WorldWideScience

Sample records for somatic 5s rrnas

  1. Identifying small RNAs derived from maternal- and somatic-type rRNAs in zebrafish development.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Abdullah, Farah; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Spaink, Herman P; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2018-02-09

    rRNAs are non-coding RNAs present in all prokaryotes and eukaryotes. In eukaryotes there are four rRNAs: 18S, 5.8S, 28S, originating from a common precursor (45S), and 5S. We have recently discovered the existence of two distinct developmental types of rRNA: a maternal-type, present in eggs and a somatic-type, expressed in adult tissues. Lately, next-generation sequencing has allowed the discovery of new small-RNAs deriving from longer non-coding RNAs, including small-RNAs from rRNAs (srRNAs). Here, we systemically investigated srRNAs of maternal- or somatic-type 18S, 5.8S, 28S, with small-RNAseq from many zebrafish developmental stages. We identified new srRNAs for each rRNA. For 5.8S, we found srRNA consisting of the 5' or 3' halves, with only the latter having different sequence for the maternal- and somatic-types. For 18S, we discovered 21 nt srRNA from the 5' end of the 18S rRNA with a striking resemblance to microRNAs; as it is likely processed from a stem-loop precursor and present in human and mouse Argonaute-complexed small-RNA. For 28S, an abundant 80 nt srRNA from the 3' end of the 28S rRNA was found. The expression levels during embryogenesis of these srRNA indicate they are not generated from rRNA degradation and might have a role in the zebrafish development.

  2. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Science.gov (United States)

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  3. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  5. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  7. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  8. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  9. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  10. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  11. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  12. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  13. Secondary structures of rRNAs from all three domains of life.

    Directory of Open Access Journals (Sweden)

    Anton S Petrov

    Full Text Available Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2° structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU 23S/28S and small subunit (SSU 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only, Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery. Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision.

  14. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  15. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  16. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  17. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  18. Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

  19. Somatic symptom disorder

    Science.gov (United States)

    ... related disorders; Somatization disorder; Somatiform disorders; Briquet syndrome; Illness anxiety disorder References American Psychiatric Association. Somatic symptom disorder. Diagnostic and Statistical Manual of Mental Disorders . ...

  20. Quantification of 16S rRNAs in complex bacterial communities by multiple competitive reverse transcription-PCR in temperature gradient gel electrophoresis fingerprints.

    Science.gov (United States)

    Felske, A; Akkermans, A D; De Vos, W M

    1998-11-01

    A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.

  1. Cortisol and somatization.

    Science.gov (United States)

    Rief, W; Auer, C

    2000-05-01

    Somatization symptoms are frequently associated with depression, anxiety, and feelings of distress. These features interact with the activity of the HPA-axis. Therefore we investigated relationships between somatization symptoms and cortisol. Seventy-seven participants were classified into three groups: somatization syndrome (at least eight physical symptoms from the DSM-IV somatization disorder list), somatization syndrome combined with major depression, and healthy controls. The following data were collected: salivary cortisol at three time points (morning, afternoon, evening), nighttime urinary cortisol, serum cortisol after the dexamethasone suppression test (DST), and psychological variables such as depression, anxiety, somatization, and hypochondriasis. Salivary cortisol showed typical diurnal variations. However, the groups did not differ on any of the cortisol variables. A possible explanation may be counteracting effects of somatization and depression. Exploratory correlational analyses revealed that associations between cortisol and psychopathological variables were time-dependent. DST results correlated with psychological aspects of somatization, but not with the number of somatoform symptoms per se.

  2. Management of somatic symptoms

    DEFF Research Database (Denmark)

    Schröder, Andreas; Dimsdale, Joel

    2014-01-01

    on the recognition and effective management of patients with excessive and disabling somatic symptoms. The clinical presentation of somatic symptoms is categorized into three groups of patients: those with multiple somatic symptoms, those with health anxiety, and those with conversion disorder. The chapter provides...

  3. Prokaryotic and eukaryotic features observed on the secondary structures of Giardia SSU rRNAs and its phylogenetic implications.

    Science.gov (United States)

    Hwang, Ui Wook

    2007-04-01

    Phylogenetic position of a diplomonad protist Giardia, a principle cause of diarrhea, among eukaryotes has been vigorously debated so far. Through the comparisons of primary and secondary structures of SSU rRNAs of G. intestinalis, G. microti, G. ardeae, and G. muris, I found two major indel regions (a 6-nt indel and a 22-26-nt indel), which correspond to the helix 10 of the V2 region and helices E23-8 to E23-9 of the V4 region, respectively. As generally shown in eukaryotes, G. intestinalis and G. microti have commonly a relatively longer helix 10 (a 7-bp stem and a 4-nt loop), and also the eukaryote-specific helices E23-6 to E23-9. On the other hand, G. muris and G. ardeae have a shorter helix 10: a 2-bp stem and a 6-nt loop in G. ardeae and a 3-bp stem and a 6-nt loop in G. muris. In the V4, they have a single long helix (like the P23-1 helix in prokaryotes) instead of the helices E23-6 to E23-9. Among the four Giardia species, co-appearance of prokaryote- and eukaryote-typical features might be significant evidence to suggest that Giardia (Archezoa) is a living fossil showing an "intermediate stage" during the evolution from prokaryotes to eukaryotes.

  4. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. 5S-menetelmän implementointi

    OpenAIRE

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  6. 5S-menetelmän pilotointi

    OpenAIRE

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  7. Somatization in Parkinson's Disease

    DEFF Research Database (Denmark)

    Carrozzino, Danilo; Bech, Per; Patierno, Chiara

    2017-01-01

    The current systematic review study is aimed at critically analyzing from a clinimetric viewpoint the clinical consequence of somatization in Parkinson's Disease (PD). By focusing on the International Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines, we...... consequence of such psychiatric symptom should be further evaluated by replacing the clinically inadequate diagnostic label of psychogenic parkinsonism with the psychosomatic concept of persistent somatization as conceived by the Diagnostic Criteria for Psychosomatic Research (DCPR)....

  8. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    International Nuclear Information System (INIS)

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  9. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    International Nuclear Information System (INIS)

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  10. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  11. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  12. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Hypochondriasis and somatization.

    Science.gov (United States)

    Kellner, R

    1987-11-20

    Between 60% and 80% of healthy individuals experience somatic symptoms in any one week. About 10% to 20% of a random sample of people worry intermittently about illness. A substantial proportion of patients present physicians with somatic complaints for which no organic cause can be found. Patients who are hypochondriacal do not understand the benign nature of functional somatic symptoms and interpret these as evidence of disease. Hypochondriacal concerns range from common short-lived worries to persistent and distressing fears or convictions of having a disease. Hypochondriasis can be secondary to other psychiatric disorders (eg, melancholia or panic disorder), and hypochondriacal attitudes remit when the primary disorder is successfully treated. Patients with primary hypochondriasis are also anxious or depressed, but the fear of disease, or the false belief of having a disease, persists and is the most important feature of their psychopathology. There are substantial differences among hypochondriacal patients in their personalities and psychopathologies. Psychotherapy as well as psychotropic drugs are effective in the treatment of functional somatic symptoms. There are no adequate controlled studies on the value of psychotherapy in hypochondriasis; the recommended guidelines are based on uncontrolled studies of hypochondriasis and on controlled studies of the psychotherapy in similar disorders. The prognosis of functional somatic symptoms as well as that of hypochondriasis is good in a substantial proportion of patients.

  14. Somatic and genetic effects

    International Nuclear Information System (INIS)

    Broerse, J.J.; Barendsen, G.W.; Kal, H.B.; Kogel, A.J. van der

    1983-01-01

    This book contains the extended abstracts of the contributions of the poster workshop sessions on somatic and genetic effects of the 7th international congress of radiation research. They cover the following main topics: haematopoietic and immune systems, mechanisms of late effects in various tissues, endogenous and exogenous factors in radiation carcinogenesis, teratogenic effects, genetic effects, in vitro transformation, tumour induction in different tissues, carcinogenesis in incorporated tissues, cancer epidemology and risk assessment. refs.; figs.; tabs

  15. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  16. Making safety an integral part of 5S in healthcare.

    Science.gov (United States)

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  17. Osteoporosis and Somatization of Anxiety

    Directory of Open Access Journals (Sweden)

    Maria Papanikou

    2013-12-01

    Full Text Available Chronic stress can now be physiologically traced as a significant player in the creation of osteoporotic bones. The present pilot study involved 100 women (N = 42 have been diagnosed with osteopenia, N = 21 have been diagnosed with osteoporosis, N = 37 had a non-osteoporotic condition who participated in the Hellenic Society of Osteoporosis Association Support. Correlations between somatic symptoms of anxiety and osteoporosis, and among medications and somatization in women were explored. Assessments were based on a self-report demographic questionnaire and on the Short Anxiety Screening Test (SAST administered for detection of anxiety disorder and somatization. Statistical analysis detected non-significant differences regarding the correlation between anxiety symptomatology or somatization due to osteoporosis and osteopenia diagnosis. The same pattern is observed among women’s age group, the occupational and marital status. Hypothesis that the osteoporosis and osteopenia group would manifest significant relationships with the age group and medicines was confirmed, as well as between somatization and medicines that women with osteoporosis and osteopenia undertake. The results suggest that women are not prone to manifest anxiety or somatization in relation to the osteoporosis condition. However, the majority of women with osteoporosis and osteopenia consume more than two medicines other than those for osteoporosis. This quantity and combination they undertake appear to contribute and deteriorate their anxiety/somatization symptomatology. Further research based on a larger sample would give more definite results.

  18. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  19. Somatically acquired structural genetic differences

    DEFF Research Database (Denmark)

    Magaard Koldby, Kristina; Nygaard, Marianne; Christensen, Kaare

    2016-01-01

    Structural genetic variants like copy number variants (CNVs) comprise a large part of human genetic variation and may be inherited as well as somatically acquired. Recent studies have reported the presence of somatically acquired structural variants in the human genome and it has been suggested t...... with age.European Journal of Human Genetics advance online publication, 20 April 2016; doi:10.1038/ejhg.2016.34....

  20. Somatic embryogenesis of Carica Papaya

    International Nuclear Information System (INIS)

    Alvina Lindsay Mijen; Rusli Ibrahim

    2006-01-01

    This paper describes the somatic embryogenesis of Carica papaya. Culture medium used was1/2 strength MS basal medium supplemented with 6% sucrose, 0.27 % agar, glutamine and various concentrations of 2,4-Dichlorophenoxyacetic acid (2,4-D). After 8 weeks in culture, the best concentration of 2,4-D to induce somatic embryo is at 45.2 μM. (Author)

  1. Review on Implementation of 5S in Various Organization

    OpenAIRE

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  2. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  3. Monitoring Milk Somatic Cell Counts

    Directory of Open Access Journals (Sweden)

    Gheorghe Şteţca

    2014-11-01

    Full Text Available The presence of somatic cells in milk is a widely disputed issue in milk production sector. The somatic cell counts in raw milk are a marker for the specific cow diseases such as mastitis or swollen udder. The high level of somatic cells causes physical and chemical changes to milk composition and nutritional value, and as well to milk products. Also, the mastitic milk is not proper for human consumption due to its contribution to spreading of certain diseases and food poisoning. According to these effects, EU Regulations established the maximum threshold of admitted somatic cells in raw milk to 400000 cells / mL starting with 2014. The purpose of this study was carried out in order to examine the raw milk samples provided from small farms, industrial type farms and milk processing units. There are several ways to count somatic cells in milk but the reference accepted method is the microscopic method described by the SR EN ISO 13366-1/2008. Generally samples registered values in accordance with the admissible limit. By periodical monitoring of the somatic cell count, certain technological process issues are being avoided and consumer’s health ensured.

  4. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  5. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. SOMATIC EMBRYOGENESIS AND MORPHOANATOMY OF Ocotea porosa SOMATIC EMBRYOS

    Directory of Open Access Journals (Sweden)

    Luciana Luiza Pelegrini

    2013-01-01

    Full Text Available Ocotea porosa seeds have strong tegument dormancy, recalcitrant behavior, low and irregular germination and that makes its natural propagation difficult. The aim of this study was to establish a protocol of regeneration of Ocotea porosa from somatic embryogenesis. Immature embryonic axes were inoculated on WPM culture medium supplemented with 2.4-D (200 μM combined or not with hydrolyzed casein or glutamine (0.5 or 1 g l-1, during 90 days. The repetitive embryogenesis was induced on medium with 2.4-D (22.62 μM combined with 2-iP (2.46 μM followed by transfer to culture medium with hydrolyzed casein or glutamine (1 g l-1 during 90 days. The maturation of somatic embryos was tested in culture medium containing NAA (0.5 μM and 2-iP (5; 10 and 20 μM. The highest percentage of somatic embryos induction (8.3% was observed in WPM culture medium containing 200 μM 2.4-D and 1 g L-1 hydrolyzed casein and the development of somatic embryos occurred indirectly. Repetitive somatic embryogenesis was promoted in WPM medium containing hydrolyzed casein or glutamine. However, the culture medium containing hydrolyzed casein promoted the maintenance of embryogenic capacity for more than two years. During the maturity phase, there was a low progression of globular embryos to cordiform and torpedo stages. The different ontogenetic stages of somatic embryos of Ocotea porosa were characterized by histological studies.

  8. SOMATIC EMBRYOGENESIS AND MORPHOANATOMY OF Ocotea porosa SOMATIC EMBRYOS

    Directory of Open Access Journals (Sweden)

    Luciana Luiza Pelegrini

    2013-12-01

    Full Text Available http://dx.doi.org/10.5902/1980509812343Ocotea porosa seeds have strong tegument dormancy, recalcitrant behavior, low and irregular germinationand that makes its natural propagation difficult. The aim of this study was to establish a protocol ofregeneration of Ocotea porosa from somatic embryogenesis. Immature embryonic axes were inoculatedon WPM culture medium supplemented with 2.4-D (200 μM combined or not with hydrolyzed casein orglutamine (0.5 or 1 g l-1, during 90 days. The repetitive embryogenesis was induced on medium with 2.4-D(22.62 μM combined with 2-iP (2.46 μM followed by transfer to culture medium with hydrolyzed caseinor glutamine (1 g l-1 during 90 days. The maturation of somatic embryos was tested in culture mediumcontaining NAA (0.5 μM and 2-iP (5; 10 and 20 μM. The highest percentage of somatic embryos induction(8.3% was observed in WPM culture medium containing 200 μM 2.4-D and 1 g L-1 hydrolyzed casein andthe development of somatic embryos occurred indirectly. Repetitive somatic embryogenesis was promotedin WPM medium containing hydrolyzed casein or glutamine. However, the culture medium containinghydrolyzed casein promoted the maintenance of embryogenic capacity for more than two years. Duringthe maturity phase, there was a low progression of globular embryos to cordiform and torpedo stages.The different ontogenetic stages of somatic embryos of Ocotea porosa were characterized by histologicalstudies.

  9. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  10. Bovine somatic cell nuclear transfer.

    Science.gov (United States)

    Ross, Pablo J; Cibelli, Jose B

    2010-01-01

    Somatic cell nuclear transfer (SCNT) is a technique by which the nucleus of a differentiated cell is introduced into an oocyte from which its genetic material has been removed by a process called enucleation. In mammals, the reconstructed embryo is artificially induced to initiate embryonic development (activation). The oocyte turns the somatic cell nucleus into an embryonic nucleus. This process is called nuclear reprogramming and involves an important change of cell fate, by which the somatic cell nucleus becomes capable of generating all the cell types required for the formation of a new individual, including extraembryonic tissues. Therefore, after transfer of a cloned embryo to a surrogate mother, an offspring genetically identical to the animal from which the somatic cells where isolated, is born. Cloning by nuclear transfer has potential applications in agriculture and biomedicine, but is limited by low efficiency. Cattle were the second mammalian species to be cloned after Dolly the sheep, and it is probably the most widely used species for SCNT experiments. This is, in part due to the high availability of bovine oocytes and the relatively higher efficiency levels usually obtained in cattle. Given the wide utilization of this species for cloning, several alternatives to this basic protocol can be found in the literature. Here we describe a basic protocol for bovine SCNT currently being used in our laboratory, which is amenable for the use of the nuclear transplantation technique for research or commercial purposes.

  11. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  12. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  13. Somatic symptom profiles in the general population

    DEFF Research Database (Denmark)

    Eliasen, Marie; Jørgensen, Torben; Schröder, Andreas

    2017-01-01

    PURPOSE: The aim of this study was to identify and describe somatic symptom profiles in the general adult population in order to enable further epidemiological research within multiple somatic symptoms. METHODS: Information on 19 self-reported common somatic symptoms was achieved from a population...

  14. Strong decays and dipion transitions of Y(5S)

    International Nuclear Information System (INIS)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  15. Assessment of application of 5S practices in ceramic industry

    Directory of Open Access Journals (Sweden)

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  16. 5S-toimintamallin kehittäminen nostintuotannossa

    OpenAIRE

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  17. Radiative transitions from Υ(5S) to molecular bottomonium

    International Nuclear Information System (INIS)

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  18. [Somatization disorders of the urogenital tract].

    Science.gov (United States)

    Günthert, E A

    2002-11-01

    Diffuse symptoms in the urogenital region can frequently be explained by somatization disorders. Since they cannot be proven either by laboratory tests or with common technical diagnostic methods, somatization disorders should always be taken into consideration. Somatization disorders are to be considered functional disorders. Since somatization disorders due to muscular tension prevail in the urogenital region, the functional disturbance can be explained by the muscular tension. Subsequently, muscular tension causes the pathophysiological development of symptoms. As a rule they appear as myofascial pain or disorder. Muscular tension can have a psychic origin. The absence of urological findings is typical. Males and females between the ages of 16 and 75 can be affected by somatization disorders in the urogenital region. Somatization disorders due to muscular tension belong to the large group of symptoms due to tension. Diagnostic and therapeutic procedures as well as the pathophysiology of somatization disorders due to muscular tension are illustrated by two detailed case-reports.

  19. Hemoglobin promotes somatic embryogenesis in peanut cultures.

    Science.gov (United States)

    Jayabalan, N; Anthony, P; Davey, M R; Power, J B; Lowe, K C

    2004-02-01

    Critical parameters influencing somatic embryogenesis include growth regulators and oxygen supply. Consequently, the present investigation has focused on optimization of a somatic embryogenic system for peanut (Arachis hypogaea L.) through media supplementation with the auxin, picloram. The latter at 30 mg L(-1) was optimal for inducing regeneration of somatic embryos from cultured explants of zygotic embryos. In contrast, somatic embryogenesis did not occur in the absence of this growth regulator. An assessment has also been made of the beneficial effect on somatic embryogenesis and plant regeneration of the commercial hemoglobin (Hb) solution, Erythrogen. Hemoglobin at 1:50 and 1:100 (v:v) stimulated increases in mean fresh weight (up to a maximum of 57% over control), mean number of explants producing somatic embryos (15%) and mean number of somatic embryos per explant (29%).

  20. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  1. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  2. Dimensions of somatization and hypochondriasis.

    Science.gov (United States)

    Ford, C V

    1995-05-01

    A significantly large group of patients who communicate their psychosocial distress in the form of physical symptoms are called somatizers. They tend to overuse medical services. The syndromes with which they present have indistinct boundaries, and there tends to be some fluidity of their symptomatic presentations. Underlying psychiatric disorders such as mood disorders, anxiety disorders (including obsessive compulsive disorder), and personality disorders are frequently present.

  3. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  4. Personality characteristics in patients with somatized disorder

    Directory of Open Access Journals (Sweden)

    Ekaterina Anatolyevna Tolkach

    2010-01-01

    Full Text Available Objective: to study personality characteristics, behavioral style, and modes of relations with their people in patients with somatized disorder. Subjects and methods. Eighty-six patients diagnosed as having somatized disorder were examined using Leary's interpersonal diagnosis system. Results. The author revealed the following personality characteristics and behavioral styles: a depressed need for authoritarianism, dominance, autonomy, aggressiveness, a display of qualities, such as superfriendliness, benevolence, submissiveness, dependency, and suspiciousness. These characteristics give an insight into the development of somatization in patients with somatized disorder.

  5. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  6. Mediators between bereavement and somatic symptoms

    Directory of Open Access Journals (Sweden)

    Konkolÿ Thege Barna

    2012-06-01

    Full Text Available Abstract Background In our research we examined the frequency of somatic symptoms among bereaved (N = 185 and non-bereaved men and women in a national representative sample (N = 4041 and investigated the possible mediating factors between bereavement status and somatic symptoms. Methods Somatic symptoms were measured by the Patient Health Questionnaire (PHQ-15, anxiety with a four-point anxiety rating scale, and depression with a nine-item shortened version of the Beck Depression Inventory. Results Among the bereaved, somatic symptoms proved to be significantly more frequent in both genders when compared to the non-bereaved, as did anxiety and depression. On the multivariate level, the results show that both anxiety and depression proved to be a mediator between somatic symptoms and bereavement. The effect sizes indicated that for both genders, anxiety was a stronger predictor of somatic symptoms than depression. Conclusions The results of our research indicate that somatic symptoms accompanying bereavement are not direct consequences of this state but they can be traced back to the associated anxiety and depression. These results draw attention to the need to recognize anxiety and depression looming in the background of somatic complaints in bereavement and to the importance of the dissemination of related information.

  7. Sulphur depletion altered somatic embryogenesis in Theobroma ...

    African Journals Online (AJOL)

    Somatic embryogenesis is a useful tool for Theobroma cacao improvement and propagation. Depending on culture medium composition, different morphogenetic structures (including somatic embryo) occur in response to alteration of genes expression patterns and biochemical changes. The effect of SO42- ion deficiency ...

  8. Optimization of somatic embryogenesis procedure for commercial ...

    African Journals Online (AJOL)

    The first objective of this study was to assess and optimize somatic embryo production in a genetically diverse range of cacao genotypes. The primary and secondary somatic embryogenesis response of eight promising cacao clones and a positive control was evaluated using modified versions of standard protocols.

  9. Direct somatic embryogenesis in Swietenia macrophylla King

    Directory of Open Access Journals (Sweden)

    Raúl Collado

    2006-04-01

    Full Text Available Swietenia macrophylla King is difficult to be propagated by tissue culture and there is not an efficient system via organogenesis, due to problems of microbial contamination, phenolic oxidation and death of tissue in the phase of in vitro establishment of explants. In order to establish a protocol for obtaining somatic embryos, zygotic embryos were used as initial plant material. Three combinations of 2,4-D with kinetin were studied, to obtain the formation of somatic embryos. After six weeks of culture, the number of explants with high and low somatic embryogenesis frequency were determined. So that the somatic embryos in globular stage reach the final stages of torpedo and cotyledonal, these were placed in three treatments with 6-BAP (0.2, 0.4 y 0.6 mg.l-1. The number of somatic embryos that reached the torpedo and cotyledonal stages were evaluated after 30 days of culture. Results demonstrated that direct somatic embryogenesis from immature zygotic embryos is obtained in the culture medium composed by MS salts with 4.0 mg.l-1 of 2,4-D and 1.0 mg.l-1 of kinetin. Higher percentage of somatic embryos in cotiledonal stage (91.7 %, was obtained with 0.4 mg.l-1 of 6-BAP. Key word: forestry, growth regulator, mahogany, somatic embryo, tissue culture

  10. MMPI screening scales for somatization disorder.

    Science.gov (United States)

    Wetzel, R D; Brim, J; Guze, S B; Cloninger, C R; Martin, R L; Clayton, P J

    1999-08-01

    44 items on the MMPI were identified which appear to correspond to some of the symptoms in nine of the 10 groups on the Perley-Guze checklist for somatization disorder (hysteria). This list was organized into two scales, one reflecting the total number of symptoms endorsed and the other the number of organ systems with at least one endorsed symptom. Full MMPIs were then obtained from 29 women with primary affective disorder and 37 women with somatization disorder as part of a follow-up study of a consecutive series of 500 psychiatric clinic patients seen at Washington University. Women with the diagnosis of somatization disorder scored significantly higher on the somatization disorder scales created from the 44 items than did women with only major depression. These new scales appeared to be slightly more effective in identifying somatization disorder than the use of the standard MMPI scales for hypochondriasis and hysteria. Further development is needed.

  11. Somatic Expression of Psychological Problems (Somatization: Examination with Structural Equation Model

    Directory of Open Access Journals (Sweden)

    Tugba Seda Çolak

    2014-09-01

    Full Text Available The main purpose of the research is to define which psychological symptoms (somatization, depression, obsessive ‐ compulsive, hostility, interpersonal sensitivity, anxiety, phobic anxiety, paranoid ideation and psychoticism cause somatic reactions at most. Total effect of these psychological symptoms on somatic symptoms had been investigated. Study was carried out with structural equation model to research the relation between the psychological symptoms and somatization. The main material of the research is formed by the data obtained from 492 people. SCL‐90‐R scale was used in order to obtain the data. As a result of the structural equation analysis, it has been found that 1Psychoticism, phobic anxiety, and paranoid ideation do not predict somatic symptoms.2There is a negative relation between interpersonal sensitivity level mand somatic reactions.3Anxiety symptoms had been found as causative to occur the highest level of somatic reactions.

  12. Evaluating the potential of housekeeping genes, rRNAs, snRNAs, microRNAs and circRNAs as reference genes for the estimation of PMI.

    Science.gov (United States)

    Tu, Chunyan; Du, Tieshuai; Shao, Chengchen; Liu, Zengjia; Li, Liliang; Shen, Yiwen

    2018-04-24

    The precise estimation of postmortem interval (PMI) is a critical step in death investigation of forensic cases. Detecting the degradation of RNA in tissues by real time quantitative polymerase chain reaction (RT-qPCR) technology provides a new theoretical basis for estimation of PMI. However, most commonly used reference genes degrade over time, while previous studies seldom consider this when selecting suitable reference genes for the estimation of PMI. Studies have shown microRNAs (miRNAs) are very stable and circular RNAs (circRNAs) have recently emerged as a novel class of RNAs with high stability. We aimed to evaluate the stability of the two kinds of RNAs and normal reference genes using geNorm and NormFinder algorithms to identify tissue-specific reference genes for PMI estimation. The content of candidate RNAs from mouse heart, liver and skeletal muscle tissues were dynamically examined in 8 consecutive days after death. Among the 11 candidate genes (β-actin, Gapdh, Rps18, 5S, 18S, U6, miR-133a, miR-122, circ-AFF1, LC-Ogdh and LC-LRP6), the following genes showed prioritized stability: miR-122, miR-133a and 18S in heart tissues; LC-Ogdh, circ-AFF1 and miR-122 in liver tissues; and miR-133a, circ-AFF1 and LC-LRP6 in skeletal muscle tissues. Our results suggested that miRNAs and circRNAs were more stable as reference genes than other kinds of RNAs regarding PMI estimation. The appropriate internal control genes were not completely the same across tissue types.

  13. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  14. Pilates, Mindfulness and Somatic Education.

    Science.gov (United States)

    Caldwell, Karen; Adams, Marianne; Quin, Rebecca; Harrison, Mandy; Greeson, Jeffrey

    2013-12-01

    The Pilates Method is a form of somatic education with the potential to cultivate mindfulness - a mental quality associated with overall well-being. However, controlled studies are needed to determine whether changes in mindfulness are specific to the Pilates Method or also result from other forms of exercise. This quasi-experimental study compared Pilates Method mat classes and recreational exercise classes on measures of mindfulness and well-being at the beginning, middle and end of a 15 week semester. Total mindfulness scores increased overall for the Pilates Method group but not for the exercise control group, and these increases were directly related to end of semester ratings of self-regulatory self-efficacy, perceived stress and mood. Findings suggest that the Pilates Method specifically enhances mindfulness, and these increases are associated with other measures of wellness. The changes in mindfulness identified in this study support the role of the Pilates Method in the mental well-being of its practitioners and its potential to support dancers' overall well-being.

  15. Further evidence for a broader concept of somatization disorder using the somatic symptom index.

    Science.gov (United States)

    Hiller, W; Rief, W; Fichter, M M

    1995-01-01

    Somatization syndromes were defined in a sample of 102 psychosomatic inpatients according to the restrictive criteria of DSM-III-R somatization disorder and the broader diagnostic concept of the Somatic Symptom Index (SSI). Both groups showed a qualitatively similar pattern of psychopathological comorbidity and had elevated scores on measures of depression, hypochondriasis, and anxiety. A good discrimination between mild and severe forms of somatization was found by using the SSI criterion. SSI use accounted for a substantial amount of comorbidity variance, with rates of 15%-20% for depression, 16% for hypochondriasis, and 13% for anxiety. The results provide further evidence for the validity of the SSI concept, which reflects the clinical relevance of somatization in addition to the narrow definition of somatization disorder.

  16. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    Science.gov (United States)

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. symptomatology and comorbidity of somatization disorder amongst

    African Journals Online (AJOL)

    underlying mental disorder, manifesting solely as somatic symptoms or with ... unsatisfactory visit and seemingly ineffective treatment plan. ... patients of all ages and both gender with various ..... identity and physical health: Interdisciplinary.

  18. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    International Nuclear Information System (INIS)

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  19. Somatic surveillance: corporeal control through information networks

    OpenAIRE

    Monahan, Torin; Wall, Tyler

    2007-01-01

    Somatic surveillance is the increasingly invasive technological monitoring of and intervention into body functions. Within this type of surveillance regime, bodies are recast as nodes on vast information networks, enabling corporeal control through remote network commands, automated responses, or self-management practices. In this paper, we investigate three developments in somatic surveillance: nanotechnology systems for soldiers on the battlefield, commercial body-monitoring systems for hea...

  20. Dance and Somatic Inquiry in Studios and Community Dance Programs.

    Science.gov (United States)

    Eddy, Martha Hart

    2002-01-01

    Addresses pragmatic aspects of somatics in the public sector, investigating the fit of somatics within various institutions and settings, including universities, professional schools, and community programs. The article explores issues such as somatic movement approaches, certification, academic degrees in somatic study, confusions within the…

  1. Multicellularity makes somatic differentiation evolutionarily stable

    Science.gov (United States)

    Wahl, Mary E.; Murray, Andrew W.

    2016-01-01

    Many multicellular organisms produce two cell lineages: germ cells, whose descendants produce the next generation, and somatic cells, which support, protect, and disperse the germ cells. This germ-soma demarcation has evolved independently in dozens of multicellular taxa but is absent in unicellular species. A common explanation holds that in these organisms, inefficient intercellular nutrient exchange compels the fitness cost of producing nonreproductive somatic cells to outweigh any potential benefits. We propose instead that the absence of unicellular, soma-producing populations reflects their susceptibility to invasion by nondifferentiating mutants that ultimately eradicate the soma-producing lineage. We argue that multicellularity can prevent the victory of such mutants by giving germ cells preferential access to the benefits conferred by somatic cells. The absence of natural unicellular, soma-producing species previously prevented these hypotheses from being directly tested in vivo: to overcome this obstacle, we engineered strains of the budding yeast Saccharomyces cerevisiae that differ only in the presence or absence of multicellularity and somatic differentiation, permitting direct comparisons between organisms with different lifestyles. Our strains implement the essential features of irreversible conversion from germ line to soma, reproductive division of labor, and clonal multicellularity while maintaining sufficient generality to permit broad extension of our conclusions. Our somatic cells can provide fitness benefits that exceed the reproductive costs of their production, even in unicellular strains. We find that nondifferentiating mutants overtake unicellular populations but are outcompeted by multicellular, soma-producing strains, suggesting that multicellularity confers evolutionary stability to somatic differentiation. PMID:27402737

  2. The Somatic Complaints List: Validation of a self-report questionnaire assessing somatic complaints in children

    NARCIS (Netherlands)

    Jellesma, F. C.; Rieffe, C.J.; Meerum Terwogt, M.

    2007-01-01

    Objective: To evaluate the Somatic Complaint List (SCL) in children. Method: At T1, 365 fourth and 352 fifth graders completed the SCL, the Children's Somatization Inventory (CSI-C), and the Mood Questionnaire. Parents (n=564) completed the parental form of the CSI-C (CSI-P). Six months later, the

  3. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    International Nuclear Information System (INIS)

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  4. Is somatic comorbidity associated with more somatic symptoms, mental distress, or unhealthy lifestyle in elderly cancer survivors?

    Science.gov (United States)

    Grov, Ellen Karine; Fosså, Sophie D; Dahl, Alv A

    2009-06-01

    The associations of lifestyle factors, somatic symptoms, mental distress, and somatic comorbidity in elderly cancer survivors have not been well studied. This study examines these associations among elderly cancer survivors (age >or=65 years) in a population-based sample. A cross-sectional comparative study of Norwegian elderly cancer survivors. Combining information from The Norwegian Cancer Registry, and by self-reporting, 972 elderly cancer survivors were identified, of whom 632 (65%) had somatic comorbidity and 340 did not. Elderly cancer survivors with somatic comorbidity had significantly higher BMI, more performed minimal physical activity, had more somatic symptoms, used more medication, and had more frequently seen a medical doctor than survivors without somatic comorbidity. In multivariable analyses, unhealthy lifestyle and higher somatic symptoms scores were significantly associated with cancer cases with somatic comorbidity. In univariate analyses those with somatic comorbidity were significantly older, had lower levels of education, higher proportions of BMI >or= 30, less physical activity, poorer self-rated health, higher somatic symptoms score, more mental distress, had more frequently seen a medical doctor last year, and more frequently used daily medication. Our outcome measures of lifestyle, somatic symptoms and mental distress were all significantly associated with somatic comorbidity in elderly cancer survivors, however only lifestyle and somatic symptoms were significant in multivariable analyses. In elderly cancer survivors not only cancer, but also somatic comorbidity, deserve attention. Such comorbidity is associated with unhealthy lifestyles, more somatic symptoms and mental distress which should be evaluated and eventually treated.

  5. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    International Nuclear Information System (INIS)

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  6. Somatization: a perspective from self psychology.

    Science.gov (United States)

    Rodin, G M

    1991-01-01

    Somatization is a complex phenomenon that occurs in many forms and diverse settings. It is not necessarily pathological and may be found in a variety of psychiatric disorders. Much of the psychiatric literature has focused on patients with conversion disorders and hypochondriasis. Psychoanalytic theories regarding such conditions were largely based upon concepts of drive, conflict, and defense. The perspective from self psychology, with its emphasis on subjective experience and the sense of self, may further enhance the psychoanalytic understanding of somatization. Individuals with disturbances in the stability and organization of the self may present with somatic symptoms and disturbances in emotional awareness. Somatization in such cases may be the experiential manifestation of a disturbance in the cohesion of the self and/or may result from defensive operations to ward off affect. The latter may be prominent when affective arousal triggers the psychological threat of fragmentation. Somatization may diminish in such individuals when a self-object relationship is formed that bolsters and consolidates the sense of self. The integration of affect into ongoing subjective experience may also be an important aspect of psychoanalytic treatment in such patients.

  7. Hypochondriacal concerns and somatization in panic disorder.

    Science.gov (United States)

    Furer, P; Walker, J R; Chartier, M J; Stein, M B

    1997-01-01

    To clarify the relationship between panic disorder and the symptoms of hypochondriasis and somatization, we evaluated these symptoms and diagnoses in patients attending an Anxiety Disorders Clinic. Structured clinical interviews, self-report measures, and symptom diaries were used to assess 21 patients with panic disorder, 23 patients with social phobia, and 22 control subjects with no psychiatric disorders. Ten of the patients with panic disorder (48%) also met DSM-IV criteria for hypochondriasis, whereas only one of the patients with social phobia and none of the healthy control subjects met the criteria for this diagnosis. None of the participants met DSM-IV criteria for somatization disorder, even though both anxiety groups reported high levels of somatic symptoms. The panic disorder group reported higher levels of fear about illness and disease conviction and endorsed more somatic symptoms than did the other groups. A higher proportion of panic disorder patients reported previously diagnosed medical conditions (48%) as compared with patients with social phobia (17%) or healthy control subjects (14%). The panic disorder patients with DSM-IV hypochondriasis obtained higher scores on measures of hypochondriacal concerns, somatization, blood-injury phobia, and general anxiety and distress than did the panic disorder patients without hypochondriasis. The results suggest a strong association between panic disorder and hypochondriasis.

  8. Cryopreservation of Arachis pintoi (leguminosae) somatic embryos.

    Science.gov (United States)

    Rey, H Y; Faloci, M; Medina, R; Dolce, N; Engelmann, F; Mroginski, L

    2013-01-01

    In this study, we successfully cryopreserved cotyledonary somatic embryos of diploid and triploid Arachis pintoi cytotypes using the encapsulation-dehydration technique. The highest survival rates were obtained when somatic embryos were encapsulated in calcium alginate beads and precultured in agitated (80 rpm) liquid establishment medium (EM) with daily increasing sucrose concentration (0.50, 0.75, and 1.0 M). The encapsulated somatic embryos were then dehydrated with silica gel for 5 h to 20% moisture content (fresh weight basis) and cooled either rapidly (direct immersion in liquid nitrogen, LN) or slowly (1 degree C per min from 25 degree C to -30 degree C followed by immersion in LN). Beads were kept in LN for a minimum of 1 h and then were rapidly rewarmed in a 30 degree C water-bath for 2 min. Finally, encapsulated somatic embryos were post-cultured in agitated (80 rpm) liquid EM with daily decreasing sucrose concentration (0.75 and 0.5 M) and transferred to solidified EM. Using this protocol, we obtained 26% and 30% plant regeneration from cryopreserved somatic embryos of diploid and triploid cytotypes. No morphological abnormalities were observed in any of the plants regenerated from cryopreserved embryos and their genetic stability was confirmed with 10 isozyme systems and nine RAPD profiles.

  9. Cellular Mechanisms of Somatic Stem Cell Aging

    Science.gov (United States)

    Jung, Yunjoon

    2014-01-01

    Tissue homeostasis and regenerative capacity rely on rare populations of somatic stem cells endowed with the potential to self-renew and differentiate. During aging, many tissues show a decline in regenerative potential coupled with a loss of stem cell function. Cells including somatic stem cells have evolved a series of checks and balances to sense and repair cellular damage to maximize tissue function. However, during aging the mechanisms that protect normal cell function begin to fail. In this review, we will discuss how common cellular mechanisms that maintain tissue fidelity and organismal lifespan impact somatic stem cell function. We will highlight context-dependent changes and commonalities that define aging, by focusing on three age-sensitive stem cell compartments: blood, neural, and muscle. Understanding the interaction between extrinsic regulators and intrinsic effectors that operate within different stem cell compartments is likely to have important implications for identifying strategies to improve health span and treat age-related degenerative diseases. PMID:24439814

  10. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    International Nuclear Information System (INIS)

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  11. Somatic seeds of Plantago asiatica L.

    Directory of Open Access Journals (Sweden)

    Emilia Andrzejewska-Golec

    2011-01-01

    Full Text Available Somatic seeds of Plantago asiatica L. were produced for the first time. Shoot-tips isolated from in vitro obtained 4-week shoots were encapsulated using sodium alginate and calcium chloride. Capsules with or without sucrose and with and without cytokinin - indole-3-butyric acid (IBA were used. Sucrose presence in capsules very distinctly influences somatic seeds of Plantago asiatica germination and their conversion into plants. However, addition of IBA to capsules has not clear influence on the ability of plant regrowth. Plantlets transplanted to soil grew to phenotypically normal plants.

  12. Human somatic cell nuclear transfer and cloning.

    Science.gov (United States)

    2012-10-01

    This document presents arguments that conclude that it is unethical to use somatic cell nuclear transfer (SCNT) for infertility treatment due to concerns about safety; the unknown impact of SCNT on children, families, and society; and the availability of other ethically acceptable means of assisted reproduction. This document replaces the ASRM Ethics Committee report titled, "Human somatic cell nuclear transfer (cloning)," last published in Fertil Steril 2000;74:873-6. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  13. Somatic tinnitus prevalence and treatment with tinnitus retraining therapy.

    Science.gov (United States)

    Ostermann, K; Lurquin, P; Horoi, M; Cotton, P; Hervé, V; Thill, M P

    2016-01-01

    Somatic tinnitus originates from increased activity of the dorsal cochlear nucleus, a cross-point between the somatic and auditory systems. Its activity can be modified by auditory stimulation or somatic system manipulation. Thus, sound enrichment and white noise stimulation might decrease tinnitus and associated somatic symptoms. The present uncontrolled study sought to determine somatic tinnitus prevalence among tinnitus sufferers, and to investigate whether sound therapy with counselling (tinnitus retraining therapy; TRT) may decrease tinnitus-associated somatic symptoms. To determine somatic tinnitus prevalence, 70 patients following the TRT protocol completed the Jastreboff Structured Interview (JSI) with additional questions regarding the presence and type of somatic symptoms. Among 21 somatic tinnitus patients, we further investigated the effects of TRT on tinnitus-associated facial dysesthesia. Before and after three months of TRT, tinnitus severity was evaluated using the Tinnitus Handicap Inventory (THI), and facial dysesthesia was assessed with an extended JSI-based questionnaire. Among the evaluated tinnitus patients, 56% presented somatic tinnitus-including 51% with facial dysesthesia, 36% who could modulate tinnitus by head and neck movements, and 13% with both conditions. Self-evaluation indicated that TRT significantly improved tinnitus and facial dysesthesia in 76% of patients. Three months of TRT led to a 50% decrease in mean THI and JSI scores regarding facial dysesthesia. Somatic tinnitus is a frequent and underestimated condition. We suggest an extension of the JSI, including specific questions regarding somatic tinnitus. TRT significantly improved tinnitus and accompanying facial dysesthesia, and could be a useful somatic tinnitus treatment.

  14. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  15. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  16. Genetic transformation of olive somatic embryos through ...

    African Journals Online (AJOL)

    Administrator

    2011-06-20

    Jun 20, 2011 ... 2Department of Biochemistry, National Center of Genetic Engineering and Biotechnology, Tehran, Iran. Accepted 9 March, 2011. Transformed olive plants were regenerated from inoculated somatic embryos with Agrobacterium tumefacience strain GV3101, which carries the plasmid pBI-P5CS containing ...

  17. Somatic Embryogenesis and Plant Regeneration in Eggplant ...

    African Journals Online (AJOL)

    DR SIDHU

    2013-02-20

    Feb 20, 2013 ... Two as well as three way interactions of three eggplant genotypes, media compositions and explants. (hypocotyl, cotyledon and leaf) showed significant differences for plant regeneration. Among three explants, hypocotyl induced highest percent callusing, but cotyledon showed best results for somatic.

  18. Studies for Somatic Embryogenesis in Sweet Potato

    Science.gov (United States)

    Bennett, J. Rasheed; Prakash, C. S.

    1997-01-01

    The purpose of this study was to improve the somatic embryo (SE) system for plant production of sweet potato (Ipomoea batatas L(Lam)). Explants isolated from SE-derived sweet potato plants were compared with control (non SE-derived) plants for their competency for SE production. Leaf explants were cultured on Murashige-Skoog (MS) medium with 2,4-dichlorophenoxy acetic acid (0.2 mg/L) and 6-benzylaminopurine (2.5 mg/L) for 2 weeks in darkness and transferred to MS medium with abscisic acid (2.5 mg/L). Explants isolated from those plants developed through somatic embryogenesis produced new somatic embryos rapidly and in higher frequency than those isolated from control plants They also appeared to grow faster in tissue culture than the control plants. Current studies in the laboratory are examining whether plants derived from a cyclical embryogenesis system (five cycles) would have any further positive impact on the rapidity and frequency of somatic embryo development. More detailed studies using electron microscopy are expected to show the point of origin of the embryos and to allow determination of their quality throughout the cyclical process. This study may facilitate improved plant micropropagation, gene transfer and germplasm conservation in sweet potato.

  19. Studies on Somatic Embryogenesis in Sweetpotato

    Science.gov (United States)

    Bennett, J. Rasheed; Prakash, C. S.

    1997-01-01

    The purpose of this study was to improve the somatic embryo (SE) system for plant production of sweetpotato Ipomoea batatas L.(Lam)l. Explants isolated from SE-derived sweet potato plants were compared with control (non SE-derived) plants for their competency for SE production. Leaf explants were cultured on Murashige-Skoog (MS) medium with 2,4-dichlorophenoxy acetic acid (0.2 mg/L) and 6-benzylaminopurine (2.5 mg/L) for 2 weeks in darkness and transferred to MS medium with abscisic acid (2.5 Explants isolated from those plants developed through somatic embryo-genesis produced new somatic embryos rapidly and in higher frequency than those isolated from control plants. They also appeared to grow faster in tissue culture than the control plants. Current studies in the laboratory are examining whether plants derived from a cyclical embryogenesis system (five cycles) would have any further positive impact on the rapidity and frequency of somatic embryo development. More detailed studies using electron microscopy are expected to show the point of origin of the embryos and to allow determination of their quality throughout the cyclical process. This study may facilitate improved plant micropropagation, gene transfer and germplasm conservation in sweet potato.

  20. POLE somatic mutations in advanced colorectal cancer.

    Science.gov (United States)

    Guerra, Joana; Pinto, Carla; Pinto, Diana; Pinheiro, Manuela; Silva, Romina; Peixoto, Ana; Rocha, Patrícia; Veiga, Isabel; Santos, Catarina; Santos, Rui; Cabreira, Verónica; Lopes, Paula; Henrique, Rui; Teixeira, Manuel R

    2017-12-01

    Despite all the knowledge already gathered, the picture of somatic genetic changes in colorectal tumorigenesis is far from complete. Recently, germline and somatic mutations in the exonuclease domain of polymerase epsilon, catalytic subunit (POLE) gene have been reported in a small subset of microsatellite-stable and hypermutated colorectal carcinomas (CRCs), affecting the proofreading activity of the enzyme and leading to misincorporation of bases during DNA replication. To evaluate the role of POLE mutations in colorectal carcinogenesis, namely in advanced CRC, we searched for somatic mutations by Sanger sequencing in tumor DNA samples from 307 cases. Microsatellite instability and mutation analyses of a panel of oncogenes were performed in the tumors harboring POLE mutations. Three heterozygous mutations were found in two tumors, the c.857C>G, p.Pro286Arg, the c.901G>A, p.Asp301Asn, and the c.1376C>T, p.Ser459Phe. Of the POLE-mutated CRCs, one tumor was microsatellite-stable and the other had low microsatellite instability, whereas KRAS and PIK3CA mutations were found in one tumor each. We conclude that POLE somatic mutations exist but are rare in advanced CRC, with further larger studies being necessary to evaluate its biological and clinical implications. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  1. Relationship between somatization and remission with ECT.

    Science.gov (United States)

    Rasmussen, Keith G; Snyder, Karen A; Knapp, Rebecca G; Mueller, Martina; Yim, Eunsil; Husain, Mustafa M; Rummans, Teresa A; Sampson, Shirlene M; O'Connor, M Kevin; Bernstein, Hilary J; Kellner, Charles H

    2004-12-30

    Patients treated with electroconvulsive therapy (ECT) were divided into those with less severe depression and those with more severe depression. In the less severely depressed group, high somatic anxiety and hypochondriasis predicted a low likelihood of sustained remission with ECT. In the more severely depressed group, these traits were not predictive of ECT outcome.

  2. Somatic And Behavioral Changes Associated With Difuse ...

    African Journals Online (AJOL)

    Aims: The effects of diffuse transcranial electrical stimulation on somatic and behavioral changes in anaesthetized and unanaesthetized normal male and female Wister rats was studied. Method: Diffuse transcranial electrical stimulation (0-25v, frequency 90Hz,pulse width 1ms) was administered via two electrodes clipped ...

  3. Somatic Symptoms in Traumatized Children and Adolescents

    Science.gov (United States)

    Kugler, Brittany B.; Bloom, Marlene; Kaercher, Lauren B.; Truax, Tatyana V.; Storch, Eric A.

    2012-01-01

    Childhood exposure to trauma has been associated with increased rates of somatic symptoms (SS), which may contribute to diminished daily functioning. One hundred and sixty-one children residing at a residential treatment home who had experienced neglect and/or abuse were administered the Trauma Symptom Checklist for Children (TSCC), the…

  4. Somatic Embryogenesis in Juniperus Procera using Juniperus ...

    African Journals Online (AJOL)

    The aim for this particular research was initially an adaptation of optimum half strength lithium chloride-sodium propionate (LP) medium protocol for growth and proliferation of embryogenic ... Additional study on the effect of seed extraction to the growing embryogenic culture showed no effect on mature somatic embryos.

  5. [Interdependance between somatic symptoms, sleep and dreams].

    Science.gov (United States)

    Todorov, Assya

    2014-03-19

    Even in an established illness, somatic complains can hide other emotional inquiries. The therapist, always with a kind attitude, can ask more about patient's sexual life. This can be use of having a better idea of patient's life and problems. Talking about dreams can also be useful: it gives new and surprising elements about patient's personality and helps to progress on healing's way.

  6. Depression, disability and somatic diseases among elderly

    NARCIS (Netherlands)

    Verhaak, P.F.M.; Dekker, Janny; De Waal, M.W.M.; Van Marwijk, H.W.J.; Comijs, H.C.

    2014-01-01

    Objective: Depression among older adults is associated with both disability and somatic disease. We aimed to further understand this complicated relationship and to study the possible modifying effect of increasing age. Design: Cross sectional survey. Setting: Outpatient and inpatient clinics of

  7. Writing Bodies: Somatic Mind in Composition Studies.

    Science.gov (United States)

    Fleckenstein, Kristie S.

    1999-01-01

    Discusses the somatic mind, a permeable materiality in which mind and body resolve into a single entity which is (re)formed by the constantly shifting boundaries of discursive and corporeal intertextualities. Addresses its importance in composition studies. Critiques the poststructuralist disregard of corporeality. (CR)

  8. Depression and hypochondriasis in family practice patients with somatization disorder.

    Science.gov (United States)

    Oxman, T E; Barrett, J

    1985-10-01

    The relationships specified in DSM-III between somatization disorder and depression, and somatization disorder and hypochondriasis require further validation and easier methods of detection for use by primary care physicians. The authors investigated hypochondriacal and depressive symptoms in 13 family practice outpatients with somatization disorder. Pain complaints and depressive symptomatology were present in over 75% of this group, while hypochondriacal symptoms were present in 38%. The mean score on the somatization scale of the Hopkins Symptom Check List (HSCL-90) was greater than that reported for any other group. These findings support the separation of somatization disorder and hypochondriasis and suggest the need for better delineation of depressive subtypes in somatization disorder. The somatization scale of the HSCL-90 should be a useful screen for somatization disorder in future research.

  9. Delusional disorder-somatic type (or body dysmorphic disorder) and ...

    African Journals Online (AJOL)

    to distinguish cases of delusional disorder of somatic subtype from severe somatization .... features suggestive of a paranoid schizophrenia. Paranoid schizophrenia ... Of note is that the patient's personality and psychosocial functioning were ...

  10. Development of direct somatic embryogenesis and regeneration on citrus sinesis

    International Nuclear Information System (INIS)

    Chong Saw Peng; Alvina Lindsay Mijen; Rusli Ibrahim

    2004-01-01

    The plant regeneration processes in Citrus sinensis involves direct somatic embryogenesis. Culture medium used was MS basal supplemented with 50 mg/L sucrose, 0.27% agar and 0.1% vitamin at pH 5.8. Sucrose is the major carbon source for the induction of somatic embryo and also the maturation and germination of somatic embryo. (Author)

  11. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  12. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  13. Dogs cloned from adult somatic cells.

    Science.gov (United States)

    Lee, Byeong Chun; Kim, Min Kyu; Jang, Goo; Oh, Hyun Ju; Yuda, Fibrianto; Kim, Hye Jin; Hossein, M Shamim; Shamim, M Hossein; Kim, Jung Ju; Kang, Sung Keun; Schatten, Gerald; Hwang, Woo Suk

    2005-08-04

    Several mammals--including sheep, mice, cows, goats, pigs, rabbits, cats, a mule, a horse and a litter of three rats--have been cloned by transfer of a nucleus from a somatic cell into an egg cell (oocyte) that has had its nucleus removed. This technology has not so far been successful in dogs because of the difficulty of maturing canine oocytes in vitro. Here we describe the cloning of two Afghan hounds by nuclear transfer from adult skin cells into oocytes that had matured in vivo. Together with detailed sequence information generated by the canine-genome project, the ability to clone dogs by somatic-cell nuclear transfer should help to determine genetic and environmental contributions to the diverse biological and behavioural traits associated with the many different canine breeds.

  14. Should general psychiatry ignore somatization and hypochondriasis?

    Science.gov (United States)

    Creed, Francis

    2006-10-01

    This paper examines the tendency for general psychiatry to ignore somatization and hypochondriasis. These disorders are rarely included in national surveys of mental health and are not usually regarded as a concern of general psychiatrists; yet primary care doctors and other physicians often feel let down by psychiatry's failure to offer help in this area of medical practice. Many psychiatrists are unaware of the suffering, impaired function and high costs that can result from these disorders, because these occur mainly within primary care and secondary medical services. Difficulties in diagnosis and a tendency to regard them as purely secondary phenomena of depression, anxiety and related disorders mean that general psychiatry may continue to ignore somatization and hypochondriasis. If general psychiatry embraced these disorders more fully, however, it might lead to better prevention and treatment of depression as well as helping to prevent the severe disability that may arise in association with these disorders.

  15. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  16. Should general psychiatry ignore somatization and hypochondriasis?

    OpenAIRE

    CREED, FRANCIS

    2006-01-01

    This paper examines the tendency for general psychiatry to ignore somatization and hypochondriasis. These disorders are rarely included in national surveys of mental health and are not usually regarded as a concern of general psychiatrists; yet primary care doctors and other physicians often feel let down by psychiatry's failure to offer help in this area of medical practice. Many psychiatrists are unaware of the suffering, impaired function and high costs that can result fr...

  17. Is Pilates a Somatic Education Method?

    Directory of Open Access Journals (Sweden)

    Débora Pereira

    2014-12-01

    Full Text Available This paper renews the discussion about the relevance of the Pilates method to the field of Somatic Education. The impact of marketing – which sells the method as a fitness activity – and the academic research on the application of the method in the treatment of various medical disorders, as well as its role in the construction of contemporary dance aesthetics, are put into perspective.

  18. The somatic shunt cable model for neurons.

    OpenAIRE

    Durand, D

    1984-01-01

    The derivation of the equations for an electrical model of nerve cells is presented. The model consists of an equivalent cylinder, a lumped somatic impedance, and a variable shunt at the soma. This shunt was introduced to take into account the fast voltage decays observed following the injections of current pulses in some motoneurons and hippocampal granule cells that could not be explained by existing models. The shunt can be interpreted either by penetration damage with the electrode or by ...

  19. The 5S methodology as a tool for improving the organisation

    OpenAIRE

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  20. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    International Nuclear Information System (INIS)

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  1. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  2. 4p-5s transitions in In XIII, In XIV and In XV

    International Nuclear Information System (INIS)

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  3. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  4. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  5. Germinal and somatic mutations in cancer

    International Nuclear Information System (INIS)

    Knudson, A.G. Jr.

    1977-01-01

    The role of germinal and somatic mutations in carcinogenesis leads to the conclusion that environmental carcinogens probably exert their effects via somatic mutations. Susceptibility to this process may itself be genetically determined, so we may deduce that two groups, one genetic and one non-genetic, are included in the 'environmental' class. Other individuals seem to acquire cancer even in the absence of such environmental agents, and these too may be classified into a genetic and a non-genetic group. It has been estimated that in industrial countries, the environmental groups include 70-80% of all cancer cases, but we are only beginning to know how to separate the genetic and non-genetic subgroups. The genetic subgroup of the 'non-environmental' group is very small, probably of the order of magnitude of 1-2% for cancer as a whole. The remainder, about 25%, comprises a non-genetic, non-environmental subgroup that seems to arise as a consequence of 'spontaneous' somatic mutations. The incidence of these 'background' cancers is what we should combat with preventive and therapeutic measures

  6. Children of people with somatization disorder.

    Science.gov (United States)

    Livingston, R

    1993-05-01

    The author investigated psychopathology, suicidal behavior, child abuse, somatization, and health care utilization in 34 children with a parent who has somatization disorder (SD-P) and two comparison groups: 41 children with a somatizing parent (SOM) (fewer symptoms than required for diagnosis of SD-P), and 30 pediatrically ill controls (CON). Child and parent versions of the Diagnostic Interview for Children and Adolescents were scored for diagnosis and symptom counts in specified categories. Medical records were obtained and abstracted. Children of SD-P had significantly more psychiatric disorders and suicide attempts than did children of SOM or the CON. SD-P and CON had significantly more unexplained physical symptoms than SOM. SD-P showed a trend toward more hospitalizations and experienced significantly more maltreatment. Children of SD-P are at significant risk in several respects. Clinical implications of these findings include a need for awareness and cooperation among general psychiatrists, primary care physicians, and child and adolescent psychiatrists to facilitate detection and treatment of these children's problems.

  7. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  9. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  10. Distinct maternal and somatic rRNA types in zebrafish development

    NARCIS (Netherlands)

    Locati, M.

    2017-01-01

    There is mounting evidence that the ribosome is not a static translation machinery, but a cell-specific, adaptive system. Ribosomal variations have mostly been studied at the protein level, even though the essential transcriptional functions are primarily performed by ribosomal RNAs (rRNAs). At the

  11. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  12. Decay rate ratios of Υ(5S)→B anti B reactions

    International Nuclear Information System (INIS)

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  13. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    International Nuclear Information System (INIS)

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  14. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  15. The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX

    International Nuclear Information System (INIS)

    Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.

    1976-01-01

    With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)

  16. The somatic symptom scale-8 (SSS-8): a brief measure of somatic symptom burden.

    Science.gov (United States)

    Gierk, Benjamin; Kohlmann, Sebastian; Kroenke, Kurt; Spangenberg, Lena; Zenger, Markus; Brähler, Elmar; Löwe, Bernd

    2014-03-01

    Somatic symptoms are the core features of many medical diseases, and they are used to evaluate the severity and course of illness. The 8-item Somatic Symptom Scale (SSS-8) was recently developed as a brief, patient-reported outcome measure of somatic symptom burden, but its reliability, validity, and usefulness have not yet been tested. To investigate the reliability, validity, and severity categories as well as the reference scores of the SSS-8. A national, representative general-population survey was performed between June 15, 2012, and July 15, 2012, in Germany, including 2510 individuals older than 13 years. The SSS-8 mean (SD), item-total correlations, Cronbach α, factor structure, associations with measures of construct validity (Patient Health Questionnaire-2 depression scale, Generalized Anxiety Disorder-2 scale, visual analog scale for general health status, 12-month health care use), severity categories, and percentile rank reference scores. The SSS-8 had excellent item characteristics and good reliability (Cronbach α = 0.81). The factor structure reflects gastrointestinal, pain, fatigue, and cardiopulmonary aspects of the general somatic symptom burden. Somatic symptom burden as measured by the SSS-8 was significantly associated with depression (r = 0.57 [95% CI, 0.54 to 0.60]), anxiety (r = 0.55 [95% CI, 0.52 to 0.58]), general health status (r = -0.24 [95% CI, -0.28 to -0.20]), and health care use (incidence rate ratio, 1.12 [95% CI, 1.10 to 1.14]). The SSS-8 severity categories were calculated in accordance with percentile ranks: no to minimal (0-3 points), low (4-7 points), medium (8-11 points), high (12-15 points), and very high (16-32 points) somatic symptom burden. For every SSS-8 severity category increase, there was a 53% (95% CI, 44% to 63%) increase in health care visits. The SSS-8 is a reliable and valid self-report measure of somatic symptom burden. Cutoff scores identify individuals with low, medium, high, and very high somatic

  17. Mortality in unipolar depression preceding and following chronic somatic diseases

    DEFF Research Database (Denmark)

    Koyanagi, A; Köhler-Forsberg, O; Benros, M E

    2018-01-01

    -varying covariates were constructed to assess the risk for all-cause and non-suicide deaths for individual somatic diseases. RESULTS: For all somatic diseases, prior and/or subsequent depression conferred a significantly higher mortality risk. Prior depression was significantly associated with a higher mortality......OBJECTIVE: It is largely unknown how depression prior to and following somatic diseases affects mortality. Thus, we examined how the temporal order of depression and somatic diseases affects mortality risk. METHOD: Data were from a Danish population-based cohort from 1995 to 2013, which included...... all residents in Denmark during the study period (N = 4 984 912). Nineteen severe chronic somatic disorders from the Charlson Comorbidity Index were assessed. The date of first diagnosis of depression and somatic diseases was identified. Multivariable Cox proportional Hazard models with time...

  18. Somatic Embryogenesis in Yam (Dioscorea rotundata

    Directory of Open Access Journals (Sweden)

    Isidro Elías Suárez Padrón

    2011-12-01

    Full Text Available Embryogenic yam (Dioscorea rotundata cultures were induced from petioles of leaves of in vitro grown plants on medium supplemented with different 2.4-D concentrations. Cultures were maintained either on semisolid or in liquid MS medium supplemented with 4.52 µM 2.4-D. The effect of sucrose concentration on somatic embryo development was also evaluated and the effects of different BAP concentrations on somatic embryo conversion were determined. Treatments were distributed using a complete randomized design. The highest rate of induction occurred with 4.52 µM 2.4-D. Sucrose at 131.46 mM significantly enhanced somatic embryo development. The conversion rate was not affected by BAP.Cultivos embriogénicos de ñame (Dioscorea rotundata fueron inducidos a partir de explantes consistentes de hojas con peciolos, aisladas de plantas establecidas en condiciones in vitro, en presencia de diferentes concentraciones de 2,4-D. Los cultivos inducidos fueron mantenidos en medio MS líquido o semisólido suplido con 4,52 µM 2,4-D. El efecto de las concentraciones de sacarosa sobre el desarrollo de embriones somáticos y el efecto de varias concentraciones de BAP sobre la tasa de conversión de embriones somáticos en plantas también fueron evaluados. Todos los tratamientos fueron distribuidos usando un diseño completamente al azar. El mayor porcentaje de inducción de tejidos embriogénicos ocurrió con 4,52 µM de 2,4-D. La adición de 131,46 mM de sacarosa incrementó significativamente el desarrollo de embriones somáticos. La tasa de conversión de embriones somáticos en plantas no fue afectada por las concentraciones de BAP.

  19. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  20. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    International Nuclear Information System (INIS)

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  1. Somatic symptom disorder treated with electroconvulsive therapy.

    Science.gov (United States)

    Borisovskaya, Anna; Augsburger, Jay Alan

    2017-05-01

    Somatic symptom disorder (SSD) is a challenging condition to treat with chronic pain, a common and disabling symptom. We present a patient who received electroconvulsive therapy (ECT) for SSD with significant improvement in pain and gastrointestinal symptoms. We also present a brief literature review of similar cases treated with ECT. Preliminary evidence suggests that ECT should be considered for treatment of SSD comorbid with major depressive disorder, when standard treatments fail. Further research is needed to clarify whether ECT can be used for SSD without associated depression.

  2. Practice Guidelines for Treatment of Somatic Pain and Depression

    OpenAIRE

    Sonali Sarkar

    2017-01-01

    Background: Somatic pain is often associated with depression. Patients presenting with this combination can be difficult to treat and create a significant financial burden on the medical system. The mechanisms of action linking somatic pain and the myriad of depression are not clearly understood thus highlighting a gap in knowledge between the scientific mechanism, pathogenesis, and psychiatry involved in depression and somatic pain. The objective of this review article is to address etiolog...

  3. Polyphenols distributions and reserve substances analysis in cacao somatic embryogenesis

    OpenAIRE

    Adriana María Gallego Rúa; Ana María Henao Ramírez; Aura Inés Urrea Trujillo; Lucía Atehortúa Garcés

    2016-01-01

    ABSTRACTIn order to understand the causes of lack of regeneration in cacao somatic embryos, two cacao varieties with different responses to regeneration potential were described based on their capacity to store different compounds. It is well known that seed reserves play a central role in the regenerative capability of somatic embryos; thus, we followed histochemical changes and reserve fluctuations of proteins, polysaccharides and polyphenols during somatic embryogenesis (SE) in the two cac...

  4. POLYPHENOLS DISTRIBUTION AND RESERVE SUBSTANCES ANALYSIS IN CACAO SOMATIC EMBRYOGENESIS

    OpenAIRE

    GALLEGO RÚA, Adriana María; HENAO RAMÍREZ, Ana María; URREA TRUJILLO, Aura Inés; ATEHORTÚA GARCÉS, Lucía

    2016-01-01

    In order to understand the causes of lack of regeneration in cacao somatic embryos, two cacao varieties with different responses to regeneration potential were described based on their capacity to store different compounds. It is well known that seed reserves play a central role in the regenerative capability of somatic embryos; thus, we followed histochemical changes and reserve fluctuations of proteins, polysaccharides and polyphenols during somatic embryogenesis (SE) in the two cacao varie...

  5. Ballet as Somatic Practice: A Case Study Exploring the Integration of Somatic Practices in Ballet Pedagogy

    Science.gov (United States)

    Berg, Tanya

    2017-01-01

    This case study explores one teacher's integration of Alexander Technique and the work of neuromuscular retrainer Irene Dowd in ballet pedagogy to establish a somatic approach to teaching, learning, and performing ballet technique. This case study highlights the teacher's unique teaching method called IMAGE TECH for dancers (ITD) and offers…

  6. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  7. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  8. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    OpenAIRE

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  9. Somatic Symptom Disorder in Semantic Dementia: The Role of Alexisomia.

    Science.gov (United States)

    Gan, Joanna J; Lin, Andrew; Samimi, Mersal S; Mendez, Mario F

    Semantic dementia (SD) is a neurodegenerative disorder characterized by loss of semantic knowledge. SD may be associated with somatic symptom disorder due to excessive preoccupation with unidentified somatic sensations. To evaluate the frequency of somatic symptom disorder among patients with SD in comparison to comparably demented patients with Alzheimer׳s disease. A retrospective cohort study was conducted using clinical data from a referral-based behavioral neurology program. Fifty-three patients with SD meeting criteria for imaging-supported semantic variant primary progressive aphasia (another term for SD) were compared with 125 patients with clinically probable Alzheimer disease. Logistic regression controlled for sex, age, disease duration, education, overall cognitive impairment, and depression. The prevalence of somatic symptom disorder was significantly higher among patients with SD (41.5%) compared to patients with Alzheimer disease (11.2%) (odds ratio = 6:1; p Cotard syndrome or the delusion that unidentified somatic symptoms signify death or deterioration. SD, a disorder of semantic knowledge, is associated with somatic symptom disorder from impaired identification of somatic sensations. Their inability to read and name somatic sensations, or "alexisomia," results in disproportionate and persistent concern about somatic sensations with consequent significant disability. Copyright © 2016 The Academy of Psychosomatic Medicine. Published by Elsevier Inc. All rights reserved.

  10. Induction of somatic embryogenesis in soybean: physicochemical factors influencing the development of somatic embryos

    Directory of Open Access Journals (Sweden)

    Bonacin Gisele Aparecida

    2000-01-01

    Full Text Available The embryogenic capability of five soybean cultivars (Renascença, IAS-5, IAC-17, BR-16 and FT-Cometa was studied at different auxin concentrations (8, 10 and 12 mg/l naphthalene acetic acid, NAA, at different pHs (5.8 and 7.0 and at low (8-12 muEm-2 s-1 and high (27-33 mEm-2 s-1 light intensities. The experimental design was completely randomized with four replications. Immature cotyledons 4-6 mm in length were placed in the six induction mediums evaluated and submitted to two light intensities. Twenty immature cotyledons per cultivar were placed on each Petri dish, which was considered to be one replication. The number of somatic embryos per treatment per replication was counted. The results showed genotype influence on somatic embryogenic capability of each cultivar, with the most embryogenic cultivars being BR-16, FT-Cometa and IAS-5. Auxin concentration and pH value also influenced somatic embryo production, with 10 mg/l NAA being the best auxin concentration and 7.0 the best pH value. The interactions cultivar x auxin, auxin x pH and pH x light were significant, while other double interactions were not. All triple and quadruple interactions were significant, except cultivar x pH x light. No significant differences in somatic embryo production were observed in medium with different pHs or when the Petri dishes containing immature cotyledons were exposed to the two light intensities evaluated. However, a higher number of somatic embryos was produced when the medium pH was adjusted to 7.0.

  11. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  12. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Science.gov (United States)

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  13. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    International Nuclear Information System (INIS)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  14. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    International Nuclear Information System (INIS)

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  15. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  16. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  17. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  18. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  19. Y(5S): What has been learned and what can be learned

    International Nuclear Information System (INIS)

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  20. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Directory of Open Access Journals (Sweden)

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  1. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  2. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Anne Bruun Krøigård

    Full Text Available Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths.

  3. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data.

    Science.gov (United States)

    Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne-Vibeke; Kruse, Torben A; Larsen, Martin Jakob

    2016-01-01

    Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths.

  4. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    International Nuclear Information System (INIS)

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  5. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

  7. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  8. The Use of Light Microscopy for Detection of Somatic Embryos

    African Journals Online (AJOL)

    usuario

    2014-02-05

    Feb 5, 2014 ... 2,4-D. After four weeks of culture of explants on the callus induction medium, globular structures were obtained. At the end of 20 days in maturation medium, somatic embryos were observed. Histological analysis showed somatic embryos with caulinar and root apex, protodermal tissue, and the vascular ...

  9. Plant regeneration of Michelia champaca L., through somatic ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-03

    May 3, 2010 ... as a basic material for perfume, cosmetic, and medicine. The development of an ... Plant regeneration systems of M. champaca through somatic ... The embryogenic cells proliferated and formed somatic embryos (30%) after four to six .... by using MS excel program and Duncan's new multiple range test.

  10. Optimization of somatic embryogenesis induction in Iranian melon ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... embryo induction and the combination of 0.1 mg/l BA and 5 mg/l 2,4-D had significant effect on somatic ... such as genotype, growth regulator, explant and culture ... different stages of somatic embryos development. (globular ...

  11. Somatic delusions and obsessive-compulsive disorder in ...

    African Journals Online (AJOL)

    The patient was later referred to the psychiatry department of the same hospital and diagnosed with schizophrenia with somatic delusions and OCS according to the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV) criteria. He was screened for schizophrenia, OCS and olfactory and somatic delusions by ...

  12. Improving somatic health of outpatients with severe mental illness

    NARCIS (Netherlands)

    Van Hasselt, Fenneke M.; Oud, Marian J. T.; Krabbe, Paul F. M.; Postma, Maarten J.; Loonen, A.J.M.

    2014-01-01

    Background: Patients with severe mental illness (SMI) experience a 13-to 30-year reduction in life expectancy compared with the general population. The majority of these deaths can be attributed to somatic health problems. The risk on somatic health problems is partly increased due to a reduced

  13. Induction of somatic embryogenesis by polyethylene glycol and ...

    African Journals Online (AJOL)

    VIJI

    2012-06-05

    Jun 5, 2012 ... supplemented with 2,4-D (2 µM), abscisic acid (3 µM) and glutamine (0.03 mM). The somatic embryos ... essential amino acids of seed proteins, shortened vegetative ... or somatic embryo maturation in diverse plants such as.

  14. Somatic embryogenesis and plant regeneration from leaf explants of ...

    African Journals Online (AJOL)

    An attempt was made to study the somatic embryogenesis and plant regeneration from the in vitro leaf explants of Rumex vesicarius L. a renowned medicinal plant, which belongs to polygonaceae family. Effective in vitro regeneration of R. vesicarius was achieved via young leaf derived somatic embryo cultures.

  15. Alcohol dependence and risk of somatic diseases and mortality

    DEFF Research Database (Denmark)

    Holst, Charlotte; Tolstrup, Janne Schurmann; Sørensen, Holger Jelling

    2017-01-01

    AIMS: To (1) estimate sex-specific risks of a comprehensive spectrum of somatic diseases in alcohol-dependent individuals versus a control population, and in the same population to (2) estimate sex-specific risks of dying from the examined somatic diseases. DESIGN: Register-based matched cohort...

  16. Somatic Diseases and Conditions Before the First Diagnosis of Schizophrenia

    DEFF Research Database (Denmark)

    Sørensen, Holger J; Nielsen, Philip Finn Rising; Benros, Michael E

    2015-01-01

    OBJECTIVE: Schizophrenia is associated with excess physical comorbidity. Yet, to our knowledge, large studies are lacking on the associations with somatic diseases before the onset of schizophrenia. The authors conducted a nationwide study of the full spectrum of treated somatic diseases before t...

  17. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    International Nuclear Information System (INIS)

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  18. Recent advancements in cloning by somatic cell nuclear transfer.

    Science.gov (United States)

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko

    2013-01-05

    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model.

  19. Somatic point mutation calling in low cellularity tumors.

    Directory of Open Access Journals (Sweden)

    Karin S Kassahn

    Full Text Available Somatic mutation calling from next-generation sequencing data remains a challenge due to the difficulties of distinguishing true somatic events from artifacts arising from PCR, sequencing errors or mis-mapping. Tumor cellularity or purity, sub-clonality and copy number changes also confound the identification of true somatic events against a background of germline variants. We have developed a heuristic strategy and software (http://www.qcmg.org/bioinformatics/qsnp/ for somatic mutation calling in samples with low tumor content and we show the superior sensitivity and precision of our approach using a previously sequenced cell line, a series of tumor/normal admixtures, and 3,253 putative somatic SNVs verified on an orthogonal platform.

  20. Predictive factors for somatization in a trauma sample

    DEFF Research Database (Denmark)

    Elklit, Ask; Christiansen, Dorte M

    2009-01-01

    ABSTRACT: BACKGROUND: Unexplained somatic symptoms are common among trauma survivors. The relationship between trauma and somatization appears to be mediated by posttraumatic stress disorder (PTSD). However, only few studies have focused on what other psychological risk factors may predispose...... a trauma victim towards developing somatoform symptoms. METHODS: The present paper examines the predictive value of PTSD severity, dissociation, negative affectivity, depression, anxiety, and feeling incompetent on somatization in a Danish sample of 169 adult men and women who were affected by a series...... of incompetence significantly predicted somatization in the trauma sample whereas dissociation, depression, and anxiety were not associated with degree of somatization. PTSD as a risk factor was mediated by negative affectivity....

  1. Recent advancements in cloning by somatic cell nuclear transfer

    Science.gov (United States)

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko

    2013-01-01

    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model. PMID:23166393

  2. Masked depression: its interrelations with somatization, hypochondriasis and conversion.

    Science.gov (United States)

    Fisch, R Z

    1987-01-01

    Masked depression appears to be a common clinical phenomenon. Most depressions present with some somatic complaints in addition to affective and cognitive ones. About one half of all depressions seen by primary care physicians initially present predominantly or exclusively with somatic symptoms. Many of these depressions are not recognized or are misdiagnosed and mistreated. The possible reasons for this are discussed here. The phenomenon of somatization in depressions and other conditions is reviewed and the interface with other related clinical problems like hypochondriasis and conversion is delineated. It is hypothesized that the proportion of depressions that are masked is positively correlated to the patients' tendency to somatize and negatively correlated to the doctors' ability to recognize depressions that hide behind somatic complaints. Suggestions for the diagnosis and treatment of masked depressions are given.

  3. Somatic Embryogenesis: Still a Relevant Technique in Citrus Improvement.

    Science.gov (United States)

    Omar, Ahmad A; Dutt, Manjul; Gmitter, Frederick G; Grosser, Jude W

    2016-01-01

    The genus Citrus contains numerous fresh and processed fruit cultivars that are economically important worldwide. New cultivars are needed to battle industry threatening diseases and to create new marketing opportunities. Citrus improvement by conventional methods alone has many limitations that can be overcome by applications of emerging biotechnologies, generally requiring cell to plant regeneration. Many citrus genotypes are amenable to somatic embryogenesis, which became a key regeneration pathway in many experimental approaches to cultivar improvement. This chapter provides a brief history of plant somatic embryogenesis with focus on citrus, followed by a discussion of proven applications in biotechnology-facilitated citrus improvement techniques, such as somatic hybridization, somatic cybridization, genetic transformation, and the exploitation of somaclonal variation. Finally, two important new protocols that feature plant regeneration via somatic embryogenesis are provided: protoplast transformation and Agrobacterium-mediated transformation of embryogenic cell suspension cultures.

  4. Somatic hybridization of sexually incompatible petunias: Petunia parodii, Petunia parviflora.

    Science.gov (United States)

    Power, J B; Berry, S F; Chapman, J V; Cocking, E C

    1980-01-01

    Somatic hybrid plants were regenerated following the fusion of leaf mesophyll protoplasts of P. parodii with those isolated from a nuclear-albino mutant of P. parviflora. Attempts at sexual hybridization of these two species repeatedly failed thus confirming their previously established cross-incompatibility. Selection of somatic hybrid plants was possible since protoplasts of P. parodii would not develop beyond the cell colony stage, whilst those of the somatic hybrid and albino P. parviflora produced calluses. Green somatic hybrid calluses were visible against a background of albino cells/calluses, and upon transfer to regeneration media gave rise to shoots. Shoots and the resultant flowering plants were confirmed as somatic hybrids based on their growth habit, floral pigmentation and morphology, leaf hair structure, chromosome number and Fraction 1 protein profiles. The relevance of such hybrid material for the development of new, and extensively modified cultivars, is discussed.

  5. Effect of light quality on somatic embryogenesis of quince leaves

    International Nuclear Information System (INIS)

    D'Onofrio, C.; Morini, S.; Bellocchi, G.

    1998-01-01

    The effect of light quality on somatic embryogenesis in quince BA 29 was investigated. 2,4-D induced leaves were exposed for 25 days to the following light quality treatments: dark, far-red, far-red+blue, far-red+red, blue, white, red+blue, red. After a further 20 days of white light exposure, somatic embryo production was recorded. Somatic embryogenesis was highest in cultures subjected to red light treatment, and decreased progressively with the transition to red+blue and to white. Overall, embryogenic competence showed a correlation with photoequilibrium. Phytochrome appeared to be inductive although this effect was adversely influenced by the blue absorbing photoreceptor, in particular at low photoequilibrium. Independently of light treatments applied, somatic embryos frequently showed severe morphological abnormalities. Conversion of somatic embryos to plantlets was not observed. (author)

  6. [Family medicine and functional somatic syndromes].

    Science.gov (United States)

    Nago, Naoki

    2009-09-01

    Between psychosomatic medicine and psychiatry, FSS (functional somatic syndromes) patients are often visiting a family doctor. For FSS, the role of family physicians is large, but the family physicians are not required for the role of diagnosis and treatment of FSS. Rather, appropriate referral to a specialist to exclude organic disease is important and a role as the coordinator is large to the patient to refuse a psychiatric consultation. To serve as a role for such coordination, a family physician has to response the patient's emotional side and focus on the construction of the doctor-patient relationship and response. I also think of structuralism medicine approach to describe disease from the meta-level as a new procedure to the patient. This approach consists of 4 components, 'entity', 'phenomenon', 'words', and 'I'. This may be a useful approach to family physicians who coordinate the overall for FSS patients' management.

  7. Progression inference for somatic mutations in cancer

    Directory of Open Access Journals (Sweden)

    Leif E. Peterson

    2017-04-01

    Full Text Available Computational methods were employed to determine progression inference of genomic alterations in commonly occurring cancers. Using cross-sectional TCGA data, we computed evolutionary trajectories involving selectivity relationships among pairs of gene-specific genomic alterations such as somatic mutations, deletions, amplifications, downregulation, and upregulation among the top 20 driver genes associated with each cancer. Results indicate that the majority of hierarchies involved TP53, PIK3CA, ERBB2, APC, KRAS, EGFR, IDH1, VHL, etc. Research into the order and accumulation of genomic alterations among cancer driver genes will ever-increase as the costs of nextgen sequencing subside, and personalized/precision medicine incorporates whole-genome scans into the diagnosis and treatment of cancer. Keywords: Oncology, Cancer research, Genetics, Computational biology

  8. The Somatic Genomic Landscape of Glioblastoma

    Science.gov (United States)

    Brennan, Cameron W.; Verhaak, Roel G.W.; McKenna, Aaron; Campos, Benito; Noushmehr, Houtan; Salama, Sofie R.; Zheng, Siyuan; Chakravarty, Debyani; Sanborn, J. Zachary; Berman, Samuel H.; Beroukhim, Rameen; Bernard, Brady; Wu, Chang-Jiun; Genovese, Giannicola; Shmulevich, Ilya; Barnholtz-Sloan, Jill; Zou, Lihua; Vegesna, Rahulsimham; Shukla, Sachet A.; Ciriello, Giovanni; Yung, WK; Zhang, Wei; Sougnez, Carrie; Mikkelsen, Tom; Aldape, Kenneth; Bigner, Darell D.; Van Meir, Erwin G.; Prados, Michael; Sloan, Andrew; Black, Keith L.; Eschbacher, Jennifer; Finocchiaro, Gaetano; Friedman, William; Andrews, David W.; Guha, Abhijit; Iacocca, Mary; O’Neill, Brian P.; Foltz, Greg; Myers, Jerome; Weisenberger, Daniel J.; Penny, Robert; Kucherlapati, Raju; Perou, Charles M.; Hayes, D. Neil; Gibbs, Richard; Marra, Marco; Mills, Gordon B.; Lander, Eric; Spellman, Paul; Wilson, Richard; Sander, Chris; Weinstein, John; Meyerson, Matthew; Gabriel, Stacey; Laird, Peter W.; Haussler, David; Getz, Gad; Chin, Lynda

    2013-01-01

    We describe the landscape of somatic genomic alterations based on multi-dimensional and comprehensive characterization of more than 500 glioblastoma tumors (GBMs). We identify several novel mutated genes as well as complex rearrangements of signature receptors including EGFR and PDGFRA. TERT promoter mutations are shown to correlate with elevated mRNA expression, supporting a role in telomerase reactivation. Correlative analyses confirm that the survival advantage of the proneural subtype is conferred by the G-CIMP phenotype, and MGMT DNA methylation may be a predictive biomarker for treatment response only in classical subtype GBM. Integrative analysis of genomic and proteomic profiles challenges the notion of therapeutic inhibition of a pathway as an alternative to inhibition of the target itself. These data will facilitate the discovery of therapeutic and diagnostic target candidates, the validation of research and clinical observations and the generation of unanticipated hypotheses that can advance our molecular understanding of this lethal cancer. PMID:24120142

  9. Multiple somatic symptoms in primary care

    DEFF Research Database (Denmark)

    Goldberg, D. P.; Reed, G. M.; Robles, R.

    2016-01-01

    Objective A World Health Organization (WHO) field study conducted in five countries assessed proposals for Bodily Stress Syndrome (BSS) and Health Anxiety (HA) for the Primary Health Care Version of ICD-11. BSS requires multiple somatic symptoms not caused by known physical pathology and associated...... with distress or dysfunction. HA involves persistent, intrusive fears of having an illness or intense preoccupation with and misinterpretation of bodily sensations. This study examined how the proposed descriptions for BSS and HA corresponded to what was observed by working primary care physicians (PCPs......) in participating countries, and the relationship of BSS and HA to depressive and anxiety disorders and to disability. Method PCPs referred patients judged to have BSS or HA, who were then interviewed using a standardized psychiatric interview and a standardized measure of disability. Results Of 587 patients...

  10. Endangered wolves cloned from adult somatic cells.

    Science.gov (United States)

    Kim, Min Kyu; Jang, Goo; Oh, Hyun Ju; Yuda, Fibrianto; Kim, Hye Jin; Hwang, Woo Suk; Hossein, Mohammad Shamim; Kim, Joung Joo; Shin, Nam Shik; Kang, Sung Keun; Lee, Byeong Chun

    2007-01-01

    Over the world, canine species, including the gray wolf, have been gradually endangered or extinct. Many efforts have been made to recover and conserve these canids. The aim of this study was to produce the endangered gray wolf with somatic cell nuclear transfer (SCNT) for conservation. Adult ear fibroblasts from a female gray wolf (Canis lupus) were isolated and cultured in vitro as donor cells. Because of limitations in obtaining gray wolf matured oocytes, in vivo matured canine oocytes obtained by flushing the oviducts from the isthmus to the infundibulum were used. After removing the cumulus cells, the oocyte was enucleated, microinjected, fused with a donor cell, and activated. The reconstructed cloned wolf embryos were transferred into the oviducts of the naturally synchronized surrogate mothers. Two pregnancies were detected by ultrasonography at 23 days of gestation in recipient dogs. In each surrogate dog, two fetal sacs were confirmed by early pregnancy diagnosis at 23 days, but only two cloned wolves were delivered. The first cloned wolf was delivered by cesarean section on October 18, 2005, 60 days after embryo transfer. The second cloned wolf was delivered on October 26, 2005, at 61 days postembryo transfer. Microsatellite analysis was performed with genomic DNA from the donor wolf, the two cloned wolves, and the two surrogate female recipients to confirm the genetic identity of the cloned wolves. Analysis of 19 microsatellite loci confirmed that the cloned wolves were genetically identical to the donor wolf. In conclusion, we demonstrated live birth of two cloned gray wolves by nuclear transfer of wolf somatic cells into enucleated canine oocyte, indicating that SCNT is a practical approach for conserving endangered canids.

  11. [Somatic complaints, emotional awareness and maladjustment in schoolchildren].

    Science.gov (United States)

    Ordóñez, A; Maganto, C; González, R

    2015-05-01

    Somatic complaints are common in childhood. Research has shown their relationship with emotional awareness and maladjustment. The study had three objectives: 1) to analyze the prevalence of somatic complaints; 2) To explore the relationships between the variables evaluated: somatic complaints, differentiating emotions, verbal sharing of emotions, not hiding emotions, body awareness, attending to others' emotions, analysis of emotions, and personal, social, family, and school maladjustments; and 3) To identify predictors of somatic complaints. The study included a total of 1,134 randomly selected schoolchildren of both sexes between 10-12 years old (M=10.99; SD=0.88). The Somatic Complaint List, Emotional Awareness Questionnaire, and Self-reported Multifactor Test of Childhood Adaptation were used to gather information. The results showed that the prevalence of somatic complaints was 90.2%, with fatigue, headache and stomachache being the most frequently. Dizziness and headache were more common in girls, and the frequency of complaints decreases with age. Somatic complaints are negatively related to emotional awareness, and positively related to maladjustment. The variables that contribute the most to the prediction of somatic complaints are personal maladjustment (25.1%) and differentiating emotions (2.5%). The study shows that personal maladjustment is the best predictor of somatic complaints; the more emotional awareness and better adapted the child, the fewer somatic complaints they lodge. Childhood is a stage with significant physical discomfort. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

  12. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  13. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  15. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  16. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Directory of Open Access Journals (Sweden)

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  17. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data

    DEFF Research Database (Denmark)

    Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne Vibeke

    2016-01-01

    a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2...

  18. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    International Nuclear Information System (INIS)

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  19. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  20. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Directory of Open Access Journals (Sweden)

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  1. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  2. Ethical and psychological factors in 5S and total productive maintenance

    International Nuclear Information System (INIS)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  3. Ethical and psychological factors in 5S and total productive maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  4. Extending a structural model of somatization to South Koreans: Cultural values, somatization tendency, and the presentation of depressive symptoms.

    Science.gov (United States)

    Zhou, Xiaolu; Min, Seongho; Sun, Jiahong; Kim, Se Joo; Ahn, Joung-Sook; Peng, Yunshi; Noh, Samuel; Ryder, Andrew G

    2015-05-01

    Somatization refers to the tendency to emphasize somatic symptoms when experiencing a psychiatric disturbance. This tendency has been widely reported in patients from East Asian cultural contexts suffering from depression. Recent research in two Chinese samples have demonstrated that the local cultural script for depression, involving two aspects-the experience and expression of distress (EED) and conceptualization and communication of distress (CCD)-can be evoked to help explain somatization. Given the beliefs and practices broadly shared across Chinese and South Korean cultural contexts, the current study seeks to replicate this explanatory model in South Koreans. Our sample included 209 psychiatric outpatients from Seoul and Wonju, South Korea. Self-report questionnaires were used to assess somatization tendency, adherence to traditional values, and psychological and somatic symptoms of depression. Results from SEM showed that the EED and CCD factors of somatization tendency were differently associated with cultural values and somatic symptoms, replicating our previous findings in Chinese outpatients. The reliance on a brief self-report measure of somatization tendency, not originally designed to assess separate EED and CCD factors, highlights the need for measurement tools for the assessment of cultural scripts in cross-cultural depression research. The replication of the Chinese structural model of somatization in South Korea lends empirical support to the view that somatization can be understood as the consequence of specific cultural scripts. These scripts involve the experience and expression of distress as well as culturally meaningful ways in which this distress is conceptualized and communicated to others. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    OpenAIRE

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  6. 5S-menetelmän käyttöönotto Case: Planmeca Oy

    OpenAIRE

    Velic, Adel

    2014-01-01

    Opinnäytetyön tavoitteena on tutkia Planmeca Oy:n panoraamaröntgentuotannossa syksyllä 2012 toteutetun 5S-projektin onnistuneisuutta. Työ kattaa sekä 5S-periaatteiden mukaisesti suunniteltujen ja toteutettujen panoraamaröntgentuotannon Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiimin työpisteiden että projektin toteutustavan onnistuneisuuden mittaamisen. Tutkimusmenetelmänä käytetään Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiim...

  7. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    International Nuclear Information System (INIS)

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  8. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  9. Somatic embryogenesis for efficient micropropagation of guava (Psidium guajava L.).

    Science.gov (United States)

    Akhtar, Nasim

    2013-01-01

    Guava (Psidium guajava L.) is well known for edible fruit, environment friendly pharmaceutical and commercial products for both national and international market. The conventional propagation and in vitro organogenesis do not meet the demand for the good quality planting materials. Somatic embryogenesis for efficient micropropagation of guava (P. guajava L.) has been developed to fill up the gap. Somatic embryogenesis and plantlets regeneration are achieved from 10-week post-anthesis zygotic embryo explants by 8-day inductive treatment with different concentrations of 2,4-dichlorophenoxy acetic acid (2,4-D) on MS agar medium containing 5% sucrose. Subsequent development and maturation of somatic embryos occur after 8 days on MS basal medium supplemented with 5% sucrose without plant growth regulator. The process of somatic embryogenesis shows the highest relative efficiency in 8-day treatment of zygotic embryo explants with 1.0 mg L(-1) 2,4-D. High efficiency germination of somatic embryos and plantlet regeneration takes place on half strength semisolid MS medium amended with 3% sucrose within 2 weeks of subculture. Somatic plantlets are grown for additional 2 weeks by subculturing in MS liquid growth medium containing 3% sucrose. Well-grown plantlets from liquid medium have survived very well following 2-4 week hardening process. The protocol of somatic embryogenesis is optimized for high efficiency micropropagation of guava species.

  10. The visceromotor and somatic afferent nerves of the penis.

    Science.gov (United States)

    Diallo, Djibril; Zaitouna, Mazen; Alsaid, Bayan; Quillard, Jeanine; Ba, Nathalie; Allodji, Rodrigue Sètchéou; Benoit, Gérard; Bedretdinova, Dina; Bessede, Thomas

    2015-05-01

    Innervation of the penis supports erectile and sensory functions. This article aims to study the efferent autonomic (visceromotor) and afferent somatic (sensory) nervous systems of the penis and to investigate how these systems relate to vascular pathways. Penises obtained from five adult cadavers were studied via computer-assisted anatomic dissection (CAAD). The number of autonomic and somatic nerve fibers was compared using the Kruskal-Wallis test. Proximally, penile innervation was mainly somatic in the extra-albugineal sector and mainly autonomic in the intracavernosal sector. Distally, both sectors were almost exclusively supplied by somatic nerve fibers, except the intrapenile vascular anastomoses that accompanied both somatic and autonomic (nitrergic) fibers. From this point, the neural immunolabeling within perivascular nerve fibers was mixed (somatic labeling and autonomic labeling). Accessory afferent, extra-albugineal pathways supplied the outer layers of the penis. There is a major change in the functional type of innervation between the proximal and distal parts of the intracavernosal sector of the penis. In addition to the pelvis and the hilum of the penis, the intrapenile neurovascular routes are the third level where the efferent autonomic (visceromotor) and the afferent somatic (sensory) penile nerve fibers are close. Intrapenile neurovascular pathways define a proximal penile segment, which guarantees erectile rigidity, and a sensory distal segment. © 2015 International Society for Sexual Medicine.

  11. Somatic embryogenesis in cassava: A tool for mutation breeding

    International Nuclear Information System (INIS)

    Lee, K.S.; Duren, M. Van; Morpurgo, R.

    1997-01-01

    Cassava is an important food and livestock feed crop. The effect of gamma radiation on somatic embryogenesis and plant regeneration in cassava clones of African origin was investigated. Explants from young leaves of cassava were cultured on MS medium, supplemented with 18.1 mM 2,4-D and 2 mM CuSO4, solidified with 0.3% Phytagel. Compact and friable calli were observed after 10-15 days of explant culture in dark, which produced somatic embryos in all but one clone. The somatic embryos showed morphological aberrations, such as fused cotyledons, lack of meristematic tip, epicotyl elongation, and had low germination rate; desiccation of embryos increased germination. Histological study showed that the somatic embryos were of multicellular origin. Leaf explants were irradiated with doses between 4 to 38 Gy of gamma rays, and cultured on somatic embryo induction medium. In addition, somatic embryos were irradiated with gamma ray doses from 10 to 18 Gy, and analyzed for germination. LD 50 for embryogenic response of leaf-explants was at around 20 Gy, while that for somatic embryo germination was ca. 10 Gy. (author). 7 refs, 2 tabs

  12. Somatic embryogenesis in cassava: A tool for mutation breeding

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K S; Duren, M Van; Morpurgo, R [Agriculture and Biotechnology Laboratory, International Atomic Energy Agency, Seibersdorf (Austria)

    1997-07-01

    Cassava is an important food and livestock feed crop. The effect of gamma radiation on somatic embryogenesis and plant regeneration in cassava clones of African origin was investigated. Explants from young leaves of cassava were cultured on MS medium, supplemented with 18.1 mM 2,4-D and 2 mM CuSO4, solidified with 0.3% Phytagel. Compact and friable calli were observed after 10-15 days of explant culture in dark, which produced somatic embryos in all but one clone. The somatic embryos showed morphological aberrations, such as fused cotyledons, lack of meristematic tip, epicotyl elongation, and had low germination rate; desiccation of embryos increased germination. Histological study showed that the somatic embryos were of multicellular origin. Leaf explants were irradiated with doses between 4 to 38 Gy of gamma rays, and cultured on somatic embryo induction medium. In addition, somatic embryos were irradiated with gamma ray doses from 10 to 18 Gy, and analyzed for germination. LD{sub 50} for embryogenic response of leaf-explants was at around 20 Gy, while that for somatic embryo germination was ca. 10 Gy. (author). 7 refs, 2 tabs.

  13. Characteristics of somatic tinnitus patients with and without hyperacusis.

    Directory of Open Access Journals (Sweden)

    Massimo Ralli

    Full Text Available Determine if somatic tinnitus patients with hyperacusis have different characteristics from those without hyperacusis.172 somatic tinnitus patients with (n = 82 and without (n = 90 hyperacusis referred to the Tinnitus Unit of Sapienza University of Rome between June 2012 and June 2016 were compared for demographic characteristics, tinnitus features, self-administered questionnaire scores, nature of somatic modulation and history.Compared to those without hyperacusis, patients with somatic tinnitus and hyperacusis: (a were older (43.38 vs 39.12 years, p = 0.05, (b were more likely to have bilateral tinnitus (67.08% vs 55.56%, p = 0.04, (c had a higher prevalence of somatic modulation of tinnitus (53.65% vs 36.66%, p = 0.02 and (d scored significantly worse on tinnitus annoyance (39.34 vs 22.81, p<0.001 and subjective hearing level (8.04 vs 1.83, p<0.001.Our study shows significantly higher tinnitus modulation and worse self-rating of tinnitus and hearing ability in somatic tinnitus patients with hyperacusis versus somatic tinnitus patients without hyperacusis. These differences could prove useful in developing a better understanding of the pathophysiology and establishing a course of treatment for these two groups of patients.

  14. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Science.gov (United States)

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  15. Ba 5s photoionization in the region of the second Cooper minimum

    International Nuclear Information System (INIS)

    Whitfield, S B; Wehlitz, R; Dolmatov, V K

    2011-01-01

    We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.

  16. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  17. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Czech Academy of Sciences Publication Activity Database

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  18. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    International Nuclear Information System (INIS)

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  19. Somatic radiation risk in case of irradiation of the brain

    Energy Technology Data Exchange (ETDEWEB)

    Nocken, U.; Ewen, K.; Makoski, H.B.

    1983-09-01

    The somatic dose index for irradiation of the brain was determined for the 10 MeV bremsstrahlung of a linear electron-accelerator. A small volume rotation technique and the irradiation of the total neurocranium were chosen as extreme conditions for the radiation exposure of the skull. On the basis of a target volume dose of 50 Gy for the total irradiation series, the somatic dose index of the small volume technique is within the scope of coronarography. In case of irradiation of the total neurocranium, however, the somatic dose index largely exceeds the maximum values of X-ray diagnosis.

  20. Extraforaminal Lumbar Interbody Fusion at the L5-S1 Level: Technical Considerations and Feasibility.

    Science.gov (United States)

    Kurzbuch, Arthur Robert; Kaech, Denis; Baranowski, Pawel; Baranowska, Alicja; Recoules-Arche, Didier

    2017-09-01

    Background  Extraforaminal lumbar interbody fusion (ELIF) surgery is a muscle-sparing approach that allows the treatment of various degenerative spinal diseases. It is technical challenging to perform the ELIF approach at the L5-S1 level because the sacral ala obstructs the view of the intervertebral disk space. Methods  We reported earlier on the ELIF technique in which the intervertebral disk is targeted at an angle of 45 degrees relative to the midline. In this article we describe the technical process we developed to overcome the anatomic relation between the sacral ala and the intervertebral disk space L5-S1 that hinders the ELIF approach at this level. We then report in a retrospective analysis on the short-term clinical and radiologic outcome of 100 consecutive patients with degenerative L5-S1 pathologies who underwent ELIF surgery. Results  The L5-S1 ELIF approach could be realized in all patients. The short-term clinical outcome was evaluated 5 months after surgery: 92% of the patients were satisfied with their postoperative result; 8% had a poor result. Overall, 17% of the patients presented light radicular or low back pain not influencing their daily activity, and 82% of the patients working before surgery returned to work 3 to 7 months after surgery. The radiologic outcome was documented by computed tomography at 5 months after surgery and showed fusion in 99% of the patients. Lumbar magnetic resonance imaging performed in 5 patients at 6 months after surgery revealed the integrity of the paraspinal muscles. Conclusions  ELIF surgery at the L5-S1 level is technically feasible for various degenerative spinal diseases. Analysis of the clinical and radiologic data in a consecutive retrospective cohort of patients who underwent this surgical procedure showed a good short-term clinical outcome and fusion rate. Georg Thieme Verlag KG Stuttgart · New York.

  1. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  2. Dysphoria and somatization in Iranian culture.

    Science.gov (United States)

    Pliskin, K L

    1992-09-01

    Iranians express dysphoria through an undifferentiated term called narahati, meaning depressed, ill at ease, nervous, inconvenienced, or anxious. People try masking this emotion or express it in specific ways nonverbally, such as sulking or not eating. Two other dysphoric affects, sadness and anger, are not masked. Because of the social conception of persons being emotionally sensitive, the expression of narahati is guarded: expressing it not only could show that one is socially vulnerable, it could also make another sensitive empathic person narahat. The body is also sensitive, but to the physical world. Physical health is maintained by balancing a diet of "hot" and "cold" foods and avoiding exposure to cold and moisture. With the social and cultural problems brought on by revolution, war, immigration, and accommodation to a new society, Iranian refugees experience changes in family, role, status, finances, language, and other sociocultural ways of being that cause them to feel narahat and to express it verbally, nonverbally, or through somatization. Understanding Iranian conceptions of emotional and physical sensitivity will help clinicians in treating Iranian patients.

  3. Dysphoria and somatization in Iranian culture.

    Science.gov (United States)

    Pliskin, K L

    1992-01-01

    Iranians express dysphoria through an undifferentiated term called narahati, meaning depressed, ill at ease, nervous, inconvenienced, or anxious. People try masking this emotion or express it in specific ways nonverbally, such as sulking or not eating. Two other dysphoric affects, sadness and anger, are not masked. Because of the social conception of persons being emotionally sensitive, the expression of narahati is guarded: expressing it not only could show that one is socially vulnerable, it could also make another sensitive empathic person narahat. The body is also sensitive, but to the physical world. Physical health is maintained by balancing a diet of "hot" and "cold" foods and avoiding exposure to cold and moisture. With the social and cultural problems brought on by revolution, war, immigration, and accommodation to a new society, Iranian refugees experience changes in family, role, status, finances, language, and other sociocultural ways of being that cause them to feel narahat and to express it verbally, nonverbally, or through somatization. Understanding Iranian conceptions of emotional and physical sensitivity will help clinicians in treating Iranian patients. PMID:1413773

  4. Cloning animals by somatic cell nuclear transfer – biological factors

    Science.gov (United States)

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong

    2003-01-01

    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other specie, this review will be focused on somatic cell cloning of cattle. PMID:14614770

  5. In vitro somatic embryogenesis and plant regeneration of cassava.

    Science.gov (United States)

    Szabados, L; Hoyos, R; Roca, W

    1987-06-01

    An efficient and reproducible plant regeneration system, initiated in somatic tissues, has been devised for cassava (Manihot esculenta Crantz). Somatic embryogenesis has been induced from shoot tips and immature leaves of in vitro shoot cultures of 15 cassava genotypes. Somatic embryos developed directly on the explants when cultured on a medium containing 4-16 mg/l 2,4-D. Differences were observed with respect to the embryogenic capacity of the explants of different varieties. Secondary embryogenesis has been induced by subculture on solid or liquid induction medium. Long term cultures were established and maintained for up to 18 months by repeated subculture of the proliferating somatic embryos. Plantlets developed from primary and secondary embryos in the presence of 0.1 mg/l BAP, 1mg/l GA3, and 0.01 mg/l 2,4-D. Regenerated plants were transferred to the field, and were grown to maturity.

  6. Inference of Tumor Phylogenies with Improved Somatic Mutation Discovery

    KAUST Repository

    Salari, Raheleh; Saleh, Syed Shayon; Kashef-Haghighi, Dorna; Khavari, David; Newburger, Daniel E.; West, Robert B.; Sidow, Arend; Batzoglou, Serafim

    2013-01-01

    multiple, genetically related tumors, current methods do not exploit available phylogenetic information to improve the accuracy of their variant calls. Here, we present a novel algorithm that uses somatic single nucleotide variations (SNVs) in multiple

  7. Anxiety, depression, and somatization in DSM-III hypochondriasis.

    Science.gov (United States)

    Kellner, R; Abbott, P; Winslow, W W; Pathak, D

    1989-01-01

    To assess the severity of distress and of somatization in hypochondriasis, the authors administered several validated self-rating scales of depression, anxiety, somatic symptoms, and anger/hostility to 21 psychiatric outpatients with the DSM-III diagnosis of hypochondriasis and to matched groups of other nonpsychotic psychiatric patients, family practice patients, and employees. Anxiety and somatic symptoms were highest in hypochondriacal patients; depression and anger/hostility did not differ from those of other psychiatric patients but were higher than in the other groups. The findings do not support the theory that hypochondriasis is a defense against anxiety or that it is a masked depression or depressive equivalent. The findings are consistent with the view that the interaction of severe anxiety and severe somatic symptoms is a common feature of the psychopathology of hypochondriasis.

  8. Hypochondriasis and somatization related to personality and attitudes toward self.

    Science.gov (United States)

    Hollifield, M; Tuttle, L; Paine, S; Kellner, R

    1999-01-01

    Better definition of the boundary between hypochondriasis and somatization was determined by measuring attitudes to self and personality dimensions associated with these syndromes. In this study, the primary care patients with hypochondriacal responses (HR) on the Illness Attitudes Scales or high somatic concern (HSC) on the Symptom Questionnaire had more negative attitudes to self and more psychological distress than the matched group of primary care control subjects. The HR subjects were different from the non-HR subjects on two of five personality domains on the NEO Personality Inventory (NEO)-Five-Factor Inventory, and the HSC subjects were different from the non-HSC subjects on four of five NEO domains. Analysis of variance demonstrated that somatization explained most of the variance in attitudes, personality, and psychological distress, but hypochondriasis uniquely contributed only to thanatophobia. The authors discuss the boundary between hypochondriasis and somatization and offer a descriptive model of this relationship.

  9. Cognitive aspects of hypochondriasis and the somatization syndrome.

    Science.gov (United States)

    Rief, W; Hiller, W; Margraf, J

    1998-11-01

    The aim of this study was to evaluate whether specific cognitive aspects are present in patients suffering from somatoform disorders. With a sample of 493 patients from a center for behavioral medicine, the authors evaluated a questionnaire assessing typical cognitions concerning body perception, illness behavior, and health. The authors further examined 225 participants, including patients with a somatization syndrome, patients with somatization syndrome and additional hypochondriasis, patients with hypochondriasis, patients with other mental disorders (clinical control group), and nonclinical controls. The results showed that not only patients with hypochondriasis but also patients with somatization syndrome had cognitive concerns and assumptions that were specific for the disorder. These patients had a self-concept of being weak and unable to tolerate stress. A catastrophizing interpretation of minor bodily complaints found in hypochondriacal patients in earlier studies was also found for patients with multiple somatization symptoms.

  10. Journeying as Amateur and Professional – A Somatic Movement Approach

    Directory of Open Access Journals (Sweden)

    Martha Eddy

    2016-07-01

    Full Text Available This account is an interactive case study co-authored by a teacher and her student on the topic of moving from amateur to professional. It highlights the role of somatic education in equalizing the experience of amateurs and professionals as well as pointing to specific curricula, public performances, participatory events and volunteer work that are made uniquely available to students of programs related to Dynamic EmbodimentTM Somatic Movement Therapy (known as the Somatic Movement Therapy Training – SMTT from 1991-2005. Written in first-person narrative style (Powdermaker 1966, this inquiry supports the primary methodology of somatic education – the process of self-discovery “from within” (Hanna 1976 emphasizing the physical body with a focus on bodily proprioception and kinesthetic awareness – as well as the humanistic nature of the student-teacher relationship and the value of each in performance and education.

  11. Somatic delusions and obsessive-compulsive disorder in ...

    African Journals Online (AJOL)

    2009-10-12

    Oct 12, 2009 ... Case Study: Somatic delusions and obsessive-compulsive disorder in schizophrenia. 527. Vol 52 No 6 ... liver function, and urea and electrolytes), including an ... neurotransmitter systems (such as serotonin and dopamine).

  12. Recurrent Somatic Structural Variations Contribute to Tumorigenesis in Pediatric Osteosarcoma

    Directory of Open Access Journals (Sweden)

    Xiang Chen

    2014-04-01

    Full Text Available Pediatric osteosarcoma is characterized by multiple somatic chromosomal lesions, including structural variations (SVs and copy number alterations (CNAs. To define the landscape of somatic mutations in pediatric osteosarcoma, we performed whole-genome sequencing of DNA from 20 osteosarcoma tumor samples and matched normal tissue in a discovery cohort, as well as 14 samples in a validation cohort. Single-nucleotide variations (SNVs exhibited a pattern of localized hypermutation called kataegis in 50% of the tumors. We identified p53 pathway lesions in all tumors in the discovery cohort, nine of which were translocations in the first intron of the TP53 gene. Beyond TP53, the RB1, ATRX, and DLG2 genes showed recurrent somatic alterations in 29%–53% of the tumors. These data highlight the power of whole-genome sequencing for identifying recurrent somatic alterations in cancer genomes that may be missed using other methods.

  13. Effect of explant age, hormones on somatic embryogenesis and ...

    African Journals Online (AJOL)

    Effect of explant age, hormones on somatic embryogenesis and production of multiple shoot from cotyledonary leaf explants of Solanum trilobatum L. VNC Dhavala, RD Tejeswara, VR Yechuri, K Prabavathi ...

  14. Breeding value estimation for somatic cell score in South African ...

    African Journals Online (AJOL)

    Breeding value estimation for somatic cell score in South African dairy cattle. ... are not unity, the RM-model estimates more competitive variances and requires ... are therefore recommended for breeding value estimation on a national basis.

  15. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  16. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  17. Somatic embryogenesis in ferns: a new experimental system.

    Science.gov (United States)

    Mikuła, Anna; Pożoga, Mariusz; Tomiczak, Karolina; Rybczyński, Jan J

    2015-05-01

    Somatic embryogenesis has never been reported in ferns. The study showed that it is much easier to evoke the acquisition and expression of embryogenic competence in ferns than in spermatophytes. We discovered that the tree fern Cyathea delgadii offers an effective model for the reproducible and rapid formation of somatic embryos on hormone-free medium. Our study provides cyto-morphological evidence for the single cell origin and development of somatic embryos. Somatic embryogenesis (SE) in both primary and secondary explants was induced on half-strength micro- and macro-nutrients Murashige and Skoog medium without the application of exogenous plant growth regulators, in darkness. The early stage of SE was characterized by sequential perpendicular cell divisions of an individual epidermal cell of etiolated stipe explant. These resulted in the formation of a linear pro-embryo. Later their development resembled that of the zygotic embryo. We defined three morphogenetic stages of fern somatic embryo development: linear, early and late embryonic leaf stage. The transition from somatic embryo to juvenile sporophyte was quick and proceeded without interruption caused by dormancy. Following 9 weeks of culture the efficiency of somatic embryogenesis reached 12-13 embryos per responding explant. Spontaneous formation of somatic embryos and callus production, which improved the effectiveness of the process sevenfold in 10-month-long culture, occurred without subculturing. The tendency for C. delgadii to propagate by SE in vitro makes this species an excellent model for studies relating to asexual embryogenesis and the endogenous hormonal regulation of that process and opens new avenues of experimentation.

  18. Pattern of somatic symptoms in anxiety and depression

    International Nuclear Information System (INIS)

    Shah, M.

    2011-01-01

    To determine the pattern of somatic symptoms in anxiety and depressive disorders. Design: Cross Sectional Comparative study Place of Study: Department of Psychiatry Military Hospital Rawalpindi. Duration of Study: From May to November 2002. Patients and Methods: Patients were divided in Group I of anxiety and group II of depression. Fifty patients considered in each group by convenience sampling. The organic basis of their symptoms was ruled out. The patterns of their somatic symptoms and other information like educational and economic status were recorded on Semi Structured Proforma. The patient's diagnosis was made on schedule based ICD-10 research criteria. The severity of anxiety and depression was assessed by using HARS and HDRS respectively. The pattern of somatic symptoms in both groups was then analyzed by the urdu version of Bradford Somatic Inventory. Patterns of somatic complaints were then analyzed by chi square test. Results: Out of 100 patients we placed 50 each in group I (anxiety) and group II (Depression). Males were higher in depression whereas females were higher in anxiety disorder group. P-value for headache was 0.017 while in rest of the somatic symptoms it was insignificant ranging from 0.4 to 1. Conclusion: We found that the patterns of somatic symptoms are present in both the groups of anxiety and depression like symptoms related to musculoskeletal and gastrointestinal system were commonly observed in cases of depression whereas symptoms related to autonomic nervous system and cardiovascular system is more significantly somatized in patients of anxiety. A larger sample is required for further studies to get better results. (author)

  19. Health Anxiety in Panic Disorder, Somatization Disorder and Hypochondriasis

    OpenAIRE

    Özgün Karaer KARAPIÇAK; Selçuk ASLAN; Çisem UTKU

    2012-01-01

    Objective: Health anxiety is the fear of being or getting seriously sick due to the misinterpretation of physical symptoms. Severe health anxiety is also named as hypochondriasis. Belief of having a disease due to the misinterpretation of physical symptoms is also seen in panic disorder and somatization disorder. The aim of this study is to search the health anxiety in panic disorder, somatization disorder and hypochondriasis and compare it with healthy volunteers. Method: SCID-I was used ...

  20. Teaching at the interface of dance science and somatics.

    Science.gov (United States)

    Geber, Pamela; Wilson, Margaret

    2010-01-01

    This article introduces a combined scientific and somatic approach to teaching and learning about the body, and explains how it can be of benefit to dancers and dance educators. The study of the science of movement (kinesiology) and a somatic approach to teaching are initially defined and described as distinct entities; following this, a model for integration of the two is presented. The authors advocate for such a combination in order to enhance dancing.

  1. Induction and isolation of somatic mutations in vegetatively propagated plants

    International Nuclear Information System (INIS)

    Donini, B.

    1975-01-01

    Research carried out since 1963 concentrated on techniques of mutagenic treatment: problems of exposure, type of radiation (acute irradiation by x- and γ-rays, and chronic exposure in the gamma field), conditions during and after irradiation, mechanisms of mutation induction, and methodology of isolation of somatic mutations. Analyses of somatic mutations included studies on apple, pear, olive, peach, grape and cherry plants. Young trees, dormant and rooted scions, summer and floral buds or seeds were used

  2. File list: Oth.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.50.AllAg.Testicular_somatic_cells mm9 TFs and others Gonad Testicular somat...ic cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  3. File list: Oth.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.05.AllAg.Testicular_somatic_cells mm9 TFs and others Gonad Testicular somat...ic cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  4. File list: Pol.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.50.AllAg.Testicular_somatic_cells mm9 RNA polymerase Gonad Testicular somat...ic cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  5. Ellipsometry study of optical parameters of AgIn5S8 crystals

    Science.gov (United States)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  6. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  7. Perception and analysis of the 5S program at a business service provider

    Directory of Open Access Journals (Sweden)

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  8. Implementation of 5S tools as a starting point in business process reengineering

    Directory of Open Access Journals (Sweden)

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  9. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  10. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Science.gov (United States)

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  11. Parental Criticism is an Environmental Influence on Adolescent Somatic Symptoms

    Science.gov (United States)

    Horwitz, BN; Marceau, K; Narusyte, J; Ganiban, J; Spotts, EL; Reiss, D; Lichtenstein, P; Neiderhiser, JM

    2015-01-01

    Previous studies have suggested that parental criticism leads to more somatic symptoms in adolescent children. Yet this research has not assessed the direction of causation or whether genetic and/or environmental influences explain the association between parental criticism and adolescent somatic symptoms. As such, it is impossible to understand the mechanisms that underlie this association. The current study uses the Extended Children of Twins design to examine whether parents’ genes, adolescents’ genes, and/or environmental factors explain the relationship between parental criticism and adolescent somatic symptoms. Participants came from two twin samples, including the Twin and Offspring Study in Sweden (N = 868 pairs of adult twins and each twin’s adolescent child) and from the Twin Study of Child and Adolescent Development (N = 690 pairs of twin children and their parents). Findings showed that environmental influences account for the association between parental criticism and adolescent somatic symptoms. This suggests that parents’ critical behaviors exert a direct environmental effect on somatic symptoms in adolescent children. Results support the use of intervention programs focused on parental criticism to help reduce adolescents’ somatic symptoms. PMID:25844495

  12. Body image and self-esteem in somatizing patients.

    Science.gov (United States)

    Sertoz, Ozen O; Doganavsargil, Ozge; Elbi, Hayriye

    2009-08-01

    The aim of the present study was to determine dissatisfaction with body appearance and bodily functions and to assess self-esteem in somatizing patients. Body image and self-esteem were investigated in 128 women; 34 of those had diagnosed somatoform disorders, 50 were breast cancer patients with total mastectomy surgery alone, and 44 were healthy subjects. Body image and self-esteem were assessed using the Body Cathexis Scale and Rosenberg Self-Esteem Scale. The two clinical groups did not differ from one another (z = -1.832, P = 0.067), but differed from healthy controls in terms of body image (somatizing patients vs healthy controls, z = -3.628, P self-esteem (z = -0.936, P = 0.349) when depressive symptoms were controlled. No statistically significant difference was observed between total mastectomy patients and healthy controls in terms of self-esteem (z = -1.727, P = 0.084). The lower levels of self-esteem in somatizing patients were largely mediated by depressive symptoms. Depressed and non-depressed somatizing patients differed significantly from healthy controls with respect to their self-esteem and body image. Somatizing patients who were dissatisfied with their bodily functions and appearance had lower levels of self-esteem and high comorbidity of depression. In clinical practice it is suggested that clinicians should take into account psychiatric comorbidity, self-esteem, and body image in somatizing patients when planning treatment approaches.

  13. Somatic mutations in histiocytic sarcoma identified by next generation sequencing.

    Science.gov (United States)

    Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo

    2016-08-01

    Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

  14. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  15. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    International Nuclear Information System (INIS)

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  16. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  17. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    International Nuclear Information System (INIS)

    Garner, P.L.; Abramson, P.B.

    1979-01-01

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  18. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  19. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Science.gov (United States)

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  20. Evidence-based management of otitis media: a 5S model approach.

    Science.gov (United States)

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  1. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Science.gov (United States)

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  2. Distraction manipulation reduction of an L5-S1 disk herniation.

    Science.gov (United States)

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  3. Gamma ray induced somatic mutations in rose

    International Nuclear Information System (INIS)

    Datta, S.K.

    1989-01-01

    Budwood of 32 rose cultivars (Rosa spp.) was exposed to 3-4 krad of gamma rays and eyes were grafted on Rosa indica var. odorata root stock. Radiosensitivity with respect to sprouting, survival and plant height, and mutation frequency varied with the cultivar and dose of gamma rays. Somatic mutations in flower colour/shape were detected as chimera in 21 cultivars. The size of the mutant sector varied from a narrow streak on a petal to a whole flower and from a portion of a branch to an entire branch. 14 mutants were detected in M 1 V 1 , four in M 1 V 2 and three in M 1 V 3 . Maximum number of mutations was detected following 3 krad treatment. Eyes from mutant branches were grafted again on root stock and non-chimeric mutants were aimed at by vegetative propagation. Mutants from 11 cultivars only could be isolated in pure form. Isolation of non-chimeric mutants sometimes is difficult due to weak growth of a mutant branch. In such a case, all normal looking branches are removed to force a better growth of the mutant branch. It is advisable to maintain irradiated plants at least for four years with drastic pruning in each year. Nine mutants viz. 'Sharada', 'Sukumari', 'Tangerine Contempo', 'Yellow Contempo', 'Pink Contempo', 'Striped Contempo', 'Twinkle', 'Curio' and 'Light Pink Prize' have already been released as new cultivars for commercialization [ref. MBNL No. 23 and 31] and others are being multiplied and assessed. The mutation spectrum appears to be wider for the cultivars 'Contempo' and 'Imperator'. Pigment composition of the original variety is relevant for the kind of flower colour mutations that can be induced

  4. 5S-MENETELMÄN KÄYTTÖÖNOTTO: LUVATA PORI OY

    OpenAIRE

    Rantanen, Suvi

    2015-01-01

    Opinnäytetyön aiheena oli 5S-menetelmän käyttöönotto Luvata Pori Oy:n tuotannos-sa. Tutkimuksen lähtökohtana ja ongelmana oli siisteyden ja järjestyksen puute. Ta-voitteena oli aikaansaada valittuun pilottikohteeseen toimivat, siistit ja turvalliset tuotantotilat sekä luoda järjestelmä, jonka avulla ylläpidetään saavutettu taso. Lisäksi tavoiteltiin hukan poistamista ja Luvatan Lean toimintatavan syventämistä. Projekti toteutettiin toimintatutkimuksena syksyn 2015 aikana. Tutkimuksen teor...

  5. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  6. The Role of Somatic Symptoms in Sexual Medicine: Somatization as Important Contextual Factor in Male Sexual Dysfunction.

    Science.gov (United States)

    Fanni, Egidia; Castellini, Giovanni; Corona, Giovanni; Boddi, Valentina; Ricca, Valdo; Rastrelli, Giulia; Fisher, Alessandra Daphne; Cipriani, Sarah; Maggi, Mario

    2016-09-01

    An important feature of somatic symptom disorder is the subjective perception of the physical symptoms and its maladaptive interpretation. Considering that psychological distress is often expressed through somatic symptoms, it is possible that they underlie at least a part of the symptoms in subjects complaining of sexual dysfunction. Nevertheless, studies on the impact of somatoform disorders in sexual dysfunction are scanty. To define the psychological, relational, and organic correlates of somatic symptoms in a large sample of patients complaining of sexual problems. A consecutive series of 2833 men (mean age 50.2 ± 13.5 years) was retrospectively studied. Somatic symptoms were assessed using the "somatized anxiety symptoms" subscale of the Middlesex Hospital Questionnaire (MHQ-S). Several clinical, biochemical, psychological, and relational parameters were studied. Patients were interviewed with the previously validated Structured Interview on Erectile Dysfunction (SIEDY), and ANDROTEST (a structured interview for the screening of hypogonadism in patients with sexual dysfunction). Among the 2833 patients studied, subjects scoring higher on somatic symptoms were older, more obese, reporting unhealthy lifestyle (current smoking, alcohol consumption), and a lower education (all P sexuality more often, including erectile problems (spontaneous or sexual-related), low sexual desire, decreased frequency of intercourse, and perceived reduction of ejaculate volume (all P sexual dysfunction. High levels of somatic symptoms in subjects with sexual dysfunction can be related to the sexual symptom itself. The consequences of this pattern have great clinical relevance in a sexual medicine setting, considering their severe impact on sexuality. Copyright © 2016 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

  7. Mouse cloning and somatic cell reprogramming using electrofused blastomeres.

    Science.gov (United States)

    Riaz, Amjad; Zhao, Xiaoyang; Dai, Xiangpeng; Li, Wei; Liu, Lei; Wan, Haifeng; Yu, Yang; Wang, Liu; Zhou, Qi

    2011-05-01

    Mouse cloning from fertilized eggs can assist development of approaches for the production of "genetically tailored" human embryonic stem (ES) cell lines that are not constrained by the limitations of oocyte availability. However, to date only zygotes have been successfully used as recipients of nuclei from terminally differentiated somatic cell donors leading to ES cell lines. In fertility clinics, embryos of advanced embryonic stages are usually stored for future use, but their ability to support the derivation of ES cell lines via somatic nuclear transfer has not yet been proved. Here, we report that two-cell stage electrofused mouse embryos, arrested in mitosis, can support developmental reprogramming of nuclei from donor cells ranging from blastomeres to somatic cells. Live, full-term cloned pups from embryonic donors, as well as pluripotent ES cell lines from embryonic or somatic donors, were successfully generated from these reconstructed embryos. Advanced stage pre-implantation embryos were unable to develop normally to term after electrofusion and transfer of a somatic cell nucleus, indicating that discarded pre-implantation human embryos could be an important resource for research that minimizes the ethical concerns for human therapeutic cloning. Our approach provides an attractive and practical alternative to therapeutic cloning using donated oocytes for the generation of patient-specific human ES cell lines.

  8. Flow cytometric and morphological analyses of Pinus pinaster somatic embryogenesis.

    Science.gov (United States)

    Marum, Liliana; Loureiro, João; Rodriguez, Eleazar; Santos, Conceição; Oliveira, M Margarida; Miguel, Célia

    2009-09-25

    An approach combining morphological profiling and flow cytometric analysis was used to assess genetic stability during the several steps of somatic embryogenesis in Pinus pinaster. Embryogenic cell lines of P. pinaster were established from immature zygotic embryos excised from seeds obtained from open-pollinated trees. During the maturation stage, phenotype of somatic embryos was characterized as being either normal or abnormal. Based upon the prevalent morphological traits, different types of abnormal embryos underwent further classification and quantification. Nuclear DNA content of maritime pine using the zygotic embryos was estimated to be 57.04 pg/2C, using propidium iodide flow cytometry. According to the same methodology, no significant differences (P< or =0.01) in DNA ploidy were detected among the most frequently observed abnormal phenotypes, embryogenic cell lines, zygotic and normal somatic embryos, and somatic embryogenesis-derived plantlets. Although the differences in DNA ploidy level do not exclude the occurrence of a low level of aneuploidy, the results obtained point to the absence of major changes in ploidy level during the somatic embryogenesis process of this economically important species. Therefore, our primary goal of true-to-typeness was assured at this level.

  9. Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.

    Science.gov (United States)

    Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab

    2017-09-01

    Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.

  10. Spondylolysis and End Plate Arthrosis at L5-S1: A Cadaveric Study.

    Science.gov (United States)

    McCunniff, Peter T; Yoo, Hojun; Yu, Charles; Bajwa, Navkirat S; Toy, Jason O; Ahn, Uri M; Ahn, Nicholas

    2017-01-01

    This study examined the effect of bilateral and unilateral L5 pars defects on the degree of disk degeneration at the L5-S1 level in cadaveric specimens. An observational study was performed of 690 cadaveric specimens selected at random. These specimens represent individuals who died between 1893 and 1938. The study included 558 male and 132 female cadavers. Of the 120 specimens with L5 spondylolysis, 95 cases were bilateral and 25 were unilateral. The remaining 544 specimens were used as the control cohort. Degenerative disk disease was measured by the classification of Eubanks et al. According to this classification, degenerative disk disease was graded from no arthrosis (grade 0) to complete ankylosis (grade IV). Linear regression analysis corrected for age, sex, and race showed that subjects with bilateral spondylolysis at L5 had a statistically significant increase in the amount of disk degeneration (P=.02) compared with those with unilateral lesions. Student's t tests showed significant differences (Pspondylolysis above what would be predicted in the normal control population. A positive correlation was found between the number of pars defects at L5 and the degree of disk degeneration at L5-S1. These results support the idea that individuals with spondylolysis at these levels may be at increased risk for development of low back pain and reduced quality of life. [Orthopedics. 2017; 40(1):e59-e64.]. Copyright 2016, SLACK Incorporated.

  11. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  12. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  13. Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

    International Nuclear Information System (INIS)

    Sharma, M.K.; Tauheed, A.; Rahimullah, K.

    2014-01-01

    The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

  14. Somatic comorbidity among migrants with posttraumatic stress disorder and depression

    DEFF Research Database (Denmark)

    Lolk, Mette; Byberg, Stine; Carlsson, Jessica

    2016-01-01

    BACKGROUND: In a cohort of migrants in Denmark, we compared somatic disease incidence among migrants diagnosed with posttraumatic stress disorder (PTSD) and depression with migrants without a diagnosed psychiatric disorder. METHODS: The study builds on a unique cohort of migrants who obtained...... for the implementation of the project (No 2012-41-0065). RESULTS: Our results showed that migrants diagnosed with PTSD and depression had significantly higher rates of somatic diseases compared with migrants without diagnosed psychiatric disorders - especially, infectious disease (IRR, 1.89; 95% CI, 1.45-2.48; p ... with migrants without a diagnosed psychiatric disorder. The rates were especially high for infectious, neurological and pulmonary diseases. Our results further suggest difference in the rates of somatic comorbidity according to region of. Preventive and treatment services should pay special attention to improve...

  15. Mind-Body Interactions in Anxiety and Somatic Symptoms.

    Science.gov (United States)

    Mallorquí-Bagué, Núria; Bulbena, Antonio; Pailhez, Guillem; Garfinkel, Sarah N; Critchley, Hugo D

    2016-01-01

    Anxiety and somatic symptoms have a high prevalence in the general population. A mechanistic understanding of how different factors contribute to the development and maintenance of these symptoms, which are highly associated with anxiety disorders, is crucial to optimize treatments. In this article, we review recent literature on this topic and present a redefined model of mind-body interaction in anxiety and somatic symptoms, with an emphasis on both bottom-up and top-down processes. Consideration is given to the role played in this interaction by predisposing physiological and psychological traits (e.g., interoception, anxiety sensitivity, and trait anxiety) and to the levels at which mindfulness approaches may exert a therapeutic benefit. The proposed model of mind-body interaction in anxiety and somatic symptoms is appraised in the context of joint hypermobility syndrome, a constitutional variant associated with autonomic abnormalities and vulnerability to anxiety disorders.

  16. Hypochondriasis and somatization in college women: a personal projects analysis.

    Science.gov (United States)

    Karoly, P; Lecci, L

    1993-03-01

    Although the descriptive features of hypochondriasis and somatization have been widely studied, the motivational correlates (goal representations) of individuals manifesting abnormal illness patterns have not been considered. The Personal Projects Analysis method (Little, 1983) was used to contrast the health and nonhealth goals of female undergraduates. Subjects selected 10 goals for evaluation along a series of dimensions. When health pursuits alone were examined, hypochondriasis on the Minnesota Multiphasic Personality Inventory was found to correlate directly with goal appraisal dimensions subsumed by an anxiety-absorption factor and inversely with dimensions characterizing rewardingness, thus suggesting a negativity of health goal construal. Somatizers also pursued more health-related projects than did nonsomatizers; nonhealth goal cognition did not relate as strongly to hypochondriasis. Finally, using discriminant function analysis, goal representations were shown to significantly and substantially differentiate somatizers from nonsomatizers.

  17. Buffalo milk: proteins electrophoretic profile and somatic cell count

    Directory of Open Access Journals (Sweden)

    S. Mattii

    2011-03-01

    Full Text Available Water buffalo milk differs from the cow’s milk for greater fat and protein content, very important features in cheese making. Proteins, casein and whey-proteins in particular, are the most important factors determining cheese yield. Several previous research discussed the rule of SCC in cow milk production (Varisco, 1999 and the close relationship existing between cow’s milk cheese yield and somatic cell count (Barbano, 2000. In particular the inverse correlation between cheese yields and somatic cells’content have been demonstrated. In Italy the regulation in force DPR 54/97 acknowledges what expressed in EEC 46/92 Directive (Tripodi, 1999 without fixing the limit threshold of somatic cells for buffalo’s milk....

  18. [Product safety analysis of somatic cell cloned bovine].

    Science.gov (United States)

    Hua, Song; Lan, Jie; Song, Yongli; Lu, Chenglong; Zhang, Yong

    2010-05-01

    Somatic cell cloning (nuclear transfer) is a technique through which the nucleus (DNA) of a somatic cell is transferred into an enucleated oocyte for the generation of a new individual, genetically identical to the somatic cell donor. It could be applied for the enhancement of reproduction rate and the improvement of food products involving quality, yield and nutrition. In recent years, the United States, Japan and Europe as well as other countries announced that meat and milk products made from cloned cattle are safe for human consumption. Yet, cloned animals are faced with a wide range of health problems, with a high death rate and a high incidence of disease. The precise causal mechanisms for the low efficiency of cloning remain unclear. Is it safe that any products from cloned animals were allowed into the food supply? This review focuses on the security of meat, milk and products from cloned cattle based on the available data.

  19. Somatic Embryogenesis in Two Orchid Genera (Cymbidium, Dendrobium).

    Science.gov (United States)

    da Silva, Jaime A Teixeira; Winarto, Budi

    2016-01-01

    The protocorm-like body (PLB) is the de facto somatic embryo in orchids. Here we describe detailed protocols for two orchid genera (hybrid Cymbidium Twilight Moon 'Day Light' and Dendrobium 'Jayakarta', D. 'Gradita 31', and D. 'Zahra FR 62') for generating PLBs. These protocols will most likely have to be tweaked for different cultivars as the response of orchids in vitro tends to be dependent on genotype. In addition to primary somatic embryogenesis, secondary (or repetitive) somatic embryogenesis is also described for both genera. The use of thin cell layers as a sensitive tissue assay is outlined for hybrid Cymbidium while the protocol outlined is suitable for bioreactor culture of D. 'Zahra FR 62'.

  20. Somatic embryogenesis and plant regeneration of Capsicum baccatum L.

    Directory of Open Access Journals (Sweden)

    Peddaboina Venkataiah

    2016-06-01

    Full Text Available A plant regeneration protocol via somatic embryogenesis was achieved in cotyledon and leaf explants of Capsicum baccatum, when cultured on MS medium supplemented with various concentrations of 2,4-dichlorophenoxy acetic acid (2,4-D, 0.5–5.0 mg l−1 in combination with Kinetin (Kn, 0.5 mg l−1 and 3% sucrose. Various stages were observed during the development of somatic embryos, including globular, heart, and torpedo-stages. Torpedo stage embryos were separated from the explants and subcultured on medium supplemented with various concentrations of different plant growth regulators for maturation. Maximum percentage (55% of somatic embryo germination and plantlet formation was found at 1.0 mg l−1 BA. Finally, about 68% of plantlets were successfully established under field conditions. The regenerated plants were morphologically normal, fertile and able to set viable seeds.

  1. Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr

    Energy Technology Data Exchange (ETDEWEB)

    Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)

    1993-12-01

    The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  2. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  3. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  4. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  5. Pathological narcissism and somatic symptoms among men and women attending an outpatient mental health clinic.

    Science.gov (United States)

    Kealy, David; Tsai, Michelle; Ogrodniczuk, John S

    2016-09-01

    To explore the relationship between types of pathological narcissism and somatic symptoms among psychiatric outpatients. Patients (N = 95) completed measures of somatic symptoms, narcissistic grandiosity and vulnerability, and psychiatric symptoms. Relationships among variables were analysed using t-tests and correlations, controlling for psychiatric distress. Somatic symptoms were positively associated with two types of narcissistic dysfunction. Among women there was a positive association between somatic symptoms and narcissistic vulnerability, but not grandiosity. Among men, somatic symptoms were positively associated with narcissistic grandiosity, but not vulnerability. The connection between narcissistic pathology and somatic symptom severity appears to differ based on gender. Further research is needed to confirm and extend this preliminary finding.

  6. Lethals induced by γ-radiation in drosophila somatic cells

    International Nuclear Information System (INIS)

    Ivanov, A.I.

    1989-01-01

    Exposure of 3-hour drosophila male embryos to γ-radiation during the topographic segregation of the germ anlage nuclei caused recessive sex-linked lethals in somatic cells only. The selectivity of the screening was determined by the ratio of mutation frequencies induced in embryos and adult males. Analysis of lethal mutations shows that a minimal rate of the divergence between germinal and somatic patterns of the cell development is observed in the embryogenesis, the 3d instar larva and prepupa, and maximal in the 1st and 2nd larva and pupa

  7. Cooperation of nuclear reactor controller ARM-5S and turbine TVER-02

    International Nuclear Information System (INIS)

    Wagner, K.; Lnenicka, B.; Pokorny, F.; Prochazka, F.

    1985-01-01

    Turbines of Czechoslovak make provided with controllers TVER-02 are installed in WWER-440 nuclear power plants under construction in Czechoslovakia. Reactor output is controlled using Soviet-made controllers ARM-5S which already comprise turbine controllers. The problems are analyzed of cooperation of both controllers, especially their parameters and transient processes in typical operating situations. The analysis uses the results of measurements performed during the power start-up of Unit 1 of the V-2 nuclear power plant at Jaslovske Bohunice. The results show that two types of control modes can be selected for the operation of the entire unit: the control to constant unit output, and control of unit output varying with turbine load selected on the TVER-02 controller or given by the demand of the power network. (Z.M.)

  8. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  9. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  10. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    International Nuclear Information System (INIS)

    Johnson, W. R.; Cheng, K. T.

    2001-01-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled

  11. Variations in 5S rDNAs in diploid and tetraploid offspring of red crucian carp × common carp.

    Science.gov (United States)

    Ye, Lihai; Zhang, Chun; Tang, Xiaojun; Chen, Yiyi; Liu, Shaojun

    2017-08-08

    The allotetraploid hybrid fish (4nAT) that was created in a previous study through an intergeneric cross between red crucian carp (Carassius auratus red var., ♀) and common carp (Cyprinus carpio L., ♂) provided an excellent platform to investigate the effect of hybridization and polyploidization on the evolution of 5S rDNA. The 5S rDNAs of paternal common carp were made up of a coding sequence (CDS) and a non-transcribed spacer (NTS) unit, and while the 5S rDNAs of maternal red crucian carp contained a CDS and a NTS unit, they also contained a variable number of interposed regions (IPRs). The CDSs of the 5S rDNAs in both parental fishes were conserved, while their NTS units seemed to have been subjected to rapid evolution. The diploid hybrid 2nF 1 inherited all the types of 5S rDNAs in both progenitors and there were no signs of homeologous recombination in the 5S rDNAs of 2nF 1 by sequencing of PCR products. We obtained two segments of 5S rDNA with a total length of 16,457 bp from allotetraploid offspring 4nAT through bacterial artificial chromosome (BAC) sequencing. Using this sequence together with the 5S rDNA sequences amplified from the genomic DNA of 4nAT, we deduced that the 5S rDNAs of 4nAT might be inherited from the maternal progenitor red crucian carp. Additionally, the IPRs in the 5S rDNAs of 4nAT contained A-repeats and TA-repeats, which was not the case for the IPRs in the 5S rDNAs of 2nF 1 . We also detected two signals of a 200-bp fragment of 5S rDNA in the chromosomes of parental progenitors and hybrid progenies by fluorescence in situ hybridization (FISH). We deduced that during the evolution of 5S rDNAs in different ploidy hybrid fishes, interlocus gene conversion events and tandem repeat insertion events might occurred in the process of polyploidization. This study provided new insights into the relationship among the evolution of 5S rDNAs, hybridization and polyploidization, which were significant in clarifying the genome evolution of

  12. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  13. Immune-to-brain communication in functional somatic symptoms

    NARCIS (Netherlands)

    Lacourt, T.E.|info:eu-repo/dai/nl/313935068

    2013-01-01

    When a person presents with somatic symptoms that cannot (fully) be explained by a known organic pathology, these symptoms will be labeled ‘medically unexplained’ or ‘functional’. Often, more than one symptom is present and certain constellations of symptoms give way to a diagnosis of a specific

  14. PECTIMORF and BIOBRAS-16 utilization in the potato somatic embryogenesis

    Directory of Open Access Journals (Sweden)

    Jaime R. Hidrobo Luna

    2002-01-01

    Full Text Available With the application of PECTIMORF and BIOBRAS-16, somatic embryos were obtained in potato (Solanum tuberosum, L c.v. Desirèe, of 40 days old callus obtained from stem micropropagated plants. These were used as possible substitutes for crop regulators used in culture media for the induction of somatic embryos. The culture media was composed for 10ml.l-1 of Murashige and Skoog salt, 0.1mg.l-1 ANA, 0.1mg.l-1 kinetin, 0.5mg.l-1 thiamine, 2.5mg.l-1 cistein, 100mg.l-1 mioinositol, 20g.l-1 sucrose and 2.0g.l-1 agar. Four culture medias were tested in distinct combinations that contained different concentration of PECTIMOR and BIOBRAS-16 as substitute of auxins and cytokinins. After 90 days, the results obtained showed the possibility of substituting the auxins (0.5mg.l-1 ANA and the cytokinins (0.5mg.l-1 kinetin in the culture media, because the application of PECTIMORF at 3.2mg.l-1 and BIOBRAS-16 at 1.0mg.l-1, gave friable callus, high fresh weight (more than 1.4g and a brownish color at the end of the process, moment in which the somatic embryos of different phases, appeared at the surface of the callus. Keywords: brasinoesteroids, callus, oligopectate, somatic embryo

  15. The somatic mutation landscape of premalignant colorectal adenoma.

    Science.gov (United States)

    Lin, Shu-Hong; Raju, Gottumukkala S; Huff, Chad; Ye, Yuanqing; Gu, Jian; Chen, Jiun-Sheng; Hildebrandt, Michelle A T; Liang, Han; Menter, David G; Morris, Jeffery; Hawk, Ernest; Stroehlein, John R; Futreal, Andrew; Kopetz, Scott; Mishra, Lopa; Wu, Xifeng

    2017-06-12

    There are few studies which characterised the molecular alterations in premalignant colorectal adenomas. Our major goal was to establish colorectal adenoma genome atlas and identify molecular markers of progression from colorectal adenoma to adenocarcinoma. Whole-exome sequencing and targeted sequencing were carried out in 149 adenoma samples and paired blood from patients with conventional adenoma or sessile serrated adenoma to characterise the somatic mutation landscape for premalignant colorectal lesions. The identified somatic mutations were compared with those in colorectal cancer (CRC) samples from The Cancer Genome Atlas. A supervised random forest model was employed to identify gene panels differentiating adenoma from CRC. Similar somatic mutation frequencies, but distinctive driver mutations, were observed in sessile serrated adenomas and conventional adenomas. The final model included 20 genes and was able to separate the somatic mutation profile of colorectal adenoma and adenocarcinoma with an area under the curve of 0.941. The findings of this project hold potential to better identify patients with adenoma who may be candidates for targeted surveillance programmes and preventive interventions to reduce the incidence of CRC. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  16. Somatic cell nuclear transfer cloning: practical applications and current legislation.

    Science.gov (United States)

    Niemann, H; Lucas-Hahn, A

    2012-08-01

    Somatic cloning is emerging as a new biotechnology by which the opportunities arising from the advances in molecular genetics and genome analysis can be implemented in animal breeding. Significant improvements have been made in SCNT protocols in the past years which now allow to embarking on practical applications. The main areas of application of SCNT are: Reproductive cloning, therapeutic cloning and basic research. A great application potential of SCNT based cloning is the production of genetically modified (transgenic) animals. Somatic cell nuclear transfer based transgenic animal production has significant advances over the previously employed microinjection of foreign DNA into pronuclei of zygotes. This cell based transgenesis is compatible with gene targeting and allows both, the addition of a specific gene and the deletion of an endogenous gene. Efficient transgenic animal production provides numerous opportunities for agriculture and biomedicine. Regulatory agencies around the world have agreed that food derived from cloned animals and their offspring is safe and there is no scientific basis for questioning this. Commercial application of somatic cloning within the EU is via the Novel Food regulation EC No. 258/97. Somatic cloning raises novel questions regarding the ethical and moral status of animals and their welfare which has prompted a controversial discussion in Europe which has not yet been resolved. © 2012 Blackwell Verlag GmbH.

  17. High frequency induction of somatic embryos and plantlet ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-16

    Nov 16, 2009 ... plant, Hygrophila spinosa through direct somatic embryogenesis from nodal explants excised from 4 week old ... medicinal purposes further curbs propagation via seed. Plant tissue ... buted a great deal of information for the genetic, morpho- ..... analysis of peroxidase in cultured lettuce (Lactuca sativa L.).

  18. Somatic cell count distributions during lactation predict clinical mastitis

    NARCIS (Netherlands)

    Green, M.J.; Green, L.E.; Schukken, Y.H.; Bradley, A.J.; Peeler, E.J.; Barkema, H.W.; Haas, de Y.; Collis, V.J.; Medley, G.F.

    2004-01-01

    This research investigated somatic cell count (SCC) records during lactation, with the purpose of identifying distribution characteristics (mean and measures of variation) that were most closely associated with clinical mastitis. Three separate data sets were used, one containing quarter SCC (n =

  19. Effect of the somatic cell count on physicochemical components of ...

    African Journals Online (AJOL)

    xz

    2015-04-29

    Apr 29, 2015 ... the standard method to determine the quality of raw milk. (Ribas, 1999). Magalhães .... somatic cell score (SCS) resulted in an increase in the protein concentration of .... Yield of Dairy Herds]. C. E. Martins, C. N. Costa, J. R. F..

  20. Hypochondriasis and somatization: two distinct aspects of somatoform disorders?

    Science.gov (United States)

    Leibbrand, R; Hiller, W; Fichter, M M

    2000-01-01

    We investigated boundaries and overlap between somatization and hypochondriasis on different levels of psychopathology: (1) comorbidity between hypochondriasis and somatization on the level of diagnoses in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV; American Psychiatric Association, 1994): (2) comorbidity with other mental disorders; (3) differences in clinical characteristics: and (4) overlap on the level of psychometric measures. The sample consisted of 120 psycho somatic inpatients. Somatoform, hypochondriacal, and depressive symptomatology, cognitions about body and health, and further aspects of general symptomatology were investigated. Diagnoses of Axis I and II were based on DSM-IV Our results suggest a large overlap on the level of DSM-IV-diagnoses: only 3 of 31 hypochondriacal patients had no multiple somatoform symptoms, while 58 of 86 patients with multiple somatoform symptoms had no hypochondriasis. However, the overlap between hypochondriacal and somatization symptomatology on the level of psychometric measurement is only moderate, indicating that hypochondriasis is a markedly distinct aspect of somatoform disorders.

  1. Health Anxiety in Panic Disorder, Somatization Disorder and Hypochondriasis

    Directory of Open Access Journals (Sweden)

    Özgün Karaer KARAPIÇAK

    2012-03-01

    Full Text Available Objective: Health anxiety is the fear of being or getting seriously sick due to the misinterpretation of physical symptoms. Severe health anxiety is also named as hypochondriasis. Belief of having a disease due to the misinterpretation of physical symptoms is also seen in panic disorder and somatization disorder. The aim of this study is to search the health anxiety in panic disorder, somatization disorder and hypochondriasis and compare it with healthy volunteers. Method: SCID-I was used to determine psychiatric disorders in patient group. In order to assess the clinical state and disease severity of the patient group; Panic and Agoraphobia Scale, Hamilton Anxiety Rating Scale, Inventory of Depressive Symptomatology were used for patients with panic disorder and Symptom Interpretation Questionnaire, Hamilton Anxiety Rating Scale, Inventory of Depressive Symptomatology were used for patients with somatization disorder and hypochondriasis. Brief Symptom Inventory was used to assess psychopathology in healthy group. In order to evaluate health anxiety of both groups, Health Anxiety Inventory-Short Form was used. Results: Results of this study support that health anxiety is a significant major component of hypochondriasis. On the other hand, health anxiety seems to be common in panic disorder and somatization disorder. Health anxiety also may be a part of depression or present in healthy people. Conclusion: Further studies are needed in order to search how to manage health anxiety appropriately and which psychotherapeutic interventions are more effective.

  2. Genetic and somatic effects in animals maintained on tritiated water

    International Nuclear Information System (INIS)

    Carsten, A.L.; Brooks, A.; Commerford, S.L.; Cronkite, E.P.

    1981-01-01

    The possible genetic (dominant lethal mutations (DLM) and cytogenetic changes in the regenerating liver) and somatic (hematopoietic stem cell changes, growth and nonspecific life time shortening) effects in mice maintained on tritiated water (HTO) over two generations was investigated. Results to date are summarized

  3. Efficient somatic embryo production of Limau madu ( Citrus ...

    African Journals Online (AJOL)

    Effects of N6-benzylaminopurine (BAP) concentration, initial cell density and carbon sources and concentrations for producing cell suspension and somatic embryos of Limau madu (Citrus suhuiensis Hort. ex Tanaka) were investigated using cell suspension culture. Cells were first inoculated into Murashige and Skoog (MS) ...

  4. Sexual abuse predicts functional somatic symptoms : An adolescent population study

    NARCIS (Netherlands)

    Bonvanie, Irma J.; van Gils, Anne; Janssens, Karin A. M.; Rosmalen, Judith G. M.

    The main aim of this study was to investigate the effect of childhood sexual abuse on medically not well explained or functional somatic symptoms (FSSs) in adolescents. We hypothesized that sexual abuse predicts higher levels of FSSs and that anxiety and depression contribute to this relationship.

  5. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2

    NARCIS (Netherlands)

    Nangalia, J.; Massie, C.E.; Baxter, E.J.; Nice, F.L.; Gundem, G.; Wedge, D.C.; Avezov, E.; Li, J.; Kollmann, K.; Kent, D.G.; Aziz, A.; Godfrey, A.L.; Hinton, J.; Martincorena, I.; Loo, P. Van; Jones, A.V.; Guglielmelli, P.; Tarpey, P.; Harding, H.P.; Fitzpatrick, J.D.; Goudie, C.T.; Ortmann, C.A.; Loughran, S.J.; Raine, K.; Jones, D.R.; Butler, A.P.; Teague, J.W.; O'Meara, S.; McLaren, S.; Bianchi, M.; Silber, Y.; Dimitropoulou, D.; Bloxham, D.; Mudie, L.; Maddison, M.; Robinson, B.; Keohane, C.; Maclean, C.; Hill, K.; Orchard, K.; Tauro, S.; Du, M.Q.; Greaves, M.; Bowen, D.; Huntly, B.J.; Harrison, C.N.; Cross, N.C.; Ron, D.; Vannucchi, A.M.; Papaemmanuil, E.; Campbell, P.J.; Green, A.R.

    2013-01-01

    BACKGROUND: Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. METHODS: We performed exome sequencing

  6. Effect of the somatic cell count on physicochemical components of ...

    African Journals Online (AJOL)

    ... of the School of Veterinary Medicine and Animal Science of the Federal University of Goiás (Escola de Veterinária e Zootecnia da Universidade Federal de Goiás). Protein, fat, lactose, casein, urea, defatted dry extract and somatic cell counts (SCC) were analyzed. A completely randomized experimental design was used.

  7. Delusional disorder-somatic type (or body dysmorphic disorder) and ...

    African Journals Online (AJOL)

    With regard to delusional disorder-somatic subtype there may be a relationship with body dysmorphic disorder. There are reports that some delusional disorders can evolve to become schizophrenia. Similarly, the treatment of such disorders with antipsychotics has been documented. This report describes a case of ...

  8. Somatic symptoms of anxiety and nonadherence to statin therapy.

    Science.gov (United States)

    Korhonen, Maarit Jaana; Pentti, Jaana; Hartikainen, Juha; Kivimäki, Mika; Vahtera, Jussi

    2016-07-01

    The association between anxiety and nonadherence to preventive therapies remains unclear. We investigated whether somatic symptoms of anxiety predict statin nonadherence. This is a prospective cohort study of 1924 individuals who responded to a questionnaire survey on health status and initiated statin therapy after the survey during 2008-2010. We followed the cohort for nonadherence, defined as the proportion of days covered pain upon anger or emotion, sweating without exercise, flushing, tremor of hands or voice, muscle twitching) before the statin initiation, and 16% had experienced at least one symptom on average weekly to daily. 49% of respondents were nonadherent. Weekly to daily occurrence of these symptoms predicted a 33% increase in the risk of nonadherence (risk ratio [RR] 1.33, 95% confidence interval, CI, 1.13-1.57) compared to no symptoms when adjusted for sociodemographics, lifestyle risks, cardiovascular comorbidities, and depression. Particularly, chest pain upon anger or emotion (RR 1.21, 95% CI 1.01-1.46) and muscle twitching (RR 1.24, 95% CI 1.08-1.42) predicted an increased risk of nonadherence to statin therapy. Psychological symptoms of anxiety were not associated with nonadherence when adjusted for somatic symptoms. Somatic anxiety-related symptoms predicted nonadherence to statin therapy. Information on pre-existing somatic symptoms may help identifying patients at increased risk of statin nonadherence. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Induction of plant somatic embryogenesis in liquid medium

    NARCIS (Netherlands)

    Kreuger, M.

    1996-01-01


    The large scale propagation of plants via somatic embryogenesis, has so far been difficult to achieve. In this thesis research is described leading to embryogenic cell lines that can be maintained for a long period, without loss of genetic stability. It is also described how embryogenic

  10. Regeneration of Algerian germplasm by stigma/style somatic ...

    African Journals Online (AJOL)

    ... days in most of the cultured genotypes. Formed embryos were cultured in a single tube before in vivo acclimatization. After sanitary assays, regenerated plants were shown to be free from the agents detected in the mother trees. Key words: Algeria, citrus germplasm, plant regeneration, sanitation, somatic embryogenesis.

  11. Behavioral Variability and Somatic Mosaicism: A Cytogenomic Hypothesis.

    Science.gov (United States)

    Vorsanova, Svetlana G; Zelenova, Maria A; Yurov, Yuri B; Iourov, Ivan Y

    2018-04-01

    Behavioral sciences are inseparably related to genetics. A variety of neurobehavioral phenotypes are suggested to result from genomic variations. However, the contribution of genetic factors to common behavioral disorders (i.e. autism, schizophrenia, intellectual disability) remains to be understood when an attempt to link behavioral variability to a specific genomic change is made. Probably, the least appreciated genetic mechanism of debilitating neurobehavioral disorders is somatic mosaicism or the occurrence of genetically diverse (neuronal) cells in an individual's brain. Somatic mosaicism is assumed to affect directly the brain being associated with specific behavioral patterns. As shown in studies of chromosome abnormalities (syndromes), genetic mosaicism is able to change dynamically the phenotype due to inconsistency of abnormal cell proportions. Here, we hypothesize that brain-specific postzygotic changes of mosaicism levels are able to modulate variability of behavioral phenotypes. More precisely, behavioral phenotype variability in individuals exhibiting somatic mosaicism might correlate with changes in the amount of genetically abnormal cells throughout the lifespan. If proven, the hypothesis can be used as a basis for therapeutic interventions through regulating levels of somatic mosaicism to increase functioning and to improve overall condition of individuals with behavioral problems.

  12. The Somatic Genomic Landscape of Chromophobe Renal Cell Carcinoma

    NARCIS (Netherlands)

    Davis, Caleb F; Ricketts, Christopher J; Wang, Min; Yang, Lixing; Cherniack, Andrew D; Shen, Hui; Buhay, Christian; Kang, Hyojin; Kim, Sang Cheol; Fahey, Catherine C; Hacker, Kathryn E; Bhanot, Gyan; Gordenin, Dmitry A; Chu, Andy; Gunaratne, Preethi H; Biehl, Michael; Seth, Sahil; Kaipparettu, Benny A; Bristow, Christopher A; Donehower, Lawrence A; Wallen, Eric M; Smith, Angela B; Tickoo, Satish K; Tamboli, Pheroze; Reuter, Victor; Schmidt, Laura S; Hsieh, James J; Choueiri, Toni K; Hakimi, A Ari; Chin, Lynda; Meyerson, Matthew; Kucherlapati, Raju; Park, Woong-Yang; Robertson, A Gordon; Laird, Peter W; Henske, Elizabeth P; Kwiatkowski, David J; Park, Peter J; Morgan, Margaret; Shuch, Brian; Muzny, Donna; Wheeler, David A; Linehan, W Marston; Gibbs, Richard A; Rathmell, W Kimryn; Creighton, Chad J

    2014-01-01

    We describe the landscape of somatic genomic alterations of 66 chromophobe renal cell carcinomas (ChRCCs) on the basis of multidimensional and comprehensive characterization, including mtDNA and whole-genome sequencing. The result is consistent that ChRCC originates from the distal nephron compared

  13. Somatic Embryos in Catharanthus roseus: A Scanning Electron Microscopic Study

    Directory of Open Access Journals (Sweden)

    Junaid ASLAM

    2014-06-01

    Full Text Available Catharanthus roseus (L. G. Don is an important medicinal plant as it contains several anti-cancerous compounds, like vinblastine and vincristine. Plant tissue culture technology (organogenesis and embryogenesis has currently been used in fast mass propagating raw materials for secondary metabolite synthesis. In this present communication, scanning electron microscopic (SEM study of somatic embryos was conducted and discussed. The embryogenic callus was first induced from hypocotyls of in vitro germinated seeds on which somatic embryos, differentiated in numbers, particularly on 2,4-D (1.0 mg/L Murashige and Skoog (MS was medium. To understand more about the regeneration method and in vitro formed embryos SEM was performed. The SEM study revealed normal somatic embryo origin and development from globular to heart-, torpedo- and then into cotyledonary-stage of embryos. At early stage, the embryos were clustered together in a callus mass and could not easily be detached from the parental tissue. The embryos were often long cylindrical structure with or without typical notch at the tip. Secondary embryos were also formed on primary embryo structure. The advanced cotyledonary embryos showed prominent roots and shoot axis, which germinated into plantlets. The morphology, structure and other details of somatic embryos at various stages were presented.

  14. Influence of plant growth regulators on somatic embryos induction ...

    African Journals Online (AJOL)

    TANOH

    2013-04-17

    Theobroma cacao L.) using Thidiazuron. In vitro Cell Dev. Biol. 34:293-299. Michaux-Ferrière N, Carron MP (1989). Histology of early somatic embryogenesis in Hevea brasiliensis. The importance of timing of subculturing. Plant Cell Tiss ...

  15. Review of somatic cell nuclear transfer in pig | Muenthaisong ...

    African Journals Online (AJOL)

    It is now more than 8 years, since the first cloned pig from nuclear transfer was reported. Success of somatic cell nuclear transfer (SCNT) in pig is still low compared to that in bovine. Embryonic and neonatal abnormalities of cloned piglets are probably a result of incorrect or incomplete reprogramming of the transferred ...

  16. Central crosstalk for somatic tinnitus: abnormal vergence eye movements.

    Directory of Open Access Journals (Sweden)

    Qing Yang

    Full Text Available BACKGROUND: Frequent oulomotricity problems with orthoptic testing were reported in patients with tinnitus. This study examines with objective recordings vergence eye movements in patients with somatic tinnitus patients with ability to modify their subjective tinnitus percept by various movements, such as jaw, neck, eye movements or skin pressure. METHODS: Vergence eye movements were recorded with the Eyelink II video system in 15 (23-63 years control adults and 19 (36-62 years subjects with somatic tinnitus. FINDINGS: 1 Accuracy of divergence but not of convergence was lower in subjects with somatic tinnitus than in control subjects. 2 Vergence duration was longer and peak velocity was lower in subjects with somatic tinnitus than in control subjects. 3 The number of embedded saccades and the amplitude of saccades coinciding with the peak velocity of vergence were higher for tinnitus subjects. Yet, saccades did not increase peak velocity of vergence for tinnitus subjects, but they did so for controls. 4 In contrast, there was no significant difference of vergence latency between these two groups. INTERPRETATION: The results suggest dysfunction of vergence areas involving cortical-brainstem-cerebellar circuits. We hypothesize that central auditory dysfunction related to tinnitus percept could trigger mild cerebellar-brainstem dysfunction or that tinnitus and vergence dysfunction could both be manifestations of mild cortical-brainstem-cerebellar syndrome reflecting abnormal cross-modality interactions between vergence eye movements and auditory signals.

  17. Seasonal variability in somatic and reproductive investment of the bivalve

    NARCIS (Netherlands)

    Santos, S.; Cardoso, J.F.M.F.; Carvalho, C.; Luttikhuizen, P.C.; van der Veer, H.W.

    2011-01-01

    Monthly investment in soma and gonads in the bivalve Scrobicularia plana is described for three populations along its distributional range: Minho estuary, Portugal; Westerschelde estuary, The Netherlands and Buvika estuary, Norway. Seasonal cycles in body mass (BMI), somatic mass (SMI) and

  18. Plant regeneration via somatic embryogenesis from root explants of ...

    African Journals Online (AJOL)

    A system for induction of callus and plant regeneration via somatic embryogenesis from root explants of Hevea brasiliensis Muell. Arg. clone Reyan 87-6-62 was evaluated. The influence of plant growth regulators (PGRs) including 2,4-dichlorophenoxyacetic acid (2,4-D), 6-benzylaminopurine (6-BA) and kinetin (KT) on ...

  19. Somatic activating ARAF mutations in Langerhans cell histiocytosis

    NARCIS (Netherlands)

    Nelson, David S.; Quispel, Willemijn; Badalian-Very, Gayane; van Halteren, Astrid G. S.; van den Bos, Cor; Bovée, Judith V. M. G.; Tian, Sara Y.; van Hummelen, Paul; Ducar, Matthew; MacConaill, Laura E.; Egeler, R. Maarten; Rollins, Barrett J.

    2014-01-01

    The extracellular signal-regulated kinase (ERK) signaling pathway is activated in Langerhans cell histiocytosis (LCH) histiocytes, but only 60% of cases carry somatic activating mutations of BRAF. To identify other genetic causes of ERK pathway activation, we performed whole exome sequencing on

  20. Optimization of somatic embryogenesis and selection regimes for ...

    African Journals Online (AJOL)

    ... kanamycin in CIM containing explants undergoing SSE led to a decrease in their embryogenic potential resulting in tissue death at 50 mg/L. The highest transient expression of uidA gene in FEC was observed combining plasmolysis, M5 particle and a helium pressure of 1,200 psi, while in somatic cotyledons, the highest ...

  1. Paroxetine for Somatic Pain Associated With Physical Illness: A Review

    OpenAIRE

    Masand, Prakash S.; Narasimhan, Meera; Patkar, Ashwin A.

    2006-01-01

    Objective: The purpose of this article is to review the prevalence of somatic pain with and without depression or anxiety and the pharmacologic effects of the selective serotonin reuptake inhibitor paroxetine on pain in physical conditions with and without comorbid depression or anxiety.

  2. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    Science.gov (United States)

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  3. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Science.gov (United States)

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  4. Epilepsy as a systemic condition: Link with somatic comorbidities.

    Science.gov (United States)

    Novy, J; Bell, G S; Peacock, J L; Sisodiya, S M; Sander, J W

    2017-10-01

    People with epilepsy have more concomitant medical conditions than the general population; these comorbidities play an important role in premature mortality. We sought to generate explanatory hypotheses about the co-occurrence of somatic comorbidities and epilepsy, avoiding causal and treatment-resultant biases. We collected clinical, demographic and somatic comorbidity data for 2016 consecutive adults with epilepsy undergoing assessment at a tertiary centre and in 1278 people with epilepsy in the community. Underlying causes of epilepsy were not classed as comorbidities. Somatic comorbidities were more frequent in the referral centre (49%) where people more frequently had active epilepsy than in the community (36%). Consistent risk factors for comorbidities were found in both cohorts. Using multivariable ordinal regression adjusted for age, longer epilepsy duration and an underlying brain lesion were independently associated with a smaller burden of somatic conditions. The treatment burden, measured by the number of drugs to which people were exposed, was not an independent predictor. Shorter epilepsy duration was a predictor for conditions that conceivably harbour significant mortality risks. Somatic comorbidities do not occur randomly in relation to epilepsy; having more severe epilepsy seems to be a risk factor. Independently from age, the early period after epilepsy onset appears to be at particular risk, although it is not clear whether this relates to an early mortality or to a later decrease in the burden of comorbidities. These results suggest that, for some people, epilepsy should be considered a systemic condition not limited to the CNS. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Effect of prosthesis endplate lordosis angles on L5-S1 kinematics after disc arthroplasty.

    Science.gov (United States)

    Tsitsopoulos, Parmenion P; Wojewnik, Bartosz; Voronov, Leonard I; Havey, Robert M; Renner, Susan M; Zelenakova, Julia; McIntosh, Braden; Carandang, Gerard; Abjornson, Celeste; Patwardhan, Avinash G

    2012-06-01

    We hypothesized that L5-S1 kinematics will not be affected by the lordosis distribution between the prosthesis endplates. Twelve cadaveric lumbosacral spines (51.3 ± 9.8 years) were implanted with 6° or 11° prostheses (ProDisc-L) with four combinations of superior/inferior lordosis (6°/0°, 3°/3°, 11°/0°, 3°/8°). Specimens were tested intact and after prostheses implantation with different lordosis distributions. Center of rotation (COR) and range of motion (ROM) were quantified. Six-degree lordosis prostheses (n = 7) showed no difference in flexion-extension ROM, regardless of design (6°/0° or 3°/3°) (p > 0.05). In lateral bending (LB), both designs reduced ROM (p lordosis prostheses (n = 5) showed no difference in flexion-extension ROM for either design (p > 0.05). LB ROM decreased with distributed lordosis prostheses (3°/8°) (p lordosis distribution among the two prosthesis endplates. The ProDisc-L prosthesis design where all lordosis is concentrated in the superior endplate yielded COR locations that were anterior and caudal to intact controls. The prosthesis with lordosis distributed between the two endplates yielded a COR that tended to be closer to intact. Further clinical and biomechanical studies are needed to assess the long-term impact of lordosis angle distribution on the fate of the facet joints.

  6. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  7. File list: DNS.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Gon.10.AllAg.Testicular_somatic_cells mm9 DNase-seq Gonad Testicular somatic ce...lls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.10.AllAg.Testicular_somatic_cells.bed ...

  8. File list: ALL.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Gon.20.AllAg.Testicular_somatic_cells mm9 All antigens Gonad Testicular somatic... cells SRX591728,SRX591729,SRX591717,SRX591716 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  9. File list: His.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Gon.50.AllAg.Testicular_somatic_cells mm9 Histone Gonad Testicular somatic cell...s SRX591729,SRX591717 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  10. File list: His.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Gon.05.AllAg.Testicular_somatic_cells mm9 Histone Gonad Testicular somatic cell...s SRX591729,SRX591717 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  11. File list: His.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Gon.10.AllAg.Testicular_somatic_cells mm9 Histone Gonad Testicular somatic cell...s SRX591729,SRX591717 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Gon.10.AllAg.Testicular_somatic_cells.bed ...

  12. File list: ALL.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Gon.50.AllAg.Testicular_somatic_cells mm9 All antigens Gonad Testicular somatic... cells SRX591728,SRX591729,SRX591717,SRX591716 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  13. File list: Unc.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Gon.10.AllAg.Testicular_somatic_cells mm9 Unclassified Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Gon.10.AllAg.Testicular_somatic_cells.bed ...

  14. File list: DNS.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Gon.20.AllAg.Testicular_somatic_cells mm9 DNase-seq Gonad Testicular somatic ce...lls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  15. File list: Pol.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.05.AllAg.Testicular_somatic_cells mm9 RNA polymerase Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  16. File list: Oth.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.20.AllAg.Testicular_somatic_cells mm9 TFs and others Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  17. File list: His.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Gon.20.AllAg.Testicular_somatic_cells mm9 Histone Gonad Testicular somatic cell...s SRX591729,SRX591717 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  18. File list: Unc.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Gon.50.AllAg.Testicular_somatic_cells mm9 Unclassified Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  19. File list: DNS.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Gon.50.AllAg.Testicular_somatic_cells mm9 DNase-seq Gonad Testicular somatic ce...lls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  20. File list: Oth.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.10.AllAg.Testicular_somatic_cells mm9 TFs and others Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.10.AllAg.Testicular_somatic_cells.bed ...

  1. File list: DNS.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Gon.05.AllAg.Testicular_somatic_cells mm9 DNase-seq Gonad Testicular somatic ce...lls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  2. File list: Unc.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Gon.05.AllAg.Testicular_somatic_cells mm9 Unclassified Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  3. File list: Unc.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Gon.20.AllAg.Testicular_somatic_cells mm9 Unclassified Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  4. File list: Pol.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.20.AllAg.Testicular_somatic_cells mm9 RNA polymerase Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  5. File list: ALL.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Gon.05.AllAg.Testicular_somatic_cells mm9 All antigens Gonad Testicular somatic... cells SRX591729,SRX591728,SRX591717,SRX591716 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  6. File list: Pol.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.10.AllAg.Testicular_somatic_cells mm9 RNA polymerase Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.10.AllAg.Testicular_somatic_cells.bed ...

  7. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  8. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  9. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  10. The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π

    International Nuclear Information System (INIS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-01-01

    With a combined analysis of data on Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B (*) π in an effective field theory approach, we determine resonance parameters of Z b states in two scenarios. In one scenario we assume that Z b states are pure molecular states, while in the other one we assume that Z b states contain compact components. We find that the present data favor that there should be some compact components inside Z b (') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B * π, we determine that the probability of finding the compact components in Z b states may be as large as about 40 %. (orig.)

  11. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  12. Structural and optical properties of AgIn5S8

    Science.gov (United States)

    Rincón, Carlos A. Durante; Durán, Larissa T.; Medina, Josefa Estévez; Castro, Jaime A.; León, Máximo; Fermín, Jose R.

    2017-12-01

    Compounds of the chalcogenide family Ag-In-VI (VI = S, Se, Te) are interesting materials due to their stoichiometric stability and potential application in nonlinear optics and solar cells. A polycrystalline ingot of AgIn5S8, an ordered vacancy semiconductor, was prepared by direct fusion of the stoichiometric mixture of the elements in an evacuated quartz ampoule. The presence of a single phase with cubic structure was confirmed by X-ray powder diffraction at room temperature. The lattice parameter, a, was calculated, giving 10.821750 Å. Samples in evacuated quartz ampoules were used to perform Differential Thermal Analysis measurements, showing congruent melting at 1110∘C. Transmittance and reflectivity measurements were used to calculate the absorption coefficient α. From the plot of (αhν)2 versus hν, two direct transitions are observed at 1.25 eV and 1.88 eV. While the higher energy direct transition has been observed by other authors, the direct nature of the lower energy transition was confirmed from the fitting of the plot of the reflectivity versus 1/hν between 0.53 eV-1 (1.89 eV) and 0.55 eV-1 (1.82 eV), obtaining a value of 1.29 eV. The real refractive index n and the high-frequency dielectric constant 𝜀∞ were also obtained from the fit of the reflectivity, resulting to be 2.68 and 7.2, respectively.

  13. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  14. Discussion on the method to increase the successful rate of L5/S1 intervertebral disc puncture

    International Nuclear Information System (INIS)

    Zhong Xianyi; Li Liangjun; Yu Chengxin

    2007-01-01

    Objective: To study the effective methods of L 5 /S 1 intervertebral disc puncture without drilling to solve the barriers from iliaca. Methods: (1) puncturing with belly-buttock sticking out: to enlarge waist sacro-iliaca angle to move the puncture point up; (2) puncturing through intervertebral edge: puncturing through L 5 to 1/3 intervertebral disc to make the puncture point move Up; (3) puncturing through L 5 /S 1 intervertebral disc with the self-made puncture location instrument. Results with the methods, 280 cases with L 5 /S 1 intervertebral disc protrusion have been successfully punctured, with successful rate 100%. Conclusion: These methods are ideal and easy to use to treat L 5 /S 1 intervertebral disc protrusion puncture, and worth popularizing. (authors)

  15. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  16. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  17. Somatic Embryogenesis Induction and Plant Regeneration in Strawberry Tree (Arbutus unedo L.).

    Science.gov (United States)

    Martins, João F; Correia, Sandra I; Canhoto, Jorge M

    2016-01-01

    Somatic embryogenesis is a powerful tool both for cloning and studies of genetic transformation and embryo development. Most protocols for somatic embryogenesis induction start from zygotic embryos or embryonic-derived tissues which do not allow the propagation of elite trees. In the present study, a reliable protocol for somatic embryogenesis induction from adult trees of strawberry tree is described. Leaves from in vitro proliferating shoots were used to induce somatic embryo formation on a medium containing an auxin and a cytokinin. Somatic embryos germinated in a plant growth regulator-free medium.

  18. Absolute transition probabilities of 5s-5p transitions of Kr I from interferometric measurements in LTE-plasmas

    International Nuclear Information System (INIS)

    Kaschek, K.; Ernst, G.K.; Boetticher, W.

    1984-01-01

    Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)

  19. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  20. Measurements of the Exclusive Decays of the Υ(5S) to B Meson Final States and Improved Bs* Mass Measurement

    International Nuclear Information System (INIS)

    Aquines, O.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G.S.; Miller, D.H.; Pavlunin, V.; Sanghi, B.; Shipsey, I.P.J.; Xin, B.; Adams, G.S.; Anderson, M.; Cummings, J.P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C.S.

    2006-01-01

    Using 420 pb -1 of data collected on the Υ(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of Υ(5S) into B meson final states. We measure the inclusive B cross section to be σ(Υ(5S)→BB(X))=(0.177±0.030±0.016) nb and make the first measurements of the production rates of σ(Υ(5S)→B*B*)=(0.131±0.025±0.014) nb and σ(Υ(5S)→BB*)=(0.043±0.016±0.006) nb, respectively. We set 90% confidence level limits of σ(Υ(5S)→BB) ( * ) B ( * ) π) s * mass to date, M(B s *)=(5411.7±1.6±0.6) MeV/c 2

  1. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  2. [Hypochondriac symptoms in late-onset depression: the relationship between hypochondria and somatic state of patients].

    Science.gov (United States)

    Ivanets, N N; Avdeeva, T I; Kinkul'kina, M A

    2013-01-01

    Authors studied 276 women with late-onset depression. Concomitant chronic somatic diseases were identified in 90%. The presence of disease and its nosological definition did not impact on the development of hypochondriac symptoms in patients with late-onset depression. Patients with hypochondriac late-onset depression more often had disability pension due to somatic disease because they more often referred to internists in case of similar objective severity of somatic pathology. It was singled out three variants of the relationship between hypochondria and somatic state: hypernosognostic (a complete coincidence of hypochondria content with actual somatic pathology; anosognostic (a lack of coincidence) and disharmonic (a partial coincidence). The themes of hypochondria in late-nset depressions were correlated with a total number of somatic diseases and their severity. At the same time, there was no correlation between the content of hypochondria and the character of somatic disease.

  3. Somatization as a core symptom of melancholic type depression. Evidence from a cross-cultural study.

    Science.gov (United States)

    Ebert, D; Martus, P

    1994-12-01

    The study questions whether different types of somatization may be a core symptom of melancholia, thus, being invariable across cultures and being a candidate for neurobiological research and diagnostic criteria. 51 Turkish patients and 51 education-matched German patients with melancholic depression were compared for two types of somatization. Turkish patients had higher frequencies of somatic preoccupation and hypochondriasis but they were not different in the perception and experience of somatic symptoms. It is concluded that: (1) somatization has to be differentiated psychopathologically; (2) it may be a neurobiological core symptom of melancholia in the well-defined sense of 'perceiving abnormal somatic symptoms'; and (3) it may be a culture-bound symptom in the sense of 'being abnormally concerned with somatic symptoms or hypochondrial fears'.

  4. Inference of Tumor Phylogenies with Improved Somatic Mutation Discovery

    KAUST Repository

    Salari, Raheleh

    2013-01-01

    Next-generation sequencing technologies provide a powerful tool for studying genome evolution during progression of advanced diseases such as cancer. Although many recent studies have employed new sequencing technologies to detect mutations across multiple, genetically related tumors, current methods do not exploit available phylogenetic information to improve the accuracy of their variant calls. Here, we present a novel algorithm that uses somatic single nucleotide variations (SNVs) in multiple, related tissue samples as lineage markers for phylogenetic tree reconstruction. Our method then leverages the inferred phylogeny to improve the accuracy of SNV discovery. Experimental analyses demonstrate that our method achieves up to 32% improvement for somatic SNV calling of multiple related samples over the accuracy of GATK\\'s Unified Genotyper, the state of the art multisample SNV caller. © 2013 Springer-Verlag.

  5. Somatic Treatments in Treatment of Depression During Pregnancy

    Directory of Open Access Journals (Sweden)

    Eylem Ozten

    2015-09-01

    Full Text Available Although some psychotropic drugs are known to be teratogenic no psychotropic drug is of proven safety for treatment of depression during pregnancy. Untreated mood disorders during pregnancy pose significant risks for mother and the newborn. This review focuses on the use of somatic tretments of depression during pregnancy.Electroconvulsive therapy, bright light therapy, transcranial magnetic stimulation and vagal nerve stimulation are relatively safe and effective treatments during pregnancy if steps are taken to decrease potential risks. A clear information related to the somatic treatment should be given to the patient and informed consent should be obtained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2015; 7(3.000: 244-254

  6. Determination of somatic mutations in human erythrocytes by cytometry

    International Nuclear Information System (INIS)

    Jensen, R.H.; Langlois, R.G.; Bigbee, W.L.

    1985-01-01

    Flow cytometric assays of human erythrocytes labeled with monoclonal antibodies specific for glycophorin A were used to enumerate variant cells that appear in peripheral blood as a result of somatic gene-loss mutations in erythrocyte precursor cells. The assay was performed on erythrocytes from 10 oncology patients who had received at least one treatment from radiation or mutagenic chemotherapy at least 3 weeks before being assayed. The patients were suffering from many different malignancies (e.g., breast, renal, bone, colon and lung), and were treated with several different mutagenic therapeutics (e.g., cisplatinum, adriamycin, daunomycin, or cyclophosphamide). The frequency of these variant cells is an indication of the amount of mutagenic damage accumulated in the individual's erythropoietic cell population. Comparing these results to HPRT clonogenic assays, we find similar baseline frequencies of somatic mutation as well as similar correlation with mutagenic exposures. 9 refs., 3 figs., 1 tab

  7. Determination of somatic mutations in human erythrocytes by cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, R.H.; Langlois, R.G.; Bigbee, W.L.

    1985-06-21

    Flow cytometric assays of human erythrocytes labeled with monoclonal antibodies specific for glycophorin A were used to enumerate variant cells that appear in peripheral blood as a result of somatic gene-loss mutations in erythrocyte precursor cells. The assay was performed on erythrocytes from 10 oncology patients who had received at least one treatment from radiation or mutagenic chemotherapy at least 3 weeks before being assayed. The patients were suffering from many different malignancies (e.g., breast, renal, bone, colon and lung), and were treated with several different mutagenic therapeutics (e.g., cisplatinum, adriamycin, daunomycin, or cyclophosphamide). The frequency of these variant cells is an indication of the amount of mutagenic damage accumulated in the individual's erythropoietic cell population. Comparing these results to HPRT clonogenic assays, we find similar baseline frequencies of somatic mutation as well as similar correlation with mutagenic exposures. 9 refs., 3 figs., 1 tab.

  8. Severe Mental Illness, Somatic Delusions, and Attempted Mass Murder.

    Science.gov (United States)

    Sarteschi, Christine M

    2016-01-01

    A case of an attempted mass shooting at a large psychiatric hospital in the United States by a 30-year-old male with severe mental illness, somatic delusions, and exceptional access to healthcare professionals is reported. Six persons were shot, one died at the scene, and the shooter was then killed by the police. Data were gathered from court documents and media accounts. An analysis of the shooter's psychiatric history, his interactions with healthcare professionals, and communications prior to the shooting suggest a rare form of mass murder, a random attack by a documented psychotic and delusional individual suffering with somatic delusions. Despite his being psychotic, the killer planned the attack and made a direct threat 1 month prior to the shootings. This case highlights problems with the healthcare system, indicating that it might be ill equipped to appropriately deal with severe mental illness. © 2015 American Academy of Forensic Sciences.

  9. Functional Somatic Syndromes: Emerging Biomedical Models and Traditional Chinese Medicine

    Directory of Open Access Journals (Sweden)

    Steven Tan

    2004-01-01

    Full Text Available The so-called functional somatic syndromes comprise a group of disorders that are primarily symptom-based, multisystemic in presentation and probably involve alterations in mind-brain-body interactions. The emerging neurobiological models of allostasis/allostatic load and of the emotional motor system show striking similarities with concepts used by Traditional Chinese Medicine (TCM to understand the functional somatic disorders and their underlying pathogenesis. These models incorporate a macroscopic perspective, accounting for the toll of acute and chronic traumas, physical and emotional stressors and the complex interactions between the mind, brain and body. The convergence of these biomedical models with the ancient paradigm of TCM may provide a new insight into scientifically verifiable diagnostic and therapeutic approaches for these common disorders.

  10. Local anesthesia selection algorithm in patients with concomitant somatic diseases.

    Science.gov (United States)

    Anisimova, E N; Sokhov, S T; Letunova, N Y; Orekhova, I V; Gromovik, M V; Erilin, E A; Ryazantsev, N A

    2016-01-01

    The paper presents basic principles of local anesthesia selection in patients with concomitant somatic diseases. These principles are history taking; analysis of drugs interaction with local anesthetic and sedation agents; determination of the functional status of the patient; patient anxiety correction; dental care with monitoring of hemodynamics parameters. It was found that adhering to this algorithm promotes prevention of urgent conditions in patients in outpatient dentistry.

  11. Health Anxiety in Panic Disorder, Somatization Disorder and Hypochondriasis

    Directory of Open Access Journals (Sweden)

    Özgün Karaer KARAPIÇAK

    2012-04-01

    Results: Results of this study support that health anxiety is a significant major component of hypochondriasis. On the other hand, health anxiety seems to be common in panic disorder and somatization disorder. Health anxiety also may be a part of depression or present in healthy people. Conclusion: Further studies are needed in order to search how to manage health anxiety appropriately and which psychotherapeutic interventions are more effective. [JCBPR 2012; 1(1.000: 43-51

  12. Protecting genomic integrity in somatic cells and embryonic stem cells

    International Nuclear Information System (INIS)

    Hong, Y.; Cervantes, R.B.; Tichy, E.; Tischfield, J.A.; Stambrook, P.J.

    2007-01-01

    Mutation frequencies at some loci in mammalian somatic cells in vivo approach 10 -4 . The majority of these events occur as a consequence of loss of heterozygosity (LOH) due to mitotic recombination. Such high levels of DNA damage in somatic cells, which can accumulate with age, will cause injury and, after a latency period, may lead to somatic disease and ultimately death. This high level of DNA damage is untenable for germ cells, and by extrapolation for embryonic stem (ES) cells, that must recreate the organism. ES cells cannot tolerate such a high frequency of damage since mutations will immediately impact the altered cell, and subsequently the entire organism. Most importantly, the mutations may be passed on to future generations. ES cells, therefore, must have robust mechanisms to protect the integrity of their genomes. We have examined two such mechanisms. Firstly, we have shown that mutation frequencies and frequencies of mitotic recombination in ES cells are about 100-fold lower than in adult somatic cells or in isogenic mouse embryonic fibroblasts (MEFs). A second complementary protective mechanism eliminates those ES cells that have acquired a mutational burden, thereby maintaining a pristine population. Consistent with this hypothesis, ES cells lack a G1 checkpoint, and the two known signaling pathways that mediate the checkpoint are compromised. The checkpoint kinase, Chk2, which participates in both pathways is sequestered at centrosomes in ES cells and does not phosphorylate its substrates (i.e. p53 and Cdc25A) that must be modified to produce a G1 arrest. Ectopic expression of Chk2 does not rescue the p53-mediated pathway, but does restore the pathway mediated by Cdc25A. Wild type ES cells exposed to ionizing radiation do not accumulate in G1 but do so in S-phase and in G2. ES cells that ectopically express Chk2 undergo cell cycle arrest in G1 as well as G2, and appear to be protected from apoptosis

  13. The modulation of visceral functions by somatic afferent activity.

    Science.gov (United States)

    Sato, A; Schmidt, R F

    1987-01-01

    We began by briefly reviewing the historical background of neurophysiological studies of the somato-autonomic reflexes and then discussed recent studies on somatic-visceral reflexes in combination with autonomic efferent nerve activity and effector organ responses. Most of the studies that have advanced our knowledge in this area have been carried out on anesthetized animals, thus eliminating emotional factors. We would like to emphasize again that the functions of many, or perhaps all visceral organs can be modulated by somato-sympathetic or somato-parasympathetic reflex activity induced by a appropriate somatic afferent stimulation in anesthetized animals. As mentioned previously, some autonomic nervous outflow, e.g. the adrenal sympathetic nerve activity, is involved in the control of hormonal secretion. John F. Fulton wrote in his famous textbook "Physiology of the Nervous System" (1949) that the posterior pituitary neurosecretion system (i.e. for oxytocin and vasopressin) could be considered a part of the parasympathetic nervous system. In the study of body homeostasis and environmental adaptation it would seem very important to further analyze the contribution of somatic afferent input to the autonomic nervous and hormonal regulation of visceral organ activity. Also, some immunological functions have been found to be influenced by autonomic nerves or hormones (e.g. adrenal cortical hormone and catecholamines). Finally, we must take into account, as we have briefly discussed, that visceral functions can be modulated by somatic afferent input via various degrees of integration of autonomic nerves, hormones, and immunological processes. We trust that such research will be expanded to higher species of mammals, and that ultimately this knowledge of somato-visceral reflexes obtained in the physiological laboratory will become clinically useful in influencing visceral functions.

  14. Reprogramming to pluripotency can conceal somatic cell chromosomal instability.

    Directory of Open Access Journals (Sweden)

    Masakazu Hamada

    Full Text Available The discovery that somatic cells are reprogrammable to pluripotency by ectopic expression of a small subset of transcription factors has created great potential for the development of broadly applicable stem-cell-based therapies. One of the concerns regarding the safe use of induced pluripotent stem cells (iPSCs in therapeutic applications is loss of genomic integrity, a hallmark of various human conditions and diseases, including cancer. Structural chromosome defects such as short telomeres and double-strand breaks are known to limit reprogramming of somatic cells into iPSCs, but whether defects that cause whole-chromosome instability (W-CIN preclude reprogramming is unknown. Here we demonstrate, using aneuploidy-prone mouse embryonic fibroblasts (MEFs in which chromosome missegregation is driven by BubR1 or RanBP2 insufficiency, that W-CIN is not a barrier to reprogramming. Unexpectedly, the two W-CIN defects had contrasting effects on iPSC genomic integrity, with BubR1 hypomorphic MEFs almost exclusively yielding aneuploid iPSC clones and RanBP2 hypomorphic MEFs karyotypically normal iPSC clones. Moreover, BubR1-insufficient iPSC clones were karyotypically unstable, whereas RanBP2-insufficient iPSC clones were rather stable. These findings suggest that aneuploid cells can be selected for or against during reprogramming depending on the W-CIN gene defect and present the novel concept that somatic cell W-CIN can be concealed in the pluripotent state. Thus, karyotypic analysis of somatic cells of origin in addition to iPSC lines is necessary for safe application of reprogramming technology.

  15. Selection of Norway spruce somatic embryos by computer vision

    Science.gov (United States)

    Hamalainen, Jari J.; Jokinen, Kari J.

    1993-05-01

    A computer vision system was developed for the classification of plant somatic embryos. The embryos are in a Petri dish that is transferred with constant speed and they are recognized as they pass a line scan camera. A classification algorithm needs to be installed for every plant species. This paper describes an algorithm for the recognition of Norway spruce (Picea abies) embryos. A short review of conifer micropropagation by somatic embryogenesis is also given. The recognition algorithm is based on features calculated from the boundary of the object. Only part of the boundary corresponding to the developing cotyledons (2 - 15) and the straight sides of the embryo are used for recognition. An index of the length of the cotyledons describes the developmental stage of the embryo. The testing set for classifier performance consisted of 118 embryos and 478 nonembryos. With the classification tolerances chosen 69% of the objects classified as embryos by a human classifier were selected and 31$% rejected. Less than 1% of the nonembryos were classified as embryos. The basic features developed can probably be easily adapted for the recognition of other conifer somatic embryos.

  16. RADIA: RNA and DNA integrated analysis for somatic mutation detection.

    Directory of Open Access Journals (Sweden)

    Amie J Radenbaugh

    Full Text Available The detection of somatic single nucleotide variants is a crucial component to the characterization of the cancer genome. Mutation calling algorithms thus far have focused on comparing the normal and tumor genomes from the same individual. In recent years, it has become routine for projects like The Cancer Genome Atlas (TCGA to also sequence the tumor RNA. Here we present RADIA (RNA and DNA Integrated Analysis, a novel computational method combining the patient-matched normal and tumor DNA with the tumor RNA to detect somatic mutations. The inclusion of the RNA increases the power to detect somatic mutations, especially at low DNA allelic frequencies. By integrating an individual's DNA and RNA, we are able to detect mutations that would otherwise be missed by traditional algorithms that examine only the DNA. We demonstrate high sensitivity (84% and very high precision (98% and 99% for RADIA in patient data from endometrial carcinoma and lung adenocarcinoma from TCGA. Mutations with both high DNA and RNA read support have the highest validation rate of over 99%. We also introduce a simulation package that spikes in artificial mutations to patient data, rather than simulating sequencing data from a reference genome. We evaluate sensitivity on the simulation data and demonstrate our ability to rescue back mutations at low DNA allelic frequencies by including the RNA. Finally, we highlight mutations in important cancer genes that were rescued due to the incorporation of the RNA.

  17. Somatic embryogenesis of East Kalimantan local upland rice varieties

    Science.gov (United States)

    Nurhasanah; Ramitha; Supriyanto, B.; Sunaryo, W.

    2018-04-01

    Somatic embryogenesis is the formation, growth and development of embryos from somatic cells. Somatic embryo induction is one of the in vitro plant propagation techniques that is very important for plant developmental purposes. Four local upland rice varieties of East Kalimantan, Mayas Pancing, Gedagai, Siam and Serai, were used in this study. A total of 200 explants (mature rice grains) for each varieties were inoculated on MS solid medium supplemented with 1 mg L-1 2,4 Dichlorophenoxy acetic acid (2,4-D) and 0.5 mg L-1 6-Benzylaminopurine (BAP). The results showed that response of each variety differed to embryosomatic induction, indicated by callus induction rate and callus quality, in terms of callus color and structure. The fastest callus formation was sobserved in Gedagai variety (8 days) while Mayas Pancing (13 days) was the latest one. The rate of callus induction varied from 60 to 98.5 %, and Serai variety has the highest callus induction rate. The highest friable callus structure was found in Siam variety (89.1%) and the lowest was in Gedagai (62.5%). Callus color was dominated by the yellowish-white (transparent) on all varieties tested. Most of the callus was potential as embryogenic callus characterized from the nodular and globular of friable callus structure and its yellowish-white color.

  18. Review of somatic symptoms in post-traumatic stress disorder.

    Science.gov (United States)

    Gupta, Madhulika A

    2013-02-01

    Post-traumatic stress disorder (PTSD) is associated with both (1) 'ill-defined' or 'medically unexplained' somatic syndromes, e.g. unexplained dizziness, tinnitus and blurry vision, and syndromes that can be classified as somatoform disorders (DSM-IV-TR); and (2) a range of medical conditions, with a preponderance of cardiovascular, respiratory, musculoskeletal, neurological, and gastrointestinal disorders, diabetes, chronic pain, sleep disorders and other immune-mediated disorders in various studies. Frequently reported medical co-morbidities with PTSD across various studies include cardiovascular disease, especially hypertension, and immune-mediated disorders. PTSD is associated with limbic instability and alterations in both the hypothalamic- pituitary-adrenal and sympatho-adrenal medullary axes, which affect neuroendocrine and immune functions, have central nervous system effects resulting in pseudo-neurological symptoms and disorders of sleep-wake regulation, and result in autonomic nervous system dysregulation. Hypervigilance, a central feature of PTSD, can lead to 'local sleep' or regional arousal states, when the patient is partially asleep and partially awake, and manifests as complex motor and/or verbal behaviours in a partially conscious state. The few studies of the effects of standard PTSD treatments (medications, CBT) on PTSD-associated somatic syndromes report a reduction in the severity of ill-defined and autonomically mediated somatic symptoms, self-reported physical health problems, and some chronic pain syndromes.

  19. Direct Transcriptional Consequences of Somatic Mutation in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Adam Shlien

    2016-08-01

    Full Text Available Disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription, coordinated secondary pathway alterations, and increased transcriptional noise. To catalog the rules governing how somatic mutation exerts direct transcriptional effects, we developed an exhaustive pipeline for analyzing RNA sequencing data, which we integrated with whole genomes from 23 breast cancers. Using X-inactivation analyses, we found that cancer cells are more transcriptionally active than intermixed stromal cells. This is especially true in estrogen receptor (ER-negative tumors. Overall, 59% of substitutions were expressed. Nonsense mutations showed lower expression levels than expected, with patterns characteristic of nonsense-mediated decay. 14% of 4,234 rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusions, and premature polyadenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data reveals the rules by which transcriptional machinery interprets somatic mutation.

  20. Relationship of milking rate to somatic cell count.

    Science.gov (United States)

    Brown, C A; Rischette, S J; Schultz, L H

    1986-03-01

    Information on milking rate, monthly bucket somatic cell counts, mastitis treatment, and milk production was obtained from 284 lactations of Holstein cows separated into three lactation groups. Significant correlations between somatic cell count (linear score) and other parameters included production in lactation 1 (-.185), production in lactation 2 (-.267), and percent 2-min milk in lactation 2 (.251). Somatic cell count tended to increase with maximum milking rate in all lactations, but correlations were not statistically significant. Twenty-nine percent of cows with milking rate measurements were treated for clinical mastitis. Treated cows in each lactation group produced less milk than untreated cows. In the second and third lactation groups, treated cows had a shorter total milking time and a higher percent 2-min milk than untreated cows, but differences were not statistically significant. Overall, the data support the concept that faster milking cows tend to have higher cell counts and more mastitis treatments, particularly beyond first lactation. However, the magnitude of the relationship was small.

  1. The role of chromatin modifications in somatic embryogenesis in plants

    Directory of Open Access Journals (Sweden)

    Clelia eDe-la-Peña

    2015-08-01

    Full Text Available Somatic embryogenesis (SE is a powerful tool for plant genetic improvement, when used in combination with agricultural traditional techniques, and it is being used to understand the different processes that occur during the development of plant embryogenesis. SE onset depends on a complex network of interactions among plant growth regulators, mainly auxins and cytokinins, during the proembryogenic early stages, and ethylene, gibberellic and abscisic acids later in the development of the somatic embryos. These growth regulators control spatial and temporal regulation of multiple genes in order to initiate the change in the genetic program of the somatic cells, as well as the transition among embryo developmental stages. In recent years, epigenetic mechanisms have emerged as critical factors during SE. Some early reports indicate that auxins modify the levels of DNA methylation in embryogenic cells. The changes in DNA methylation patterns are associated with the regulation of several genes involved in SE, such as WUS, BBM1, LEC, and several others. In this review, we highlight the more recent discoveries in the role of epigenetic regulation of SE. In addition, we include a survey of novel approaches to the study of SE, and new opportunities to focus SE studies.

  2. Somatic mutations affect key pathways in lung adenocarcinoma

    Science.gov (United States)

    Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

    2009-01-01

    Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

  3. Advances in reprogramming somatic cells to induced pluripotent stem cells.

    Science.gov (United States)

    Patel, Minal; Yang, Shuying

    2010-09-01

    Traditionally, nuclear reprogramming of cells has been performed by transferring somatic cell nuclei into oocytes, by combining somatic and pluripotent cells together through cell fusion and through genetic integration of factors through somatic cell chromatin. All of these techniques changes gene expression which further leads to a change in cell fate. Here we discuss recent advances in generating induced pluripotent stem cells, different reprogramming methods and clinical applications of iPS cells. Viral vectors have been used to transfer transcription factors (Oct4, Sox2, c-myc, Klf4, and nanog) to induce reprogramming of mouse fibroblasts, neural stem cells, neural progenitor cells, keratinocytes, B lymphocytes and meningeal membrane cells towards pluripotency. Human fibroblasts, neural cells, blood and keratinocytes have also been reprogrammed towards pluripotency. In this review we have discussed the use of viral vectors for reprogramming both animal and human stem cells. Currently, many studies are also involved in finding alternatives to using viral vectors carrying transcription factors for reprogramming cells. These include using plasmid transfection, piggyback transposon system and piggyback transposon system combined with a non viral vector system. Applications of these techniques have been discussed in detail including its advantages and disadvantages. Finally, current clinical applications of induced pluripotent stem cells and its limitations have also been reviewed. Thus, this review is a summary of current research advances in reprogramming cells into induced pluripotent stem cells.

  4. Boron-Mediated Plant Somatic Embryogenesis: A Provocative Model

    Directory of Open Access Journals (Sweden)

    Dhananjay K. Pandey

    2012-01-01

    Full Text Available A central question in plant regeneration biology concerns the primary driving forces invoking the acquisition of somatic embryogenesis. Recently, the role of micronutrient boron (B in the initiation and perpetuation of embryogenesis has drawn considerable attention within the scientific community. This interest may be due in part to the bewildering observation that the system-wide induction of embryogenic potential significantly varied in response to a minimal to optimal supply of B (minimal ≤ 0.1 mM, optimal = 0.1 mM. At the cellular level, certain channel proteins and cell wall-related proteins important for the induction of embryogenesis have been shown to be transcriptionally upregulated in response to minimal B supply suggesting the vital role of B in the induction of embryogenesis. At the molecular level, minimal to no B supply increased the endogenous level of auxin, which subsequently influenced the auxin-inducible somatic embryogenesis receptor kinases, suggesting the role of B in the induction of embryogenesis. Also, minimal B concentration may “turn on” other genetic and/or cellular transfactors reported earlier to be essential for cell-restructuring and induction of embryogenesis. In this paper, both the direct and indirect roles of B in the induction of somatic embryogenesis are highlighted and suggested for future validation.

  5. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  6. File list: NoD.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Gon.50.AllAg.Testicular_somatic_cells mm9 No description Gonad Testicular somat...ic cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  7. File list: NoD.Gon.05.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Gon.05.AllAg.Testicular_somatic_cells mm9 No description Gonad Testicular somat...ic cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Gon.05.AllAg.Testicular_somatic_cells.bed ...

  8. File list: NoD.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Gon.20.AllAg.Testicular_somatic_cells mm9 No description Gonad Testicular somat...ic cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  9. DIRECT AND INDIRECT SOMATIC EMBRYOGENESIS ON ARABICA COFFEE (Coffea arabica

    Directory of Open Access Journals (Sweden)

    Meynarti Sari Dewi Ibrahim

    2013-10-01

    Full Text Available Propagation of Coffea arabica L. through direct and indirect somatic embryogenesis technique is promising for producing large number of coffee seedlings. The objectives of the research were to evaluate methods for direct and indirect somatic embryo-genesis induction of C. arabica var. Kartika. The explants were the youngest fully expanded leaves of arabica coffee. The evalu-ated medium was modified Murashige and Skoog (MS medium supplemented with a combination of 2.26 µM 2,4-D + 4.54 or 9.08 µM thidiazuron; 4.52 µM 2,4-D + 4.54 or 9.08 µM thidiazuron; or 9.04 µM 2,4-D + 9.08 µM thidiazuron. Both calli (100 mg and pre-embryos developed from the edge of leaf explants were subcultured into regeneration medium (half strength MS with modified vitamin, supplemented with kinetine 9.30 µM and adenine sulfate 40 mg L-1. The results showed coffee leaf explant cultured on medium containing 2.26 µM 2,4-D + 4.54 or 9.08 µM thidiazuron to induce direct somatic embriogenesis from explant, while that of 4.52 or 9.04 µM 2,4-D + 9.08 µM thidiazuron to induced indirect somatic embrio-genesis. The medium for calli induction from coffee by explants was medium supplemented with 4.52 or 9.04 µM 2,4-D in combination with 9.08 µM thidiazuron. On the other hand, the best medium for activation of induction of somatic embryos was MS medium supplemented with 9.04 µM 2,4-D + 9.08 µM thidiazuron. Based on this results, the first step for developing micropropagation for coffee has been resolved. The subsequent studies will be directed to evaluate agronomic performance of the derived planting materials.

  10. Replication of somatic micronuclei in bovine enucleated oocytes

    Directory of Open Access Journals (Sweden)

    Canel Natalia

    2012-11-01

    Full Text Available Abstract Background Microcell-mediated chromosome transfer (MMCT was developed to introduce a low number of chromosomes into a host cell. We have designed a novel technique combining part of MMCT with somatic cell nuclear transfer, which consists of injecting a somatic micronucleus into an enucleated oocyte, and inducing its cellular machinery to replicate such micronucleus. It would allow the isolation and manipulation of a single or a low number of somatic chromosomes. Methods Micronuclei from adult bovine fibroblasts were produced by incubation in 0.05 μg/ml demecolcine for 46 h followed by 2 mg/ml mitomycin for 2 h. Cells were finally treated with 10 μg/ml cytochalasin B for 1 h. In vitro matured bovine oocytes were mechanically enucleated and intracytoplasmatically injected with one somatic micronucleus, which had been previously exposed [Micronucleus- injected (+] or not [Micronucleus- injected (−] to a transgene (50 ng/μl pCX-EGFP during 5 min. Enucleated oocytes [Enucleated (+] and parthenogenetic [Parthenogenetic (+] controls were injected into the cytoplasm with less than 10 pl of PVP containing 50 ng/μl pCX-EGFP. A non-injected parthenogenetic control [Parthenogenetic (−] was also included. Two hours after injection, oocytes and reconstituted embryos were activated by incubation in 5 μM ionomycin for 4 min + 1.9 mM 6-DMAP for 3 h. Cleavage stage and egfp expression were evaluated. DNA replication was confirmed by DAPI staining. On day 2, Micronucleus- injected (−, Parthenogenetic (− and in vitro fertilized (IVF embryos were karyotyped. Differences among treatments were determined by Fisher′s exact test (p≤0.05. Results All the experimental groups underwent the first cell divisions. Interestingly, a low number of Micronucleus-injected embryos showed egfp expression. DAPI staining confirmed replication of micronuclei in most of the evaluated embryos. Karyotype analysis revealed that all Micronucleus-injected embryos had

  11. Anatomy of somatic embryogenesis in Carica papaya L.

    Directory of Open Access Journals (Sweden)

    Juliana A. Fernando

    2001-09-01

    Full Text Available Mature zygotic embryos of Carica papaya L. ‘Sunrise Solo’ were used as explants for embryogenesis induction. The explants were inoculated on Murashige and Skoog culture medium supplemented with 2 mg.L-1 2,4-dichlorophenoxyacetic acid and incubated in darkness at 25+2°C. Histological analysis of callogenesis and somatic embryogenesis indicated occurrence of direct and indirect somatic embryogenesis development. Direct somatic embryo formation was observed from hypocotyledonary epidermic cells only from explant 18 days after inoculation. Somatic embryos formed indirectly were originated from embryogenic superficial cells of pre-embryonic complexes located on peripherical and on internal cell layers of callus 49 days after inoculation. Diverse morphological differences including disformed embryos were observed among the somatic embryos.Embriões zigóticos maduros de Carica papaya L. ‘Sunrise Solo’ foram utilizados como explantes para indução da embriogênese. Estes explantes foram inoculados em meio de cultura de Murashige & Skoog suplementado com 2,0 mg.L-1 de 2,4 ácido diclorofenoxiacético (2,4-D e mantidos no escuro em câmara de crescimento à temperatura de 21°C por período de tempo variável. Através da análise histológica foi possível verificar que os primeiros embriões somáticos formaram-se diretamente a partir de células únicas da epiderme hipocotiledonar do explante após o 18º dia de cultura. Porém, os demais embriões somáticos originaram-se indiretamente a partir de células superficiais de complexos pré-embriônicos presentes nas camadas periféricas e internas do calo após o 49º dia de cultura. Foram detectadas algumas diferenças morfológicas entre os embriões somáticos obtidos.

  12. The cation-deficient Ruddlesden-Popper oxysulfide Y2Ti2O5S2 as a layered sulfide: topotactic potassium intercalation to form KY2Ti2O5S2.

    Science.gov (United States)

    Rutt, Oliver J; Hill, Timothy L; Gál, Zoltán A; Hayward, Michael A; Clarke, Simon J

    2003-12-01

    Potassium intercalation into the cation-deficient n = 2 Ruddlesden-Popper oxysulfide Y(2)Ti(2)O(5)S(2) to form KY(2)Ti(2)O(5)S(2) has been carried out by reaction of the oxysulfide with potassium vapor in sealed metal tubes at 400 degrees C, potassium naphthalide in THF at 50 degrees C, or potassium in liquid ammonia at temperatures as low as -78 degrees C. Insertion of potassium is topotactic, and although a site 12-coordinate by oxide ions is vacant in the perovskite-type oxide slabs of the structure, potassium is too large to enter this site via the 4-coordinate window, and instead enters the rock-salt-type sulfide layers of the structure which necessitates a 30% increase in the lattice parameter c normal to the layers. In contrast with one of the sodium intercalates of Y(2)Ti(2)O(5)S(2) (beta-NaY(2)Ti(2)O(5)S(2)) in which sodium occupies a tetrahedral site in the sulfide layers, potassium favors an 8-coordinate site which necessitates a relative translation of adjacent oxide slabs. KY(2)Ti(2)O(5)S(2) is tetragonal: P4/mmm, a = 3.71563(4) A, c = 14.8682(2) A (at 298 K), Z = 1. Although the resistivity (3.4(1) x 10(3) Omega cm) is larger than would be expected for a metal, temperature independent paramagnetism dominates the magnetic susceptibility, and the material is electronically very similar to the analogous sodium intercalate beta-NaY(2)Ti(2)O(5)S(2) which features reduced-titanium-containing oxide layers of very similar geometry and electron count.

  13. When Whole(ness is more than the Sum of the Parts: somatics as contemporary epistemological field

    Directory of Open Access Journals (Sweden)

    Ciane

    2014-12-01

    Full Text Available In the text, it is discussed some aspects on somatics in contemporary times, from the starting point of its technical and conceptual basis, clarifying premises and applications, as well as misunderstandings and restrictions. Some aspects include: conceptual, historical, and technical origins; common premises and principles developed by diverse somatic techniques; the difference between somatic technique, method, and approach; transculturality, decolonization, and repatterning; Somatic Attunement and Wisdom; institutionalization in technical and/or academic courses; somatics as autonomous field of therapy, education, aesthetics, and research; somatics as practice as research; somatic-performative research.

  14. Applicability of the 5S management method for quality improvement in health-care facilities: a review.

    Science.gov (United States)

    Kanamori, Shogo; Shibanuma, Akira; Jimba, Masamine

    2016-01-01

    The 5S management method (where 5S stands for sort, set in order, shine, standardize, and sustain) was originally implemented by manufacturing enterprises in Japan. It was then introduced to the manufacturing sector in the West and eventually applied to the health sector for organizing and standardizing the workplace. 5S has recently received attention as a potential solution for improving government health-care services in low- and middle-income countries. We conducted a narrative literature review to explore its applicability to health-care facilities globally, with a focus on three aspects: (a) the context of its application, (b) its impacts, and (c) its adoption as part of government initiatives. To identify relevant research articles, we researched public health databases in English, including CINAHL, PubMed, ScienceDirect, and Web of Science. We found 15 of the 114 articles obtained from the search results to be relevant for full-text analysis of the context and impacts of the 5S application. To identify additional information particularly on its adoption as part of government initiatives, we also examined other types of resources including reference books, reports, didactic materials, government documents, and websites. The 15 empirical studies highlighted its application in primary health-care facilities and a wide range of hospital areas in Brazil, India, Jordan, Senegal, Sri Lanka, Tanzania, the UK, and the USA. The review also found that 5S was considered to be the starting point for health-care quality improvement. Ten studies presented its impacts on quality improvements; the changes resulting from the 5S application were classified into the three dimensions of safety, efficiency, and patient-centeredness. Furthermore, 5S was adopted as part of government quality improvement strategies in India, Senegal, Sri Lanka, and Tanzania. 5S could be applied to health-care facilities regardless of locations. It could be not only a tool for health workers and

  15. Three forms of somatization in primary care: prevalence, co-occurrence, and sociodemographic characteristics.

    Science.gov (United States)

    Kirmayer, L J; Robbins, J M

    1991-11-01

    Three definitions of somatization were operationalized: (a) high levels of functional somatic distress, measured by the Somatic Symptom Index (SSI) of the Diagnostic Interview Schedule; (b) hypochondriasis measured by high scores on a measure of illness worry in the absence of evidence for serious illness; and (c) exclusively somatic clinical presentations among patients with current major depression or anxiety. Of 685 patients attending two family medicine clinics, 26.3% met criteria for one or more forms of somatization. While DSM-III somatization disorder had a prevalence of only 1% in this population, 16.6% of the patients met abridged criteria for subsyndromal somatization disorder (SSI 4,6). Hypochondriacal worry had a prevalence of 7.7% in the clinic sample. Somatized presentations of current major depression or anxiety disorder had a prevalence of 8%. The three forms of somatization were associated with different sociodemographic and illness behavior characteristics. A majority of patients met criteria for only one type of somatization, suggesting that distinct pathogenic processes may be involved in each of the three types.

  16. Germline contamination and leakage in whole genome somatic single nucleotide variant detection.

    Science.gov (United States)

    Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C

    2018-01-31

    The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

  17. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  18. Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Moore, P.B.

    1987-01-01

    The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR

  19. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Science.gov (United States)

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  20. O-5S quantitative real-time PCR: a new diagnostic tool for laboratory confirmation of human onchocerciasis.

    Science.gov (United States)

    Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz

    2017-10-02

    Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.

  1. Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

    Science.gov (United States)

    Kanamori, Shogo; Castro, Marcia C.; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

    2016-01-01

    Background The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. Design A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results Backward stepwise linear regression (n=1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014). Additional regression analyses showed significant score increases of 0.44 (p=0.002), 0.14 (p=0.002), 0.06 (p=0.019), and 0.17 (p=0.044) points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities

  2. Impact of the Japanese 5S management method on patients' and caretakers' satisfaction: a quasi-experimental study in Senegal.

    Science.gov (United States)

    Kanamori, Shogo; Castro, Marcia C; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

    2016-01-01

    The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Backward stepwise linear regression ( n= 1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention ( p= 0.014). Additional regression analyses showed significant score increases of 0.44 ( p= 0.002), 0.14 ( p= 0.002), 0.06 ( p= 0.019), and 0.17 ( p= 0.044) points on four items, which, respectively were healthcare staff members' communication, explanations about illnesses or cases, and consultation duration, and clients' overall satisfaction. The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities, further studies need to address the

  3. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    International Nuclear Information System (INIS)

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  4. Comparison of Excretory-Secretory and Somatic Antigens of Ornithobilharzia turkestanicum in Agar Gel Diffusion Test

    Directory of Open Access Journals (Sweden)

    H Miranzadeh

    2008-12-01

    Full Text Available Background: Ornithobilharziosis as one of the parasitic infections may give rise to serious economic problems in animal husbandry. The Aim of the study was to prepare and compare the somatic and excretory-secretory (ES antigens of O. tur­kestanicum in gel diffusion test. Methods: Excretory-secretory (ES and somatic antigens of Ornithobilharzia turkestanicum were prepared from collected worms from mesentric blood vessels of infected sheep. The laboratory bred rabbits were immunized with antigens and then antisera were prepared. The reaction of antigens and antisera was observed in gel diffusion test. Results: ES antigens of this species showed positive reaction with antisera raised against ES and also somatic antigens. Somatic antigens also showed positive reaction with antisera raised against somatic and also ES antigens. Conclusion: The antigenicity of O. turkestanicum ES and somatic antigens is the same in gel diffusion test.

  5. Characterization of somatic embryogenesis initiated from the Arabidopsis shoot apex.

    Science.gov (United States)

    Kadokura, Satoshi; Sugimoto, Kaoru; Tarr, Paul; Suzuki, Takamasa; Matsunaga, Sachihiro

    2018-04-28

    Somatic embryogenesis is one of the best examples of the remarkable developmental plasticity of plants, in which committed somatic cells can dedifferentiate and acquire the ability to form an embryo and regenerate an entire plant. In Arabidopsis thaliana, the shoot apices of young seedlings have been reported as an alternative tissue source for somatic embryos (SEs) besides the widely studied zygotic embryos taken from siliques. Although SE induction from shoots demonstrates the plasticity of plants more clearly than the embryo-to-embryo induction system, the underlying developmental and molecular mechanisms involved are unknown. Here we characterized SE formation from shoot apex explants by establishing a system for time-lapse observation of explants during SE induction. We also established a method to distinguish SE-forming and non-SE-forming explants prior to anatomical SE formation, enabling us to identify distinct transcriptome profiles of these two explants at SE initiation. We show that embryonic fate commitment takes place at day 3 of SE induction and the SE arises directly, not through callus formation, from the base of leaf primordia just beside the shoot apical meristem (SAM), where auxin accumulates and shoot-root polarity is formed. The expression domain of a couple of key developmental genes for the SAM transiently expands at this stage. Our data demonstrate that SE-forming and non-SE-forming explants share mostly the same transcripts except for a limited number of embryonic genes and root genes that might trigger the SE-initiation program. Thus, SE-forming explants possess a mixed identity (SAM, root and embryo) at the time of SE specification. Copyright © 2018. Published by Elsevier Inc.

  6. In vivo somatic mutation systems in the mouse

    International Nuclear Information System (INIS)

    Russell, L.B.

    1979-01-01

    In an effort to meet the need for a fast and cheap in vivo prescreen for inherited mammalian point mutations, a somatic forward-mutation method, originally developed in an x-ray experiment, has more recently been tested in work with chemical mutagens. The method makes use of coat-color mutations because the gene product is usually locally expressed, mosaics can be detected with minimal effort, and opportunities for making comparison with induction of germinal point mutations are greatest.--Following treatment of embryos that are heterozygous at specific coat-color loci, various induced genetic changes can result in expression of the recessive (RS) in clones derived from mutant melanocyte precursor cells. However, other events, such as decrease in the number of precursor cells, or disturbed differentiation, can also result in spots, which with careful classification can usually be distinguished from RS's on the basis of their location and color. When this is done, the relative RS frequencies for a series of compounds at least roughly parallel the relative spermatogonial mutation rates. The fact that easily measurable (though low) RS rates are obtained with compounds that have yielded negative results in spermatogonial tests is not surprising in view of the fact that RS's can be caused by several mechanisms besides point mutation.--In spite of the parallelism observed in one laboratory, the usefulness of the in vivo somatic mutation method as a prescreen could come to be doubted because of major discrepancies between results of similar experiments at different laboratories. However, It appears probable that at least some of these discrepancies are due to failure to discriminate between spots that probably resulted from melanocyte insufficiency and spots that resulted from expression of the recessive.--Reverse somatic mutation systems can potentially avoid some of the pitfalls of forward mutation systems. Such system are still in developmental stages

  7. Cloning Endangered Felids by Interspecies Somatic Cell Nuclear Transfer.

    Science.gov (United States)

    Gómez, Martha C; Pope, C Earle

    2015-01-01

    In 2003, the first wild felid was produced by interspecies somatic cell nuclear transfer. Since then other wild felid clone offspring have been produced by using the same technique with minor modifications. This chapter describes detailed protocols used in our laboratory for (1) the isolation, culture, and preparation of fibroblast cells as donor nucleus, and (2) embryo reconstruction with domestic cat enucleated oocytes to produce cloned embryos that develop to the blastocyst stage in vitro and, after transfer into synchronized recipients, establish successful pregnancies.

  8. Novel technologies using radiation and somatic embryogenesis for Kenaf improvement

    International Nuclear Information System (INIS)

    Rusli Ibrahim; Siti Mariam Mohd Nahar; Siti Hajar Mohd Nahar; Abdul Rahim Harun; Azhar Mohamad; Sobri Hussein

    2010-01-01

    Full text: Kenaf (Hibiscus cannabinus L.) is a plant in the Malvaceae family, similar to roselle (Hibiscus sabdariffa), cotton (Gossypium hirsutum L.) and okra (Abelmoschus esculentus), holds a promising potential in the Malaysian bio composite industry. Its long fibres are suitable in the process of making a number of products such as pulp and paper, fibre and particle boards, as well as fibre reinforced plastic components and chemical absorbent. Most varieties of kenaf are photo period sensitive and vegetative growth increases until the daylight period becomes less than 12 h 30 min. flowering is then initiated and the vegetative growth rate declines. At present, most of the varieties planted by the farmers produced very low yield, between 3-5 tons/ha. The aim of this research proposal is to study the potential of using nuclear technique with the use radiation in combination with biotechnology to induce genetic variability in kenaf using somatic embryogenesis. Since mutation is a single cell event, irradiation of cell cultures such as somatic embryos will induce high rate of mutation for selection of desired traits. One of the main objectives of the project was to establish an efficient and productive regeneration system for intact plants from somatic embryos obtained from the original mother plant varieties: G4, V36 dan G393. Once regeneration protocol has been optimized, somatic embryos were irradiated using both acute (high dose rate) and chronic (lower dose rate) gamma irradiation with effective doses (2-3 doses). It takes between 4-5 months to reach maximum height of 4-6 meters from seed propagated plants before they can be harvested. With the use of in vitro mutagenesis, screening and selection of new mutant lines with traits of interest can be achieved within a short period of time (3-5 years). Field evaluations were carried out in collaboration with National Kenaf and Tobacco Board (NKTB) and Kelantan Biotech Corporation Sdn. Bhd. targeted for desired

  9. Method for somatic cell nuclear transfer in zebrafish.

    Science.gov (United States)

    Siripattarapravat, Kannika; Cibelli, Jose B

    2011-01-01

    Somatic cell nuclear transfer (SCNT) has been a well-known technique for decades and widely applied to generate identical animals, including ones with genetic alterations. The system has been demonstrated successfully in zebrafish. The elaborated requirements of SCNT, however, limit reproducibility of the established model to a few groups in zebrafish research community. In this chapter, we meticulously outline each step of the published protocol as well as preparations of equipments and reagents used in zebrafish SCNT. All describable detailed-tips are elaborated in texts and figures. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. [Treatment of functional somatic syndrome with abdominal pain].

    Science.gov (United States)

    Abe, Tetsuya; Kanbara, Kenji; Mizuno, Yasuyuki; Fukunaga, Mikihiko

    2009-09-01

    Functional somatic syndrome (FSS) with abdominal pain include functional gastrointestinal disorder, chronic pancreatitis, chronic pelvic pain syndrome, which generally contain autonomic dysfunction. Regarding the treatment of FSS, it is important to know about FSS for a therapist at first. Secondly, the therapist should find out physical dysfunction of patients positively, and confirm objectively the hypotheses about both peripheral and central pathophysiological mechanisms as much as possible. Heart rate variability is an easy method, and useful to assess autonomic function. After grasping the patient's explanatory model about the illness, the therapist showes the most acceptable treatment for the patient at last.

  11. Do yogis have “Learning Styles”? (A somatic solution

    Directory of Open Access Journals (Sweden)

    William Ben Strean

    2017-01-01

    Full Text Available Background: "Learning styles" has captivated a great deal of attention in yoga teacher training. The triad of visual, auditory, and kinesthetic learning styles has been particularly popular; yet as Sharp et al. asserted, such an approach trivializes the complexity of learning and compromises scholarship at all levels of the education community. Aims: This paper addresses that although there is great merit in recognizing yoga students′ differences and preferences, many uses of learning styles in yoga teacher training are superficial and promote self-handicapping. Conclusion: A somatic perspective (from soma, the body in its wholeness offers a framework to reconsider the depth of effective learning.

  12. Molecular profiling of Vitis vinifera Chardonnay obtained by somatic embryogenesis

    Directory of Open Access Journals (Sweden)

    Christophe Bertsch

    2003-12-01

    Full Text Available With the help of microsatellite profiling, we showed that Vitis vinifera Chardonnay clone 96 is a periclinal chimera plant which is composed at least of two distinct cell layers. Performing somatic embryogenesis allowed us to separate the two cell layers and to regenerate L1 plants. These regenerated L1 plants did not show phenotypic differences to the parental clone when grown in greenhouse conditions, suggesting therefore that the phenotype of Chardonnay 96 did not result of an interaction between the two distinct cell layers L1 and L2.

  13. Do yogis have "Learning Styles"? (A somatic solution).

    Science.gov (United States)

    Strean, William Ben

    2017-01-01

    Learning styles has captivated a great deal of attention in yoga teacher training. The triad of visual, auditory, and kinesthetic learning styles has been particularly popular; yet as Sharp et al . asserted, such an approach trivializes the complexity of learning and compromises scholarship at all levels of the education community. This paper addresses that although there is great merit in recognizing yoga students' differences and preferences, many uses of learning styles in yoga teacher training are superficial and promote self-handicapping. A somatic perspective (from soma, the body in its wholeness) offers a framework to reconsider the depth of effective learning.

  14. Do yogis have “Learning Styles”? (A somatic solution)

    Science.gov (United States)

    Strean, William Ben

    2017-01-01

    Background: Learning styles has captivated a great deal of attention in yoga teacher training. The triad of visual, auditory, and kinesthetic learning styles has been particularly popular; yet as Sharp et al. asserted, such an approach trivializes the complexity of learning and compromises scholarship at all levels of the education community. Aims: This paper addresses that although there is great merit in recognizing yoga students’ differences and preferences, many uses of learning styles in yoga teacher training are superficial and promote self-handicapping. Conclusion: A somatic perspective (from soma, the body in its wholeness) offers a framework to reconsider the depth of effective learning. PMID:28149066

  15. [Disease at any price: psychological challenge and the financial costs of somatization].

    Science.gov (United States)

    Matalon, A

    1996-01-01

    In clinical medicine we sometimes deal with patients with unexplained somatic complaints. In a 45-year-old woman with multiple somatic complaints, 2 years of medical examinations in search of a disease diagnosis cost almost 250,000 shekels (about +84,000). The differential diagnosis between somatization, hypochondriasis and psychosomatic pain, and the reasons why physicians are tempted to participate in the "investigation dance" are presented.

  16. Personality traits influencing somatization symptoms and social inhibition in the elderly

    Directory of Open Access Journals (Sweden)

    Wongpakaran T

    2014-01-01

    Full Text Available Tinakon Wongpakaran, Nahathai WongpakaranFaculty of Medicine, Chiang Mai University, Chiang Mai, ThailandPurpose: Somatization is a common symptom among the elderly, and even though personality disorders have been found to be associated with somatization, personality traits have not yet been explored with regard to this symptom. The aim of this study is to investigate the relationship between personality traits and somatization, and social inhibition.Patients and methods: As part of a cross-sectional study of a community sample, 126 elderly Thais aged 60 years or over completed self-reporting questionnaires related to somatization and personality traits. Somatization was elicited from the somatization subscale when using the Symptom Checklist SCL-90 instrument. Personality traits were drawn from the 16 Personality Factor Questionnaire and social inhibition was identified when using the inventory of interpersonal problems. In addition, path analysis was used to establish the influence of personality traits on somatization and social inhibition.Results: Of the 126 participants, 51% were male, 55% were married, and 25% were retired. The average number of years in education was 7.6 (standard deviation =5.2. “Emotional stability” and “dominance” were found to have a direct effect on somatization, as were age and number of years in education, but not sex. Also, 35% of the total variance could be explained by the model, with excellent fit statistics. Dominance was found to have an indirect effect, via vigilance, on social inhibition, which was also influenced by number of years in education and emotional stability. Social inhibition was not found to have any effect on somatization, although hypothetically it should.Conclusion: “Emotional stability”, “dominance”, and “vigilance”, as well as age and the number of years in education, were found to have an effect on somatization. Attention should be paid to these factors in the elderly

  17. Monitoring Genetic Stability in Quercus serrata Thunb. Somatic Embryogenesis Using RAPD Markers

    OpenAIRE

    Ramesh C., Thakur; Susumu, Goto; Katsuaki, Ishii; S. Mohan, Jain; Forestry and Forest Products Research Institute; Fukuoka Prefecture Forest Research and Extension Center; Forestry and Forest Products Research Institute; University of Helsinki

    1999-01-01

    Genetic stability of propagules regenerated via somatic embryogenesis is of paramount importance for its application to clonal forestry. Random amplified polymorphic DNA (RAPD) markers were used to determine the genetic stability in somatic embryogenesis of Quercus serrata Thunb. (Japanese white oak). Forty samples from an embryogenic line, consisting of regenerated plantlets, somatic embryos, and embryogenic calli, were examined using 54 decanucleotide primers. A total of 6520 clear reproduc...

  18. Adaptation of the S-5-S Pendulím Seismometer for Measurement of Rotational Ground Motion

    Czech Academy of Sciences Publication Activity Database

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-01-01

    Roč. 16, č. 4 (2012), s. 649-656 ISSN 1383-4649 Institutional support: RVO:68145535 Keywords : rotation al ground motion * experimental measurement * mining induced seismicity * S-5-S seismometer Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.388, year: 2012 http://link.springer.com/article/10.1007%2Fs10950-012-9279-6

  19. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Evolution of primary and secondary structures in 5S and 5.8S rRNA

    International Nuclear Information System (INIS)

    Curtiss, W.C.

    1986-01-01

    The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented

  1. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  2. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  3. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  4. The Effectiveness of Somatization in Communicating Distress in Korean and American Cultural Contexts

    Science.gov (United States)

    Choi, Eunsoo; Chentsova-Dutton, Yulia; Parrott, W. Gerrod

    2016-01-01

    Previous research has documented that Asians tend to somatize negative experiences to a greater degree than Westerners. It is posited that somatization may be a more functional communication strategy in Korean than American context. We examined the effects of somatization in communications of distress among participants from the US and Korea. We predicted that the communicative benefits of somatic words used in distress narratives would depend on the cultural contexts. In Study 1, we found that Korean participants used more somatic words to communicate distress than US participants. Among Korean participants, but not US participants, use of somatic words predicted perceived effectiveness of the communication and expectations of positive reactions (e.g., empathy) from others. In Study 2, we found that when presented with distress narratives of others, Koreans (but not Americans) showed more sympathy in response to narratives using somatic words than narratives using emotional words. These findings suggest that cultural differences in use of somatization may reflect differential effectiveness of somatization in communicating distress across cultural contexts. PMID:27047414

  5. Is chronic pain associated with somatization/hypochondriasis? An evidence-based structured review.

    Science.gov (United States)

    Fishbain, David A; Lewis, John E; Gao, Jinrun; Cole, Brandly; Steele Rosomoff, R

    2009-01-01

    This is an evidence-based structured review. The objectives of this review were to answer the following questions: (1) Are somatization/hypochondriasis associated with chronic pain? (2) Is the degree of somatization/hypochondriasis related to pain levels? (3) Does pain treatment improve somatization/hypochondriasis? (4) Are some pain diagnoses differentially associated with somatization/hypochondriasis? Fifty-seven studies which fulfilled inclusion criteria and had high quality scores were sorted by the above-mentioned objectives. Agency for health care policy and research guidelines were utilized to type and characterize the strength/consistency of the study evidence within each objective. Somatization and hypochondriasis were both consistently associated with chronic pain (consistency ratings B and A, respectively). Study evidence indicated a correlation between pain intensity and presence of somatization and hypochondriasis (consistency rating A and B, respectively). Pain treatment improved somatization and hypochondriasis (consistency rating B and A, respectively). Some chronic pain diagnostic groups somatized more (consistency rating B). Somatization is commonly associated with chronic pain and may relate to pain levels.

  6. Maturation and germination of somatic embryos of Sorghum bicolor (L. Moench cultivar 'CIAP 132R-05'

    Directory of Open Access Journals (Sweden)

    Silvio de J Martínez

    2017-03-01

    Full Text Available In sorghum [Sorghum bicolor (L. Moench], developed protocols for plant regeneration via somatic embryogenesis do not include maturation stage. The present work was carried out with the aim of achieving the maturation and germination of sorghum somatic embryos in cultivar 'CIAP 132R-05'. It were studied four concentrations of sucrose (30, 50, 70 and 90 g l-1, two of abscisic acid (0.25 and 0.5 μM and a control without this growth regulator. Germination initiation (days and number of somatic embryos with complete germination were evaluated in three periods (1 - 7, 8 - 14 and 15 - 21 days of culture. In addition, the effect of 6-BAP (8.9, 17.8 and 26.6 μM on somatic embryo germination was determined. The germination start time (days and after 21 days the number of somatic embryos with complete germination and plants with malformations were determined. The addition of 70 g l-1 sucrose in the culture medium without abscisic acid increased the germination of the somatic embryos to 37.2 plants per embryo group (0.5 g of fresh mass. The highest number of somatic embryos germinated was obtained with 17.78 μM 6-BAP in the germination culture medium. It was demonstrated the need of a maturation stage in the sorghum somatic embryogenesis to increase the germination percentage.   Keywords: somatic embryogenesis, sorghum, sucrose, 6-BAP

  7. Determination of organ doses during radiological examinations and calculation of somatically significant dose

    International Nuclear Information System (INIS)

    Steiner, H.

    1980-01-01

    Examples are used to demonstrate that a shift in the point of emphasis is necessary with regard to radiation hazard in medicinal X-ray diagnosis. The parameters employed in this study to calculate somatic dose (SD) and somatically significant dose (SSD) may well be in need of modification; nevertheless the numerical estimation of SSD arrived at here appears to reflect the right order of magnitude for the estimation of somatic risk. The consideration of the threshold dose for somatic injury remains a problem. (orig./MG) [de

  8. The Effectiveness of Somatization in Communicating Distress in Korean and American Cultural Contexts

    Directory of Open Access Journals (Sweden)

    Eunsoo eChoi

    2016-03-01

    Full Text Available Previous research has documented that Asians tend to somatize negative experiences to a greater degree than Westerners. It is posited that somatization may be a more functional communication strategy in Korean than American context. We examined the effects of somatization in communications of distress among participants from the US and Korea. We predicted that the communicative benefits of somatic words used in distress narratives would depend on the cultural contexts. In Study 1, we found that Korean participants used more somatic words to communicate distress than US participants. Among Korean participants, but not US participants, use of somatic words predicted perceived effectiveness of the communication and expectations of positive reactions (e.g., empathy from others. In study 2, we found that when presented with distress narratives of others, Koreans (but not Americans showed more sympathy in response to narratives using somatic words than narratives using emotional words. These findings suggest that cultural differences in use of somatization may reflect differential effectiveness of somatization in communicating distress across cultural contexts.

  9. Somatic and movement inductions phantom limb in non-amputees

    Science.gov (United States)

    Casas, D. M.; Gentiletti, G. G.; Braidot, A. A.

    2016-04-01

    The illusion of the mirror box is a tool for phantom limb pain treatment; this article proposes the induction of phantom limb syndrome on non-amputees upper limb, with a neurological trick of the mirror box. With two study situations: a) Somatic Induction is a test of the literature reports qualitatively, and novel proposal b) Motor Induction, which is an objective report by recording surface EEG. There are 3 cases proposed for Motor illusion, for which grasped movement is used: 1) Control: movement is made, 2) illusion: the mirror box is used, and 3) Imagination: no movement is executed; the subject only imagines its execution. Three different tasks are registered for each one of them (left hand, right hand, and both of them). In 64% of the subjects for somatic experience, a clear response to the illusion was observed. In the experience of motor illusion, cortical activation is detected in both hemispheres of the primary motor cortex during the illusion, where the hidden hand remains motionless. These preliminary findings in phantom limb on non-amputees can be a tool for neuro-rehabilitation and neuro-prosthesis control training.

  10. A stochastic model of epigenetic dynamics in somatic cell reprogramming

    Directory of Open Access Journals (Sweden)

    Max eFloettmann

    2012-06-01

    Full Text Available Somatic cell reprogramming has dramatically changed stem cell research inrecent years. The high pace of new findings in the field and an ever increasingamount of data from new high throughput techniques make it challengingto isolate core principles of the process. In order to analyze suchmechanisms, we developed an abstract mechanistic model of a subset of theknown regulatory processes during cell differentiation and production of inducedpluripotent stem cells. This probabilistic Boolean network describesthe interplay between gene expression, chromatin modifications and DNAmethylation. The model incorporates recent findings in epigenetics and reproducesexperimentally observed reprogramming efficiencies and changes inmethylation and chromatin remodeling. It enables us to investigate in detail,how the temporal progression of the process is regulated. It also explicitlyincludes the transduction of factors using viral vectors and their silencing inreprogrammed cells, since this is still a standard procedure in somatic cellreprogramming. Based on the model we calculate an epigenetic landscape.Simulation results show good reproduction of experimental observations duringreprogramming, despite the simple stucture of the model. An extensiveanalysis and introduced variations hint towards possible optimizations of theprocess, that could push the technique closer to clinical applications. Fasterchanges in DNA methylation increase the speed of reprogramming at theexpense of efficiency, while accelerated chromatin modifications moderatelyimprove efficiency.

  11. The Relationship between Mental and Somatic Practices and Wisdom.

    Directory of Open Access Journals (Sweden)

    Patrick B Williams

    Full Text Available In this study we sought to explore how experience with specific mental and somatic practices is associated with wisdom, using self-report measures of experience and wisdom. We administered standard surveys to measure wisdom and experience among four groups of practitioners of mental and somatic practices, namely, meditators, practitioners of the Alexander Technique, practitioners of the Feldenkrais Method, and classical ballet dancers. We additionally administered surveys of trait anxiety and empathy to all participants to explore possible mediating relationships of experience and wisdom by characteristics thought to be components of wisdom. Wisdom was higher on average among meditation practitioners, and lowest among ballet dancers, and this difference held when controlling for differences in age between practices, supporting the view that meditation is linked to wisdom and that ballet is not. However, we found that increased experience with meditation and ballet were both positively associated with wisdom, and that lowered trait anxiety mediated this positive association among meditation practitioners, and, non-significantly, among ballet dancers. These results suggest that not all practices that are purported to affect mental processing are related to wisdom to the same degree and different kinds of experience appear to relate to wisdom in different ways, suggesting different mechanisms that might underlie the development of wisdom with experience.

  12. Numerical chromosome errors in day 7 somatic nuclear blastocysts

    DEFF Research Database (Denmark)

    Booth, Paul J; Viuff, Dorthe; Tan, Shijian J

    2003-01-01

    Day 7 bovine somatic nuclear transfer (NT) embryos reconstructed from granulosa cells were examined for numerical chromosome aberrations as a potential cause of the high embryonic and fetal loss observed in such embryos after transfer. The NT embryos were reconstructed using a zona-free manipulat......Day 7 bovine somatic nuclear transfer (NT) embryos reconstructed from granulosa cells were examined for numerical chromosome aberrations as a potential cause of the high embryonic and fetal loss observed in such embryos after transfer. The NT embryos were reconstructed using a zona...... families, consisting of 112 blastocysts reconstructed from five different primary granulosa cell cultures, were examined. Overall, the mean chromosome complement within embryos was 86.9 +/- 3.7% (mean +/- SEM) diploid, 2.6 +/- 0.5% triploid, 10.0 +/- 3.1% tetraploid, and 0.5 +/- 0.2% pentaploid or greater......; the vast majority (>75%) of the abnormal nuclei were tetraploid. Completely diploid and mixoploid embryos represented 22.1 +/- 4.5% and 73.7 +/- 5.5%, respectively, of all clones. Six totally polyploid blastocysts, containing or=5N chromosome complements, respectively) between two clone families were...

  13. Genetic characterization of somatic recombination in Trichoderma pseudokoningii

    Directory of Open Access Journals (Sweden)

    Barcellos Fernando Gomes

    2003-01-01

    Full Text Available Crossing experiments via hyphal anastomosis between two strains contrasting for auxotrophic markers of Trichoderma pseudokoningii were conducted to characterize the somatic recombination process in this specie. Four crossings were made and a total of 1052 colonies obtained from conidial suspensions of the heterokaryotic colonies were analyzed. Sixty-eight recombinant colonies, from four growing generations, were analyzed for the auxotrophic markers. Of the 68 colonies analyzed, 58 were stable after four generations and the remainders were unstable, reverting to one of the parentals. Most of the recombinant colonies were unstable through subculture and after four growing generations they showed the leu ino met markers (auxotrophic for leucin, inositol and metionin respectively. The unstable recombinant colonies showed irregular growing borders, sparse sporulation and frequent sector formation. The results suggest the occurrence of recombination mechanisms in the heterokaryon (somatic recombination, different from those described for the parasexual cycle or parameiosis. Therefore, we proposed the ocurrence of nuclei degradation from one parental (non prevalent parental in the heterokaryon and that the resulting chromosomal fragments may be incorporated into whole nuclei of the another parental (prevalent parental. However the parameiosis as originally described cannot be excluded.

  14. A somatic marker perspective of immoral and corrupt behavior.

    Science.gov (United States)

    Sobhani, Mona; Bechara, Antoine

    2011-01-01

    Individuals who engage in corrupt and immoral behavior are in some ways similar to individuals with psychopathy. Normal people refrain from engaging in such behaviors because they tie together the moral value of society and the risk of punishment when they violate social rules. What is it, then, that allows these immoral individuals to behave in this manner, and in some situations even to prosper? When there is a dysfunction of somatic markers, specific disadvantageous impairments in decision-making arise, as in moral judgment, but, paradoxically, under some circumstances, the damage can cause the patient to make optimal financial investment decisions. Interestingly, individuals with psychopathy, a personality disorder, share many of the same behavioral characteristics seen in VMPFC and amygdala lesion patients, suggesting that defective somatic markers may serve as a neural framework for explaining immoral and corrupt behaviors. While these sociopathic behaviors of sometimes famous and powerful individuals have long been discussed, primarily within the realm of social science and psychology, here we offer a neurocognitive perspective on the possible neural roots of immoral and corrupt behaviors.

  15. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  17. Zygotic and somatic embryo morphogenesis in Pinus pinaster: comparative histological and histochemical study.

    Science.gov (United States)

    Tereso, Susana; Zoglauer, Kurt; Milhinhos, Ana; Miguel, Célia; Oliveira, M Margarida

    2007-05-01

    We compared morphogenesis and accumulation of storage proteins and starch in Pinus pinaster Ait. zygotic embryos with those in somatic embryos grown with different carbohydrate sources. The maturation medium for somatic embryos included 80 microM abscisic acid (ABA), 9 g l(-1) gellam gum and either glucose, sucrose or maltose at 44, 88, 175 or 263 mM in the presence or absence of 6% (w/v) polyethylene glycol (PEG) 4000 MW. Maturation medium containing 44 or 88 mM of a carbohydrate source produced only one or no cotyledonary somatic embryos per 0.6 g fresh mass of culture. The addition of PEG to the basal maturation medium resulted in a low yield of cotyledonary somatic embryos that generally showed incomplete development and anatomical abnormalities such as large intercellular spaces and large vacuoles. High concentrations of maltose also induced large intercellular spaces in the somatic embryonic cells, and 263 mM sucrose produced fewer and less developed cotyledonary somatic embryos compared with 175 mM sucrose, indicating that the effect of carbohydrate source is partially osmotic. Zygotic embryos had a lower dry mass than somatic embryos at the same stage of development. Starch granules followed a similar accumulation pattern in zygotic and somatic embryos. A low starch content was found in cotyledonary zygotic embryos and in somatic embryos developed in the presence of 175 mM maltose or 263 mM glucose. In zygotic embryos and in PEG-treated somatic embryos, protein bodies appeared later and were smaller and fewer than in well-developed somatic embryos grown without PEG. We propose that storage protein concentration might be a marker of embryo quality.

  18. Cognitive-affective depression and somatic symptoms clusters are differentially associated with maternal parenting and coparenting.

    Science.gov (United States)

    Lamela, Diogo; Jongenelen, Inês; Morais, Ana; Figueiredo, Bárbara

    2017-09-01

    Both depressive and somatic symptoms are significant predictors of parenting and coparenting problems. However, despite clear evidence of their co-occurrence, no study to date has examined the association between depressive-somatic symptoms clusters and parenting and coparenting. The current research sought to identify and cross-validate clusters of cognitive-affective depressive symptoms and nonspecific somatic symptoms, as well as to test whether clusters would differ on parenting and coparenting problems across three independent samples of mothers. Participants in Studies 1 and 3 consisted of 409 and 652 community mothers, respectively. Participants in Study 2 consisted of 162 mothers exposed to intimate partner violence. All participants prospectively completed self-report measures of depressive and nonspecific somatic symptoms and parenting (Studies 1 and 2) or coparenting (Study 3). Across studies, three depression-somatic symptoms clusters were identified: no symptoms, high depression and low nonspecific somatic symptoms, and high depression and nonspecific somatic symptoms. The high depression-somatic symptoms cluster was associated with the highest levels of child physical maltreatment risk (Study 1) and overt-conflict coparenting (Study 3). No differences in perceived maternal competence (Study 2) and cooperative and undermining coparenting (Study 3) were found between the high depression and low somatic symptoms cluster and the high depression-somatic symptoms cluster. The results provide novel evidence for the strong associations between clusters of depression and nonspecific somatic symptoms and specific parenting and coparenting problems. Cluster stability across three independent samples suggest that they may be generalizable. The results inform preventive approaches and evidence-based psychotherapeutic treatments. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    Directory of Open Access Journals (Sweden)

    Nezih Akca

    2014-01-01

    Full Text Available Context: Little seems to be known about the sexual dysfunction (SD in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois. The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was

  20. The engine maintenance scheduling by using reliability centered maintenance method and the identification of 5S application in PT. XYZ

    Science.gov (United States)

    Sembiring, N.; Panjaitan, N.; Saragih, A. F.

    2018-02-01

    PT. XYZ is a manufacturing company that produces fresh fruit bunches (FFB) to Crude Palm Oil (CPO) and Palm Kernel Oil (PKO). PT. XYZ consists of six work stations: receipt station, sterilizing station, thressing station, pressing station, clarification station, and kernelery station. So far, the company is still implementing corrective maintenance maintenance system for production machines where the machine repair is done after damage occurs. Problems at PT. XYZ is the absence of scheduling engine maintenance in a planned manner resulting in the engine often damaged which can disrupt the smooth production. Another factor that is the problem in this research is the kernel station environment that becomes less convenient for operators such as there are machines and equipment not used in the production area, slippery, muddy, scattered fibers, incomplete use of PPE, and lack of employee discipline. The most commonly damaged machine is in the seed processing station (kernel station) which is cake breaker conveyor machine. The solution of this problem is to propose a schedule plan for maintenance of the machine by using the method of reliability centered maintenance and also the application of 5S. The result of the application of Reliability Centered maintenance method is obtained four components that must be treated scheduled (time directed), namely: for bearing component is 37 days, gearbox component is 97 days, CBC pen component is 35 days and conveyor pedal component is 32 days While after identification the application of 5S obtained the proposed corporate environmental improvement measures in accordance with the principles of 5S where unused goods will be moved from the production area, grouping goods based on their use, determining the procedure of cleaning the production area, conducting inspection in the use of PPE, and making 5S slogans.

  1. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    Science.gov (United States)

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  2. [Work organisation improvement methods applied to activities of Blood Transfusion Establishments (BTE): Lean Manufacturing, VSM, 5S].

    Science.gov (United States)

    Bertholey, F; Bourniquel, P; Rivery, E; Coudurier, N; Follea, G

    2009-05-01

    Continuous improvement of efficiency as well as new expectations from customers (quality and safety of blood products) and employees (working conditions) imply constant efforts in Blood Transfusion Establishments (BTE) to improve work organisations. The Lean method (from "Lean" meaning "thin") aims at identifying wastages in the process (overproduction, waiting, over-processing, inventory, transport, motion) and then reducing them in establishing a mapping of value chain (Value Stream Mapping). It consists in determining the added value of each step of the process from a customer perspective. Lean also consists in standardizing operations while implicating and responsabilizing all collaborators. The name 5S comes from the first letter of five operations of a Japanese management technique: to clear, rank, keep clean, standardize, make durable. The 5S method leads to develop the team working inducing an evolution of the way in the management is performed. The Lean VSM method has been applied to blood processing (component laboratory) in the Pays de la Loire BTE. The Lean 5S method has been applied to blood processing, quality control, purchasing, warehouse, human resources and quality assurance in the Rhône-Alpes BTE. The experience returns from both BTE shows that these methods allowed improving: (1) the processes and working conditions from a quality perspective, (2) the staff satisfaction, (3) the efficiency. These experiences, implemented in two BTE for different processes, confirm the applicability and usefulness of these methods to improve working organisations in BTE.

  3. Effects of the substrate temperature on the properties of CuIn{sub 5}S{sub 8} thin films

    Energy Technology Data Exchange (ETDEWEB)

    Gannouni, M., E-mail: gm_mounir@yahoo.fr [Laboratoire de Photovoltaique et Materiaux Semi-conducteurs - ENIT BP 37, Le belvedere 1002-Tunis (Tunisia); Kanzari, M. [Laboratoire de Photovoltaique et Materiaux Semi-conducteurs - ENIT BP 37, Le belvedere 1002-Tunis (Tunisia)

    2011-10-01

    Structural, optical and electrical properties of CuIn{sub 5}S{sub 8} thin films grown by thermal evaporation have been studied relating the effects of substrate heating conditions of these properties. The CuIn{sub 5}S{sub 8} thin films were carried out at substrate temperatures in the temperature range 100-300 deg. C. The effects of heated substrate on their physico-chemical properties were investigated using X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDX), optical transmission and hot probe method. X-ray diffraction revealed that the films are strong preferred orientation along the (3 1 1) plane upon substrate temperature 200 deg. C and amorphous for the substrate temperatures below 200 deg. C. No secondary phases are observed for all the films. The composition is greatly affected by heated substrate. From the optical transmission and reflection, an important absorption coefficient exceeds 10{sup 5} cm{sup -1} at 800 nm was found. As increasing the substrate temperature, the optical energy band gap decreases from 1.70 eV for the unheated films to 1.25 eV for the deposited films at 300 deg. C. It was found that CuIn{sub 5}S{sub 8} thin film is an n-type semiconductor at 250 deg. C.

  4. Effects of the substrate temperature on the properties of CuIn5S8 thin films

    International Nuclear Information System (INIS)

    Gannouni, M.; Kanzari, M.

    2011-01-01

    Structural, optical and electrical properties of CuIn 5 S 8 thin films grown by thermal evaporation have been studied relating the effects of substrate heating conditions of these properties. The CuIn 5 S 8 thin films were carried out at substrate temperatures in the temperature range 100-300 deg. C. The effects of heated substrate on their physico-chemical properties were investigated using X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDX), optical transmission and hot probe method. X-ray diffraction revealed that the films are strong preferred orientation along the (3 1 1) plane upon substrate temperature 200 deg. C and amorphous for the substrate temperatures below 200 deg. C. No secondary phases are observed for all the films. The composition is greatly affected by heated substrate. From the optical transmission and reflection, an important absorption coefficient exceeds 10 5 cm -1 at 800 nm was found. As increasing the substrate temperature, the optical energy band gap decreases from 1.70 eV for the unheated films to 1.25 eV for the deposited films at 300 deg. C. It was found that CuIn 5 S 8 thin film is an n-type semiconductor at 250 deg. C.

  5. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  6. Intermixing, band alignment and charge transport in AgIn5S8/CuI heterojunctions

    International Nuclear Information System (INIS)

    Konovalov, I.; Makhova, L.; Hesse, R.; Szargan, R.

    2005-01-01

    Possibilities of creating photovoltaic devices using CuI/AgIn 5 S 8 heterojunctions are considered. Among other properties, preferential formation of polar (111) surfaces makes n-type AgIn 5 S 8 an attractive candidate for absorber layers of top cells in 4-terminal tandem structures. Cu-Ag exchange at the interface with p-type CuI was observed. This intermixing results in an additional component of Ag 3d5 photoelectron line after deposition of CuI, in the Cu (but not I) contamination of the surface after a chemical removal of CuI, and in a photoelectric sensitivity of the junction at energies below the band gaps. Valence band offsets of 0.4 and 0.5 eV (cliff) were found at interfaces with thin film and bulk AgIn 5 S 8 , supporting a conduction mechanism through interface recombination. Pinning conflict at the interface between materials with contradictory doping limitations is likely to promote the intermixing

  7. Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

    Science.gov (United States)

    Zhang, Yawei; Li, Gang

    2018-01-01

    Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

  8. Simulasi Pengembangan Bengkel Fabrikasi Jurusan Pendidikan Teknik Mesin Sesuai Kaidah 5S Menggunakan Aplikasi 3ds Max

    Directory of Open Access Journals (Sweden)

    Putut Hargiyarto

    2014-10-01

    Full Text Available The objectives of this study were to assess the risks involved in workshops, to apply the Seiso, Seiton, Seiri, Seiketsu, Shitsuke (5S concept for workshops development and to develop the fabrication workshop for the Department of Mechanical Engineering Education, Faculty of Engineering, YSU using the 3DS Max simulation application. This study was categorised into Research and Development. The first steps were designing and creating the product using 3DS Max application. The next step was testing the product by implementing it to perform the workshops policy. The results of this study showed the risks consisted of noise, strong light, harmful gases and the mechanical hazards due to falling and moving objects. The implementation of 5S concept, K3 and ergonomics were required to maintain the regularity, efficiency and work discipline, to prevent and to minimize workplace accidents. The development of fabrication workshops using the 3DS Max simulation applicationis is beneficial for implementing the aspects of 5S, K3, ergonomics and provides a reference in redesigning a workshop.

  9. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  10. Influence of different dose irradiation on genetic effect in mice somatic and germ cells

    International Nuclear Information System (INIS)

    Kostrova, L.N.; Molofej, V.P.; Mosseh, I.B.

    2007-01-01

    Comparison of clastogenic effects of different radiation doses in somatic and germ cells of one the same animals has been studied. Correlation analysis allows to extrapolate genetic effects from somatic cells to germ ones. This can be useful for human model elaboration. (authors)

  11. Somatic PI3K activity regulates transition to the spermatocyte stages ...

    Indian Academy of Sciences (India)

    Spermatogenesis, involving multiple transit amplification divisions and meiosis, occurs within an enclosure formed bytwo somatic cells. As the cohort of germline cells divide and grow, the surface areas of the somatic cells expandmaintaining a tight encapsulation throughout the developmental period. Correlation between ...

  12. Antigen receptors and somatic hypermutation in B-cell chronic lymphocytic leukemia with Richter's transformation

    NARCIS (Netherlands)

    Smit, Laura A.; van Maldegem, Febe; Langerak, Anton W.; van der Schoot, C. Ellen; de Wit, Mireille J.; Bea, Silvia; Campo, Elias; Bende, Richard J.; van Noesel, Carel J. M.

    2006-01-01

    BACKGROUND AND OBJECTIVES: Activation-induced cytidine deaminase is essential for somatic hypermutation and class switch recombination of the immunoglobulin genes in B cells. It has been proposed that aberrant targeting of the somatic hypermutation machinery is instrumental in initiation and

  13. Pervasive Developmental Disorder Behavior in Adolescents with Intellectual Disability and Co-Occurring Somatic Chronic Diseases

    Science.gov (United States)

    Oeseburg, B.; Groothoff, J. W.; Dijkstra, G. J.; Reijneveld, S. A.; Jansen, D. E. M. C.

    2010-01-01

    Evidence on the association between somatic chronic diseases in ID-adolescents and the full range of pervasive developmental disorder behavior (PDD behavior) is scarce. The aim of the present study is to assess the association between somatic chronic diseases in ID-adolescents and mild PDD behavior. We obtained data on 1044 ID-adolescents, aged…

  14. Injection molded pinched flow fractionation device for enrichment of somatic cells in cow milk

    DEFF Research Database (Denmark)

    Jensen, Marie Pødenphant; Marie, Rodolphe; Olesen, Tom

    2014-01-01

    In this paper the continuous microfluidic separation technique pinched flow fractionation is applied to the enrichment of somatic cells from cow milk. Somatic cells were separated from the smallest fat particles and proteins thus better imaging and analysis of the cells can be achieved...

  15. Pervasive developmental disorder behavior in adolescents with intellectual disability and co-occurring somatic chronic diseases

    NARCIS (Netherlands)

    Oeseburg, B.; Groothoff, J. W.; Dijkstra, G. J.; Reijneveld, S. A.; Jansen, D. E. M. C.

    2010-01-01

    Evidence on the association between somatic chronic diseases in ID-adolescents and the full range of pervasive developmental disorder behavior (PDD behavior) is scarce. The aim of the present study is to assess the association between somatic chronic diseases in ID-adolescents and mild PDD behavior.

  16. Cell-of-Origin-Specific 3D Genome Structure Acquired during Somatic Cell Reprogramming

    NARCIS (Netherlands)

    Krijger, Peter Hugo Lodewijk; Di Stefano, Bruno; de Wit, Elzo; Limone, Francesco; van Oevelen, Chris; de Laat, Wouter; Graf, Thomas

    2016-01-01

    Forced expression of reprogramming factors can convert somatic cells into induced pluripotent stem cells (iPSCs). Here we studied genome topology dynamics during reprogramming of different somatic cell types with highly distinct genome conformations. We find large-scale topologically associated

  17. Polyamine levels during the development of zygotic and somatic embryos of Pinus radiata

    Science.gov (United States)

    Rakesh Minocha; Dale R. Smith; Cathie Reeves; Kevin D. Steele; Subhash C. Minocha

    1999-01-01

    Changes in the cellular content of three polyamines (putrescine, spermidine and spermine) were compared at different stages of development in zygotic and somatic embryos of Pinus radiata D. Don. During embryo development, both the zygotic and the somatic embryos showed a steady increase in spermidine content, with either a small decrease or no...

  18. Contrastive Study of Somatisms Distinctive Features in Phraseology of Different Languages

    Directory of Open Access Journals (Sweden)

    Sharbat Muhamedzhanova

    2013-01-01

    Full Text Available The article analyzes semantic transformations of phraseologically active somatisms, based on contrastive study of fixed combinations in Kazakh and French languages. The prospects for the study of fixed combinations, having somatic vocabulary as a semantic kernel in conceptualization of idioethnic anthropological paradigm was studied

  19. Somatic PI3K activity regulates transition to the spermatocyte stages ...

    Indian Academy of Sciences (India)

    Samir Gupta

    2017-04-22

    Apr 22, 2017 ... like growth factor (IGF) families, control the tissue homeosta- sis (Biteau et al. 2011 ... A breach in the somatic encapsulation due to the loss of somatic cyst cells .... populations at the apical region of testes of 4-days-old adults.

  20. Genetic associations for pathogen-specific clinical mastitis and patterns of peaks in somatic cell count

    NARCIS (Netherlands)

    Haas, de Y.; Barkema, H.W.; Schukken, Y.H.; Veerkamp, R.F.

    2003-01-01

    Genetic associations were estimated between pathogen-specific cases of clinical mastitis (CM), lactational average somatic cell score (LACSCS), and patterns of peaks in somatic cell count (SCC) which were based on deviations from the typical lactation curve for SCC. The dataset contained test-day

  1. Effects of Response Styles on the Report of Psychological and Somatic Distress.

    Science.gov (United States)

    Linden, Wolfgang; And Others

    1986-01-01

    Assessed the impact of two major response style dimensions (self-deception and impression management) on the report of psychological and somatic symptoms. Results confirmed that response styles were more predictive of psychological than somatic symptoms. Both anxiety and depression were associated with a high rate of physical symptoms,…

  2. Somatic gene mutation in the human in relation to radiation risk

    International Nuclear Information System (INIS)

    Mendelsohn, M.L.

    1992-01-01

    This report discusses the measurement of somatic gene-mutation frequencies in the human. We ask the following questions. How well can they be measured? Do they respond to radiation? Can they also function as a dosimeter? What do they tell us about the somatic mutation theory of carcinogenesis?

  3. Somatic Markers and Explicit Knowledge Are both Involved in Decision-Making

    Science.gov (United States)

    Guillaume, Sebastien; Jollant, Fabrice; Jaussent, Isabelle; Lawrence, Natalia; Malafosse, Alain; Courtet, Philippe

    2009-01-01

    In 1994, it was proposed that decision-making requires emotion-related signals, known as somatic markers. In contrast, some authors argued that conscious knowledge of contingencies is sufficient for advantageous decision-making. We aimed to investigate the respective roles of somatic markers and explicit knowledge in decision-making. Thirty…

  4. Somatic complaints in childhood : how they are related to children's emotional and social functioning

    NARCIS (Netherlands)

    Jellesma, Francisca Catharina

    2008-01-01

    This thesis deals with emotional and social influences on childhood somatic complaints. Strong support is provided for the idea that negative affect contributes to the development of somatic complaints in childhood. In addition, the studies described give information about the type and levels of

  5. PREDICTORS FORMATION OF SOCIAL MALADJUSTMENT IN PATIENTS WITH PARANOID SCHIZOPHRENIA WITH CONCOMITANT SOMATIC-NEUROLOGICAL DISORDERS

    Directory of Open Access Journals (Sweden)

    Valeriy Semionovici PIDKORYTOV

    2017-05-01

    Full Text Available The investigation of the level of stress in patients with paranoid schizophrenia with concomitant somatic-neurological disorders and quality of life as predictors of the formation of their social exclusion. The influence of somatic-neurological pathology for paranoid schizophrenia at different levels of stress.

  6. Somatic Experiencing Treatment with Social Service Workers Following Hurricanes Katrina and Rita

    Science.gov (United States)

    Leitch, M. Laurie; Vanslyke, Jan; Allen, Marisa

    2009-01-01

    In a disaster, social service workers are often survivors themselves. This study examines whether somatic intervention using a brief (one to two session) stabilization model now called the Trauma Resiliency Model[TM] (TRM), which uses the skills of Somatic Experiencing[R] (SE), can reduce the postdisaster symptoms of social service workers…

  7. The Contribution of High Levels of Somatic Symptom Severity to Sickness Absence Duration, Disability and Discharge

    NARCIS (Netherlands)

    Hoedeman, Rob; Blankenstein, Annette H.; Krol, Boudien; Koopmans, Petra C.; Groothoff, Johan W.

    Introduction: The primary objectives were to compare the duration of sickness absence in employees with high levels of somatic symptom severity (HLSSS) with employees with lower levels of somatic symptom severity, and to establish the long-term outcomes concerning return to work (RTW), disability

  8. Symptom-specific associations between low cortisol responses and functional somatic symptoms : The TRAILS study

    NARCIS (Netherlands)

    Janssens, K.A.; Oldehinkel, A.J.; Verhulst, F.C.; Hunfeld, J.A.; Ormel, J.; Rosmalen, J.G.

    Background: Functional somatic symptoms (FSS), like chronic pain and overtiredness, are often assumed to be stress-related. Altered levels of the stress hormone cortisol could explain the association between stress and somatic complaints. We hypothesized that low cortisol levels after awakening and

  9. Investigation of growth and characterization of nanostructured CuIn5S8 thin films produced by glancing angle deposition

    International Nuclear Information System (INIS)

    Sinaoui, A.; Chaffar-Akkari, F.; Gallas, B.; Demaille, D.; Kanzari, M.

    2015-01-01

    Ternary chalcogenide of copper and indium (CuIn 5 S 8 ) thin films were grown by thermal evaporation method using GLancing Angle Deposition (GLAD) technique. The samples were prepared under different incident angles (α = 0°, 40°, 60° and 85° measured from the normal to the substrate surface) with a substrate rotation of 2 rpm. X-ray diffraction, scanning electron microscopy, and ultraviolet–visible-infrared spectra are employed to characterize the microstructure and optical properties of the CuIn 5 S 8 thin films deposited by this technique. Under the GLAD conditions, we demonstrate that with substrate rotation, the columns were grown vertically due to the shadowing symmetry. The optical constants of the deposited films were determined from the analysis of transmission and reflection data. The results show that the refractive index and the thickness were decreased as α rises from 0° to 85° while the porosity and the Urbach energy were increased with increasing of the incident angle. The minimum refractive index is found to be 2.03 for the helical CuIn 5 S 8 film deposited at an angle of 85° and the Urbach energy was found to increase from 0.29 to 0.5 eV as α rises from 0° to 85°. Such changes of the optical behaviors are correlated with changes of the microstructure, especially a porous architecture which is favored for high incident angle. These properties exhibit potential for use in applications such as photonic crystals, graded index optical filters, and birefrigent omnidirectional reflectors. - Highlights: • GLancing angle deposition technique was employed to prepare CuIn 5 S 8 thin films. • CuIn 5 S 8 films exhibit a spinel structure with a preferred orientation along 311. • With substrate rotation, the columns were grown vertically due to shadowing symmetry. • The refractive index decreases with increasing glancing angle deposition. • Variations of the optical behaviors were correlated to the highly porous structure

  10. CYTOLOGICAL QUALITY OF GOAT MILK ON THE BASIS OF THE SOMATIC CELL COUNT

    Directory of Open Access Journals (Sweden)

    Henryka BERNACKA

    2007-07-01

    Full Text Available The aim of the present paper was to evaluate the cytological quality of goat milk based on the somatic cell count in respective months of lactation. Besides there was defined the effect of somatic cell on the milk production and chemical composition of milk. The research covered goats of color improved breed in the 2nd and 3rd lactation. Daily milk yield, chemical composition of milk and its somatic cell count were defined based on monthly morning and evening control milkings from both teats, following the A4 method applied in District Animal Evaluation Stations. The research indicated that the greater the somatic cell count in milk, the lower the daily milk yield, however the greater the somatic cell count, the greater the percentage content of fat and dry matter and the lower the content of lactose.

  11. Somatic embryogenesis from leaf explants of Australian fan flower, Scaevola aemula R. Br.

    Science.gov (United States)

    Wang, Y-H; Bhalla, P L

    2004-01-01

    Somatic embryogenesis from leaf explants of Scaevola aemula R. Br. was achieved. Somatic embryos were induced from explants cultured on MS medium supplemented with 0.2 mg/ 2,4-dichlorophenoxyacetic acid and 0.2-0.5 mg/l 6-benzylaminopurine (BAP). Various developmental stages of somatic embryos were found on this medium-from globular embryos to germinated embryos. The transfer of globular embryos to MS medium containing 0.5 mg/l BAP resulted in a high frequency of shoot regeneration. Leaf explants cultured on MS medium containing different combinations of BAP and alpha-naphthaleneacetic acid formed adventitious shoots and roots. Histological examination confirmed the process of somatic embryogenesis. Induction of somatic embryogenesis in Scaevola provides a system for studying embryogenesis in Australian native plants and will facilitate the improvement of these plants using genetic transformation techniques.

  12. Micropropagation of Citrus spp. by organogenesis and somatic embryogenesis.

    Science.gov (United States)

    Chiancone, Benedetta; Germanà, Maria Antonietta

    2013-01-01

    Citrus spp., the largest fruit crops produced worldwide, are usually asexually propagated by cuttings or grafting onto seedling rootstocks. Most of Citrus genotypes are characterized by polyembryony due to the occurrence of adventive nucellar embryos, which lead to the production of true-to-type plants by seed germination. Tissue culture and micropropagation, in particular, are valuable alternatives to traditional propagation to obtain a high number of uniform and healthy plants in a short time and in a small space. Moreover, in vitro propagation provides a rapid system to multiply the progeny obtained by breeding programs, allows the use of monoembryonic and seedless genotypes as rootstocks, and it is very useful also for breeding and germplasm preservation.In this chapter, two protocols regarding organogenesis of a rootstock and somatic embryogenesis of a cultivar have been described.

  13. X-ray sensitivity of somatic cell hybrids

    International Nuclear Information System (INIS)

    Zampetti-Bosseler, F.; Heilporn, V.; Lievens, A.; Limbosch, S.

    1976-01-01

    Different somatic cell hybrids have been studied as a function of their x-ray survival and karyotypic properties. Hybrids between x-ray-sensitive mouse lymphoma cells and mouse fibroblasts, retaining a large proportion of both parental chromosomes, were much more resistant to irradiation than either of the parental cells. On the other hand, hybrids between sensitive mouse lymphoma cells and hamster fibroblasts which also retained a relatively high number of chromosomes from both parents had a sensitivity intermediate between the sensitivities of the parental cell lines. Finally, hybrids between mouse fibroblasts and hamster fibroblasts carrying at least one hamster genome and less than one mouse genome resembled the hamster parent with respect to survival capactity. The significance of these results is discussed

  14. Induction of somatic mutation in chrysanthemum cultivar 'Anupam'

    International Nuclear Information System (INIS)

    Banerji, B.K.; Datta, S.K.

    1990-01-01

    Rooted cuttings of chrysanthemum cv. 'Anupam' were irradiated with 1.5, 2.0 and 2.5 Krad of gamma rays. Significant reduction in survival, plant height, branch, leaf and flower head number and leaf size were recorded after irradiation. Radio sensitivity was determined on the basis of different cytomorphological parameters. Different types of morphological abnormalities in leaves and flower and chromosomal abnormalities during root tip mitosis were observed and the total abnormalities increased with increase in exposure to gamma rays. Significant delay in flower bud initiation, first colour showing and full bloom were recorded in the treated population. Somatic mutations in flower colour could be induced in vM 1 as chimera and a total of three flower colour mutant, i.e., lighter, white and striped were isolated and established in pure form as new cultivars which are of direct use for floriculture industry. (author). 17 refs., 6 figs. , 2 tabs

  15. Somatic embryogenesis in cell cultures of Glycine species.

    Science.gov (United States)

    Gamborg, O L; Davis, B P; Stahlhut, R W

    1983-08-01

    This report describes the development of procedures for the production of somatic embryos in cell cultures of Glycine species including soybean. The conditions for callus induction and initiation of rapidly growing cell suspension cultures were defined. Methods for inducing embryogenesis were tested on 16 lines of several Glycine species and cultivars of soybean. The SB-26 Culture of a G. soja gave the best results and was used in the experiments. Embryogenesis required the presence of picloram or 2,4-D. AMO 1618, CCC, PP-333 and Ancymidol enhanced the embryogenesis frequency. Plants of the G. soja (SB-26) were grown to maturity from seed-derived shoot tips. Characteristics of the plants are discussed.

  16. Histology study of the somatic embryogenesis in Agave fourcroydes Lem.

    Directory of Open Access Journals (Sweden)

    Silvia Alemán García

    2002-01-01

    Full Text Available A histological study of the structures embryogenic formed from meristem of Agave fourcroydes, with the objective of observing the behavior of the somatic embryogenesis from the induction until the formation of the embryo was carried out. The meristem cultivated in vitro was subculture in modified MS medium the induction. The samples to be included intheresinJB–4weretakenperiodically.Thehistologicalscutsof5-10µmwerecarriedoutwithrotatorymicrotome and strained in 2% toluidine blue. The sections were observed and photographed in light microscopy Axioplan Zeiis with increases of 20X. The results show to the 60 days of culture the presence of cells meristematic pre-embrygenic. Embryos in different phases of formation globular and scutellum were observed in all the mass of the callus in the following subculture. Key words: Agavaceae, in vitro culture, embryo, histology

  17. Characterizing somatization, hypochondriasis, and hysteria in the borderline personality disorder.

    Science.gov (United States)

    Snyder, S; Pitts, W M

    1986-03-01

    Somatization, hypochondriasis, and hysteria have often been considered as associated features of the borderline personality disorder. This study was designed to characterize these three syndromes in the borderline patient. Inpatients with DSM-III borderline personality disorder were compared with controls with dysthymic disorder. Scales and items from standardized rating instruments which measured the three syndromes were scored and compared between groups. Although the hysteria-obvious and hypochondriasis scales of the MMPI and the Hamilton Depression Scale item measuring hypochondriasis were elevated in the borderline group, there were no significant differences between groups. Scores of dysthymic patients significantly exceeded those of borderline patients on four of five MMPI codetypes measuring the three syndromes. Findings are discussed in light of previous psychodynamic, empirical, and research literature.

  18. Improvement of quantification of somatic radiation risks at low doses

    International Nuclear Information System (INIS)

    Jacobi, W.; Paretzke, H.G.; Henrichs, K.; Hettig, H.; Jacob, P.; Merkle, W.; Messerer, P.; Schindel, F.

    1985-10-01

    In this research contract several selected topics of basic relevancy for assessment models of radiological consequences of hypothetical reactor accidents have been considered. The investigations focussed on the following areas: 1) Age dependent dose conversion factors for members of the public and their variability for radioisotopes of iodine, strontium, and caesium, - improvement of the accuracy of dose calculations for external gamma irradiation from cloud- and ground-shine; 2) analysis of data and models relevant for the assessment of exposure-time-effect relationships for lethal somatic late effects of lung and breast cancer and of leukemia; 3) analysis of various health status indices (e.g. ''loss of healthy life span'') with respect to their usefulness in addition to incidence, mortality, etc. for the evaluation of the magnitude of a health detriment due to a previous radiation exposure. (orig./HP) [de

  19. Somatically segregating clone of apomictic maize-tripsacum hybrid

    International Nuclear Information System (INIS)

    Yudin, B.F.; Lukina, L.A.

    1988-01-01

    The results of further study on clone AM-5, isolated in the progeny of γ-irradiated plants of the apomictic hybrid of maize with tripsacum (2n = 38) are reported. The variegated-leaf seedlings of the clone segregate somatically and produce variegated, mottled, green (phenotypically normal) plants in different ratios in the apomictic progenies. The variegated, and to a lesser degree, green segregants segregate further. The mottled apomictics as well as mottled branches of variegated seedlings maintain their phenotype on transplantation, however, these is a progressive enhancement of the characters of vegetative lethality. Lethals of two extra maize genomes to the AM-5 nucleus does not affect significantly the scope and nature of segregation. At the same time, the loss of tripsacum genome restores normal phenotype. Clone AM-5 is an example of hybrid apomictic form causing significant morphological variability, which is, nevertheless, not related with apomictic and reversion to the sexual process

  20. Local Actions of Melatonin in Somatic Cells of the Testis.

    Science.gov (United States)

    Frungieri, Mónica Beatriz; Calandra, Ricardo Saúl; Rossi, Soledad Paola

    2017-05-31

    The pineal hormone melatonin regulates testicular function through the hypothalamic-adenohypophyseal axis. In addition, direct actions of melatonin in somatic cells of the testis have been described. Melatonin acts as a local modulator of the endocrine activity in Leydig cells. In Sertoli cells, melatonin influences cellular growth, proliferation, energy metabolism and the oxidation state, and consequently may regulate spermatogenesis. These data pinpoint melatonin as a key player in the regulation of testicular physiology (i.e., steroidogenesis, spermatogenesis) mostly in seasonal breeders. In patients with idiopathic infertility, melatonin exerts anti-proliferative and anti-inflammatory effects on testicular macrophages, and provides protective effects against oxidative stress in testicular mast cells. Consequently, melatonin is also involved in the modulation of inflammatory and oxidant/anti-oxidant states in testicular pathology. Overall, the literature data indicate that melatonin has important effects on testicular function and male reproduction.

  1. Sex-reversed somatic cell cloning in the mouse.

    Science.gov (United States)

    Inoue, Kimiko; Ogonuki, Narumi; Mekada, Kazuyuki; Yoshiki, Atsushi; Sado, Takashi; Ogura, Atsuo

    2009-10-01

    Somatic cell nuclear transfer has many potential applications in the fields of basic and applied sciences. However, it has a disadvantage that can never be overcome technically-the inflexibility of the sex of the offspring. Here, we report an accidental birth of a female mouse following nuclear transfer using an immature Sertoli cell. We produced a batch of 27 clones in a nuclear transfer experiment using Sertoli cells collected from neonatal male mice. Among them, one pup was female. This "male-derived female" clone grew into a normal adult and produced offspring by natural mating with a littermate. Chromosomal analysis revealed that the female clone had a 39,X karyotype, indicating that the Y chromosome had been deleted in the donor cell or at some early step during nuclear transfer. This finding suggests the possibility of resuming sexual reproduction after a single male is cloned, which should be especially useful for reviving extinct or endangered species.

  2. Family intervention for children with functional somatic symptoms

    DEFF Research Database (Denmark)

    Hulgaard, Ditte Roth; Dehlholm-Lambertsen, Birgitte; Rask, Charlotte Ulrikka

    lidelser, Århus; Århus universitet Aim & Background: Functional somatic symptoms (FSS) can be defined as physical symptoms that cannot be fully explained by organic pathology. FSS are prevalent in children worldwide and in all medical settings, and when severe, pose a major burden on those with FSS...... and on society. In clinical practice and current research in child mental health, focus on family factors is increasing. The aim of this systematic review was to explore and describe the current family based approaches used for youngsters with FSS, and to evaluate the quality of the existing research...... quality scores on the POMRF. Many different outcome measures were employed, and the outcome measures chosen did not necessarily reflect what was targeted in the therapy. Focus on illness beliefs and shifting focus away from an organic explanation was agreed upon in all studies, with the alternative...

  3. Family therapy for children with functional somatic symptoms

    DEFF Research Database (Denmark)

    Hulgaard, Ditte Roth; Dehlholm-Lambertsen, Birgitte; Rask, Charlotte

    Introduction: Functional somatic symptoms (FSS) can be defined as physical symptoms that cannot be fully explained by organic pathology. FSS are prevalent in children worldwide and in all medical settings, and when severe, pose a major burden on those with FSS and on society. In clinical practice...... and current research in child mental health, focus on family factors is increasing. The aim of this systematic review was to explore and describe the current family based approaches used for youngsters with FSS, and to evaluate the quality of the existing research in this area. Method: The review...... on family based CBT. Conclusions and implications: The family’s illness explanations are an important target for intervention and coordination between paediatric and CAMHS is important, when treating youngsters with FSS. Clinical implications of the findings and recommendations for future research...

  4. The somatic genomic landscape of chromophobe renal cell carcinoma.

    Science.gov (United States)

    Davis, Caleb F; Ricketts, Christopher J; Wang, Min; Yang, Lixing; Cherniack, Andrew D; Shen, Hui; Buhay, Christian; Kang, Hyojin; Kim, Sang Cheol; Fahey, Catherine C; Hacker, Kathryn E; Bhanot, Gyan; Gordenin, Dmitry A; Chu, Andy; Gunaratne, Preethi H; Biehl, Michael; Seth, Sahil; Kaipparettu, Benny A; Bristow, Christopher A; Donehower, Lawrence A; Wallen, Eric M; Smith, Angela B; Tickoo, Satish K; Tamboli, Pheroze; Reuter, Victor; Schmidt, Laura S; Hsieh, James J; Choueiri, Toni K; Hakimi, A Ari; Chin, Lynda; Meyerson, Matthew; Kucherlapati, Raju; Park, Woong-Yang; Robertson, A Gordon; Laird, Peter W; Henske, Elizabeth P; Kwiatkowski, David J; Park, Peter J; Morgan, Margaret; Shuch, Brian; Muzny, Donna; Wheeler, David A; Linehan, W Marston; Gibbs, Richard A; Rathmell, W Kimryn; Creighton, Chad J

    2014-09-08

    We describe the landscape of somatic genomic alterations of 66 chromophobe renal cell carcinomas (ChRCCs) on the basis of multidimensional and comprehensive characterization, including mtDNA and whole-genome sequencing. The result is consistent that ChRCC originates from the distal nephron compared with other kidney cancers with more proximal origins. Combined mtDNA and gene expression analysis implicates changes in mitochondrial function as a component of the disease biology, while suggesting alternative roles for mtDNA mutations in cancers relying on oxidative phosphorylation. Genomic rearrangements lead to recurrent structural breakpoints within TERT promoter region, which correlates with highly elevated TERT expression and manifestation of kataegis, representing a mechanism of TERT upregulation in cancer distinct from previously observed amplifications and point mutations. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Anatomical Study of Somatic Embryogenesis in Glycine max (L. Merrill

    Directory of Open Access Journals (Sweden)

    Juliana Aparecida Fernando

    2002-09-01

    Full Text Available A comparative anatomical analysis of somatic embryogenesis in two soybean (Glycine max (L. Merrill genotypes was carried out. The somatic embryos were originated from cotyledonary explants obtained from immature zygotic embryos. The medium used for somatic embryogenesis induction was Murashige and Skoog, 1962, salts and Gamborg et al., 1968, vitamins (MSB supplemented with 0.8 mg.L-1 of 2,4-D for genotype PI 123439 and 40 mg.L-1 of 2,4-D for ‘Williams 82’. Globular structures, constituted by meristematic cells, originated from subepidermal cell divisions of the cotyledonary mesophyll. In PI 123439, the globular structures presented tracheary differentiation among meristematic cells and they could follow distinct morphogenetic process depending on their location along the explant. For ‘Williams 82’ it was observed globular structures along the cotyledonary explant surface. They gave rise to somatic embryos. These embryos showed different morphologies and they were classified based on their shape and number of cotyledons. The ability of these morphological types to convert to plantlets was discussed.Realizou-se uma análise anatômica comparativa da embriogênese somática em dois genótipos de soja (Glycine max (L. Merrill. Os embriões somáticos foram obtidos a partir de explantes cotiledonares excisados de embriões zigóticos imaturos do genótipo PI 123439, adaptado às condições tropicais, e ‘Williams 82’. O meio utilizado para indução da embriogênese somática constituiu-se de sais de Murashige e Skoog,1962, e vitaminas de Gamborg et al., 1968 (MSB suplementado com 0,8 mg.L-1 de 2,4-D (PI 123439 e 40 mg.L-1 (‘Williams 82’. Estruturas globulares originaram-se a partir de divisões celulares nas camadas subepidérmicas do mesofilo cotiledonar e foram constituídas por células meristemáticas. No genótipo PI 123439, as estruturas globulares apresentaram diferenciação traqueal entre as células meristemáticas e

  6. Ultraviolet irradiation disrupts somatic pili structure and function

    Energy Technology Data Exchange (ETDEWEB)

    Silverblatt, F.J.

    1979-09-01

    Three piliated bacterial species were exposed to ultraviolet light and the effect of increasing duration of irradiation on the integrity of the somatic pili was quantitated by negative-stain electron microscopy. Heavily piliated Proteus mirabilis became devoid of pili after 20 min of irradiation, but Escherichia coli and Neisseria gonorrhoeae required 40 min for complete depiliation. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated that new, small molecular weight fragments appeared after irradiation of purified E. coli pili, suggesting that cleavage of the peptide chain rather than dissociation of pilin monomers accounted for the loss of pili structure. These observations indicate that the ultrastructural integrity and function of pili can be disrupted by ultraviolet light.

  7. Neuroticism and maladaptive coping in patients with functional somatic syndromes

    DEFF Research Database (Denmark)

    Pedersen, Heidi Frølund; Frostholm, Lisbeth; Jensen, Jens Søndergaard

    2016-01-01

    Objectives. The cognitive-behavioural model of functional somatic syndromes (FSS) proposes a multifactorial aetiology consisting of predisposing, precipitating and perpetuating factors. In this study, we sought to investigate three questions that can be drawn from this model: (1) Do patients...... with FSS show high levels of neuroticism? (2) Does neuroticism affect physical health and social functioning, either directly or indirectly through maladaptive coping? (3) Does more adaptive coping mediate the effect of cognitive-behavioural therapy (CBT) on outcome? Design. Secondary analysis....... Reduction in symptom catastrophizing during group CBT partially mediated its long-term effect. Conclusions. The results give support to a generic cognitive-behavioural model of FSS. Targeting symptom catastrophizing may be an essential component in CBT for patients with FSS, regardless of their specific...

  8. Novel somatic and germline mutations in intracranial germ cell tumours.

    Science.gov (United States)

    Wang, Linghua; Yamaguchi, Shigeru; Burstein, Matthew D; Terashima, Keita; Chang, Kyle; Ng, Ho-Keung; Nakamura, Hideo; He, Zongxiao; Doddapaneni, Harshavardhan; Lewis, Lora; Wang, Mark; Suzuki, Tomonari; Nishikawa, Ryo; Natsume, Atsushi; Terasaka, Shunsuke; Dauser, Robert; Whitehead, William; Adekunle, Adesina; Sun, Jiayi; Qiao, Yi; Marth, Gábor; Muzny, Donna M; Gibbs, Richard A; Leal, Suzanne M; Wheeler, David A; Lau, Ching C

    2014-07-10

    Intracranial germ cell tumours (IGCTs) are a group of rare heterogeneous brain tumours that are clinically and histologically similar to the more common gonadal GCTs. IGCTs show great variation in their geographical and gender distribution, histological composition and treatment outcomes. The incidence of IGCTs is historically five- to eightfold greater in Japan and other East Asian countries than in Western countries, with peak incidence near the time of puberty. About half of the tumours are located in the pineal region. The male-to-female incidence ratio is approximately 3-4:1 overall, but is even higher for tumours located in the pineal region. Owing to the scarcity of tumour specimens available for research, little is currently known about this rare disease. Here we report the analysis of 62 cases by next-generation sequencing, single nucleotide polymorphism array and expression array. We find the KIT/RAS signalling pathway frequently mutated in more than 50% of IGCTs, including novel recurrent somatic mutations in KIT, its downstream mediators KRAS and NRAS, and its negative regulator CBL. Novel somatic alterations in the AKT/mTOR pathway included copy number gains of the AKT1 locus at 14q32.33 in 19% of patients, with corresponding upregulation of AKT1 expression. We identified loss-of-function mutations in BCORL1, a transcriptional co-repressor and tumour suppressor. We report significant enrichment of novel and rare germline variants in JMJD1C, which codes for a histone demethylase and is a coactivator of the androgen receptor, among Japanese IGCT patients. This study establishes a molecular foundation for understanding the biology of IGCTs and suggests potentially promising therapeutic strategies focusing on the inhibition of KIT/RAS activation and the AKT1/mTOR pathway.

  9. Novel somatic and germline mutations in intracranial germ cell tumors

    Science.gov (United States)

    Wang, Linghua; Yamaguchi, Shigeru; Burstein, Matthew D.; Terashima, Keita; Chang, Kyle; Ng, Ho-Keung; Nakamura, Hideo; He, Zongxiao; Doddapaneni, Harshavardhan; Lewis, Lora; Wang, Mark; Suzuki, Tomonari; Nishikawa, Ryo; Natsume, Atsushi; Terasaka, Shunsuke; Dauser, Robert; Whitehead, William; Adekunle, Adesina; Sun, Jiayi; Qiao, Yi; Marth, Gábor; Muzny, Donna M.; Gibbs, Richard A.; Leal, Suzanne M.; Wheeler, David A.; Lau, Ching C.

    2015-01-01

    Intracranial germ cell tumors (IGCTs) are a group of rare heterogeneous brain tumors which are clinically and histologically similar to the more common gonadal GCTs. IGCTs show great variation in their geographic and gender distribution, histological composition and treatment outcomes. The incidence of IGCTs is historically 5–8 fold greater in Japan and other East Asian countries than in Western countries1 with peak incidence near the time of puberty2. About half of the tumors are located in the pineal region. The male-to-female incidence ratio is approximately 3–4:1 overall but even higher for tumors located in the pineal region3. Due to the scarcity of tumor specimens available for research, little is currently known about this rare disease. Here we report the analysis of 62 cases by next generation sequencing, SNP array and expression array. We find the KIT/RAS signaling pathway frequently mutated in over 50% of IGCTs including novel recurrent somatic mutations in KIT, its downstream mediators KRAS and NRAS, and its negative regulator CBL. Novel somatic alterations in the AKT/mTOR pathway included copy number gain of the AKT1 locus at 14q32.33 in 19% of patients, with corresponding upregulation of AKT1 expression. We identified loss-of-function mutations in BCORL1, a transcriptional corepressor and tumor suppressor. We report significant enrichment of novel and rare germline variants in JMJD1C, a histone demethylase and coactivator of the androgen receptor, among Japanese IGCT patients. This study establishes a molecular foundation for understanding the biology of IGCTs and suggests potentially promising therapeutic strategies focusing on the inhibition of KIT/RAS activation and the AKT1/mTOR pathway. PMID:24896186

  10. Somatic Mutations and Clonal Hematopoiesis in Aplastic Anemia.

    Science.gov (United States)

    Yoshizato, Tetsuichi; Dumitriu, Bogdan; Hosokawa, Kohei; Makishima, Hideki; Yoshida, Kenichi; Townsley, Danielle; Sato-Otsubo, Aiko; Sato, Yusuke; Liu, Delong; Suzuki, Hiromichi; Wu, Colin O; Shiraishi, Yuichi; Clemente, Michael J; Kataoka, Keisuke; Shiozawa, Yusuke; Okuno, Yusuke; Chiba, Kenichi; Tanaka, Hiroko; Nagata, Yasunobu; Katagiri, Takamasa; Kon, Ayana; Sanada, Masashi; Scheinberg, Phillip; Miyano, Satoru; Maciejewski, Jaroslaw P; Nakao, Shinji; Young, Neal S; Ogawa, Seishi

    2015-07-02

    In patients with acquired aplastic anemia, destruction of hematopoietic cells by the immune system leads to pancytopenia. Patients have a response to immunosuppressive therapy, but myelodysplastic syndromes and acute myeloid leukemia develop in about 15% of the patients, usually many months to years after the diagnosis of aplastic anemia. We performed next-generation sequencing and array-based karyotyping using 668 blood samples obtained from 439 patients with aplastic anemia. We analyzed serial samples obtained from 82 patients. Somatic mutations in myeloid cancer candidate genes were present in one third of the patients, in a limited number of genes and at low initial variant allele frequency. Clonal hematopoiesis was detected in 47% of the patients, most frequently as acquired mutations. The prevalence of the mutations increased with age, and mutations had an age-related signature. DNMT3A-mutated and ASXL1-mutated clones tended to increase in size over time; the size of BCOR- and BCORL1-mutated and PIGA-mutated clones decreased or remained stable. Mutations in PIGA and BCOR and BCORL1 correlated with a better response to immunosuppressive therapy and longer and a higher rate of overall and progression-free survival; mutations in a subgroup of genes that included DNMT3A and ASXL1 were associated with worse outcomes. However, clonal dynamics were highly variable and might not necessarily have predicted the response to therapy and long-term survival among individual patients. Clonal hematopoiesis was prevalent in aplastic anemia. Some mutations were related to clinical outcomes. A highly biased set of mutations is evidence of Darwinian selection in the failed bone marrow environment. The pattern of somatic clones in individual patients over time was variable and frequently unpredictable. (Funded by Grant-in-Aid for Scientific Research and others.).

  11. Allocation of Nutrients to Somatic Tissues in Young Ovariectomized Grasshoppers

    Science.gov (United States)

    Judd, Evan T.; Hatle, John D.; Drewry, Michelle D.; Wessels, Frank J.; Hahn, Daniel A.

    2010-01-01

    The disposable soma hypothesis predicts that when reproduction is reduced, life span is increased because more nutrients are invested in the soma, increasing somatic repair. Rigorously testing the hypothesis requires tracking nutrients from ingestion to allocation to the soma or to reproduction. Fruit flies on life-extending dietary restriction increase allocation to the soma “relative” to reproduction, suggesting that allocation of nutrients can be associated with extension of life span. Here, we use stable isotopes to track ingested nutrients in ovariectomized grasshoppers during the first oviposition cycle. Previous work has shown that ovariectomy extends life span, but investment of protein in reproduction is not reduced until after the first clutch of eggs is laid. Because ovariectomy does not affect investment in reproduction at this age, the disposable soma hypothesis would predict that ovariectomy should also not affect investment in somatic tissues. We developed grasshopper diets with distinct signatures of 13C and 15N, but that produced equivalent reproductive outputs. These diets are, therefore, appropriate for the reciprocal switches in diet needed for tracking ingested nutrients. Incorporation of stable isotopes into eggs showed that grasshoppers are income breeders, especially for carbon. Allocation to the fat body of nitrogen ingested as adults was slightly increased by ovariectomy; this was our only result that was not consistent with the disposable soma hypothesis. In contrast, ovariectomy did not affect allocation of nitrogen to femoral muscles. Further, allocation of carbon to the fat body or femoral muscles did not appear to be affected by ovariectomy. Total anti-oxidant activities in the hemolymph and femoral muscles were not affected by ovariectomy. These experiments showed that allocation of nutrients was altered little by ovariectomy in young grasshoppers. Additional studies on older individuals are needed to further test the disposable

  12. Somatic cell genotoxicity at the glycophorin A locus in humans

    International Nuclear Information System (INIS)

    Jensen, R.H.; Grant, S.G.; Langlois, R.G.; Bigbee, W.L.

    1990-01-01

    We have developed an assay for detecting variant erythrocytes that occur as a result of in vivo allele loss at the glycophorin A (GPA) locus on chromosome 4 in humans. This gene codes for an erythroid- specific cell surface glycoprotein, and with our assay we are able to detect rare variant erythrocytes that have lost expression of one of the two GPA alleles. Two distinctly different variant cell types are detected with this assay. One variant cell type (called N OE) is hemizygous. Our assay also detects homozygous variant erythrocytes that have lost expression of the GPA(M) allele and express the GPA(N) allele at twice the heterozygous level. The results of this assay are an enumeration of the frequency of N OE and NN variant cell types for each individual analyzed. These variant cell frequencies provide a measure of the amount of somatic cell genotoxicity that has occurred at the GPA locus. Such genotoxicity could be the result of (1) reactions of toxic chemicals to which the individual has been exposed, or (2) high energy radiation effects on erythroid precursor cells, or (3) errors in DNA replication or repair in these cells of the bone marrow. Thus, the GPA-based variant cell frequency can serve as a biodosimeter that indicates the amount of genotoxic exposure each individual has received. Because two very different kinds of variant cells are enumerated, different kinds of genotoxicity should be distinguishable. Results of the GPA somatic genotoxicity assay may also provide valuable information for cancer-risk estimation on each individual. 16 refs

  13. Somatic hybrid plants between Lycopersicon esculentum and Solanum lycopersicoides.

    Science.gov (United States)

    Handley, L W; Nickels, R L; Cameron, M W; Moore, P P; Sink, K C

    1986-02-01

    Leaf mesophyll protoplasts of Lycopersicon esculentum (2n=2x=24) were fused with suspension culture-derived protoplasts of Solanum lycopersicoides (2n=2x=24) and intergeneric somatic hybrid plants were regenerated following selective conditions. A two phase selection system was based on the inability of S. lycopersicoides protoplasts to divide in culture in modified medium 8E and the partial inhibition of L. esculentum protoplasts by the PEG/DMSO fusion solution. At the p-calli stage, putative hybrids were visually selected based on their hybrid vigor and lime-green coloration in contrast to slower growing parental calli characterized by a watery, whitish-brown coloration. Early identification of the eight hybrid plants studied was facilitated by isozyme analysis of leaf tissue samples taken from plants in vitro at the rooting stage. Regenerated plants growing in planting medium were further verified for hybridity by 5 isozymes marking 7 loci on 5 chromosomes in tomato. These included Skdh-1 mapped to chromosome 1 of tomato, Pgm-2 on chromosome 4, Got-2 and Got-3 on chromosome 7, Got-4 on chromosome 8, and Pgi-1 and Pgdh-2 both on chromosome 12. Fraction I protein small subunits further confirmed the hybrid nature of the plants with bands of both parents expressed in all hybrids. The parental chloroplasts could not be differentiated by the isoelectric points of the large subunit. Seven of the eight somatic hybrids had a chromosome number ranging from the expected 2n=4x=48 to 2n=68. Mixoploid root-tip cells containing 48, 53, 54 or 55 chromosomes for two of the hybrids were also observed.

  14. Operationalization of diagnostic criteria of DSM-5 somatic symptom disorders.

    Science.gov (United States)

    Xiong, Nana; Zhang, Yaoyin; Wei, Jing; Leonhart, Rainer; Fritzsche, Kurt; Mewes, Ricarda; Hong, Xia; Cao, Jinya; Li, Tao; Jiang, Jing; Zhao, Xudong; Zhang, Lan; Schaefert, Rainer

    2017-11-07

    The aim of this study was to test the operationalization of DSM-5 somatic symptom disorder (SSD) psychological criteria among Chinese general hospital outpatients. This multicenter, cross-sectional study enrolled 491 patients from 10 general hospital outpatient departments. The structured clinical "interview about cognitive, affective, and behavioral features associated with somatic complaints" was used to operationalize the SSD criteria B. For comparison, DSM-IV somatoform disorders were assessed with the Mini International Neuropsychiatric Interview plus. Cohen's к scores were given to illustrate the agreement of the diagnoses. A three-structure model of the interview, within which items were classified as respectively assessing the cognitive (B1), affective (B2), and behavioral (B3) features, was examined. According to percentages of screening-positive persons and the receiver operator characteristic (ROC) analysis, a cut-off point of 2 was recommended for each subscale of the interview. With the operationalization, the frequency of DSM-5 SSD was estimated as 36.5% in our sample, and that of DSM-IV somatoform disorders was 8.2%. The agreement between them was small (Cohen's к = 0.152). Comparisons of sociodemographic features of SSD patients with different severity levels (mild, moderate, severe) showed that mild SSD patients were better-off in terms of financial and employment status, and that the severity subtypes were congruent with the level of depression, anxiety, quality of life impairment, and the frequency of doctor visits. The operationalization of the diagnosis and severity specifications of SSD was valid, but the diagnostic agreement between DSM-5 SSD and DSM-IV somatoform disorders was small. The interpretation the SSD criteria should be made cautiously, so that the diagnosis would not became over-inclusive.

  15. Genetic and somatic effects in animals maintained on tritiated water

    International Nuclear Information System (INIS)

    Carsten, A.L.; Commerford, S.L.; Cronkite, E.P.; Brooks, A.

    1982-01-01

    Somatic and genetic effects of the continuous ingestion of tritiated water (HTO) at concentrations of 0.3, 1.0 and 3.0 μCi/ml were investigated in mice of the Hale-Stoner-Brookhaven strain. At these levels, there was no measurable somatic effect. Although genetic effects as measured by dominant lethal mutation (DLM) assay indicated a significant effect (P>0.01) on the number of viable embryos and early deaths in the 3.0 μCi/ml HTO group and on the number of viable embryos in the 1.0 μCi/ml HTO group, no genetic effects were significantly noted in the 0.3 μCi/ml HTO group. Liver cytogenetic studies showed a significant increase in the number of abnormal cells in the 3.0 μCi/ml HTO group. A reduction in bone marrow stem cells, without an attendant reduction in total marrow cellularity, was noted in the 3.0 and 1.0 μCi/ml HTO groups. There was no significant difference in any of the DLM parameters between animals maintained on 3.0 μCi/ml of HTO and animals exposed to the equivalent 137 Cs gamma dose (22 hours/day exposure). Consideration of the relative amounts and biological half lives of tritium present in the nucleus as water, DNA and histone suggests that after transient exposure to tritiated water, nearly all significant radiation damage can be attributed to tritium present in the nucleus as water. These data suggest that hazards from tritium attendant with normal reactor operation should not at this time be considered as a deterrent to the further development of fission and/or fusion reactor technology. (Namekawa, K.)

  16. Programa 5S's adaptado ao gerenciamento da alimentação escolar no contexto da descentralização The 5S's program adapted to school meals in the context of decentralization

    Directory of Open Access Journals (Sweden)

    Ana Iris Mendes Coelho

    1999-12-01

    Full Text Available O processo de descentralização da alimentação escolar desencadeou um aumento da demanda por assessoria técnica, principalmente no que se refere ao seu planejamento e execução. Este trabalho relata a experiência da utilização do programa 5S's no município de Viçosa, MG, durante o período de fevereiro de 1995 a dezembro de 1997, para auxiliar no gerenciamento da alimentação escolar, atuando em pontos críticos detectados nos estabelecimentos de ensino, bem como apresenta a adaptação do Programa idealizada para este fim. Os resultados evidenciaram que a metodologia utilizada foi eficaz neste processo.The school meals decentralization has broken out an increasing demand for technical assistance, particularly because of the faults in its planning and execution. The present paper gives an account of the experience from 5S's Program used in the city of Viçosa, MG during the period of 1995 February until 1997 December, acting in critical points to help with school meals management, as well as to present the Program adaptation idealized for this purpose. The results showed that the methodology used in this process was effective for this case.

  17. File list: InP.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Gon.10.AllAg.Testicular_somatic_cells mm9 Input control Gonad Testicular somati...c cells SRX591728,SRX591716 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Gon.10.AllAg.Testicular_somatic_cells.bed ...

  18. File list: InP.Gon.20.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Gon.20.AllAg.Testicular_somatic_cells mm9 Input control Gonad Testicular somatic... cells SRX591728,SRX591716 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Gon.20.AllAg.Testicular_somatic_cells.bed ...

  19. File list: InP.Gon.50.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Gon.50.AllAg.Testicular_somatic_cells mm9 Input control Gonad Testicular somatic... cells SRX591728,SRX591716 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Gon.50.AllAg.Testicular_somatic_cells.bed ...

  20. File list: NoD.Gon.10.AllAg.Testicular_somatic_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Gon.10.AllAg.Testicular_somatic_cells mm9 No description Gonad Testicular somatic... cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Gon.10.AllAg.Testicular_somatic_cells.bed ...