≤0.35, ≥0 to ≤0.25, ≥0 to ≤ 0.14 and ≥ 0 to ≤0.11 for petroleum oil concentrations varying from 50, 100, 150

  17. Cr(VI) reduction from contaminated soils by Aspergillus sp. N2 and Penicillium sp. N3 isolated from chromium deposits.

    Science.gov (United States)

    Fukuda, Tsubasa; Ishino, Yasuhiro; Ogawa, Akane; Tsutsumi, Kadzuyo; Morita, Hiroshi

    2008-10-01

    Aspergillus sp. N2 and Penicillium sp. N3 are chromate-resistant filamentous fungi that were isolated from Cr(VI) contaminated soil based on their ability to decrease hexavalent chromium levels in the growth medium. After 120 h of growth in a medium containing 50 ppm Cr(VI) at near neutral pH, Aspergillus sp. N2 reduced the Cr(VI) concentration by about 75%. Penicillium sp. N3 was able to reduce the Cr(VI) concentration by only 35%. However, Penicillium sp. N3 reduced the Cr(VI) concentration in the medium by 93% under acidic conditions. Interestingly, the presence of Cu(II) enhanced the Cr(VI) reducing ability of Aspergillus sp. N2 and Penicillium sp. N3 at near neutral pH. Aspergillus sp. N2 and Penicillium sp. N3 reduced the Cr(VI) concentration in the growth medium to a virtually undetectable level within 120 h. For both Aspergillus sp. N2 and Penicillium sp. N3, mycelial seed cultures were more efficient at Cr(VI) reduction than conidium seed cultures. The mechanisms of Cr(VI) reduction in Aspergillus sp. N2 and Penicillium sp. N3 were enzymatic reduction and sorption to mycelia. Enzymatic activity contributed significantly to Cr(VI) reduction. Aspergillus sp. N2 and Penicillium sp. N3 reduced the levels of Cr(VI) in polluted soil samples, suggesting that these strains might be useful for cleaning up chromium-contaminated sites.

  18. DAN IDENTIFIKASI PATOGEN POTENSIAL YANG MENGINFEKSI IKAN RAINBOW (Melanotaenia sp.

    Directory of Open Access Journals (Sweden)

    Lili Sholichah

    2014-03-01

    Full Text Available Pemeliharaan ikan rainbow (Melanotaenia sp. di Balai Penelitian dan Pengembangan Budidaya Ikan Hias selalu terjadi kematian secara bertahap mulai calon induk hingga proses pemijahan. Hal ini terjadi berulang kali sehingga ketersediaan induk Melanotaenia sp. sangat terancam. Ikan ini berasal dari Papua yang diperoleh mengandalkan penangkapan di alam. Tujuan dari penelitian ini adalah untuk menginventarisir dan mengidentifikasi berbagai patogen (parasit, jamur, bakteri potensial yang menginfeksi ikan rainbow yang dipelihara di dalam akuarium berukuran 50 cm x 50 cm x 50 cm dengan sistem aliran air stagnan. Tiga jenis rainbow yang dipelihara yaitu: rainbow Sungai Salawati, asal Sungai Sawiat, dan asal Danau Kurumoi. Setiap ikan masing-masing berjumlah 100 ekor dipelihara di akuarium dengan penambahan batu karang dan tanpa penambahan karang (kontrol ke dalam akuarium. Ikan diberi pakan sekenyangnya berupa jentik nyamuk dan cacing rambut beku setiap pagi dan sore hari. Sampling dilakukan secara random sebulan sekali dan secara unrandom setiap ada kejadian ikan sakit. Gejala klinis ikan yang sakit sebagai berikut: ikan berenang di permukaan dan menggosok-gosokkan badan di dinding akuarium, nafsu makan berkurang, gerakan berputar-putar, warna memudar menjadi putih, penekanan warna hitam pada sirip punggung dan perut meningkat, pendarahan pada perut, lendir berlebihan dan sangat berbau, serta sisik berdiri/terbuka. Diagnosa dan deteksi penyakit awal berupa pengamatan parasit baik ektoparasit maupun endoparasit, pengamatan dan isolasi jamur pada media selektif jamur, dan isolasi bakteri dilakukan untuk mengetahui jenis-jenis patogen yang menginfeksi ketiga jenis ikan rainbow. Selanjutnya dilakukan uji histologi dan analisa DNA beberapa patogen. Hasil pengamatan diperoleh patogen berupa parasit (Ichthyophthirius sp., Dactylogyrus sp., Gyrodactylus sp., dan Trichodina sp. dan bakteri (Aeromonas hydrophila, Acinetobacter sp

  19. Scalability of Parallel Spatial Direct Numerical Simulations on Intel Hypercube and IBM SP1 and SP2

    Science.gov (United States)

    Joslin, Ronald D.; Hanebutte, Ulf R.; Zubair, Mohammad

    1995-01-01

    The implementation and performance of a parallel spatial direct numerical simulation (PSDNS) approach on the Intel iPSC/860 hypercube and IBM SP1 and SP2 parallel computers is documented. Spatially evolving disturbances associated with the laminar-to-turbulent transition in boundary-layer flows are computed with the PSDNS code. The feasibility of using the PSDNS to perform transition studies on these computers is examined. The results indicate that PSDNS approach can effectively be parallelized on a distributed-memory parallel machine by remapping the distributed data structure during the course of the calculation. Scalability information is provided to estimate computational costs to match the actual costs relative to changes in the number of grid points. By increasing the number of processors, slower than linear speedups are achieved with optimized (machine-dependent library) routines. This slower than linear speedup results because the computational cost is dominated by FFT routine, which yields less than ideal speedups. By using appropriate compile options and optimized library routines on the SP1, the serial code achieves 52-56 M ops on a single node of the SP1 (45 percent of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a "real world" simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP supercomputer. For the same simulation, 32-nodes of the SP1 and SP2 are required to reach the performance of a Cray C-90. A 32 node SP1 (SP2) configuration is 2.9 (4.6) times faster than a Cray Y/MP for this simulation, while the hypercube is roughly 2 times slower than the Y/MP for this application. KEY WORDS: Spatial direct numerical simulations; incompressible viscous flows; spectral methods; finite differences; parallel computing.

  20. Genetic polymorphism of horse serum protein 3 (SP3).

    Science.gov (United States)

    Juneja, R K; Sandberg, K; Kuryl, J; Gahne, B

    1989-01-01

    Two-dimensional agarose gel (pH 8.6)-horizontal polyacrylamide gel (pH 9.0) electrophoresis of horse serum samples, followed by general protein staining, revealed genetic polymorphism of an unidentified protein tentatively designated serum protein 3 (SP3). The SP3 fractions appeared distinctly when a 14% concentration of acrylamide was used in the separation gels. The 2-D mobilities of SP3 fractions were quite similar to that of albumin. Family data were consistent with the hypothesis that the observed SP3 phenotypes were controlled by four co-dominant, autosomal alleles (D, F, I, S). Evidence was provided that the F allele can be further divided into two alleles (F1 and F2); the mobilities of F1 and F2 variants were very similar. Each of the SP3 alleles gave rise to one fraction and each of the heterozygous types showed two fractions. More than 600 horses representing five different breeds (Swedish Trotter, North-Swedish Trotter, Thoroughbred, Arab and Polish Tarpan) were typed for SP3, and allele frequency estimates were calculated. SP3 was highly polymorphic in all breeds studied.

  1. Reparation and Immunomodulating Properties of Bacillus sp. Metabolites from Permafrost.

    Science.gov (United States)

    Kalenova, L F; Melnikov, V P; Besedin, I M; Bazhin, A S; Gabdulin, M A; Kolyvanova, S S

    2017-09-01

    An ointment containing metabolites of Bacillus sp. microorganisms isolated from permafrost samples was applied onto the skin wound of BALB/c mice. Metabolites isolated during culturing of Bacillus sp. at 37°C produced a potent therapeutic effect and promoted wound epithelialization by 30% in comparison with the control (ointment base) and by 20% in comparison with Solcoseryl. Treatment with Bacillus sp. metabolites stimulated predominantly humoral immunity, reduced the time of wound contraction and the volume of scar tissue, and promoted complete hair recovery. These metabolites can be considered as modulators of the wound process with predominance of regeneration mechanisms.

  2. Post-neonatal drop in alveolar SP-A expression

    DEFF Research Database (Denmark)

    Stray-Pedersen, Arne; Vege, Ashild; Stray-Pedersen, Asbjorg

    2008-01-01

    BACKGROUND: Surfactant protein A (SP-A) is synthesized in the lung and is a part of the innate immune system. The aim of this study was to evaluate the expression of SP-A in lung tissue from fetuses, infants, children and adults with special regard to sudden infant death syndrome (SIDS). METHODS......: A total of 160 cases were studied; 19 fetuses and neonates, 59 SIDS and 49 explained infant deaths below 1 year of age, 19 toddlers and 14 adults. Immunohistochemical detection of SP-A using monoclonal antibodies was performed by microscopy of lung tissue specimens collected at autopsy. A scoring system...

  3. Efektivitas Ovitrap Bambu terhadap Jumlah Jentik Aedes sp yang Terperangkap

    Directory of Open Access Journals (Sweden)

    Wiwit Aditama

    2015-05-01

    places of 10 subdistricts. Data of trapped Aedes sp larvae numbers was collected four times repeatedly within one week time-lapse. Analysis was conducted using the mean number of larvae in ovitraps and ovitrap index. The number of Aedes sp larvae trapped was 1,265. The most effective ovitrap is piece of bamboo, mean = 123, p value = 0.006, HI = 10.01% (16.66 26.67%, CI = 36.8% (336.06 - 39.74%, BI = 29.97% (73.33 - 103.3%. Health authorities should promote bamboo ovitrap, especially to public as an effort to control Aedes sp.

  4. Späte Mutterschaft – (keine biografische Entscheidung

    Directory of Open Access Journals (Sweden)

    Martina Beham

    2004-11-01

    Full Text Available Der Übergang in die Mutterschaft findet zunehmend später statt. Über die Gründe liegen zahlreiche Vermutungen und einige theoretische Diskussionen, aber kaum empirische Befunde vor. Die Autorinnen möchten mit ihrer Studie einen Beitrag zum Abbau dieses Forschungsdefizits leisten. In ihrer empirisch-biografischen Untersuchung gehen Ingrid Herlyn und Dorothea Krüger der Frage nach, ob späte Erstmutterschaft ein neues biografisches Muster der Familiengründung darstellt oder ob Mutterschaft nach wie vor eine selbstverständlich anerkannte Norm ist, deren Realisierung im Lebenslauf lediglich zeitlich später stattfindet.

  5. Pengaruh Perbedaan Konsentrasi Ekstrak Sargassum sp. dan Lama Penyimpanan terhadap Oksidasi Lemak pada Fillet Ikan Patin (Pangasius sp.

    Directory of Open Access Journals (Sweden)

    Fatin Hidayati

    2017-05-01

    Full Text Available ABSTRAK Ikan patin merupakan ikan air tawar yang mengandung lemak dan protein tinggi sehingga apabila dilakukan penyimpanan rentan terjadi oksidasi yang mengakibatkan ketengikan. Sargassum sp. dengan kandungan fenol dan flavonoid mampu menghambat terjadinya oksidasi pada fillet ikan patin. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan ekstrak Sargassum sp. dan lama penyimpanan dalam menghambat terjadinya oksidasi pada fillet ikan patin. Materi yang digunakan dalam penelitian ini adalah ekstrak Sargassum sp. dan fillet ikan patin. Metode penelitian yang digunakan adalah experimental laboratories dengan menggunakan Rancangan Acak Lengkap (RAL faktorial dengan 2 faktor yaitu konsentrasi ekstrak Sargassum sp. (0%, 1%, 1,5% dan 2% dan lama penyimpanan (hari ke-0, hari ke-2, hari ke-4, dan hari ke-6. Hasil penelitian menunjukkan bahwa perbedaan penambahan konsentrasi ekstrak Sargassum sp. dan lama penyimpanan memberikan pengaruh nyata terhadap nilai PV, nilai TBA, kadar lemak, kadar protein, kadar air serta organoleptik (P < 0,05. Hasil penelitian tahap I didapatkan rendemen Sargassum sp. dengan pelarut etanol 96% sebesar 1,39%, kandungan fenol 1,813%, flavonoid 0,278% dan aktivitas antioksidan 99,1659 ppm (kuat. Hasil penelitian tahap II didapatkan nilai PV berkisar antara 2,03 - 19,82 meq/kg, nilai TBA 0,63 - 6,72 mg.mal/kg. Konsentrasi 1,5% merupakan konsentrasi terbaik ekstrak Sargassum sp. dalam menghambat oksidasi lemak pada fillet ikan patin selama penyimpanan. Kata kunci: Antioksidan, Ekstrak Sargassum sp., Lama Penyimpanan, Oksidasi lemak, Fillet Ikan patin ABSTRACT Catfish is a freshwater fish that contain high fat and protein so that if its stored it will susceptible to oxidation process which leads to rancidity. Sargassum sp. with its phenolic and flavonoid content are able to inhibit the oxidation process in catfish fillet. This research was aimed to know the effects of different concentrations of Sargassum sp. extracts and

  6. Mycorrhizal dependency of laurel (Ocotea sp.)

    International Nuclear Information System (INIS)

    Sierra-Escobar, Jorge A; Castro Restrepo, Dagoberto; Osorio Vega, Walter

    2009-01-01

    A greenhouse experiment was carried out to determine the mycorrhizal dependency of laurel (>Ocotea sp.). In order to do this, a completely randomized experimental design was used, with six treatments in a factorial array of 3 x 2 and five repetitions. The treatments involved a combination of three Phosphorus (P) levels in soil solution (0.002, 0.02 and 0.2 mg L-1) and two levels of mycorrhizal inoculation, either inoculated or non-inoculated with Glomus aggregatum Schenck and Smith. The leaf P content as a function of time was used as an output variable. Shoot dry matter, shoot P content, mycorrhizal colonization of roots, and mycorrhizal dependence were measured at harvest. The results indicated that the leaf P content increased significantly when using the mycorrhizal inoculation in laurel at P level 0.2 mg L -1, but not in the other P levels, on some of the sampling days. Shoot dry weight and total plant P content did not increase at all levels of soil available P. Mycorrhizal dependency of laurel reached 28%, which allows this species to be classified as moderately dependent on mycorrhiza.

  7. Production of biodiesel from Coelastrella sp. microalgae

    Science.gov (United States)

    Mansur, Dieni; Fitriady, Muhammad Arifuddin; Susilaningsih, Dwi; Simanungkalit, Sabar Pangihutan

    2017-11-01

    Microalgae have a wide area of usage and one of them it can be used for biodiesel production. In biodiesel production, lipids containing triglyceride or free fatty acid are converted into methyl ester through trans/esterification reactions. Lipids from microalgae can be extracted by acetone and dimethyl carbonate using homogenizer. Esterification of the lipids was investigated using various catalysts and source of methyl group. Activity of homogeneous catalyst such as HCl and H2SO4 and heterogeneous catalysts such as montmorillonit K-10 and ledgestone was investigated. Moreover, methanol and dimethyl carbonate as source of methyl group were also studied. Among of catalysts with methanol as source of methyl group, it was found that yield of crude biodiesel derived from Choelestrella Sp. microalgae was high over H2SO4 catalyst. On the other hand, over H2SO4 catalyst using dimethyl carbonate as source of methyl group, yield of crude biodiesel significant increase. However, FAME composition of crude biodiesel was high over HCl catalyst.

  8. Campylobacter iguaniorum sp. nov., isolated from reptiles.

    Science.gov (United States)

    Gilbert, Maarten J; Kik, Marja; Miller, William G; Duim, Birgitta; Wagenaar, Jaap A

    2015-03-01

    During sampling of reptiles for members of the class Epsilonproteobacteria, strains representing a member of the genus Campylobacter not belonging to any of the established taxa were isolated from lizards and chelonians. Initial amplified fragment length polymorphism, PCR and 16S rRNA sequence analysis showed that these strains were most closely related to Campylobacter fetus and Campylobacter hyointestinalis. A polyphasic study was undertaken to determine the taxonomic position of five strains. The strains were characterized by 16S rRNA and atpA sequence analysis, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry and conventional phenotypic testing. Whole-genome sequences were determined for strains 1485E(T) and 2463D, and the average nucleotide and amino acid identities were determined for these strains. The strains formed a robust phylogenetic clade, divergent from all other species of the genus Campylobacter. In contrast to most currently known members of the genus Campylobacter, the strains showed growth at ambient temperatures, which might be an adaptation to their reptilian hosts. The results of this study clearly show that these strains isolated from reptiles represent a novel species within the genus Campylobacter, for which the name Campylobacter iguaniorum sp. nov. is proposed. The type strain is 1485E(T) ( = LMG 28143(T) = CCUG 66346(T)). © 2015 IUMS.

  9. Parapedobacter koreensis gen. nov., sp. nov.

    Science.gov (United States)

    Kim, Myung Kyum; Na, Ju-Ryun; Cho, Dong Ha; Soung, Nak-Kyun; Yang, Deok-Chun

    2007-06-01

    Strain Jip14(T), a Gram-negative, non-spore-forming, rod-shaped, non-motile bacterium, was isolated from dried rice straw and characterized in order to determine its taxonomic position. 16S rRNA gene sequence analysis revealed that strain Jip14(T) belongs to the family Sphingobacteriaceae, and the highest degree of sequence similarity was determined to be to Pedobacter saltans DSM 12145(T) (88.5 %), Pedobacter africanus DSM 12126(T) (87.6 %), Pedobacter heparinus DSM 2366(T) (87.1 %) and Pedobacter caeni LMG 22862(T) (86.9 %). Chemotaxonomic data revealed that strain Jip14(T) possesses menaquinone MK-7 and the predominant fatty acids C(15 : 0) iso, C(16 : 0), C(16 : 0) 10-methyl, C(17 : 0) iso 3-OH and summed feature 3 (C(15 : 0) iso 2-OH/C(16 : 1)omega7c). The results of physiological and biochemical tests clearly demonstrated that strain Jip14(T) represents a distinct species. Based on these data, Jip14(T) should be classified within a novel genus and species, for which the name Parapedobacter koreensis gen. nov., sp. nov. is proposed. The type strain of Parapedobacter koreensis is Jip14(T) (=KCTC 12643(T)=LMG 23493(T)).

  10. Pedobacter insulae sp. nov., isolated from soil.

    Science.gov (United States)

    Yoon, Jung-Hoon; Kang, So-Jung; Oh, Hyun Woo; Oh, Tae-Kwang

    2007-09-01

    A Gram-negative, non-motile, rod-shaped bacterium, DS-139(T), was isolated from a soil sample collected from Dokdo, Korea, and subjected to a polyphasic taxonomic analysis. Strain DS-139(T) grew optimally at 25 degrees C and pH 6.5-7.5 in the presence of 0-0.5 % (w/v) NaCl. It contained MK-7 as the predominant menaquinone and iso-C(15 : 0), C(16 : 1)omega7c and/or iso-C(15 : 0) 2-OH and iso-C(17 : 0) 3-OH as the major fatty acids. The DNA G+C content was 39.4 mol%. Phylogenetic analyses based on 16S rRNA gene sequences revealed that strain DS-39(T) belongs to the genus Pedobacter in the family Sphingobacteriaceae. The similarity values between the 16S rRNA gene sequence of strain DS-139(T) and those of the type strains of recognized Pedobacter species, except Pedobacter saltans, were in the range 93.9-96.7 %. The differential phenotypic properties, together with the phylogenetic distinctiveness, were sufficient to assign strain DS-139(T) to a species that is separate from recognized Pedobacter species. On the basis of the phenotypic and phylogenetic data, therefore, strain DS-139(T) represents a novel species of the genus Pedobacter, for which the name Pedobacter insulae sp. nov. is proposed. The type strain is DS-139(T) (=KCTC 12820(T) =DSM 18684(T)).

  11. Lactobacillus paralimentarius sp. nov., isolated from sourdough.

    Science.gov (United States)

    Cai, Y; Okada, H; Mori, H; Benno, Y; Nakase, T

    1999-10-01

    Six strains of lactic acid bacteria isolated from sourdough were characterized taxonomically. They were Gram-positive, catalase-negative, facultatively anaerobic rods that did not produce gas from glucose. Morphological and physiological data indicated that the strains belong to the genus Lactobacillus and they were similar to Lactobacillus alimentarius in phenotypic characteristics. These strains shared the same phenotypic characteristics and exhibited intragroup DNA homology values of over 89.8%, indicating that they comprised a single species. The G + C content of the DNA for the strains was 37.2-38.0 mol%. The 16S rRNA sequence of representative strain TB 1T was determined and aligned with that of other Lactobacillus species. This strain was placed in the genus Lactobacillus on the basis of phylogenetic analysis. L. alimentarius was the most closely related species in the phylogenetic tree and this species also showed the highest sequence homology value (96%) with strain TB 1T. DNA-DNA hybridization indicated that strain TB 1T did not belong to L. alimentarius. It is proposed that these strains are placed in the genus Lactobacillus as a new species, Lactobacillus paralimentarius sp. nov. The type strain of L. paralimentarius is TB 1T, which has been deposited in the Japan Collection of Microorganisms (JCM) as strain JCM 10415T.

  12. sp magnetism in clusters of gold thiolates

    International Nuclear Information System (INIS)

    Ayuela, A; Hernando, A; Echenique, P M; Crespo, P; García, M A

    2012-01-01

    Using first-principles calculations, we consider the bond between thiolate and small Au clusters, with particular emphasis on the resulting magnetic moment. The moment of pure gold clusters is 1 μ B for clusters with an odd number of Au atoms and zero for those with an even number. The addition of the thiolate, having an odd number of electrons itself, shifts the phase of the odd-even oscillations so that particles with an even number of Au atoms now have unit moment. Surprisingly, gold thiolate exhibits a dramatic and non-intuitive distribution of charge and spin moment. Our results show that the S-Au bond is such that sulfur does not get charge and an electron is transferred to the Au cluster. This extra electron is mainly sp in character and resides in an electronic shell below the Au surface. The calculations suggest that any thiolate-induced magnetism occurs in the gold nanoparticle and not the thiolate, and can be controlled by modifying the thiolate coverage. (paper)

  13. Preliminary SP-100/Stirling heat exchanger designs

    International Nuclear Information System (INIS)

    Schmitz, P.; Tower, L.; Blue, B.; Dunn, P.

    1994-01-01

    Analytic modeling of several heat exchanger concepts to couple the SP-100 nuclear reactor lithium loop and the Space Stirling Power Convertor (SSPC) was performed. Four 25 kWe SSPC's are used to produce the required 100 kW of electrical power. This design work focused on the interface between a single SSPC and the primary lithium loop. Manifolding to separate and collect the four channel flow was not modeled. This work modeled two separate types of heat exchanger interfaces (conductive coupling and radiative coupling) to explore their relative advantages and disadvantages. The minimum mass design of the conductively coupled concepts was 18 kg or 0.73 kg/kWe for a single 25 kWe convertor. The minimum mass radiatively coupled concept was 41 kg or 1.64 kg/kWe. The direct conduction heat exchanger provides a lighter weight system because of its ability to operate the Stirling convertor evaporator at higher heat fluxes than those attainable by the radiatively coupled systems. Additionally the conductively coupled concepts had relatively small volumes and provide potentially simpler assembly. Their disadvantages were the tight tolerances and material joining problems associated with this refractory to superalloy interface. The advantages of the radiatively coupled designs were the minimal material interface problems

  14. The Growth of Monoraphidium sp. and Scenedesmus sp. Cells in the Presence of Thorium

    Directory of Open Access Journals (Sweden)

    Juliana Cristina de Queiroz

    2012-01-01

    Full Text Available Toxicity of thorium by Monoraphidium sp. and Scenedesmus sp. was studied. Microalgal cultures were inoculated in ASM-1 medium in presence and absence of thorium. Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with software. The toxicity of thorium over the species was observed for concentrations over 50.0 mg/L. After 30 days, Monoraphidium cells decreased their concentration from 4.23×106 to 4.27×105 and 8.57×105 cells/mL, in the presence of 50.0 and 100.0 mg/L of thorium, respectively. Scenedesmus sp. cells were more resistant to thorium: for an initial cell concentration of 7.65×104 cells/mL it was observed a change to 5.25×105 and 5.12×105 cells/mL, in the presence of thorium at 50.0 and 100.0 mg/L, respectively. This is an indication that low concentrations of the radionuclide favored the growth, and that Scenedesmus cells are more resistant to thorium than Monoraphidium cells. The software used for comparison with direct count method proved to be useful for the improvement of accuracy of the results obtained, a decrease in the uncertainty and allowed recording of the data. The presence of thorium suggests that low concentrations have a positive effect on the growth, due to the presence of the nitrate, indicating its potential for ecotoxicological studies.

  15. The Growth of Monoraphidium sp. and Scenedesmus sp. Cells in the Presence of Thorium

    Science.gov (United States)

    de Queiroz, Juliana Cristina; Ferreira, Ana Cristina de Melo; da Costa, Antonio Carlos Augusto

    2012-01-01

    Toxicity of thorium by Monoraphidium sp. and Scenedesmus sp. was studied. Microalgal cultures were inoculated in ASM-1 medium in presence and absence of thorium. Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with software. The toxicity of thorium over the species was observed for concentrations over 50.0 mg/L. After 30 days, Monoraphidium cells decreased their concentration from 4.23 × 106 to 4.27 × 105 and 8.57 × 105 cells/mL, in the presence of 50.0 and 100.0 mg/L of thorium, respectively. Scenedesmus sp. cells were more resistant to thorium: for an initial cell concentration of 7.65 × 104 cells/mL it was observed a change to 5.25 × 105 and 5.12 × 105 cells/mL, in the presence of thorium at 50.0 and 100.0 mg/L, respectively. This is an indication that low concentrations of the radionuclide favored the growth, and that Scenedesmus cells are more resistant to thorium than Monoraphidium cells. The software used for comparison with direct count method proved to be useful for the improvement of accuracy of the results obtained, a decrease in the uncertainty and allowed recording of the data. The presence of thorium suggests that low concentrations have a positive effect on the growth, due to the presence of the nitrate, indicating its potential for ecotoxicological studies. PMID:22649297

  16. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J

    2007-05-01

    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  17. Cloning and expression of an amylase gene from Bacillus sp ...

    African Journals Online (AJOL)

    SAM

    2014-08-06

    Aug 6, 2014 ... Bacillus sp. isolated from an agricultural field in West. Bengal, India ... plants, even though, the competition is incipient (Sen,. 2007), and therefore ..... proteins: Engineering mesophilic–like activity and stability in a cold adapted ...

  18. Itinerant ferromagnetism in fermionic systems with SP (2 N) symmetry

    Science.gov (United States)

    Yang, Wang; Wu, Congjun

    The Ginzburg-Landau free energy of systems with SP (2 N) symmetry describes a second order phase transition on the mean field level, since the Casimir invariants of the SP (2 N) group can be only of even order combinations of the generators of the SP (2 N) group. This is in contrast with systems having the SU (N) symmetry, where the allowance of cubic term generally makes the phase transition into first order. In this work, we consider the Hertz-Millis type itinerant ferromagnetism in an interacting fermionic system with SP (2 N) symmetry, where the ferromagnetic orders are enriched by the multi-component nature of the system. The quantum criticality is discussed near the second order phase transition point.

  19. Phenotyping and molecular characterization of Lysinibacillus sp. P ...

    African Journals Online (AJOL)

    ) branched with Lysinibacillus boronitolerans with 89% bootstrap support. Lysinibacillus sp. P-011 (~105 cfu/ml) played an important role on larval development of D. melanogaster under controlled environmental condition. Wild larvae when ...

  20. Achelia shepherdi n. sp. and other Pycnogonida from Australia

    NARCIS (Netherlands)

    Stock, Jan H.

    1973-01-01

    Records of 10 species of shallow water Pycnogonida from Western Australia, Victoria, Tasmania, and New South Wales, including Achelia shepherdi n. sp., Parapallene avida Stock, 1973 (♀ new to science), and Anoplodactylus pulcher Carpenter, 1907 (new to Australia).

  1. Benefit Analysis of SPC Panel SP-2 Projects

    National Research Council Canada - National Science Library

    Robinson, Rodney A

    1993-01-01

    This Task has investigated the benefits derived from the projects sponsored by SNAME Ship Production Committee Panel SP-2 on Outfitting and Production Aids during the 15 year period when this Panel...

  2. Economic analysis of variables affecting the plantain ( Musa sp ...

    African Journals Online (AJOL)

    Journal of Agriculture, Forestry and the Social Sciences ... The study examined variables affecting plantain (Musa sp) mono cropping system of production by ... land fragmentation, wrong application of fertilizer, high cost of fertilizers, lack of ...

  3. Linking surfactant protein SP-D and IL-13

    DEFF Research Database (Denmark)

    Qaseem, Asif S; Sonar, Sanchaita; Mahajan, Lakshna

    2012-01-01

    of allergen-IgE interaction, histamine release by sensitised mast cells, downregulation of specific IgE production, suppression of pulmonary and peripheral eosinophilia, inhibition of mechanisms that cause airway remodelling, and induction of apoptosis in sensitised eosinophils. SP-D can also shift helper T......Surfactant protein D (SP-D) is an innate immune molecule that plays a protective role against lung infection, allergy, asthma and inflammation. In vivo experiments with murine models have shown that SP-D can protect against allergic challenge via a range of mechanisms including inhibition...... cell polarisation following in vivo allergenic challenge, from pathogenic Th2 to a protective Th1 cytokine response. Interestingly, SP-D gene deficient (-/-) mice show an IL-13 over-expressing phenotype. IL-13 has been shown to be involved in the development of asthma. Transgenic mice over...

  4. Massarina armatispora sp. nov., a new intertidal ascomycete from mangroves

    Digital Repository Service at National Institute of Oceanography (India)

    Hyde, K.D.; Vrijmoed, L.L.P.; Chinnaraj, S.; Jones, E.B.G.

    Massarina armatispora sp. nov. is described from dead intertidal mangrove wood collected in India and Hong Kong. The new taxon is compared with other M. species, and its placement in the genus Massarina is discussed...

  5. Biomineralization of a calcifying ureolytic bacterium Microbacterium sp. GM-1

    Directory of Open Access Journals (Sweden)

    Guojing Xu

    2017-01-01

    Conclusions: The results of this research provide evidence that Microbacterium sp. GM-1 can biologically induce calcification and suggest that strain GM-1 may play a potential role in the synthesis of new biominerals and in bioremediation or biorecovery.

  6. Feather wastes digestion by new isolated strains Bacillus sp. in ...

    African Journals Online (AJOL)

    Feather wastes digestion by new isolated strains Bacillus sp. in Morocco. ... The most efficient isolated strain selected was compared with Bacillus subtilis ATCC 6633. Results showed ... African Journal of Biotechnology Vol.3(1) 2004: 67-70 ...

  7. Volvatellin, caulerpenyne-related product fromt he sacoglossan Volvatella sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Fontana, A; Ciavatta, M.L; Mollo, E.; Naik, C.G.; Wahidullah, S.; DeSouza, L; Cimino, G.

    Volvatellin (4) is a highly unstable terpene isolated from the extracts of the Indian opisthobranch mollusk Volvatella sp. The structure and the relative stereochemistry of 4 were determined by NMR methods. The paper also describes a hypothetical...

  8. SP-100 multimegawatt scaleup to meet electric propulsion mission requirements

    International Nuclear Information System (INIS)

    Newkirk, D.W.; Salamah, S.A.; Stewart, S.L.; Pluta, P.R.

    1991-01-01

    The SP-100 space power nuclear reactor nuclear heat source technology, utilizing uranium nitride fuel clad in PWC-11 in a fast reactor with lithium coolant circulated by an electromagnetic pump, is shown in this paper to be directly extrapolatable to thermal power levels that meet NASA nuclear electric propulsion requirements using different power conversion techniques. The SP-100 nuclear technology can be applied for missions with NEP requirements as low as 10's of kWe to 10's of MWe

  9. Pigment Production from Immobilized Monascus sp. Utilizing Polymeric Resin Adsorption

    OpenAIRE

    Evans, Patrick J.; Wang, Henry Y.

    1984-01-01

    Pigment production by the fungus Monascus sp. was studied to determine why Monascus sp. provides more pigment in solid culture than in submerged culture. Adding a sterilized nonionic polymeric adsorbent resin directly to the growing submerged culture did not enhance the pigment production, thus indicating that pigment extraction is probably not a factor. Monascus cells immobilized in hydrogel were studied and exhibited decreased pigment production as a result of immobilization. This result is...

  10. Pengaruh PH dan Suhu terhadap Aktivitas Protease Penicillium SP.

    OpenAIRE

    Yusriah, Yusriah; Kuswytasari, Nengah Dwianita

    2013-01-01

    Tujuan penelitian ini adalah untuk mengetahui pengaruh pH dan suhu terhadap aktivitas protease pada Penicillium sp.3 T3f2. Selanjutnya, isolat Penicillium sp. di kultur dalam media produksi protease untuk menghasilkan protease. Suhu yang digunakan adalah 300 – 500C sedangkan pH-nya 4 – 8. Aktivitas protease ditentukan dan diukur dengan spektrofotometer pada panjang gelombang 275 nm, dengan kasein sebagai substrat. Berdasarkan uji ANOVA yang dilanjutkan dengan uji Duncan dengan taraf kepercaya...

  11. Environmental interactions and the SP-100 power system

    International Nuclear Information System (INIS)

    Ferguson, D.C.

    1993-01-01

    The Civil Space Technology Initiative High-Capacity-Power Environmental Interactions Program has made great progress in defining and evaluating the interactions of the SP-100 power system with its expected ambient environments. The NASCAP/LEO and POLAR computer codes demonstrated that local electric fields at the user interface module are high. Therefore, particular attention must be paid to geometries and materials in this region to prevent arcing at conductor-insulator junctions in low Earth orbit. NASCAP/LEO and EPSAT computer models revealed that SP-100 payloads float about 100 V negative of the LEO plasma. In addition, ground tests and modeling done for the Space Station Freedom Electrical Grounding Tiger Team found that dielectric coatings often break down at such voltages in a plasma. Thus, surface coatings for SP-100 payloads should be carefully selected. Sputtering may also be a concern for long-duration missions in LEO at these voltages. Much work has been done on a sputtering model to evaluate surface material loss rates on SP-100 payloads. In ground plasma chamber tests of cables and cable insulators at SP-100 voltages, parasitic power losses due to the plasma current collected from possible pinholes or coating defects were quantified and shown to be small. Modeling revealed that the power loss from currents to other surfaces is also small. The atomic oxygen durability of SP-100 materials and coatings continues to be investigated in ground tests. In the upcoming Evaluation of Oxygen Interaction with Materials (EOIM-3) Shuttle flight experiment, a host of SP-100 materials will be evaluated for atomic oxygen durability in LEO. Finally, an evaluation of the interactions of the SP-100 power system with lunar and planetary environments has started. At a workshop on chemical and electrical interactions on Mars recently held at the NASA Lewis Research Center, many of primary interactions were identified

  12. Genome sequencing and annotation of Serratia sp. strain TEL.

    Science.gov (United States)

    Lephoto, Tiisetso E; Gray, Vincent M

    2015-12-01

    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  13. Genome sequencing and annotation of Serratia sp. strain TEL

    Directory of Open Access Journals (Sweden)

    Tiisetso E. Lephoto

    2015-12-01

    Full Text Available We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410. This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926 collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  14. Genome sequencing and annotation of Serratia sp. strain TEL

    OpenAIRE

    Lephoto, Tiisetso E.; Gray, Vincent M.

    2015-01-01

    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  15. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Claudia M Rivera-Hoyos

    Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range

  16. Malachite Green and Crystal Violet Decolorization by Ganoderma lucidum and Pleurotus ostreatus Supernatant and by rGlLCC1 and rPOXA 1B Concentrates: Molecular Docking Analysis.

    Science.gov (United States)

    Morales-Álvarez, Edwin D; Rivera-Hoyos, Claudia M; Poveda-Cuevas, Sergio A; Reyes-Guzmán, Edwin A; Pedroza-Rodríguez, Aura M; Reyes-Montaño, Edgar A; Poutou-Piñales, Raúl A

    2018-03-01

    Laccases catalyze the oxidation of various aromatic organic compounds concomitantly with molecular oxygen reduction to water. Triphenylmethane dyes are synthetic compounds widely used in diverse industries. Their removal from effluents is difficult, due to their high degree of structural complexity; hence, their high concentration in effluents cause a negative impact on the environment. In the present work, molecular docking was used to evaluate interactions between rGlLCC1 or rPOXA 1B enzymes with Crystal Violet (CV) or Malachite Green (MG) dyes. In addition, removal tests of the two dyes were performed. Van der Waals interactions were obtained for only the CV dye for both GlLCC1 and POXA 1B enzymes. Nevertheless, in the GlLCC1 model, two π-π interactions were observed. For the MG dye only, Van der Waals interactions were obtained. Moreover, amino acid composition interacting in each model with each dye was similar. It is important to highlight that by molecular docking, none of the estimated ligand configurations generated hydrogen bonds. Thus, explaining the difficulty to degrade CV and MG. Regarding CV, maximum decolorization percentage was 23.6 ± 1.0% using Ganoderma lucidum supernatant and 5.0 ± 0.5% with Pleurotus ostreatus supernatant. When using recombinant laccase enzyme concentrates, decolorization percentages were 9.9 ± 0.1 and 7.5 ± 1.0% for rGlLCC1 and rPOXA 1B, respectively. On the other hand, for the MG dye, maximum decolorization percentages were 52.1 ± 5.1 and 2.3 ± 0.2% using G. lucidum and P. ostreatus concentrates, respectively. Whereas with recombinant laccase enzymatic concentrates, values of 9.4 ± 0.8% were obtained, with rGlLCC1, and 2.1 ± 0.1% when using rPOXA 1B. These findings represent an important step in bioremediation processes improvement and efficiency of industry-generated products, using environmentally friendly alternatives.

  17. Uranium and thorium uptake by live and dead cells of Pseudomonas Sp

    International Nuclear Information System (INIS)

    Siva Prasath, C.S.; Manikandan, N.; Prakash, S.

    2010-01-01

    This study presents uptake of uranium (U) and thorium (Th) by live and dead cells of Pseudomonas Sp. Increasing concentration of U and Tb showed decrease in absorption by Pseudomonas Sp. Dead cells of Pseudomonas Sp. exhibited same or more uptake of U and Th than living cells. Increasing temperature promotes uptake of U and Th by Pseudomonas Sp. (author)

  18. Evidence for cooperative mineralization of diuron by Arthrobacter sp. BS2 and Achromobacter sp. SP1 isolated from a mixed culture enriched from diuron exposed environments.

    Science.gov (United States)

    Devers-Lamrani, Marion; Pesce, Stéphane; Rouard, Nadine; Martin-Laurent, Fabrice

    2014-12-01

    Diuron was found to be mineralized in buffer strip soil (BS) and in the sediments (SED) of the Morcille river in the Beaujolais vineyard repeatedly treated with this herbicide. Enrichment cultures from BS and SED samples led to the isolation of three bacterial strains transforming diuron to 3,4-dichloroaniline (3,4-DCA) its aniline derivative. 16S rRNA sequencing revealed that they belonged to the genus Arthrobacter (99% of similarity to Arthrobacter globiformis strain K01-01) and were designated as Arthrobacter sp. BS1, BS2 and SED1. Diuron-degrading potential characterized by sequencing of the puhA gene, characterizing the diuron-degradaing potential, revealed 99% similarity to A. globiformis strain D47 puhA gene isolated a decade ago in the UK. These isolates were also able to use chlorotoluron for their growth. Although able to degrade linuron and monolinuron to related aniline derivatives they were not growing on them. Enrichment cultures led to the isolation of a strain from the sediments entirely degrading 3,4-DCA. 16S rRNA sequence analysis showed that it was affiliated to the genus Achromobacter (99% of similarity to Achromobacter sp. CH1) and was designated as Achromobacter sp. SP1. The dcaQ gene encoding enzyme responsible for the transformation of 3,4-DCA to chlorocatechol was found in SP1 with 99% similarity to that of Comamonas testosteroni WDL7. This isolate also used for its growth a range of anilines (3-chloro-4-methyl-aniline, 4-isopropylaniline, 4-chloroaniline, 3-chloroaniline, 4-bromoaniline). The mixed culture composed of BS2 and SP1 strains entirely mineralizes (14)C-diuron to (14)CO2. Diuron-mineralization observed in the enrichment culture could result from the metabolic cooperation between these two populations. Copyright © 2014. Published by Elsevier Ltd.

  19. Streptomyces sp. Sebagai Biofungisida Patogen Fusarium oxysporum (Schlecht. f.sp. lycopersici (Sacc. Snyd. et Hans. Penyebab Penyakit Layu Pada Tanaman Tomat (Solanum lycopersicum L.

    Directory of Open Access Journals (Sweden)

    NURI MANDAN SARI

    2014-01-01

    Full Text Available A research was conducted to isolate Streptomyces sp. of soil Udayana University campus in theBukit-Jimbaran, to obtain the most effective Streptomyces sp. which is effective in inhibit the growth ofFusarium oxysporum f.sp. lycopersici, and to test response of tomato plants with Streptomyces sp.culture against Fusarium wilt desease. Implementation phases of the research consisted of isolation andidentification of Streptomyces sp, test the inhibition against F. oxysporum f.sp. lycopersici, and in vivotest used by dyeing the roots of the tomato plant (Solanum lycopersicum with Fusarium spores andafter 30 seconds the roots were dyeing Streptomyces culture. Furthermore, sterile soil in polybagwatered by Fusarium spores and Streptomyces culture at the same time. Based on morphologicalcharacteristic it found five isolates of Streptomyces sp.. The antagonist test showed Streptomyces sp.1 had ability (75% against Fusarium, Streptomyces sp 2 (68,3%, Streptomyces sp. 3 (71,6%,Streptomyces sp. 4 (63,3%, and Streptomyces sp. 5 (21,6%. All Streptomyces suppressed thegrowth of Fusarium on tomato plants in glass house (p<0,05. Streptomyces sp.3 suppressed Fusariumwilt disease in tomato from 88% in control to 20%.

  20. Characterization of a bioflocculant produced by a consortium of Halomonas sp. Okoh and Micrococcus sp. Leo.

    Science.gov (United States)

    Okaiyeto, Kunle; Nwodo, Uchechukwu U; Mabinya, Leonard V; Okoh, Anthony I

    2013-10-16

    The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2-10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment.

  1. Identification and production of bioflocculants by Enterobacter sp. and Bacillus sp. and their characterization studies.

    Science.gov (United States)

    Muthulakshmi, L; Nellaiah, H; Kathiresan, T; Rajini, N; Christopher, Fenila

    2017-05-28

    In this work, two bioflocculants, namely, EB-EPS and B1-EPS, were derived from Enterobacter sp. and Bacillus sp., respectively, and analyzed with regard to their production and characterization. About 0.9 and 0.16 g of purified EB and B1 were obtained from I L of fermentation broth. Chemical analysis showed the contents of purified EB and B1 mainly as 88.7 and 92.8% (w/w) of carbohydrate, and 11.3 and 21.8% (w/w) protein, respectively. Fourier-transform infrared spectrometry analysis revealed the presence of hydroxyl, amide, and carboxyl groups in the identified bioflocculant. Thermogravimetric analysis (TGA) results exhibited enhanced thermal stability with a minimum mass loss of 50% while 25% were found to have occurred at higher temperatures (>400°C) for microbe-derived compounds EB and B1 leading to the possibility of using these compounds as fillers or for fabricating composite films for high-temperature applications. Further, the compounds from both the bacteria exhibited good antibacterial characteristics against pathogenic Escherichia coli. Degradability study of bioflocculant-embedded composite films shows the possibility of attaining eco-friendly bioremediation. Accordingly, experimental results revealed the suitability of developed composite films as a suitable alternative for food packaging and biomedical applications.

  2. Potencial de antagonismo de isolados de Trichoderma sp. contra o isolados de Fusarium sp., in vitro

    Directory of Open Access Journals (Sweden)

    Charles Anthony Hoffmann

    2015-06-01

    Full Text Available Resumo – O uso discriminado de agrotóxicos acarreta em uma grande prejuízo a saúdes das pessoas e do meio ambiente. O uso de novos métodos de combate a pragas se faz necessário para o equilíbrio da cadeia produtiva. A utilização de microrganismos no combate a pragas se faz como uma boa alternativa. O trabalho objetivou-se em avaliar o potencial de antagonismo de isolados de Trichoderma sp. contra o patógeno Fusarium sp. in vitro. Para isso foi utilizado os métodos de confronto direto, pareamento de culturas e de metabólitos voláteis. Os experimentos foram realizados na incubadora de empresas da Universidade Federal do Tocantins – UFT Campus de Gurupi, seguiram com três repetições. Foram testados 15 isolados do antagonista em confronto direto com o patógeno e os mesmos isolados e patógeno foram testados em metabólitos voláteis ambos utilizando o meio de cultura BDA. Todos os isolados apresentaram antagonismo in vitro contra o patógeno.

  3. Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

    Science.gov (United States)

    Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

    2015-01-01

    Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

  4. Glycomyces scopariae sp. nov. and Glycomyces mayteni sp. nov., isolated from medicinal plants in China.

    Science.gov (United States)

    Qin, Sheng; Chen, Hua-Hong; Klenk, Hans-Peter; Zhao, Guo-Zhen; Li, Jie; Xu, Li-Hua; Li, Wen-Jun

    2009-05-01

    Two actinomycete strains, designated YIM 56256(T) and YIM 61331(T), were isolated from the roots of Scoparia dulcis and Maytenus austroyunnanensis, two Chinese medicinal plants, and their taxonomic status was established based on a polyphasic investigation. The organisms were found to have chemical and morphological markers typical of members of the genus Glycomyces. 16S rRNA gene sequence analysis showed that they were closely related to each other and to Glycomyces sambucus E71(T). A battery of physiological characteristics and levels of DNA-DNA relatedness indicated that strains YIM 56256(T) and YIM 61331(T) represent two novel species, clearly different from the related known Glycomyces species. On the basis of the data presented, it is evident that each of these strains represents a novel species of the genus Glycomyces, for which the names Glycomyces scopariae sp. nov. (type strain YIM 56256(T) =KCTC 19158(T) =DSM 44968(T)) and Glycomyces mayteni sp. nov. (type strain YIM 61331(T) =KCTC 19527(T) =CCTCC AA 208004(T)) are proposed.

  5. Methylobacterium pseudosasicola sp. nov. and Methylobacterium phyllostachyos sp. nov., isolated from bamboo leaf surfaces.

    Science.gov (United States)

    Madhaiyan, Munusamy; Poonguzhali, Selvaraj

    2014-07-01

    Two strains of Gram-negative, methylotrophic bacteria, isolated because of their abilities to promote plant growth, were subjected to a polyphasic taxonomic study. The isolates were strictly aerobic, motile, pink-pigmented, facultatively methylotrophic, non-spore-forming rods. The chemotaxonomic characteristics of the isolates included the presence of C18 : 1ω7c as the major cellular fatty acid. The DNA G+C contents of strains BL36(T) and BL47(T) were 69.4 and 69.8 mol%, respectively. 16S rRNA gene sequence analysis of strains BL36(T) and BL47(T) placed them under the genus Methylobacterium, with the pairwise sequence similarity between them and the type strains of closely related species ranging from 97.2 to 99.0%. On the basis of their phenotypic and phylogenetic distinctiveness and the results of DNA-DNA hybridization analysis, the isolates represent two novel species within the genus Methylobacterium, for which the names Methylobacterium pseudosasicola sp. nov. (type strain BL36(T) = NBRC 105203(T) = ICMP 17621(T)) and Methylobacterium phyllostachyos sp. nov. (type strain BL47(T) = NBRC 105206(T) = ICMP 17619(T)) are proposed. © 2014 IUMS.

  6. Watery rot of pseudo-stem (Dickeya sp. management in banana (Musa sp. under greenhouse conditions

    Directory of Open Access Journals (Sweden)

    Joaquín Guillermo Ramírez

    2014-12-01

    Full Text Available This crop has serious constraints with diseases, including those caused by bacteria, such as Dickeya sp. This research aimed to evaluate the effect of 4 resistance inductors and 3 doses in Chlorine Dioxide in handling watery rot of pseudo-stem (Dickeya sp. in banana. Resistance inducers and their doses were Potassium Phosphite: 1.5 cm 3 .l -1 ; 3-Aminobutanoic Acid: 1.0 g.l -1 ; Methyl Jasmonate: 0.2 g.l -1 ; S-Methyl-Acibenzolar: 0.3 ml.l -1 , all by foliar application, while Chlorine Dioxide was injected into the pseudo-stem, in doses of 10, 20 and 30 mg.l -1 . The evaluated variables were: development of the disease, total biomass and quantification of the bacterium in the inoculated pseudo-stems. Applications of Chlorine Dioxide achieved a reduction of disease by 65.4, 91.99 and 61.5%, in addition to an inhibition of 100% of the pathogen, using 30 and 50 mg.l -1 doses. Meanwhile, the use of resistance inductors reduced up to 60.6% of the disease, but this effect failed to improve plant growth.

  7. Streptococcus loxodontisalivarius sp. nov. and Streptococcus saliviloxodontae sp. nov., isolated from oral cavities of elephants.

    Science.gov (United States)

    Saito, Masanori; Shinozaki-Kuwahara, Noriko; Hirasawa, Masatomo; Takada, Kazuko

    2014-09-01

    Four Gram-stain-positive, catalase-negative, coccoid-shaped organisms were isolated from elephant oral cavities. The isolates were tentatively identified as streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequencing studies confirmed the organisms to be members of the genus Streptococcus. Two isolates (NUM 6304(T) and NUM 6312) were related most closely to Streptococcus salivarius with 96.8 % and 93.1 % similarity based on the 16S rRNA gene and the RNA polymerase β subunit encoding gene (rpoB), respectively, and to Streptococcus vestibularis with 83.7 % similarity based on the 60 kDa heat-shock protein gene (groEL). The other two isolates (NUM 6306(T) and NUM 6318) were related most closely to S. vestibularis with 97.0 % and 82.9 % similarity based on the 16S rRNA and groEL genes, respectively, and to S. salivarius with 93.5 % similarity based on the rpoB gene. Based on phylogenetic and phenotypic evidence, these isolates are suggested to represent novel species of the genus Streptococcus, for which the names Streptococcus loxodontisalivarius sp. nov. (type strain NUM 6304(T) = JCM 19287(T) = DSM 27382(T)) and Streptococcus saliviloxodontae sp. nov. (type strain NUM 6306(T) = JCM 19288(T) = DSM 27513(T)) are proposed. © 2014 IUMS.

  8. Streptococcus moroccensis sp. nov. and Streptococcus rifensis sp. nov., isolated from raw camel milk.

    Science.gov (United States)

    Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter

    2014-07-01

    Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T)  = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T)  = CCMM B833(T)) are proposed. © 2014 IUMS.

  9. Growth kinetics and biodeterioration of polypropylene microplastics by Bacillus sp. and Rhodococcus sp. isolated from mangrove sediment.

    Science.gov (United States)

    Auta, H S; Emenike, C U; Jayanthi, B; Fauziah, S H

    2018-02-01

    Interest in the biodegradation of microplastics is due to their ubiquitous distribution, availability, high persistence in the environment and deleterious impact on marine biota. The present study evaluates the growth response and mechanism of polypropylene (PP) degradation by Bacillus sp. strain 27 and Rhodococcus sp. strain 36 isolated from mangrove sediments upon exposure to PP microplastics. Both bacteria strains were able to utilise PP microplastic for growth as confirmed by the reduction of the polymer mass. The weight loss was 6.4% by Rhodococcus sp. strain 36 and 4.0% by Bacillus sp. strain 27 after 40days of incubation. PP biodegradation was further confirmed using Fourier-transform infrared spectroscopy and scanning electron microscopy analyses, which revealed structural and morphological changes in the PP microplastics with microbial treatment. These analyses showed that the isolates can colonise, modify and utilise PP microplastics as carbon source. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Enhanced photocatalytic activity induced by sp 3 to sp 2 transition of carbon dopants in BiOCl crystals

    KAUST Repository

    Sun, Jianguo

    2017-09-19

    The insufficient light absorption and low quantum efficiency limit the photocatalytic performance of wide bandgap semiconductors. Here, we report a facile strategy to engineer the surface disordered defects of BiOCl nanosheets via carbon doping. The surface defects boost the light absorption and also the quantum yields, as the doped carbon atoms exhibit a transition from sp3 to sp2 hybridization at elevated temperature, corresponding to a change of assembly state from 3D cluster to 2D graphite-like structure. This transition results in an effective charge separation and thus one order of enhancement in photocatalytic activity toward phenol degradation under visible light. The current study opens an avenue to introduce sp3 to sp2 transition of carbon dopants for simultaneous increment of light absorption and quantum efficiency for application in photocatalysis and energy conversion.

  11. Rhopalophthalmus constrictus sp. nov. and Australomysis reubeni sp. nov. (Crustacea-Mysidacea) from south-west Australian waters

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Two new species of mysids are described, Rhopalophthalmus constrictus sp. nov. is in having a well-produced triangular rostral plate, pleural plates on the anterior five abdominal somites and prominent constriction at the distal end of the telson...

  12. Gordonia humi sp. nov., isolated from soil.

    Science.gov (United States)

    Kämpfer, P; Young, Chiu-Chung; Chu, Jiunn-Nan; Frischmann, A; Busse, H-J; Arun, A B; Shen, Fo-Ting; Rekha, P D

    2011-01-01

    A Gram-stain-positive, non-endospore-forming actinobacterium (CC-12301(T)) was isolated from soil attached to a spawn used in the laboratory to grow the edible mushroom Agaricus brasiliensis. Based on 16S rRNA gene sequence similarities, strain CC-12301(T) was shown to belong to the genus Gordonia and was most closely related to the type strains of Gordonia hydrophobica (97.6 % similarity), Gordonia terrae (97.5 %), Gordonia amarae (97.5 %) and Gordonia malaquae (97.4 %). The quinone system was determined to consist predominantly of menaquinone MK-9(H(2)), minor amounts of MK-8(H(2)) and MK-7(H(2)). The polar lipid profile consisted of the major compounds diphosphatidylglycerol and phosphatidylethanolamine, moderate amounts of two phosphatidylinositol mannosides and phosphatidylinositol and minor amounts of phosphatidylglycerol, three unidentified glycolipids, two phosphoglycolipids and a phospholipid. Mycolic acids were present. These chemotaxonomic traits and the major fatty acids, which were C(16 : 1) cis9, C(16 : 0), C(18 : 1) and tuberculostearic acid (10-methyl C(18 : 0)), supported the affiliation of strain CC-12301(T) to the genus Gordonia. The results of physiological and biochemical tests allowed clear phenotypic differentiation of strain CC-12301(T) from the most closely related Gordonia species. Strain CC-12301(T) therefore represents a novel species, for which the name Gordonia humi sp. nov. is proposed, with the type strain CC-12301(T) (=DSM 45298(T) =CCM 7727(T)).

  13. Xenophilus aerolatus sp. nov., isolated from air.

    Science.gov (United States)

    Kim, Soo-Jin; Kim, Yi-Seul; Weon, Hang-Yeon; Anandham, Rangasamy; Noh, Hyung-Jun; Kwon, Soon-Wo

    2010-02-01

    A novel aerobic, Gram-negative, motile, rod-shaped bacterial strain designated 5516S-2(T) was isolated from an air sample taken in Suwon, Republic of Korea. Colonies were yellow-pigmented and circular with entire margins. 16S rRNA gene sequence analysis showed that strain 5516S-2(T) was closely related to Xylophilus ampelinus DSM 7250(T) (97.6 % sequence similarity), Variovorax soli KACC 11579(T) (97.5 %) and Xenophilus azovorans DSM 13620(T) (97.1 %). However, the phylogenetic tree indicated that strain 5516S-2(T) formed a separate clade from Xenophilus azovorans. Strain 5516S-2(T) displayed 42, 31 and 30 % DNA-DNA relatedness to the type strains of Xenophilus azovorans, Xylophilus ampelinus and V. soli, respectively. The major fatty acids (>10 % of total fatty acids) were C(16 : 0) (33.3 %), C(17 : 0) cyclo (18.8 %), C(18 : 1)omega7c (17.5 %) and summed feature 3 (comprising C(16 : 1)omega7c and/or iso-C(15 : 0) 2-OH; 13.0 %). The DNA G+C content was 69 mol%. The major quinone was ubiquinone Q-8. The predominant polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol and two unknown aminophospholipids. Genotypic and phenotypic characteristics clearly distinguished strain 5516S-2(T) from closely related species and indicated that it represents a novel species within the genus Xenophilus, for which the name Xenophilus aerolatus sp. nov. is proposed. The type strain is 5516S-2(T) (=KACC 12602(T)=DSM 19424(T)).

  14. Streptomyces xylanilyticus sp. nov., isolated from soil.

    Science.gov (United States)

    Moonmangmee, Duangtip; Kanchanasin, Pawina; Phongsopitanun, Wongsakorn; Tanasupawat, Somboon; Moonmangmee, Somporn

    2017-10-01

    A novel actinomycete, strain SR2-123 T , belonging to the genus Streptomyces, was isolated from a soil sample collected from the Sakaerat Environmental Research Station, Thailand Institute of Scientific and Technological Research, Nakhon Ratchasima Province, Thailand. The taxonomic position of the strain was characterized using a polyphasic study. Strain SR2-123 T contained ll-diaminopimelic acid, glucose, mannose and ribose in whole-cell hydrolysates. The N-acyl type of muramic acid was acetyl. Menaquinones were MK-9(H6), MK-9(H8) and MK-9(H4). The predominant cellular fatty acids were iso-C15 : 0, anteiso-C15 : 0, iso-C16 : 0, anteiso-C17 : 0 and iso-C17 : 0. The major polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, an unknown phospholipid, unknown glycolipids, an unknown aminophospholipid, unknown lipids and an unknown aminolipid. The DNA G+C content was 74.8 mol%. The strain was closely related to Streptomyces coeruleorubidus JCM 4359 T (98.5 %), Streptomyces flavofungini JCM 4753 T (98.5 %), Streptomyces coerulescens NBRC 12758 T (98. 5 %) and Streptomyces alboflavus JCM 4615 T (98.4 %), based on 16S rRNA gene sequence similarities. The novel strain exhibited low DNA-DNA relatedness values with the type strains (11.4-25.0 %) of closely related species. On the basis of phenotypic and genotypic characteristics, strain SR2-123 T could be distinguished from closely related species of the genus Streptomyces and represents a novel species of the genus Streptomyces for which the name Streptomyces xylanilyticus sp. nov. is proposed. The type strain is SR2-123 T (=TISTR 2493 T =KCTC 39909 T ).

  15. Streptomyces krungchingensis sp. nov., isolated from soil.

    Science.gov (United States)

    Sripreechasak, Paranee; Phongsopitanun, Wongsakorn; Tamura, Tomohiko; Tanasupawat, Somboon

    2017-01-01

    A novel actinomycete, designated strain KC-035T, was isolated from soil collected from Krung Ching Waterfall National Park, Nakhon Si Thammarat Province, Thailand. Its taxonomic position was determined using a polyphasic approach. The strain had morphological and chemotaxonomic properties typical of members of the genus Streptomyces: flexuous spore chain; ll-diaminopimelic acid in the cell-wall peptidoglycan; MK-9(H8), MK-9(H6) and MK-9(H4) as menaquinones; diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol and phosphatidylinositol mannoside as phospholipids; anteiso-C15 : 0, C16 : 0, iso-C16 : 0, iso-C15 : 0 and iso-C14 : 0 as major cellular fatty acids; and DNA G+C content of 72 mol%. 16S rRNA gene sequence analysis revealed that strain KC-035T showed high similarity to Streptomyces albiflavescens n20T (99.16 %) and Streptomyces siamensis KC-038T (98.43 %) as well as formed a monophyletic clade with them in the phylogenetic tree. On the basis of comparison of phenotypic properties and the low level of DNA-DNA relatedness, strain KC-035T could be distinguished from its closely related Streptomyces species and is considered to represent a novel species of the genus Streptomyces, for which the name Streptomyces krungchingensis sp. nov. is proposed. The type strain is KC-035T (=NBRC 110087T=KCTC 29503T=TISTR 2402T).

  16. Deinococcus antarcticus sp. nov., isolated from soil.

    Science.gov (United States)

    Dong, Ning; Li, Hui-Rong; Yuan, Meng; Zhang, Xiao-Hua; Yu, Yong

    2015-02-01

    A pink-pigmented, non-motile, coccoid bacterial strain, designated G3-6-20(T), was isolated from a soil sample collected in the Grove Mountains, East Antarctica. This strain was resistant to UV irradiation (810 J m(-2)) and slightly more sensitive to desiccation as compared with Deinococcus radiodurans. Phylogenetic analyses based on the 16S rRNA gene sequence of the isolate indicated that the organism belongs to the genus Deinococcus. Highest sequence similarities were with Deinococcus ficus CC-FR2-10(T) (93.5 %), Deinococcus xinjiangensis X-82(T) (92.8 %), Deinococcus indicus Wt/1a(T) (92.5 %), Deinococcus daejeonensis MJ27(T) (92.3 %), Deinococcus wulumuqiensis R-12(T) (92.3 %), Deinococcus aquaticus PB314(T) (92.2 %) and Deinococcus radiodurans DSM 20539(T) (92.2 %). Major fatty acids were C18 : 1ω7c, summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c), anteiso-C15 : 0 and C16 : 0. The G+C content of the genomic DNA of strain G3-6-20(T) was 63.1 mol%. Menaquinone 8 (MK-8) was the predominant respiratory quinone. Based on its phylogenetic position, and chemotaxonomic and phenotypic characteristics, strain G3-6-20(T) represents a novel species of the genus Deinococcus, for which the name Deinococcus antarcticus sp. nov. is proposed. The type strain is G3-6-20(T) ( = DSM 27864(T) = CCTCC AB 2013263(T)). © 2015 IUMS.

  17. Pedobacterpsychrotolerans sp. nov., isolated from soil.

    Science.gov (United States)

    Manandhar, Pooja; Zhang, Gengxin; Lama, Arun; Hu, Yilun; Gao, Feng

    2016-11-01

    A Gram-stain-negative, non-motile, light-pink-pigmented, aerobic, rod-shaped bacterium, designated V5RDT, was isolated from soil of Damxung county in the Qinghai-Tibetan Plateau. Strain V5RDT grew luxuriously at 10 °C, at pH 9.0 and in the presence of 1 % NaCl (w/v). Phylogenetic analysis of 16S rRNA gene sequences placed strain V5RDT in the genus Pedobacter and found that it was most closely related to Pedobacter alluvionis DSM 19624T (97.3 %), Pedobacter ginsenosidimutans JCM 16721T (96.84 %), Pedobacter agri DSM 19486T (96.28 %), Pedobacter roseus JCM 13399T (96.22 %), Pedobacter sandarakinus KCTC 12559T (95.92 %) and Pedobacter borealis DSM 19626T (95.85 %). The G+C content of the genomic DNA of the type strain V5RDT was 37.40 mol%. DNA-DNA relatedness for the type strain V5RDT with respect to its closest phylogenetic relative, P. alluvionis DSM 19624T, was 62.5±1.7 %. The polar lipid profile of the strain consisted of phosphatidylethanolamine, one unidentified aminolipid, one unidentified glycolipid and two unidentified polar lipids. Menaquinone MK-7 was the predominant respiratory quinone, and summed feature 3 (comprising C16 : 1ω7c and/or C16 : 1ω6c), iso-C15 : 0 and iso-C17 : 0 3-OH were the major fatty acids. With respect to phenotypic characteristics, biochemical properties and phylogenetic inference, strain V5RDT represents a novel species of the genus Pedobacter, for which the name Pedobacter psychrotolerans sp. nov is proposed. The type strain is V5RDT (=CGMCC 1.15644T=DSM 103236T).

  18. Impact of serum SP-A and SP-D levels on comparison and prognosis of idiopathic pulmonary fibrosis

    Science.gov (United States)

    Wang, Kai; Ju, Qing; Cao, Jing; Tang, Wenze; Zhang, Jian

    2017-01-01

    Abstract Background and objective: Idiopathic pulmonary fibrosis (IPF) has a poor prognosis in general; however, it is heterogeneous to detect relative biomarkers for predicting the disease progression. Serum biomarkers can be conveniently collected to detect and help to differentially diagnose IPF and predict IPF prognosis. This meta-analysis aimed to evaluate the use of serum surfactant proteins A and D (SP-A and SP-D) for differential diagnosis and prognosis of IPF. Methods: Relevant articles were searched in PubMed, Embase, and Chinese National Knowledge Infrastructure databases and reviewed by 2 independent readers. Standard mean difference (SMD) and 95% confidence interval (CI) were calculated to assess the difference in serum levels of SP-A/D among patients with IPF, when compared to patients with non-IPF interstitial lung disease (ILD), pulmonary infection, and healthy control. Hazard ratio (HR) and 95% CI were used to compare the relative risk of mortality. Results: Twenty-one articles (totalling 1289 IPF patients) were included in final meta-analysis. Serum SP-A levels were significantly higher in patients with IPF than in patients with non-IPF ILD (SMD: 1.108 [0.584, 1.632], P infection (SMD: 1.320 [0.999, 1.640], P SMD: 2.802 [1.901, 3.702], P SMD: 0.459 [−0.000, 0.919], P = .050). Serum SP-D levels were significantly higher in patients with IPF than in patients with pulmonary infection (SMD: 1.308 [0.813, 1.803], P SMD: 2.235 [1.739, 2.731], P < .001). Risk of death in patients with IPF and elevated serum SP-A was increased 39% compared to patients with low SP-A groups. Elevated SP-D increased risk by 111% when compared to low SP-D. In acute exacerbation of IPF, serum SP-A/D were higher than those in stable stage. The comparisons and prognosis might be different in Asian and Caucasian patients. Conclusions: Serum SP-A/D detection might be useful for differential diagnosis and prediction of survival in patients with IPF. PMID:28591049

  19. Flow chemistry as a discovery tool to access sp2-sp3 cross-coupling reactions via diazo compounds.

    Science.gov (United States)

    Tran, Duc N; Battilocchio, Claudio; Lou, Shing-Bong; Hawkins, Joel M; Ley, Steven V

    2015-02-01

    The work takes advantage of an important feature of flow chemistry, whereby the generation of a transient species (or reactive intermediate) can be followed by a transfer step into another chemical environment, before the intermediate is reacted with a coupling partner. This concept is successfully applied to achieve a room temperature sp 2 -sp 3 cross coupling of boronic acids with diazo compounds, these latter species being generated from hydrazones under flow conditions using MnO 2 as the oxidant.

  20. Modular Stereoselective Synthesis of (1 -> 2)-C-Glycosides based on the sp(2)-sp(3) Suzuki-Miyaura Reaction

    Czech Academy of Sciences Publication Activity Database

    Oroszová, B.; Choutka, J.; Pohl, Radek; Parkan, K.

    2015-01-01

    Roč. 21, č. 19 (2015), s. 7043-7047 ISSN 0947-6539 Grant - others:GA ČR(CZ) GPP207/12/P713; GA ČR(CZ) GA15-17572S Institutional support: RVO:61388963 Keywords : C-disaccharides * C-glycosides * diastereoselectivity * Mitsunobu reaction * sp(2)-sp(3) coupling Subject RIV: CC - Organic Chemistry Impact factor: 5.771, year: 2015