Sample records for solanum fastigiatum solanaceae
-
Energy Technology Data Exchange (ETDEWEB)
Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales, E-mail: noronha@ufpr.br [Departamento de Quimica, Universidade Federal do Parana, Centro Politecnico, Curitiba, PR (Brazil); Costa, Emmanoel V. [Departamento de Quimica, Universidade Federal de Sergipe, Sao Cristovao, SE (Brazil); Mikich, Sandra Bos [Laboratorio de Ecologia, Embrapa Florestas, Colombo, PR (Brazil); Braga, Raquel M. [Instituto de Quimica, Universidade Estadual de Campinas, SP (Brazil); Delarmelina, Camila; Duarte, Marta C.T. [Divisao de Microbiologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil); Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de [Divisa de Farmacologia e Toxicologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil)
2012-07-01
Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5{alpha}-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)
-
International Nuclear Information System (INIS)
Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales; Costa, Emmanoel V.; Mikich, Sandra Bos; Braga, Raquel M.; Delarmelina, Camila; Duarte, Marta C.T.; Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de
2012-01-01
Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5α-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)
-
International Nuclear Information System (INIS)
Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S.
2011-01-01
Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, 1 H and 13 C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)
-
Estudo Farmacognóstico e Screening Biológico de Solanum lycocarpum St. Hill (Solanaceae)
Martins, Gilmarcio Zimmermann [UNESP
2013-01-01
Devido ao negligenciamento e ao aumento de números de casos das doenças microbianas e parasitárias no Brasil, o aprimoramento da investigação científica e tecnológica na área de plantas medicinais faz-se indispensável para à busca de novos produtos antimicrobianos e antiparasitários. A Solanum lycocarpum St. Hill. (Solanaceae) é uma planta medicinal tradicionalmente utilizada na forma de polvilho de lobeira como terapia complementar para o tratamento do Diabetes Mellitus, hipocolesterolêmico ...
-
Seguí-Simarro, Jose M
2016-01-01
The Solanaceae is one of the most important families for global agriculture. Among the different solanaceous species, tobacco (Nicotiana tabacum), potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum) are five crops of outstanding importance worldwide. In these crops, maximum yields are produced by hybrid plants created by crossing pure (homozygous) lines with the desired traits. Pure lines may be produced by conventional breeding methods, which is time consuming and costly. Alternatively, it is possible to accelerate the production of pure lines by creating doubled haploid (DH) plants derived from (haploid) male gametophytes or their precursors (androgenesis). In this way, the different steps for the production of pure lines can be reduced to only one generation, which implies important time and cost savings. This and other advantages make androgenic DHs the choice in a number of important crops where any of the different experimental in vitro techniques (anther culture or isolated microspore culture) is well set up. The Solanaceae family is an excellent example of heterogeneity in terms of response to these techniques, including highly responding species such as tobacco, considered a model system, and tomato, one of the most recalcitrant species, where no reliable and reproducible methods are yet available. Interestingly, the first evidence of androgenesis, particularly through in vitro anther culture, was demonstrated in a solanaceous species, Datura innoxia. In this chapter, we report the state of the art of the research about androgenic DHs in Solanaceae, paying special attention to datura, tobacco, potato, tomato, eggplant, and pepper.
-
Differential strengths of selection on S-RNases from Physalis and Solanum (Solanaceae
Directory of Open Access Journals (Sweden)
Kohn Joshua R
2011-08-01
Full Text Available Abstract Background The S-RNases of the Solanaceae are highly polymorphic self-incompatibility (S- alleles subject to strong balancing selection. Relatively recent diversification of S-alleles has occurred in the genus Physalis following a historical restriction of S-allele diversity. In contrast, the genus Solanum did not undergo a restriction of S-locus diversity and its S-alleles are generally much older. Because recovery from reduced S-locus diversity should involve increased selection, we employ a statistical framework to ask whether S-locus selection intensities are higher in Physalis than Solanum. Because different S-RNase lineages diversify in Physalis and Solanum, we also ask whether different sites are under selection in different lineages. Results Maximum-likelihood and Bayesian coalescent methods found higher intensities of selection and more sites under significant positive selection in the 48 Physalis S-RNase alleles than the 49 from Solanum. Highest posterior densities of dN/dS (ω estimates show that the strength of selection is greater for Physalis at 36 codons. A nested maximum likelihood method was more conservative, but still found 16 sites with greater selection in Physalis. Neither method found any codons under significantly greater selection in Solanum. A random effects likelihood method that examines data from both taxa jointly confirmed higher selection intensities in Physalis, but did not find different proportions of sites under selection in the two datasets. The greatest differences in strengths of selection were found in the most variable regions of the S-RNases, as expected if these regions encode self-recognition specificities. Clade-specific likelihood models indicated some codons were under greater selection in background Solanum lineages than in specific lineages of Physalis implying that selection on sites may differ among lineages. Conclusions Likelihood and Bayesian methods provide a statistical approach to
-
Silva,Alexandre Coletto da; Kinupp,Valdely Ferreira; Absy,Maria Lucia; Kerr,Warwick Estevam
2004-01-01
The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The poll...
-
Energy Technology Data Exchange (ETDEWEB)
Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo, E-mail: opessoa@ufc.b [Universidade Federal do Ceara (DQOI/UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S. [Universidade de Brasilia (FCS/UnB), DF (Brazil). Fac. de Ciencias da Saude
2011-07-01
Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, {sup 1}H and {sup 13}C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)
-
The effect of Ageratum fastigiatum extract on Rhodnius nasutus, vector of Chagas disease
Directory of Open Access Journals (Sweden)
Bethânia A. Avelar-Freitas
2013-04-01
Full Text Available Control of Chagas disease is based on insecticide spraying in domiciles in order to exterminate triatomine populations. However, since the vectors differ in susceptibility to currently used insecticides, the screening of the toxic potential of Brazilian flora may identify new molecules lethal to triatomines. This study evaluated the toxicity of ethanolic extract of Ageratum fastigiatum (Gardner R.M. King & H. Rob., Asteraceae, on Rhodnius nasutus, a known vector of Chagas disease. Ethanolic extracts of the aerial parts of A. fastigiatum were prepared at 25 and 50 mg/mL concentrations, and 5 µL was applied to fifth-instar nymphs of R. nasutus (n=30. Controls included nymphs that were treated with 5 µL ethanol (n=30 or left untreated (n=30. The percentage of dead insects in each group was observed at 24, 48, 72, 96 and 120 h after application. The extracts of A. fastigiatum showed a mortality rate of about 37% and 77% after 120 h, at concentrations of 25 and 50 mg/mL, respectively. In control groups, the mortality rate remained under 7%. The extract of A. fastigiatum contains a coumarin, a molecule with recognized toxicity in insects, and which may be responsible for killing the triatomines.
-
Directory of Open Access Journals (Sweden)
Alexandre Coletto da Silva
2004-09-01
Full Text Available The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The pollen of S. stramoniifolium is tricolporate and psilate or without ornamentation. In a word, S. stramoniifolium constitutes a potential source of pollen for different species of bees with and without sting, providing an interesting field for germination studies, insect-plant interactions and floral biology that are already under way.A família Solanaceae tem ampla distribuição, principalmente nas áreas tropicais e subtropicais da América do Sul. Solanum L. é um dos mais importantes gêneros desta família com aproximadamente 1.200 espécies. O objetivo deste trabalho foi o de estudar a biologia floral com enfoque na morfologia polínica e no registro de algumas abelhas visitantes de S. stramoniifolium. Dados preliminares indicam a presença de uma espécie de abelha com ferrão e quatro espécies sem ferrão como visitantes de S. stramoniifolium. O pólen de S. stramoniifolium é tricolporado e psilado, ou seja, sem ornamentação. Conclui-se, após o estudo da biologia floral, que S. stramoniifolium constitui fonte potencial de pólen para diferentes espécies de abelhas com e sem ferrão, representando interessante campo para estudos de germinação, interações inseto-planta e biologia floral.
-
Dos Santos, Fabio Eduardo; Carvalho, Marcos Schleiden Sousa; Silveira, Graciele Lurdes; Correa, Felipe Folgaroli; Cardoso, Maria das Graças; Andrade-Vieira, Larissa Fonseca; Vilela, Luciane Resende
2018-03-05
Plants are rich in biologically active compounds. They can be explored for the production of bioherbicides. In this context, the present work aimed to evaluate the allelopathic effect of hydroalcoholic extracts from two Solanaceae species: Solanum muricatum Ait. and Solanum betaceum Cav. For this end, we conducted phytochemical screening and biological assays, determining the effects of the extracts on germination, early development, cell cycle, and DNA fragmentation in plantlets and meristematic cells of the plant model Lactuca sativa L. (lettuce). The percentage of seeds germinated under effect of S. muricatum extract did not differ from the control, but plantlet growth was reduced at the highest concentrations. For S. betaceum extract, dose dependence was observed for both germination and plantlet development, with the highest concentrations inhibiting germination. The growth curves revealed the concentrations of 2.06 and 1.93 g/L for S. muricatum and S. betaceum extracts, respectively, as those reducing 50% of root growth (RG). At these concentrations, both extracts presented mitodepressive effect, besides inducing significant increase in the frequency of condensed nuclei, associated to DNA fragmentation and cytoplasmic shrinkage. The frequency of chromosome alterations was not significant. We further discuss the mechanisms of action related to the chemical composition of the extracts, which presented organic acids, reducing sugars, proteins, amino acids, and tannins, besides catechins and flavonoids, only found in the extract of S. betaceum.
-
Palumbo, Matthew D.; Fleming, Jonathan P.; Monsegur, Omar A.; Vilella, Francisco
2016-01-01
Solanum conocarpum (Solanaceae) (Marron Bacora) is a rare, dry-forest shrub endemic to the island of St. John, US Virgin Islands, considered for listing under the Endangered Species Act. Given its status as a species of conservation concern, we incorporated environmental characteristics of 3 observed populations and 5 additional known locations into a geographic information system (GIS) analysis to create a habitat-suitability model for the species on the island of St. John. Our model identified 1929.87 ha of highly suitable and moderately suitable habitat. Of these, 1161.20 ha (60.2%) occurred within the boundaries of Virgin Islands National Park. Our model provides spatial information on potential locations for future surveys and restoration sites for this endemic species of the US Virgin Islands.
-
Caracterização morfoanatômica de Ageratum fastigiatum (Asteraceae
Directory of Open Access Journals (Sweden)
Glauciemar Del-Vechio-Vieira
Full Text Available Ageratum fastigiatum (Gardn. R. M. King et H. Rob. (Asteraceae, conhecido como "matapasto", é uma planta usada na medicina popular como cicatrizante e antimicrobiano. O objetivo deste trabalho foi realizar caracterização morfoanatômica da folha, dos ramos e da raiz de A. fastigiatum. Secções transversais e paradérmicas, coradas com safranina/azul de astra e azul de toluidina foram analisadas ao microscópio. As folhas são alternas ou fasciculadas; a inflorescência é constituída de capítulos; as flores com corola lilás; ausência de pápus. A raiz apresenta crescimento secundário na zona de ramificação com estruturas secretoras. O caule possui epiderme uniestratificada, estômatos, tricomas tectores simples e tricomas glandulares capitados. O pecíolo exibe contorno côncavo-convexo e a epiderme é unisseriada. A lâmina foliar é anfiestomática e o mesófilo dorsiventral. A epiderme possui células de contorno sinuoso e os estômatos são do tipo anomocítico. Os caracteres morfoanatômicos permitiram estabelecer parâmetros para identificação do A. fastigiatum.
-
Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves
2008-03-26
The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.
-
Embryology of Ageratum conyzoides L. and A. fastigiatum R.M. King & H. Rob. (Asteraceae
Directory of Open Access Journals (Sweden)
Rafael de Oliveira Franca
2015-03-01
Full Text Available Ageratum has a complex circumscription, and recent studies have indicated its polyphyletism. The genus has been placed in the tribe Eupatorieae whose embryology is not fully known. Embryological data are conservative and important indicators of phylogenetic relationships and can improve family relationships. This study presents, for the first time in Eupatorieae, embryological data for Ageratum conyzoides and A. fastigiatum. Both species have common features of the family such as a unitegmic anatropous ovule, basal placentation, secretory tapetum, Polygonum megagametophyte, and Asterad embryogenesis. The data obtained reinforce the heterogeneity of the family embryology and show, for the first time, the anther wall development of the monocotyledonous type for Asteraceae. The species studied show also differences between themselves. A. conyzoides has bisporangiated and introrse anthers, conspicuous pappus, and cypselae with trichomes on the ribs, whereas A. fastigiatum has tetrasporangiate and latrorse anthers, pappus absent at maturity, and glabrous cypselae. The data presented support recent phylogenetic molecular studies, suggesting the replacement of A. fastigiatum to another genus along with Gyptidinae.
-
Directory of Open Access Journals (Sweden)
Knapp, Sandra
2008-06-01
Full Text Available Lectotypes, neotypes or epitypes are confirmed or designated here for 16 of the 22 names coined by Martín Sessé y Lacasta and José Mariano Mociño that were described as members of the large genus Solanum (Solanaceae: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (both homonyms, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense and S. uniflorum. A brief introduction assesses the importance of the Sessé & Mociño expedition (the Real Expedición Botánica a Nueva España to the botany of their time, and identifies difficulties in identifying and neotypifying or lectotypifying names coined by them. More than half of the names coined by Sessé and Mociño have no material associated with them. The currently accepted name for each taxon is given, and taxa of uncertain status are indicated. Each typification is accompanied by a discussion of the reasoning behind the choice of specimen, and all newly designated types are illustrated.Se confirman o designan los lectótipos, neótipos o epítipos de 16 de los 22 nombres acuñados por Martín de Sessé y Lacasta y José Mariano Mociño que o bien fueron descritos dentro del género Solanum (Solanaceae o son actualmente reconocidos como parte del mismo: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (ambos homónimos, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense y S. uniflorum. Se incluye una breve introducción explicando la importancia de la Real Expedición Botánica a Nueva España (expedición de Sessé y Mociño para la botánica de su tiempo, así como las dificultades que entraña neotipificar o lectotipificar los nombres acuñados por éllos. Se incluye el nombre aceptado para cada taxon cuando es posible y cada tipificación se acompaña de una discusión explicando
-
Directory of Open Access Journals (Sweden)
Wagner de Souza Tavares
2014-03-01
Full Text Available The Zona da Mata region is located in southeastern Minas Gerais State, Brazil with fauna and flora diversified, including herbivorous insects and Solanaceae plants. Ithomiinae caterpillars were observed damaging tree of Solanum granuloso-leprosum Dunal (Solanaceae, used for different purposes and abundant in secondary forest. The objective of this study was to identify defoliating caterpillars of S. granuloso-leprosum at the campus of Universidade Federal de Viçosa (UFV in Viçosa, Minas Gerais State, Brazil and review host plants of Mechanitis polymnia L., 1758 (Lepidoptera: Nymphalidae. Thirteen caterpillars found damaging a tree of S. granuloso-leprosum at the campus of UFV were collected and maintained in the Laboratório de Controle Biológico de Insetos (LCBI from UFV until adult emergence. These caterpillars were of two species, being ten of the first and three of the second species. Adult specimens of the latter species were identified as Ithomia lichyi lichyi D'Almeida, 1939 (Lepidoptera: Nymphalidae in the Departamento de Zoologia of Universidade Federal do Paraná (UFPR in Curitiba, Paraná State, Brazil and of the group of ten caterpillars as Mechanitis polymnia casabranca Haensch, 1905 (Lepidoptera: Nymphalidae in the Museu de Zoologia of Universidade de São Paulo (USP in São Paulo State, Brazil. This is the first report of M. polymnia casabranca and I. lichyi lichyi together damaging plant of S. granuloso-leprosum in the Zona da Mata region of Minas Gerais State, Brazil and 57 plants are recorded as host of M. polymnia.
-
A new commelinid monocot seed fossil from the early Eocene previously identified as Solanaceae.
Särkinen, Tiina; Kottner, Sören; Stuppy, Wolfgang; Ahmed, Farah; Knapp, Sandra
2018-01-01
Fossils provide minimum age estimates for extant lineages. Here we critically evaluate Cantisolanum daturoides Reid & Chandler and two other early putative seed fossils of Solanaceae, an economically important plant family in the Asteridae. Three earliest seed fossil taxa of Solanaceae from the London Clay Formation (Cantisolanum daturoides) and the Poole and Branksome Sand Formations (Solanum arnense Chandler and Solanispermum reniforme Chandler) were studied using x-ray microcomputed tomography (MCT) and scanning electron microscopy (SEM). The MCT scans of Cantisolanum daturoides revealed a high level of pyrite preservation at the cellular level. Cantisolanum daturoides can be clearly excluded from Solanaceae and has more affinities to the commelinid monocots based on a straight longitudinal axis, a prominent single layer of relatively thin-walled cells in the testa, and a clearly differentiated micropyle surrounded by radially elongated and inwardly curved testal cells. While the MCT scans show no internal preservation in Solanum arnense and Solanispermum reniforme, SEM images show the presence of several characteristics that allow the placement of these taxa at the stem node of Solanaceae. Cantisolanum daturoides is likely a member of commelinid monocots and not Solanaceae as previously suggested. The earliest fossil record of Solanaceae is revised to consist of fruit fossil with inflated calyces from the early Eocene of Patagonia (52 Ma) and fossilized seeds from the early to mid-Eocene of Europe (48-46 Ma). The new identity for Cantisolanum daturoides does not alter a late Cretaceous minimum age for commelinids. © 2018 Botanical Society of America.
-
Flowerlocation in Solanum dulcamara L. (Solanaceae
Directory of Open Access Journals (Sweden)
Irina Zhuravlyeva
2013-01-01
Full Text Available The morphology of inflorescence of Solanum dulcamara is studied. Pseudolateral location of inflorescence relatively to plant body is set, the absence of bracteae and the sympodial type of growing of branches are found out. From W. Troll point of view the inflorescence of nightshade is defined as the polytelica synflorescence – complex dichasium.
-
Mechanism and control of Solanum lycocarpum
Pinto, L.V.A.; Silva, Da E.A.A.; Davide, A.C.; Mendes de Jesus, V.A.; Toorop, P.E.; Hilhorst, H.W.M.
2007-01-01
Background Solanaceae seed morphology and physiology have been widely studied but mainly in domesticated crops. The present study aimed to compare the seed morphology and the physiology of germination of Solanum lycocarpum, an important species native to the Brazilian Cerrado, with two species with
-
Directory of Open Access Journals (Sweden)
Nathalia Diniz Araújo
2010-11-01
Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.In this work, a pharmacobotanical study of Solanum crinitum Lam., S. gomphodes Dunal and S. lycocarpum A. St-Hil., all belonging to the Solanum sect. Crinitum Child. has been realized with the objective of providing a macroscopical and microscopical morphodiagnosis for their characterizations. The three species are commonly named "jurubeba", "fruta-de-lobo" and "lobeira", and they are used in the folk medicine for the treatment of diabetes and others diseases. The three species studied share various morphological characters, like shrub and tree forms, the velutinous abaxial indument, the presence of bristles, the flower with stellate-pentagonal corollas ranging from violet to purple, and the fruit reaching up to 5 cm in diameter. The principal parameters to distinct the three species studied were the morphology of petiole and base of the blade leaf, the indument of adaxial surface, the anatomy of mesophyll, the types of stomata and the leaf margin.
-
Potato (Solanum tuberosum L.).
Chetty, Venkateswari J; Narváez-Vásquez, Javier; Orozco-Cárdenas, Martha L
2015-01-01
Agrobacterium-mediated transformation is the most common method for the incorporation of foreign genes into the genome of potato as well as many other species in the Solanaceae family. This chapter describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp. tuberosum (Desiréé), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena using internodal segments as explants.
-
Two new South American species of Solanum section Crinitum (Solanaceae
Directory of Open Access Journals (Sweden)
Frank Farruggia
2010-11-01
Full Text Available Two new species of Solanum section Crinitum are described here. Solanum falciforme Farruggia, sp. nov., closely resembles S. crinitum and S. lycocarpum, but differs by the presence of falcate trichomes on the young growth. It is endemic to the cerrado and adjacent woodlands of Distrito Federal, Bahia, Goiás and Minas Gerais, Brazil. The other species, Solanum pseudosycophanta Farruggia, sp.nov., has close affinities to S. sycophanta but differs from the latter inprominent long-stalked stellate hairs along the stem, calyx, petiole and the adaxial surface of the leaf, in contrast to S. sycophanta which is glabrous or pubescent with sessile to short-stalked multangulate hairs. This species is narrowly distributed in tropical montane forests of northern Peru and southern Ecuador.
-
Knapp, Sandra; Vorontsova, Maria S
2013-01-01
A Solanum species long considered an American introduction to the Cape Verde Islands off the west coast of Africa is identified as Solanum rigidum, a member of the Eggplant clade of Old World spiny solanums (Solanum subgenus Leptostemonum) and is probably endemic to the Cape Verde Islands. Collections of this species from the Caribbean are likely to have been introduced from the Cape Verde Islands on slave ships. We discuss the complex nomenclatural history of this plant and provide a detailed description, illustration and distribution map. The preliminary conservation status of Solanum rigidum is Least Concern, but needs to be reassessed in light of its endemic rather than introduced status.
-
Annotated checklist of Solanum L. (Solanaceae for Peru
Directory of Open Access Journals (Sweden)
Tiina Särkinen
2015-04-01
Full Text Available The genus Solanum is among the most species-rich genera both of the Peruvian flora and of the tropical Andes in general. The present revised checklist treats 276 species of Solanum L., of which 253 are native, while 23 are introduced and/or cultivated. A total of 74 Solanum species (29% of native species are endemic to Peru. Additional 58 species occur only in small number of populations outside Peru, and these species are here labelled as near-endemics to highlight the role Peru playes in their future protection. Species diversity is observed to peak between 2500 – 3000 m elevation, but endemic species diversity is highest between 3000 – 3500 m elevation. Cajamarca has the highest number of endemic (29 spp. and total species (130 spp., even when considering the effect of area. Centers of endemic species diversity are observed in provinces of Cajamarca (Cajamarca, Huaraz and Carhuaz (Ancash, and Canta and Huarochirí (Lima. Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca, Santiago de Chuco (La Libertad, Oxapampa (Pasco, and Cusco (Cusco. Current diversity patterns are highly correlated with collection densities, and further collecting is needed across all areas, especially from Arequipa, Ayacucho, Puno, Ancash, Huánuco, Amazonas and Cajamarca, where high levels of species diversity and endemism are indicated but only a few collections of many species are known.
-
UNA NUEVA ESPECIE DE SOLANUM SECCIÓN GEMINATA (SOLANACEAE DE COLOMBIA
Directory of Open Access Journals (Sweden)
GRANADOS-TOCHOY JUAN CARLOS
2006-06-01
Full Text Available Se describe Solanum sagittantherum Granados-Tochoy & C.I. Orozco, una nuevaespecie de Solanum sección Geminata encontrada en la Cordillera Oriental de losAndes de Colombia. Se presenta información sobre su distribución, hábitat y taxonomía.
-
Directory of Open Access Journals (Sweden)
Deise Mari Barboza
2009-04-01
Full Text Available Solanum mauritianum Scopoli (Solanaceae, a native Brazilian shrub, has become naturalized and invasive in several countries. In South Africa, where invasions are severe, herbivorous insects that attack S. mauritianum in its native area have been considered for introduction as biological control agents. To assess the action of such herbivores on the plant, studies were carried out on a population of S. mauritianum in an area undergoing regeneration in southern Brazil. An analysis of the structure of that population was performed, as well as of herbivory by insects, in particular of Anthonomus (Curculionidae. The population structure showed an "inverted J" pattern in diameter classes, but not in height classes. Individual plants showed an aggregate distribution. The damage caused by Anthonomus did not amount to the loss of a large leaf area, but since it was inflicted on young leaves and in a large proportion, could lead to the survival decrease.Solanum mauritianum Scopoli (Solanaceae, um arbusto endêmico do sul do Brasil, naturalizou-se e tornou-se invasor em vários países do mundo. Na África do Sul, onde as invasões são severas, insetos fitófagos associados à planta no país de origem têm sido considerados para introdução como agentes de controle biológico. Para avaliar a ação de tais insetos no ambiente natural, foram conduzidos estudos em uma população de S. mauritianum em uma área em regeneração no sul do Brasil. Foi realizada análise da estrutura populacional, bem como da herbivoria causada por insetos, em particular para uma espécie do gênero Anthonomus (Curculionidae, para subsidiar o trabalho sobre controle biológico. A estrutura da população mostrou um padrão "J invertido" nas classes de diâmetro, mas não nas classes de altura; a distribuição espacial dos indivíduos era agregada. O dano causado por Anthonomus sp. não refletiu na perda real de grande área foliar. No entanto, uma vez que foi detectada uma
-
Contribution for the phytochemical studies of Ageratum fastigiatum
Directory of Open Access Journals (Sweden)
Lucas D. Gonçalves
2011-08-01
Full Text Available Organic extracts from leaves plus branches plus inflorescences of Ageratum fastigiatum (Gardner R. M. King & H. Rob., Asteraceae, were fractionated through classic chromatography. The steroids stigmasterol, chondrillasterol and campesterol were isolated from hexane extract. The triterpenes lupeol, taraxasterol, α-amyrin, β-amyrin, pseudotaraxasterol, lupeol acetate and α-amyrin acetate were isolated from ethyl acetate extract. Steroids and triterpenes were identified by GC-MS. The coumarin ayapin was isolated from ethanol extract and identified by NMR. Essential oils of the fresh leaves and fresh inflorescences were obtained by hydrodistillation and analyzed for GC-MS. The main components in both essential oils were α-pinene, limonene and germacrene D.
-
Directory of Open Access Journals (Sweden)
Nathalia Diniz Araújo
2010-09-01
Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.
-
Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella
2010-01-01
The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae...
-
Directory of Open Access Journals (Sweden)
Carla Patrícia Rodrigues Batista-Franklim
2008-09-01
Full Text Available Foram estudados 21 táxons de Solanum L., com o objetivo de caracterizá-los palinologicamente e, assim, contribuir para a elaboração de um catálogo polínico da flora das restingas do Estado do Rio de Janeiro. Os táxons examinados foram Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum cordifolium Dunal, Solanum curvispinum Dunal, Solanum echidnaeforme Dunal, Solanum gardneri Sendtn.,Solanum indigoferum A. St.-Hil., Solanum insidiosum Mart., Solanum mauritianum Scop., Solanum paludosum Moric., Solanum paniculatum L., Solanum paratyense Vell., Solanum pseudoquina A.St.-Hil., Solanum sisymbriifolium Lam., Solanum torvum Sw., Solanum velleum Sw. Os grãos de pólen foram acetolisados, mensurados, descritos e fotomicrografados. A análise sob microscopia eletrônica de varredura foi utilizada, em grãos de pólen não acetolisados, para confirmar as descrições feitas sob microscopia de luz e, em alguns casos para confirmar as descrições de abertura e ornamentação. Constatou-se que os grãos de pólen são pequenos ou médios, isopolares, subprolatos a oblato-esferoidais, 3-colporados, sexina granulada, rugulado-granulada ou escabrada. Pela análise dos resultados obtidos pôde-se concluir que os táxons analisados apresentam certa heterogeneidade polínica, quanto à forma, aos atributos das aberturas e à ornamentação da sexina, podendo-se usar estes caracteres na taxonomia do gênero.In this study 21 taxa of Solanum L. were investigated for palynological characterization and to contribute to the Pollen Catalog of the Flora of the Rio de Janeiro restingas. The taxa analysed were Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum
-
Manoko, M.L.K.; Berg, van den R.G.; Feron, R.M.C.; Weerden, van der G.M.; Mariani, C.
2008-01-01
Two hexaploid species of Solanum sect. Solanum are present in Africa: Solanum scabrum and S. nigrum. Solanum scabrum is a widely cultivated species and is used as a leafy vegetable, as a source of medicine and as a source of ink dye. In previous studies a wide range of morphological diversity has
-
Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas
2016-05-01
Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
-
Phenetic analysis of medicinally important species of the genus solanum from Pakistan
International Nuclear Information System (INIS)
Yousaf, Z.; Shinwari, Z.K.; Khan, M.A.
2010-01-01
Solanum is one of the largest and hyper diverse genera of the family Solanaceae. In Pakistan Solanum is represented by 15 species, of which 11 species have the medicinal properties. Taxonomically this is a complex genus because of the presence of number of hybrid and controversial taxonomic status of S. nigrum complex. In the present study numerical techniques were utilized to evaluate the taxonomic status of the genus Solanum. Cluster analysis was employed to work out the relationship among the taxa of the genus Solanum. The Euclidean distance measured similarity matrix and a dendrogram was constructed by using the complete linkage method. This analysis showed that all the species of genus Solanum can easily be divided into two groups at hundred percentage linkage distance. Co-relation of quantitative characters showed that floral characters had highly significant relationship with the stem characters, these characters plays a significant role in the identification of the species of the genus Solanum. (author)
-
Del-Vechio-Vieira, Glauciemar; Santos, Bruna C S; Alves, Maria Silvana; Araújo, Aílson L A; Yamamoto, Célia H; Pinto, Míriam A O; Kaplan, Maria Auxiliadora C; Sousa, Orlando V
2016-07-11
The present study was designed to investigate the antioxidant, antinociceptive and anti-inflammatory activities of the ethanol extract from Ageratum fastigiatum branches. Phytochemical screening and total phenol and flavonoid contents were determined. The antioxidant activity was assessed by 2,2-diphenyl-1-pycrilhydrazin (DPPH) and iron reducing power methods. The antinociceptive effect was evaluated using the acetic acid-induced writhing, formalin, hot plate and tail immersion assays; while the carrageenan-induced paw edema and pleurisy tests were performed to examine the anti-inflammatory activity against acute inflammation. The extract revealed the presence of flavonoids, tannins, coumarins, terpenes, sterols and saponins. Expressive levels of total phenols and flavonoids and a promising antioxidant effect were quantified. At the doses of 50, 100 and 200 mg/kg, the extract inhibited the writhing, reduced both phases of paw licking time and increased the reaction time on the hot plate. In the tail immersion test, the extract (50, 100 and 200 mg/kg) caused a significant inhibition of pain. In these doses, the paw edema, exudate volume and leucocyte mobilization were significantly reduced. These results suggest that A. fastigiatum can be an active source of substances with antioxidant, antinociceptive and anti-inflammatory activities, adding scientific support to the appropriate use in the Brazilian folk medicine.
-
Coelho, C P; Gomes, D C; Guilherme, F A G; Souza, L F
2017-11-01
The genus Solanum (family Solanaceae) includes more than 1400 species and has buzz-pollinated flowers with poricidal anthers. The present study aimed to describe the distribution, breeding system and pollination mechanism of Solanum melissarum, a species endemic to Brazil. The study of breeding system was conducted in an urban forest fragment in Jataí, GO. Distribution data were gathered from floristic surveys and digital plant databases. The floral morphology and the pollination mechanism were studied on through field observations and preserved flowers. The breeding system was determined through hand pollination treatments. The species has a distribution only in the Brazilian Atlantic forest coastal, and this study provides the first records of S. melissarum for the state of Goiás. The pendulous flowers have poricidal anthers close to the stigma, with membranous thecae joined by a connective bearing osmophores that attract males of Euglossa cordata bees. As they collect fragrances, the bees press the thecae and pollen is released through a bellows mechanism. Based on the hand-pollination treatments, this species is self-incompatible. Isolated forest fragments may not include enough pollinators to ensure the pollination of plants with specialized systems. However, they are essential for the conservation of species with interesting phytogeographic patterns, such as the vicariance observed in S. melissarum, and for the conservation of regional diversity.
-
Induction of cell death on Plasmodium falciparum asexual blood stages by Solanum nudum steroids
DEFF Research Database (Denmark)
López, Mary Luz; Vommaro, Rossiane; Zalis, Mariano
2010-01-01
Solanum nudum Dunal (Solanaceae) is a plant used in traditional medicine in Colombian Pacific Coast, from which five steroids denominated SNs have been isolated. The SNs compounds have antiplasmodial activity against asexual blood stages of Plasmodium falciparum strain 7G8 with an IC50 between 20...
-
Solanum section Petota (Solanaceae), which includes the cultivated potato (Solanum tuberosum) and its wild relatives, contains over 150 wild species distributed from the southwestern U.S.A. (38°N) to central Argentina and adjacent Chile (41°S). This catalog includes all species from the Southern Con...
-
In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species
Directory of Open Access Journals (Sweden)
Evandro Vagner Tambarussi
2009-01-01
Full Text Available The availability of chloroplast genome (cpDNA sequences of Atropa belladonna, Nicotiana sylvestris, N.tabacum, N. tomentosiformis, Solanum bulbocastanum, S. lycopersicum and S. tuberosum, which are Solanaceae species,allowed us to analyze the organization of cpSSRs in their genic and intergenic regions. In general, the number of cpSSRs incpDNA ranged from 161 in S. tuberosum to 226 in N. tabacum, and the number of intergenic cpSSRs was higher than geniccpSSRs. The mononucleotide repeats were the most frequent in studied species, but we also identified di-, tri-, tetra-, pentaandhexanucleotide repeats. Multiple alignments of all cpSSRs sequences from Solanaceae species made the identification ofnucleotide variability possible and the phylogeny was estimated by maximum parsimony. Our study showed that the plastomedatabase can be exploited for phylogenetic analysis and biotechnological approaches.
-
Directory of Open Access Journals (Sweden)
Sandra Knapp
2017-08-01
Full Text Available The Solanum elaeagnifolium clade (Elaeagnifolium clade contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species.
-
Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)
Cornelius, Marli T. F.; Carvalho, Mário G. de; Silva, Tania M. S. da; Alves, Cassia C. F.; Siston, Ana P. N.; Alves, Kelly Z.; Sant'Anna, Carlos M. R.; Neto, Mario B.; Eberlin, Marcos N.; Braz-Filho, Raimundo
2010-01-01
The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1→5)-β-D-apiofuranosyl-(1→6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans- coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solama...
-
Scholte, K.
2000-01-01
Ninety accessions of non-tuber bearing Solanaceae were screened for (i) resistance to and (ii) stimulatory effect on juvenile hatch of potato cyst nematodes, and (iii) their growth under temperate climatic conditions. All plant species belonging to the genus Solanum tested induced hatching but this
-
Directory of Open Access Journals (Sweden)
Sarah Christina Caldas Oliveira
2012-09-01
Full Text Available Solanum lycocarpum A.St.-Hil (Solanaceae é um arbusto típico da região central do Brasil (Cerrado. A atividade alelopática do extrato aquoso de folhas e frutos dessa espécie já foi verificada em estudos anteriores. O objetivo desse trabalho foi avaliar a atividade alelopática de diferentes extratos de S. lycocarpum na germinação e crescimento de quatro espécies-alvo. As folhas foram coletadas, secas e trituradas e submetidas a dois métodos distintos de extração: 1- líquido-líquido (acetato de etila e diclorometano do extrato aquoso das folhas e 2- com solventes em polaridade crescente (hexano, diclorometano, acetato de etila, acetona, metanol e água diretamente das folhas. Cada extração foi realizada com equipamento de ultrassom durante uma hora, filtrado e evaporado. Desses extratos, soluções de 800, 400 e 200 ppm foram preparadas, e água e Logran® foram usados como controle positivo e negativo, respectivamente. Cada solução, bem como os controles, foi dissolvida em DMSO para os bioensaios. As espécies alvo usadas foram: alface, agrião, tomate e cebola. Cada placa era composta de 20 sementes e foi adicionado 1 mL de solução teste com 4 repetições. As placas foram incubadas a 25 ºC no escuro. Posteriormente, as plântulas tiveram suas partes aéreas e raízes medidas e a porcentagem de germinação e inibição calculada para cada extrato. Tomate foi a espécie que mostrou maior sensibilidade para todos os extratos, seguido de agrião, cebola e alface. Os extratos que tiveram maior atividade foram o acetato de etila, acetona e as extrações líquido-líquido, indicando as frações que devem conter os princípios ativos da folha dessa espécie.Solanum lycocarpum A.St.-Hil (Solanaceae is a typical shrub in the Cerrado of central Brazil. The allelopathic activity of aqueous extracts of the leaves and fruits of this species has already been proven in previous studies. The goal of this work was to verify the
-
Six cultivars of Solanum macrocarpon (Solanaceae in Ghana
Directory of Open Access Journals (Sweden)
Z. R. Bukenya
1987-10-01
Full Text Available The Solanum macrocarpon complex (the cultivated egg plant has been studied in Ghana using morphological and experimental methods. Six cultivars belonging to the S. macrocarpon complex have been recognized and described. The cultivars are S. macrocarpon ‘Gboma’, S. macrocarpon ‘Mankessim’, S. macrocarpon ‘Akwaseho’, S. macrocarpon ‘Kade’, S. macrocarpon ‘Sarpeiman’ and S. macrocarpon ‘Bui’. The very spiny, hairy plant traditionally called S. dasyphyllum is regarded as the wild ancestor from which the cultivars have been derived through a process of crop evolution. The variation within S. macrocarpon complex is attributable to genotypic differences and environmental factors.
-
Unilateral incompatibility in Capsicum (Solanaceae): occurrence and taxonomic distribution.
Onus, A Naci; Pickersgill, Barbara
2004-08-01
Unilateral incompatibility (UI) occurs when pollinations between species are successful in one direction but not in the other. Self-incompatible (SI) species frequently show UI with genetically related, self-compatible (SC) species, as pollen of SI species is compatible on the SC pistil, but not vice versa. Many examples of unilateral incompatibility, and all those which have been studied most intensively, are found in the Solanaceae, particularly Lycopersicon, Solanum, Nicotiana and Petunia. The genus Capsicum is evolutionarily somewhat distant from Lycopersicon and Solanum and even further removed from Nicotiana and Petunia. Unilateral incompatibility has also been reported in Capsicum; however, this is the first comprehensive study of crosses between all readily available species in the genus. All readily available (wild and domesticated) species in the genus are used as plant material, including the three genera from the Capsicum pubescens complex plus eight other species. Pollinations were made on pot-grown plants in a glasshouse. The number of pistils pollinated per cross varied (from five to 40 pistils per plant), depending on the numbers of flowers available. Pistils were collected 24 h after pollination and fixed for 3-24 h. After staining, pistils were mounted in a drop of stain, squashed gently under a cover slip and examined microscopically under ultra-violet light for pollen tube growth. Unilateral incompatibility is confirmed in the C. pubescens complex. Its direction conforms to that predominant in the Solanaceae and other families, i.e. pistils of self-incompatible species, or self-compatible taxa closely related to self-incompatible species, inhibit pollen tubes of self-compatible species. Unilateral incompatibility in Capsicum does not seem to have arisen to prevent introgression of self-compatibility into self-incompatible taxa, but as a by-product of divergence of the C. pubescens complex from the remainder of the genus.
-
DEFF Research Database (Denmark)
Friis, Ib
2007-01-01
A taxonomic revision and a floristic account of all species in the plant family Solanaceae (nightshade family) recorded from Ethiopia and Eritrea.......A taxonomic revision and a floristic account of all species in the plant family Solanaceae (nightshade family) recorded from Ethiopia and Eritrea....
-
Contribution to the knowledge of chemical plants of northeast Brazil: Solanum buddleifolium SENDTN
Francisco das Chagas Lima Pinto
2013-01-01
This work describes the chemical study of Solanum buddleifolium (Solanaceae) aimed the isolation and structural characterization of its secondary metabolites. The chemical prospection was realized using chromatographic techniques such as chromatography over silica gel Sephadex LH-20 and solid phase extraction (SPE) besides High Performance Liquid Chromatography (HPLC) From EtOH were isolated the known compounds β-sitosterol and estigmasterol betulinic acid 13-hidroxysolavetrivone polista...
-
Directory of Open Access Journals (Sweden)
Sandra Knapp
2013-10-01
Full Text Available La familia Solanaceae es una de las más ricas en especies en la flora peruana, siendo reconocida con alrededor de 42 géneros y 600 especies (Brako & Zarucchi, 1993; Ulloa Ulloa et al., 2004, principalmente hierbas y arbustos. En este trabajo reconocemos 208 especies y seis variedades como endémicos, en 16 géneros. Esta familia ocupa el sexto lugar por su diversidad en especies endémicas, siendo Solanum, Nolana y Jaltomata los géneros más ricos en especies. Los taxones endémicos se encuentran en la mayoría de las regiones, principalmente en Mesoandina, Desierto Semicálido Tropical y Bosques Muy Húmedos Montanos, desde el nivel del mar hasta los 3800 m de altitud. Treinta y seis taxones se encuentran representados dentro del Sistema Nacional de Áreas Naturales Protegidas por el Estado.
-
Directory of Open Access Journals (Sweden)
Franco E. Chiarini
2010-12-01
Full Text Available The mature fruits of 10 South American species of Solanum sect. Torva were studied. Cross and longitudinal microtome sections, stained with astra blue/basic fuchsin, were made for microscopic examination. All species present an epidermis formed by a unistrate layer of small, isodiametric cells, with dense content and cellulosic walls. Immediately below, a hypodermis is always found, consisting of a well-defined layer of lignified cells with a single calcium oxalate crystal occupying the whole lumen of each cell. This is followed by one layer of cellulosic, isodiametric cells with dense cytoplasm and then several collenchymatous layers, sometimes with sclerified cell walls. The mesocarp comprises two zones histologically differentiated: an external one (formed by regular, vacuolated, medium-sized cells with small intercellular spaces, and an internal one, commonly juicy, and developing proliferations among the seeds. The fruits analyzed are alike, and despite some particularities, they can be classified as berries in the conventional sense. All the traits examined agree with the ornithochorous dispersal syndrome. The homogeneity in fruit traits may be due to shared habit, habitat and sexual system.Se estudiaron los frutos maduros de 10 especies sudamericanas de Solanum sect. Torva. Se examinaron en microscopio cortes microtómicos transversales y longitudinales teñidos con azul astral/fucsina básica. Todas las especies presentaron una epidermis unistrata de células pequeñas, isodiamétricas, de contenido denso y paredes celulósicas. Inmediatamente por debajo se encontró siempre una hipodermis, formada por una capa bien definida de células lignificadas con un cristal de oxalato de calcio en el lúmen de cada célula. A continuación se halló otra capa de celulas isodiamétricas, celulósicas, de contenido denso, y luego varias capas de colénquima, en ocasiones con paredes esclerificadas. El mesocarpo presentó dos zonas histologicamente
-
Alkaloids in Solanum torvum Sw (Solanaceae): (With 2 Tables & 1 Figure)
Pérez-Amador, MC; Muñoz Ocotero, V; García Castañeda, JM; González Esquinca, AR
2007-01-01
A comparison was made between plants of Solanum torvum Sw that grow in Chiapas, Mexico, and plants of the same species originating from India. This was effected to establish either similarities or differences between these plants in total alkaloid contents and presence of solasodine, an important alkaloid for the partial synthesis of steroids. The total alkaloid content (0.12%) of the plants coming from Chiapas and India was the same. However, solasodine was found only in the plants of Chiapa...
-
Taylor, Gary S; Kent, Deborah S
2013-02-11
Acizzia credoensis sp. n. is described from a single population on the native plant, Solanum lasiophyllum, from semi-arid Western Australia. The host range of Acizzia solanicola Kent & Taylor, initially recorded as damaging eggplant, S. melongena, in commercial crops and gardens and on wild tobacco bush, S. mauritianum in eastern Australia, is expanded to include the following Solanaceae: rock nightshade, S. petrophilum, cape gooseberry, Physalis peruviana, and an undetermined species of angel's trumpet Brugmansia and Datura. New Zealand specimens of A. solanicola collected in early 2012 from S. mauritianum are the first record for this species from outside Australia, and possibly represent a very recent incursion. The potential for the solanaceous-inhabiting Psyllidae to vector Candidatus Liberibacter solanacearum, an economically important plant pathogen, on native Australian Solanaceae is discussed. The occurrence of A. credoensis and A. solanicola on native Australian Solanum supports the Australian origin for the solanaceous-inhabiting Acizzia psyllids.
-
Krstić Lana N.; Merkulov Ljiljana S.; Boža Pal P.
2002-01-01
In Europe on the whole as well as in Yugoslavia, the most widespread weed species from the genus Solanum is Solanum nigrum L. Since this species inhabits different habitats, it developed several ways of adaptation to environmental conditions. The influence of ecological factors on plant organism and resulting plant adaptations are most evident in leaf morphology and anatomy. Therefore, the anatomical structure of leaves and leaf epidermal tissue of S. nigrum was analyzed and compared among pl...
-
Aoki, Koh; Yano, Kentaro; Suzuki, Ayako; Kawamura, Shingo; Sakurai, Nozomu; Suda, Kunihiro; Kurabayashi, Atsushi; Suzuki, Tatsuya; Tsugane, Taneaki; Watanabe, Manabu; Ooga, Kazuhide; Torii, Maiko; Narita, Takanori; Shin-I, Tadasu; Kohara, Yuji; Yamamoto, Naoki; Takahashi, Hideki; Watanabe, Yuichiro; Egusa, Mayumi; Kodama, Motoichiro; Ichinose, Yuki; Kikuchi, Mari; Fukushima, Sumire; Okabe, Akiko; Arie, Tsutomu; Sato, Yuko; Yazawa, Katsumi; Satoh, Shinobu; Omura, Toshikazu; Ezura, Hiroshi; Shibata, Daisuke
2010-03-30
The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs) was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706) was estimated to be 0.061%. The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the tomato whole-genome sequence and aid in tomato functional
-
Directory of Open Access Journals (Sweden)
Kikuchi Mari
2010-03-01
Full Text Available Abstract Background The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. Results To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706 was estimated to be 0.061%. Conclusion The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the
-
Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)
International Nuclear Information System (INIS)
Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant'Anna, Carlos M.R.; Benassi Neto, Mario; Eberlin, Marcos N.; Braz-Filho, Raimundo
2010-01-01
The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1->5)-β-D-apiofuranosyl-(1->6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete 1 H and 13 C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)
-
Directory of Open Access Journals (Sweden)
Edson Luís de Carvalho Soares
2011-06-01
Full Text Available This work consists of a taxonomic synopsis of the genera of Solanaceae in Rio Grande do Sul state, Brazil. Solanaceae is represented by 28 genera in this state: Acnistus Schott, Athenaea Sendtn., Aureliana Sendtn., Bouchetia Dunal, Browalia L., Brugmansia Pers., Brunfelsia L., Calibrachoa La Llave & Lex., Capsicum L., Cestrum L., Datura L., Dyssochroma Miers, Grabowskia Schltdl., Jaborosa Juss., Lycianthes (Dunal Hassl., Melananthus Walp., Nicandra Adans., Nicotiana L., Nierembergia Ruiz & Pav., Petunia Juss., Physalis L., Salpichroa Miers, Schwenckia L., Sessea Ruiz & Pav., Solandra Sw., Solanum L. (including Cyphomandra Sendtn. and Lycopersicon Mill., Streptosolen Miers and Vassobia Rusby. Of these, 23 consist of native species , while five are represented exclusively by introduced species. The total number of species is 149, of which 118 are native and 31 are introduced (adventitious or cultivated. An identification key for genera, and also comments on the most relevant taxonomic characters of each one are presented, plus comments on the species that occur in Rio Grande do Sul state.Este trabalho consiste em uma sinopse taxonômica dos gêneros de Solanaceae no Estado do Rio Grande do Sul, Brasil. Constatou-se a ocorrência de 28 gêneros: Acnistus Schott, Athenaea Sendtn., Aureliana Sendtn., Bouchetia Dunal, Browalia L., Brugmansia Pers., Brunfelsia L., Calibrachoa La Llave & Lex., Capsicum L., Cestrum L., Datura L., Dyssochroma Miers, Grabowskia Schltdl., Jaborosa Juss., Lycianthes (Dunal Hassl., Melananthus Walp., Nicandra Adans., Nicotiana L., Nierembergia Ruiz & Pav., Petunia Juss., Physalis L., Salpichroa Miers, Schwenckia L., Sessea Ruiz & Pav., Solandra Sw., Solanum L. (incluindo Cyphomandra Sendtn. e Lycopersicon Mill., Streptosolen Miers e Vassobia Rusby. Destes, 23 apresentam espécies nativas, enquanto cinco estão representados exclusivamente por espécies introduzidas. O número total de espécies é de 149, sendo que 118 s
-
Directory of Open Access Journals (Sweden)
Rita de Cássia M. Oliveira
Full Text Available Solanum megalonyx Sendtn. (Solanaceae é conhecida popularmente por "jurubeba" no Nordeste do Brasil e se apresenta na forma de arbusto. Várias espécies de Solanum apresentam efeito espasmolítico em órgãos isolados. Assim, objetivou-se investigar e comparar o efeito dos extratos metanólico (SM-MeOH e acetato de etila (SM-AcOEt, obtidos das partes aéreas de S. megalonyx, em íleo isolado de cobaia. SM-MeOH e SM-AcOEt antagonizaram (n = 5 as contrações fásicas induzidas por 1 mM de acetilcolina (logCI50 = 3,2 ± 0,1 e 1,8 ± 0,6 mg/mL, respectivamente ou de histamina (logCI50 = 2,8 ± 0,5 e 1,7 ± 0,3 mg/mL, respectivamente. SM-MeOH e SM-AcOEt também relaxaram (n = 5 o íleo pré-contraído por 40 mM de KCl (logCE50 = 1,9 ± 0,09 e 1,9 ± 0,1 mg/mL, respectivamente, por 1 mM de histamina (logCE50 = 1,9 ± 0,07 e 1,7 ± 0,08 mg/mL, respectivamente ou de acetilcolina (logCE50 = 1,9 ± 0,02 e 1,7 ± 0,09 mg/mL, respectivamente de maneira dependente de concentração e equipotente. Demonstra-se pela primeira vez que S. megalonyx apresenta efeito espasmolítico não seletivo em íleo isolado de cobaia, sugerindo que os extratos podem estar agindo em um passo comum da via de sinalização dos agentes contráteis testados.
-
Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)
Energy Technology Data Exchange (ETDEWEB)
Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant' Anna, Carlos M.R., E-mail: mgeraldo@ufrrj.b [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Dept. de Quimica; Benassi Neto, Mario; Eberlin, Marcos N. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacases, RJ (Brazil). Setor de Quimica de Produtos Naturais. Lab. de Ciencias Quimicas
2010-07-01
The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-{beta}-D-apiofuranosyl-(1->5)-{beta}-D-apiofuranosyl-(1->6)-{beta}-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete {sup 1}H and {sup 13}C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)
-
Renata Fabiane Jorge Tiossi
2010-01-01
Solanum lycocarpum A. St.-Hil. (Solanaceae Solanum), popular lobeira, é espécie arbustiva nativa e característica do Cerrado brasileiro. Seus frutos são empregados na medicina caseira como diurética, calmante, anti-espasmódica, antiofídica e antiepilética. As espécies do gênero Solanum são produtoras de heterosídeos alcaloídicos, os quais possuem atividade antitumoral, incluindo-se anticâncer de pele. O câncer de pele tem preocupado as autoridades no mundo com os crescentes índices atuais e,...
-
N-trans-feruloyltyramine and flavonol glycosides from the leaves of Solanum sordidum
Directory of Open Access Journals (Sweden)
Regina Mikie Kanada
2012-03-01
Full Text Available Chemical investigation of the leaves of Solanum sordidum Sendtn., Solanaceae, resulted in the isolation and identification of sitosterol, stigmasterol, 3β-O-β-glycopyranosyl stigmasterol, 3β-O-β-glycopyranosyl sitosterol, kaempferol-3-O-α-rhamnopyranosyl-(1-6-α-glycopyranoside, rutin, and N-trans-feruloyltyramine. The structures of these compounds were established by analysis of 1D and 2D NMR spectrometric data and comparison with data in the literature. The evaluation of antioxidant activity showed an IC50 of 159.5 ppm for the chloroformic fraction and IC50 of 77.5 ppm for the hydromethanolic fraction.
-
N-trans-feruloyltyramine and flavonol glycosides from the leaves of Solanum sordidum
Directory of Open Access Journals (Sweden)
Regina Mikie Kanada
2012-06-01
Full Text Available Chemical investigation of the leaves of Solanum sordidum Sendtn., Solanaceae, resulted in the isolation and identification of sitosterol, stigmasterol, 3β-O-β-glycopyranosyl stigmasterol, 3β-O-β-glycopyranosyl sitosterol, kaempferol-3-O-α-rhamnopyranosyl-(1-6-α-glycopyranoside, rutin, and N-trans-feruloyltyramine. The structures of these compounds were established by analysis of 1D and 2D NMR spectrometric data and comparison with data in the literature. The evaluation of antioxidant activity showed an IC50 of 159.5 ppm for the chloroformic fraction and IC50 of 77.5 ppm for the hydromethanolic fraction.
-
International Nuclear Information System (INIS)
Azeredo, Edson Henrique de; Lima, Eduardo; Cassino, Paulo Cesar Rodrigues
2004-01-01
Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha -1 of N + K with 27.03% at P -1 , in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)
-
Directory of Open Access Journals (Sweden)
Hermes Araméndiz Tatis
2009-12-01
Full Text Available La berenjena es una especie perteneciente al género Solanum, de gran importancia en la horticultura del Caribe colombiano. El estudio tuvo como objetivo describir la morfología floral de dos cultivares de berenjena “Long Purple” y “Criolla Lila”, que tienen origen geográfico diferente, utilizando para ello, una muestra aleatoria de 100 cojines florales por cultivar. Se estimaron la media, rango, varianza, desviación estándar, coeficiente de variación y se aplicó la prueba t, para determinar diferencias entre los dos cultivares. Los resultados indicaron que el cultivar “Long Purple”, presenta flores distílicas, en tanto que en el “Criollo Lila” se observó la presencia de tristilia. El potencial de producción de frutos, fue del 76,5% y 57,52%, para el “Criollo Lila” y “Long Purple”, respectivamente. Las flores brevistílicas en ambos cultivares, incrementan la aptitud masculina y por ende un desbalance entre las flores con funcionamiento masculino y hermafrodita.The eggplant is a specie of genus Solanum, of great importance in horticulture of colombian Caribbean region. The objective of study was to describe the floral morphology of two cultivars of eggplant “Long Purple” and “Lilac land race”, which have different geographic origin. We used a random sample of 100 floral cushions for cultivar. The mean, range, variance, standard deviation, variation coefficient were estimated. The t-test was applied to determine differences between two cultivars. The results indicated that genotype ‘Long Purple’, showed distylics flowers, while in the “Lilac land race” was observed the presence of tristylics flowers. The potential for production of fruit was 76.50% and 57.52% for the “Lilac land race” and “Long Purple”, respectively. Brevistylics flowers in the two cultivars, increased male fitness and thus produced a nonbalance on functioning between male and hermaphrodite flowers.
-
Directory of Open Access Journals (Sweden)
Krstić Lana N.
2002-01-01
Full Text Available In Europe on the whole as well as in Yugoslavia, the most widespread weed species from the genus Solanum is Solanum nigrum L. Since this species inhabits different habitats, it developed several ways of adaptation to environmental conditions. The influence of ecological factors on plant organism and resulting plant adaptations are most evident in leaf morphology and anatomy. Therefore, the anatomical structure of leaves and leaf epidermal tissue of S. nigrum was analyzed and compared among plants that originated from different habitats, in order to determine leaf structural adaptations. S. nigrum lamina has the mesomorphic structure with some xero-heliomorphic adaptations. The differences in stomata number, number of hairs, thickness of lamina, palisade and spongy tissue, as well as the size of mesophyll cells have been noticed. The highest values for most of the parameters have been recorded for the plants from cultivated soil. Largest variations of the examined characters were found for the leaves from ruderal habitats, where environmental conditions are most variable.
-
Directory of Open Access Journals (Sweden)
Jiali Zhao
Full Text Available We investigate native and introduced populations of Solanum rostratum, an annual, self-compatible plant that has been introduced around the globe. This study is the first to compare the genetic diversity of Solanum rostratum between native and introduced populations. We aim to (1 determine the level of genetic diversity across the studied regions; (2 explore the likely origins of invasive populations in China; and (3 investigate whether there is the evidence of multiple introductions into China.We genotyped 329 individuals at 10 microsatellite loci to determine the levels of genetic diversity and to investigate population structure of native and introduced populations of S. rostratum. We studied five populations in each of three regions across two continents: Mexico, the U.S.A. and China.We found the highest genetic diversity among Mexican populations of S. rostratum. Genetic diversity was significantly lower in Chinese and U.S.A. populations, but we found no regional difference in inbreeding coefficients (F IS or population differentiation (F ST. Population structure analyses indicate that Chinese and U.S.A. populations are more closely related to each other than to sampled Mexican populations, revealing that introduced populations in China share an origin with the sampled U.S.A. populations. The distinctiveness between some introduced populations indicates multiple introductions of S. rostratum into China.
-
Berinjela (Solanum melongena L.: mito ou realidade no combate as dislipidemias?
Directory of Open Access Journals (Sweden)
Maria da Conceição R. Gonçalves
Full Text Available A dislipidemia é considerada um dos fatores de risco mais importantes para o desenvolvimento da doença arterial coronariana. Como resultado, tratamentos efetivos com fármacos foram desenvolvidos para combatê-la, porém, apresentam alto custo e efeitos colaterais. Considerando este fato, pacientes têm recorrido a tratamentos utilizando alimentos conhecidos científica e popularmente por possuírem efeito hipolipemiante. Várias pesquisas vêm sendo realizadas com esses alimentos como a berinjela no sentido de investigarem seus possíveis efeitos na redução dos lipídios sangüíneos. A berinjela (Solanum melongena L. tem sido alvo desses estudos devido a sua utilização popular para dietas de emagrecimento, por aumentar a eliminação de gorduras e combater o excesso de colesterol. Este trabalho teve como objetivo fazer uma revisão da literatura científica sobre a espécie Solanum melongena (berinjela da família Solanaceae, associado a redução de gorduras no organismo. Para este fim foram consultados vinte e cinco referências.
-
Directory of Open Access Journals (Sweden)
Juliana E. Cardona J.
2011-12-01
Full Text Available Se determinó la presencia y la estructura(mediante el uso de técnicas espectroscópicasy cromatográficas de algunos metabolitossecundarios en tres morfotiposdel fruto de cocona (Solanum sessiliflorumDunal; Solanaceae cultivados en eldepartamento del Guaviare. Se destacóla presencia de ácido p-cumárico, ácidop-hidroxidihidrocumárico, naringenina,salicilato de metilo, hidrocarburos decadena larga, ácidos grasos y sus ésteresmetílicos y etílicos. Algunos de estoscompuestos se acumulan únicamente enel epicarpio de la fruta. La comparaciónde metabolitos volátiles permitió establecerdiferencias químicas entre los tresmorfotipos de la fruta.
-
2010-01-01
The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with FST > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species. PMID:21637482
-
Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella
2010-04-01
The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F(ST) > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.
-
Directory of Open Access Journals (Sweden)
Felix Enciso-Rodríguez
2010-01-01
Full Text Available The Lulo or naranjilla (Solanum quitoense Lam. and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt. are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32 and tree tomatoes (n = 30 through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII in other Solanaceae (Asterid species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested and tree tomatoes (26 out of 41 for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F ST > 0.90, which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.
-
Prolonged Adaptive Evolution of a Defensive Gene in the Solanaceae.
Rausher, Mark D; Huang, Jie
2016-01-01
Although plants and their natural enemies may coevolve for prolonged periods, little is known about how long individual plant defensive genes are involved in the coevolutionary process. We address this issue by examining patterns of selection on the defensive gene threonine deaminase (TD). Tomato (Solanum lycopersicum) has two copies of this gene. One performs the canonical housekeeping function in amino acid metabolism of catalyzing the first reaction in the conversion of threonine to isoleucine. The second copy functions as an antinutritive defense against lepidopteran herbivores by depleting threonine in the insect gut. Wild tobacco (Nicotiana attenuata) also contains a defensive copy. We show that a single copy of TD underwent two or three duplications near the base of the Solanaceae. One copy retains the housekeeping function, whereas a second copy evolved defensive functions. Positive selection occurred on the branch of the TD2 gene tree subtending the common ancestor of the Nicotianoideae and Solanoideae. It also occurred within the Solanoideae clade but not within the Nicotianoideae clade. Finally, it occurred on most branches leading from the common ancestor to S. lycopersicum. Based on recent calibrations of the Solanaceae phylogeny, TD2 experienced adaptive substitutions for a period of 30-50 My. We suggest that the most likely explanation for this result is fluctuating herbivore abundances: When herbivores are rare, relaxed selection increases the likelihood that slightly disadvantageous mutations will be fixed by drift; when herbivores are common, increased selection causes the evolution of compensatory adaptive mutations. Alternative explanations are also discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
-
Glicoalcaloides antifúngicos, flavonoides e outros constituintes químicos de Solanum asperum
Directory of Open Access Journals (Sweden)
Francisco das Chagas L. Pinto
2011-01-01
Full Text Available Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-α-L-ramnopyranosyl-kaempferol and 3-O-[ß-D-glucopyranosyl-(1→6-α-L-ramnopyranosyl]-7- O-α-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae. The structures of all compounds were determined by interpretation of their spectra (IR, MS, ¹H and 13C NMR and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 μg/mL against four filamentous fungi species of the genera Microsporum and Trichophyton.
-
Energy Technology Data Exchange (ETDEWEB)
Azeredo, Edson Henrique de [Universidade Federal Fluminense (UFF), Pinheiral, RJ (Brazil). Pro-Reitoria de Extensao], e-mail: edsonhenrique.azeredo@bol.com.br; Lima, Eduardo [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Agronomia. Dept. de Solos; Cassino, Paulo Cesar Rodrigues [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Biologia. Centro Integrado de Manejo de Pragas C.R.G.
2004-03-15
Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha{sup -1} of N + K with 27.03% at P< 0,05. It was observed that the effect of the dosage of N + K in the increment of the concentration of soluble sugars increased the damages in the tubercles and stems by A. ipsilon. The infestation by these species increased to 58.82% on the Monalisa cultivar, when the nitrogen dosage increased from zero to 150 kg.ha{sup -1}, in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)
-
Leisner, Courtney P; Hamilton, John P; Crisovan, Emily; Manrique-Carpintero, Norma C; Marand, Alexandre P; Newton, Linsey; Pham, Gina M; Jiang, Jiming; Douches, David S; Jansky, Shelley H; Buell, C Robin
2018-05-01
Cultivated potato (Solanum tuberosum L.) is a highly heterozygous autotetraploid that presents challenges in genome analyses and breeding. Wild potato species serve as a resource for the introgression of important agronomic traits into cultivated potato. One key species is Solanum chacoense and the diploid, inbred clone M6, which is self-compatible and has desirable tuber market quality and disease resistance traits. Sequencing and assembly of the genome of the M6 clone of S. chacoense generated an assembly of 825 767 562 bp in 8260 scaffolds with an N50 scaffold size of 713 602 bp. Pseudomolecule construction anchored 508 Mb of the genome assembly into 12 chromosomes. Genome annotation yielded 49 124 high-confidence gene models representing 37 740 genes. Comparative analyses of the M6 genome with six other Solanaceae species revealed a core set of 158 367 Solanaceae genes and 1897 genes unique to three potato species. Analysis of single nucleotide polymorphisms across the M6 genome revealed enhanced residual heterozygosity on chromosomes 4, 8 and 9 relative to the other chromosomes. Access to the M6 genome provides a resource for identification of key genes for important agronomic traits and aids in genome-enabled development of inbred diploid potatoes with the potential to accelerate potato breeding. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
-
Silvana D Del V. Figueroa; Nilda Dottori; María Teresa Cosa
2011-01-01
Solanum chenopodioides Lam., conocida como "hierba mora", es una hierba o subarbusto ampliamente distribuido en Argentina y otras zonas de Sudamérica y es una maleza sumamente tóxica para el ganado. Sus hojas tienen propiedades medicinales y son utilizadas como sedante y en oftalmología. Es frecuente el ataque de sus hojas por ácaros fitófagos y por insectos minadores. El objetivo del presente trabajo fue analizar la morfología y la anatomía de las hojas en plantas sanas e infestadas por ácar...
-
Directory of Open Access Journals (Sweden)
Daniel Gandolfo
2008-10-01
Full Text Available Metriona elatior Klug é potencial candidato para o controle biológico de Solanum viarum Dunal (joá-bravo, pois as larvas e adultos se alimentam de suas folhas e têm baixa taxa de dispersão. A especificidade é um forte requisito para a adequabilidade de umorganismo como agente de controle biológico, especialmente pela estratégia inundativa. Desse modo, a preferência alimentar do adulto desse inseto em laboratório foi avaliada em 14 híbridos de Solanum melogena Linnaeus (berinjela. A criação estoque foi mantida emlaboratório, com os indivíduos se alimentando de folhas do joá-bravo. O estudo foi realizado utilizando-se testes de dupla e múltipla escolha, em períodos de alimentação de 24 e 48h, oferecendo-se discos de tecido foliar, em condições de placas de Petri. As avaliaçõesda sobrevivência e consumo foliar dos insetos adultos recém-emergidos foram realizadas em folhas de joá-bravo e dos híbridos de berinjela, mantidas túrgidas pela imersão do pecíolo em água. A área foliar foi medida antes e após quatro dias de exposição ao inseto. M. elatiorapresentou preferência para alimentação, sobrevivência e consumo na planta daninha. A preferência do crisomelídeo foi maior para o híbrido ‘Minikuro Kowishiki’ de berinjela.Metriona elatior Klug is a potential biocontrol agent for Solanum viarum Dunal (tropical soda apple, because larvae and adults feed on its leaves and this species shows a low dispersion rate. Specificity plays a major role in the feasibility of an organism as abiological control agent, especially in the inundative strategy. The feeding preference of M. elatior adults was evaluated to 14 eggplant (Solanum melogena Linnaeus hybrids. Mass rearing was carried out under lab conditions, with the insect feeding directly on S. viarum leaves. The study started with dual and multiple choice tests in 24 and 48 hour feeding times, by offering leaf disks in Petri dish conditions. Survival and leaf
-
International Nuclear Information System (INIS)
Al-Ayedh, Hassan Ibn Yahiya
2005-01-01
Trapping efficiency of seven different colored sticky traps (Green, Fluorescent yellow, Orange, Pink, red, White and Yellow) was evaluated in some solanacea plants, tomatoes (Lycopersicon esculentum), eggplant (Solanum Magellan) and sweet pepper (Capsicum spp.) crops, for whitefly (Bemis ia airlifting), leaf miners (Liriomyza trifolii), thrips (Thrips tabaci) in Riyadh, Saudi Arabia. The traps were placed at four different heights (0.5, 1.0, 1.5 and 2.0 m above the ground). The experiment was laid out in a Completely Randomized Block Design (CRBD) with four replications during autumn 2001, spring and autumn 2002. Significantly high insect populations were trapped on Fluorescent yellow, yellow and green colored sticky traps. No significant differences were witnessed between mean numbers of various insects caught on sticky traps placed at different heights but more insects were trapped at 0.5 - 1.5m. (author)
-
Directory of Open Access Journals (Sweden)
Keser Lidewij H
2008-01-01
Full Text Available Abstract Background Solanum carolinense (horsenettle is a highly successful weed with a gametophytic self-incompatibility (SI system. Previous studies reveal that the strength of SI in S. carolinense is a plastic trait, associated with particular S-alleles. The importance of this variation in self-fertility on the ability of horsenettle to found and establish new populations will depend, to a large extent, on the magnitude of inbreeding depression. We performed a series of greenhouse and field experiments to determine the magnitude of inbreeding depression in S. carolinense, whether inbreeding depression varies by family, and whether the estimates of inbreeding depression vary under field and greenhouse conditions. We performed a series of controlled self- and cross-pollinations on 16 genets collected from a large population in Pennsylvania to obtain progeny with different levels of inbreeding. We grew the selfed and outcrossed progeny in the greenhouse and under field conditions and recorded various measures of growth and reproductive output. Results In the greenhouse study we found (1 a reduction in flower, fruit and seed production per fruit in inbred (selfed progeny when compared to outbred (outcrossed progeny; (2 a reduction in growth of resprouts obtained from rhizome cuttings of selfed progeny; and (3 an increase in the ability to self-fertilize in the selfed progeny. In the field, we found that (1 outcrossed progeny produced more leaves than their selfed siblings; (2 herbivory seems to add little to inbreeding depression; and (3 outcrossed plants grew faster and were able to set more fruits than selfed plants. Conclusion Solanum carolinense experiences low levels of inbreeding depression under greenhouse conditions and slightly more inbreeding depression under our field conditions. The combined effects of low levels of inbreeding depression and plasticity in the strength of SI suggest that the production of selfed progeny may play an
-
Directory of Open Access Journals (Sweden)
Ludmilla M. de S. Aguiar
2005-06-01
Full Text Available During May, June and July of 2004, the feeding habits of Platyrrhinus lineatus (E. Geoffroy, 1810 were investigated. Each morning food remains (dry oral pellets, seeds, feces and partly eaten foods were collected in two day roosts sites located inside the main building at Embrapa Cerrados. Fruits of Emmotum nitens (Benth. Miers (1852 and leaves of Solanum lycocarpum S. Hil. (1833 were items consumed by P. lineatus. Independent of plant and bat distribution area, the use of Solanum leaves by P. lineatus appears to be common.Durante os meses de maio, junho e julho de 2004, os hábitos alimentares de Platyrrhinus lineatus (E. Geoffroy, 1810 foram investigados. Toda manhã os restos alimentares (pelotas de matéria seca, sementes, fezes e itens parcialmente comidos foram coletados em dois abrigos diurnos localizados dentro das dependências da Embrapa Cerrados. Além de frutos de Emmotum nitens (Benth. Miers (1852, folhas de Solanum lycocarpum S. Hil. (1833 foram consumidas por P. lineatus. Independentemente da área de distribuição, da planta ou do morcego, o uso de folhas de espécies do gênero Solanum por P. lineatus parece ser comum.
-
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Silvana D Del V. Figueroa
2011-12-01
Full Text Available Solanum chenopodioides Lam., conocida como "hierba mora", es una hierba o subarbusto ampliamente distribuido en Argentina y otras zonas de Sudamérica y es una maleza sumamente tóxica para el ganado. Sus hojas tienen propiedades medicinales y son utilizadas como sedante y en oftalmología. Es frecuente el ataque de sus hojas por ácaros fitófagos y por insectos minadores. El objetivo del presente trabajo fue analizar la morfología y la anatomía de las hojas en plantas sanas e infestadas por ácaros (Tetranychidae, Tetranychus sp. y dípteros minadores de la hoja (Agromyzidae. Los resultados muestran que el ataque de ambos agentes reduce significativamente el volumen del tejido fotosintético por excelencia. Así, se compromete el crecimiento, y por lo tanto la supervivencia de la especie. Aún más, en caso de ser utilizada como especie medicinal se afecta la calidad del principio activo.Solanum chenopodioides Lam., known as "nightshade", is a herb or subshrub widely distributed in Argentina and another zones of South America, and is a weed highly toxic to livestock. Its leaves have medicinal properties and are used as a sedative and in ophthalmology. The attack of its leaves by phytophagous mites and leafminer insects is frequent. The aim of this study was to analyze the morphology and the anatomy of the leaves of both healthy and infested plants by Tetranychidae, Tetranychus sp. mites and Agromyzidae leafminer diptera. The results show that the attack of both agents significantly reduces the amount of photosynthetic tissue par excellence. Thus, growth is compromised, and therefore the survival of the species. Moreover, when used as medicinal species, the quality the active principle is affected.
-
Directory of Open Access Journals (Sweden)
Francieli Lando
2018-01-01
Full Text Available Brazil’s Atlantic Forest biome is currently undergoing forest loss due to repeated episodes of devastation. In this biome, bees perform the most frequent pollination system. Over the last decade, network analysis has been extensively applied to the study of plant–pollinator interactions, as it provides a consistent view of the structure of plant–pollinator interactions. The aim of this study was to use palynological studies to obtain an understanding of the relationship between floral visitor bees and the pioneer plant S. didymum in a fragment of the Atlantic Forest, and also learn about the other plants that interact to form this network. Five hundred bees were collected from 32 species distributed into five families: Andrenidae, Apidae, Colletidae, Megachilidae, and Halictidae. The interaction network consisted of 21 bee species and 35 pollen types. The Solanum-type bee species with the highest number of interactions were Anthrenoides sp. 1, Augochlora sp. 2, and Augochloropsis notophos, representing 71.78% of their interactions. Augochloropsis notophos and Augochlora sp. 2 were the only common species in the flowers of S. didymum. Given the results of our study, we conclude that Solanum is an important source of pollen grains for several native bee species, mainly for the solitary species that are more diverse in the south of Brazil. Moreover, our results indicate that bees from the families Halictidae (A. notophos, Augochlora and Andrenidae (Anthrenoides are the pollinators of S. didymum.
-
Directory of Open Access Journals (Sweden)
Ripoll, J.
2011-01-01
Full Text Available Optimization of the genomic DNA extraction method of silverleaf nightshade (Solanum elaeagnifolium Cav., an invasive plant in the cultivated areas within the Mediterranean region. The geographical origin of an invasive plant in the cultivated area within the Mediterranean region, silverleaf nightshade, Solanum elaeagnifolium Cav. (Solanaceae should be identified through the analysis of genetic similarities between native and introduced populations using microsatellite markers. Beforehand, an effective and less costly method for extracting genomic DNA from dehydrated and polysaccharide-rich leaves was investigated. The original Doyle's protocol based on the use of a cationic detergent, CTAB, was successfully optimized in order to extract high quality DNA (A260/280 ratio of 1.8; A260/230 ratio of 1.7 to 2. The DNA yields obtained with this new protocol were higher than those obtained with a commercial kit, although quality of the DNA extracted was comparable. The improvement of the protocol was further proven by the amplification of several microsatellite loci first developed in eggplant, Solanum melongena L.
-
Directory of Open Access Journals (Sweden)
Thamer Matias Pereira
2014-10-01
Full Text Available Introduction The larvicidal activity of Solanum lycocarpum against Culex quinquefasciatus is unknown. Methods We evaluated the larvicidal activity of extracts of the green fruits of Solanum lycocarpum against third and fourth instar larvae of C. quinquefasciatus. Results Dichloromethane and ethyl acetate fractions showed the greatest larvicidal effect at 200mg/L (83.3% and 86.7%, respectively. The methanol and dichloromethane, ethyl acetate, and hydromethanolic fractions demonstrated larvicidal effects against C. quinquefasciatus, with LC50 values of 126.24, 75.13, 83.15, and 207.05mg/L, respectively. Conclusions Thus, when considering new drugs with larvicidal activity from natural products, S. lycocarpum fruits may be good candidate sources.
-
Solanum paniculatum root extract reduces diarrhea in rats
Directory of Open Access Journals (Sweden)
Jonh A.B. Tenório
Full Text Available Abstract Solanum paniculatum L., Solanaceae, locally known as "jurubeba", is widely used in Brazil for culinary purposes, and in folk medicine to treat of diverse disorder including gastric dysfunctions. In this study we investigated the antidiarrheal activity of S. paniculatum roots extract in rats at different concentrations (125, 250 and 500 mg/kg, p.o using different experimental models such as castor oil-induced diarrhea, enteropooling and gastrointestinal motility, determined by in vivo experimental models. The major compound of root extract was characterized as chlorogenic acid based in the IR, 1D and 2D NMR analysis. All the extract doses achieved antidiarrheal potency, as indicated by reduced weight of feces in castor oil-induced diarrhea, decreased intestinal motility and significantly inhibited castor oil-induced enteropooling compared to the vehicle group. The highest dose (500 mg/kg produced greater anti-motility effect and better reduction of enteropooling, similar to the reference drug Loperamide (5 mg/kg. Extract from S. paniculatum L. roots had antidiarrheal activity, as shown by the lower weight of the feces as well as decrease in the accumulation of intestinal fluid and slower transit, justifying the traditional use of plant for diarrhea.
-
Tang, X.; Szinay, D.; Ramanna, M.S.; Vossen, van der E.A.G.; Datema, E.; Klein Lankhorst, R.M.; Boer, de J.M.; Peters, S.A.; Bachem, C.W.B.; Stiekema, W.J.; Visser, R.G.F.; Jong, de J.H.; Bai, Y.
2008-01-01
Ongoing genomics projects of tomato (Solanum lycopersicum ) and potato (Solanum tuberosum) are providing unique tools for comparative mapping studies in Solanaceae. At the chromosomal level, BACs can be positioned on pachytene comple-ments by fluorescent in situ hybridization (FISH) on homoeologous
-
Directory of Open Access Journals (Sweden)
Viviane de Cássia Bicalho Silva
2015-10-01
Full Text Available ABSTRACTINTRODUCTION:The larvicidal activity of oils, fatty acids, and methyl esters of Solanum lycocarpum fruit against Culex quinquefasciatus is unknown.METHODS:The larvicidal activity of samples of ripe and unripe fruit from S. lycocarpum was evaluated against third and fourth instar larvae of C. quinquefasciatus .RESULTS:The oils, fatty acids, and methyl esters of S. lycocarpum showed the greatest larvicidal effect (57.1-95.0% at a concentration of 100mg/L (LC 50values between 0.70 and 27.54mg/L.CONCLUSIONS:Solanum lycocarpum fruit may be a good source of new natural products with larvicidal activity.
-
Schuelter, A R; Grunvald, A K; Amaral, A T; da Luz, C L; Luz, C L; Gonçalves, L M; Stefanello, S; Scapim, C A
2009-08-11
Cocona (Solanum sessiliflorum Dunal) is a solanaceous shrub native to the Amazon region that produces an edible fruit. This species has numerous advantages, particularly a high nutritional value and productivity. However, due to irregular germination and rapid loss of seed viability, there are few plantations for production on a large scale. Development of alternative propagation strategies is essential for the production of homogeneous seedlings of genotypes with superior agronomic performance. We developed techniques for in vitro regeneration of the cocona varieties Santa Luzia and Thaís for large-scale production of healthy plantlets. Twenty days after seeding, seedling segments germinated in vitro were used as explant sources. Three successive experiments were performed: one to test the effect of the explant source and combinations of two growth regulators, auxin (indole acetic acid, IAA) and kinetin (KIN), on the morphogenetic response; another to investigate the effect of the combination of growth regulators on the morphogenetic response of hypocotyl segments, and another to evaluate how sucrose concentration affects the development of adventitious shoots. The best shoot induction was obtained using hypocotyl segments and stem apices, while rhizogenesis was greatest in leaves with a petiole. The number of adventitious shoots per explant on hypocotyl segments increased with 10 and 20 mg/L KIN, combined with 0.02 mg/L IAA in the variety Santa Luzia. Sucrose combined with these growth regulator levels increased the average number of calli; these were optimally produced when 45 g/L sucrose and 0.01 mg/L IAA + 20 mg/L KIN were applied. Only sucrose concentration influenced shoot proliferation in the two S. sessiliflorum varieties, with a maximum at 17.5 g/L.
-
Directory of Open Access Journals (Sweden)
Gabriel Ordaz
2011-06-01
Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.Chemical composition of essential oils from leaves of Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae and Solanum subinerme (Solanaceae from Sucre, Venezuela. Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary
-
Production of Pharmaceutical Proteins in Solanaceae Food Crops
Directory of Open Access Journals (Sweden)
Giorgio De Guzman
2013-01-01
Full Text Available The benefits of increased safety and cost-effectiveness make vegetable crops appropriate systems for the production and delivery of pharmaceutical proteins. In particular, Solanaceae edible crops could be inexpensive biofactories for oral vaccines and other pharmaceutical proteins that can be ingested as minimally processed extracts or as partially purified products. The field of crop plant biotechnology is advancing rapidly due to novel developments in genetic and genomic tools being made available today for the scientific community. In this review, we briefly summarize data now available regarding genomic resources for the Solanaceae family. In addition, we describe novel strategies developed for the expression of foreign proteins in vegetable crops and the utilization of these techniques to manufacture pharmaceutical proteins.
-
Directory of Open Access Journals (Sweden)
Andi Gita Maulidyah Indraswari
2016-12-01
Full Text Available Tomato (Solanum lycopersicum L. is a hermaphrodite plant and capable of auto pollination. However it still need pollinators to maximize pollination success. This research was aimed to determine the diversity, foraging activity of pollinator bees and its effectiveness on seeds and fruits formation of tomato. Scan sampling method was used to determine the diversity of pollinators and focal sampling method was used to observe visiting behavior of the bees. We conducted two experiments i.e., screen caged plants and open plants to compare the effect of the bee pollinators on fruits and seeds set formation. Results showed that eleven species of bees were found, i.e., Megachile conjuncta Smith, Megachile fulfifrons Smith, Megachile unbripennis Smith, Xylocopa confusa Latreille, Xylocopa latipes Drury, Xylocopa caerulea Fabricius, Ceratina cognata Latreille, Nomia quadridentata Bingham, Amegilla cyrtandrae Lieftinck, Amegilla burneensis Friese, and Apis cerana Fabricius. Three species of bees were dominant, i.e., X. confusa, A. cyrtandrae, and C. cognata. Bee, X. confusa visited more flowers per minute, followed by A. cyrtandrae and C. cognata. The longest species visiting in plants were C. cognata, followed by X. confusa and A. cyrtandrae. Bee pollinators increase 8.92% of fruiting, 43% of fruit size, 189% of number of seeds per fruit, and 355% of weight of seeds of tomato plants.
-
Directory of Open Access Journals (Sweden)
M.E. GALLON
2015-01-01
Full Text Available RESUMO A espécie vegetal Solanum lycocarpum, Solanaceae, popularmente conhecida como lobeira, está distribuída por todo o Brasil, principalmente em áreas do cerrado. Estudos comprovam que os frutos possuem diversas atividades e, atualmente, estão sendo utilizados no tratamento da diabetes. As folhas são utilizadas popularmente contra afecções das vias urinárias, cólicas abdominais e renais, espasmos e epilepsia, porém são poucos os estudos científicos que verificam as atividades farmacológicas das folhas. Assim, torna-se necessária a determinação de parâmetros anatômicos, físico-químicos e fitoquímicos que auxiliarão em futuras identificações e controle de qualidade da droga vegetal. Neste estudo foi realizada a coleta, secagem e pulverização das folhas de Solanum lycocarpum para a obtenção da droga vegetal e posterior caracterização desta. As análises microscópicas do pecíolo, nervura central e mesofilo revelaram características típicas da família Solanaceae, observando-se um sistema vascular bicolateral e a presença de areia cristalina e tricomas estrelados. A triagem fitoquímica, constatou a presença de taninos, flavonoides, esteróides e triterpenos, cumarinas e saponinas. Obteve-se o teor médio de 9,90% de perda por dessecação, 7,91% de cinzas totais e de 0,37% de cinzas insolúveis em ácidos. Para as substâncias extraíveis por álcool, o teor médio encontrado foi de 14,479% para o método de extração por Soxhlet e 0,987% para o método de extração a frio. Assim, espera-se que esses dados possam ser utilizados na identificação e controle de qualidade da droga vegetal de Solanum lycocarpum para a produção de novos medicamentos fitoterápicos.
-
International Nuclear Information System (INIS)
Flechas, Henry; Sanchez, Laura; Silva, Jairo
2008-01-01
This research includes the study of aerial parts (fruits) of lulo de monte (Solanum quitoense var. Septentrionale).The main objective of this research was to determine the secondary metabolites and especially the presence and quantity of alkaloidal saponins, which are common in the Solanaceae family. These substances are used as precursors for the manufacture of several steroid-type drugs, hormones and anti-inflammatories. The study was conducted with species of three different origins and three different maturing stages gathered in the department of Cundinamarca, Colombia between 2.400 and 2.600 meters above sea level during the period from March to June. Sapogenins were extracted, isolated and purified through various techniques used for this purpose. The presence of saponins was proved through physical and chemical analysis, and the structural elucidation through NMR and IR spectroscopic techniques. The presence of hecogenin in green fruits from the three sources was determined. This molecular structure corresponds to a non-steroidal sapogenin reported in this species.
-
Directory of Open Access Journals (Sweden)
Marcelo Gonzaga de Freitas Araújo
2010-11-01
Full Text Available
Neste trabalho avaliou-se o perfil fitoquímico e a toxicidade preliminar frente a larvas de Artemia salina do extrato etanólico de frutos de Solanum lycocarpum. O extrato foi submetido à analise fitoquímica preliminar para identificação das principais classes de metabolitos secundários presentes e testado frente a larvas de A. salina para obtenção das concentrações letais médias (CL50%. Os testes fitoquímicos demonstraram a presença de fenóis, taninos, saponinas, alcalóides e esteróides e triterpenos livres. O extrato foi fracionado em diferentes solventes para a avaliação da toxicidade frente à A. salina, apresentando considerável citotoxicidade encontrada na fração hidroalcoólica (CL50% = 285,546 µg/mL. Palavras-chave: Solanum lycocarpum, Artemia salina, triagem fitoquímica preliminar. ABSTRACT The phytochemical profile of ethanolic extract of Solanum lycocarpum fruits was analyzed and preliminary toxicity tests were performed against brine shrimp larvae. The extract was subjected to preliminary phytochemical analysis to identify the main classes of secondary metabolites and tested against the larvae of A. salina to obtain the median lethal concentrations (LC50%. The phytochemical tests showed the presence of phenols, tannins, saponins, alkaloids and free steroids. The extract was fractionated with various solvents for toxicity testing against the larvae and the hydroalcoholic fraction showed considerable cytotoxicity (CL50% = 285.546 g/mL. Keywords: Solanum lycocarpum, Artemia salina, phytochemical screening
-
Lifescience Database Archive (English)
Full Text Available QT96944 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT97016 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96931 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96911 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96668 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96940 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96935 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96933 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96937 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT97018 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96927 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96946 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Lifescience Database Archive (English)
Full Text Available QT96929 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.
-
Directory of Open Access Journals (Sweden)
João Vasconcellos-Neto
2009-12-01
Full Text Available The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of "nativo" vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous, and one species of lizard (Tropidurus torquatus fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds, 19% (crab-eating fox and 4% (lizards. Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control, bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.O propósito deste estudo foi analisar a dispersão de sementes e o estabelecimento de Solanum thomasiifolium em uma área de vegetação de "nativo" no Estado do Espírito Santo, na costa do sudeste do Brasil. Dez espécies de aves, o cachorro-do-mato (Cerdocyon thous e uma espécie de lagarto (Tropidurus torquatus alimentaram-se de frutos de S. thomasiifolium e dispersaram sementes viáveis em suas fezes. A contribuição proporcional de cada um destes grupos na dispersão de sementes foi de 77% para aves, 19% para o cachorro-do-mato e 4% para o lagarto. Formigas também contribuíram com a dispersão de sementes. Mais sementes foram depositadas nas ilhas de vegetação do que nas
-
Aline Schwarz
2005-01-01
A Solanum lycocarpum St. Hil (Solanaceae) é uma planta nativa do cerrado brasileiro, cujos frutos possuem os glicoalcalóides esteroidais solasonina e solamargina. É possível que a ingestão de frutos que contenham esses glicoalcalóides possam interferir no equilíbrio do sistema endócrino. O presente estudo foi realizado com o objetivo de avaliar os possíveis efeitos tóxicos provenientes da ingestão diária de frutos verdes da S. lycocarpum (10% na ração) por ratas prenhes, a partir do 6° dia da...
-
Directory of Open Access Journals (Sweden)
Stefano Salvo Aires
2005-06-01
Full Text Available Investigaram-se os efeitos de extratos aquosos de folhas e frutos de Solanum lycocarpum na germinação e crescimento inicial de Sesamum indicum em solo. Os experimentos foram conduzidos sob temperaturas de 22, 30 e 38 ºC. O extrato de folhas não interferiu significativamente no tempo médio, mas reduziu a germinabilidade e diminuiu o pico de germinação nas três temperaturas. Esse extrato não interferiu significativamente no crescimento da parte aérea, exceto a 30 ºC, mas reduziu significativamente o crescimento da radícula nas três temperaturas. Os extratos de frutos aumentaram significativamente o tempo médio de germinação a 30 ºC e reduziram a germinabilidade a 22 ºC. Também reduziram tanto o crescimento aéreo quanto das raízes das plântulas. Os resultados mostram que as propriedades alelopáticas de Solanum lycocarpum se manifestam no substrato solo em ampla faixa de temperatura.The effects of leaf aqueous extracts (3% and ground fruits (0.5% and 1% of Solanum lycocarpum were tested on Sesanum indicum seed germination and early seedling growth in soil. The experiments were conducted at 22 ºC, 30 ºC and 38 ºC. The leaf extract did not interfere significantly on the average time for germination, but it reduced the germinability and the germination peak at the three temperatures tested. The leaf extract did not alter substantially shoot growth, except at 30 ºC, but reduced significantly root growth at the three temperatures. The ground fruits increased significantly the average time for germination at 30 ºC, and reduced the germinability at 22 ºC. These ground fruits added to the soil reduced shoot and root growth in all temperatures tested. These results suggest allelopathic effects of Solanum lycocarpum debris in soil onto a large range of temperatures.
-
Hidayat, Topik; Barlian, Andri; Kusdianti, R.; Kirana, Rinda
2017-05-01
Potato (Solanum tuberosum L.; Solanaceae) is an important commodity in Indonesia as one of the main crop after rice. Recently some new varieties have been released, but their relationship have not been studied yet. The purpose of this research was to determine the relationship among nine varieties of potatoes. Phenetic analysis was conducted using 27 morphological character states, which was derived from stems, leaves, and tubers. The character states observed were scored, and further analyzed based on Unweighted Pair Group Method with Arithmetic Mean (UPGMA) method. The results showed a high diversity of morphological character states, of which 20 states were significantly different across the varieties. Phenogram indicated that the nine varieties of potato were classified into three main groups. While the first group was consisted of varieties of Cipanas, Granola, Atlantic, and Repita, the second group was housed of Manohara and GM 05. The third group was composed of Margahayu, Mb 17, and Maglia. This pattern of relationships can be used as one of the basis in the process of crossbreeding to assemble the new varieties. The crossbreeding will be better if it is made between distantly related varieties.
-
Morphological Characters, Occurrence and Distribution among ...
African Journals Online (AJOL)
ADOWIE PERE
Key words: Solanaceae, Solanum, Stomata, trichomes, Complements, Comparative. .... kind of oil secretory function which gave the leaves and stems glossary outlook. .... 25. 96. 20.66%. Anomocyti c. CWO13. Capsicum frutescens. Linn. 5. 78.
-
Paz, Rosalía Cristina; Kozaczek, Melisa Eliana; Rosli, Hernán Guillermo; Andino, Natalia Pilar; Sanchez-Puerta, Maria Virginia
2017-10-01
Transposable elements are the most abundant components of plant genomes and can dramatically induce genetic changes and impact genome evolution. In the recently sequenced genome of tomato (Solanum lycopersicum), the estimated fraction of elements corresponding to retrotransposons is nearly 62%. Given that tomato is one of the most important vegetable crop cultivated and consumed worldwide, understanding retrotransposon dynamics can provide insight into its evolution and domestication processes. In this study, we performed a genome-wide in silico search of full-length LTR retroelements in the tomato nuclear genome and annotated 736 full-length Gypsy and Copia retroelements. The dispersion level across the 12 chromosomes, the diversity and tissue-specific expression of those elements were estimated. Phylogenetic analysis based on the retrotranscriptase region revealed the presence of 12 major lineages of LTR retroelements in the tomato genome. We identified 97 families, of which 77 and 20 belong to the superfamilies Copia and Gypsy, respectively. Each retroelement family was characterized according to their element size, relative frequencies and insertion time. These analyses represent a valuable resource for comparative genomics within the Solanaceae, transposon-tagging and for the design of cultivar-specific molecular markers in tomato.
-
Directory of Open Access Journals (Sweden)
Guilherme Augusto Ferreira da Costa
2015-01-01
Full Text Available Ethanol extract and fractions obtained from leaves of Solanum lycocarpum were examined in order to determine their phenolic composition, antioxidant, antibacterial, anti-inflammatory, and cytotoxic potential. High performance liquid chromatography coupled with DAD analysis indicated that the flavonoids apigenin and kaempferol were the main phenolic compounds present in dichloromethane and ethyl acetate fractions, respectively. The antioxidant activity was significantly more pronounced for dichloromethane, ethyl acetate, and hydroethanol fractions than that of the commercial antioxidant 2,6-di-tert-butyl-4-methylphenol. The hexane and dichloromethane fractions were more active against the tested bacteria. The hydroethanol fraction exhibited significant anti-inflammatory activity at the dose of 75 and 150 mg/kg in the later phase of inflammation. However, the antiedematogenic effect of the higher dose of the ethyl acetate fraction (150 mg/kg was more pronounced. The ethyl acetate fraction also presented a less cytotoxic effect than the ethanol extract and other fractions. These activities found in S. lycocarpum leaves can be attributed, at least in part, to the presence of phenolic constituents such as flavonoids. This work provided the knowledge of phenolic composition in the extract and fractions and the antioxidant, antibacterial, anti-inflammatory, and cytotoxic activities of leaves of S. lycocarpum.
-
Lifescience Database Archive (English)
Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop
-
Lifescience Database Archive (English)
Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT
-
Lifescience Database Archive (English)
Full Text Available entage concerning shoot regeneration 2 ME10-141 ... Chr07 19.51 6.84 ... 10.1186/1471-2229-11-140 22014149 ... QT73653 Solanum lycopersicum Solanaceae SpRg-7 In vitro plant regeneraion bud perc
-
Directory of Open Access Journals (Sweden)
Robinson Antonio Pitelli
2008-11-01
Full Text Available Metriona elatior Klug é potencial candidato para o controle biológico de Solanum viarum Dunal (joá-bravo, pois as larvas e adultos se alimentam de suas folhas e têm baixa taxa de dispersão. A especificidade é um forte requisito para a adequabilidade de um organismo como agente de controle biológico, especialmente pela estratégia inundativa. Desse modo, a preferência alimentar do adulto desse inseto em laboratório foi avaliada em 14 híbridos de Solanum melogena Linnaeus (berinjela. A criação estoque foi mantida em laboratório, com os indivíduos se alimentando de folhas do joá-bravo. O estudo foi realizado utilizando-se testes de dupla e múltipla escolha, em períodos de alimentação de 24 e 48h, oferecendo-se discos de tecido foliar, em condições de placas de Petri. As avaliações da sobrevivência e consumo foliar dos insetos adultos recém-emergidos foram realizadas em folhas de joá-bravo e dos híbridos de berinjela, mantidas túrgidas pela imersão do pecíolo em água. A área foliar foi medida antes e após quatro dias de exposição ao inseto. M. elatior apresentou preferência para alimentação, sobrevivência e consumo na planta daninha. A preferência do crisomelídeo foi maior para o híbrido Minikuro Kowishiki de berinjela.Metriona elatior Klug is a potential biocontrol agent for Solanum viarum Dunal (tropical soda apple, because larvae and adults feed on its leaves and this species shows a low dispersion rate. Specificity plays a major role in the feasibility of an organism as a biological control agent, especially in the inundative strategy. The feeding preference of M. elatior adults was evaluated to 14 eggplant (Solanum melogena Linnaeus hybrids. Mass rearing was carried out under lab conditions, with the insect feeding directly on S. viarum leaves. The study started with dual and multiple choice tests in 24 and 48 hour feeding times, by offering leaf disks in Petri dish conditions. Survival and leaf
-
Lifescience Database Archive (English)
Full Text Available QT96955 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr08 ... 10.1007/s00122-013-2254-y 24408376
-
Lifescience Database Archive (English)
Full Text Available QT96953 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376
-
Lifescience Database Archive (English)
Full Text Available QT96951 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr01 ... 10.1007/s00122-013-2254-y 24408376
-
Lifescience Database Archive (English)
Full Text Available QT62244 Solanum lycopersicum Solanaceae RXopJ4 resistance locus resistance to bacterial spot... disease resistance to bacterial spot disease (Xanthomonas perforans (Xp)) 3 J350 ... Chr06 ... 10.1007/s00122-012-2004-6 23117718
-
Lifescience Database Archive (English)
Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857
-
Lifescience Database Archive (English)
Full Text Available QT75069 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr06 101.1-107.3 3.68 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75066 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr04 65.1-81.9 2.15 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75072 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr08 72.6-87.8 2.32 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75075 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr12 49.5-63.0 2.54 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
ANÁLISIS CARIOTÍPICO DE CAPSICUM PUBESCENS (SOLANACEAE "ROCOTO"
Directory of Open Access Journals (Sweden)
Misael Guevara
2014-06-01
Full Text Available Análisis cariotípico de Capsicum pubescens R&P (Solanaceae. Los cromosomas han sido descritos, comparados y dibujados, usando una técnica de coloración modificada, C. pubescens tiene un número cromosómico diploide 2n = 24, de los cuales 11 pares son metacéntricos y 1 par submetacéntrico.
-
Antioxidant Activity and Phytochemical Composition of the Leaves of Solanum guaraniticum A. St.-Hil
Directory of Open Access Journals (Sweden)
Félix Alexandre Antunes Soares
2012-10-01
Full Text Available Solanum guaraniticum is a shrub belonging to the Solanaceae family popularly known in Brazil as jurubeba or false-jurubeba. The aim of this study was to evaluate the antioxidant activity of crude extract and chloroform, ethyl acetate and n-butanol fractions from its leaves, verifying the ability to remove reactive species and identify and quantify phenolic compounds. The ethyl acetate fraction showed the highest amount of total polyphenols (546.57 ± 2.35 mg gallic acid equivalent/g and the lowest IC50 (9.11 ± 0.75 µg/mL by the DPPH method. Furthermore, the chloroform fraction presented the highest content of flavonoids (75.73 ± 0.34 mg rutin equivalents/g, tannins (56.03 ± 0.68 mg catechin equivalents/g and alkaloids (10.79 ± 0.06 mg/g. This fraction was effective in the scavenging of reactive species by 2′,7′-dichlorofluorescein diacetate assay, in addition to completely reducing protein carbonyl content and reducing lipid peroxidation at basal levels even at low concentrations. Chlorogenic, caffeic and rosmarinic acids were identified and quantified by HPLC/DAD. These results show that S. guaraniticum is rich in phenolic compounds and has potential as an antioxidant.
-
Directory of Open Access Journals (Sweden)
Renata Fabiane Jorge Tiossi
2012-01-01
Full Text Available Solanum lycocarpum (Solanaceae is native to the Brazilian Cerrado. Fruits of this species contain the glycoalkaloids solasonine (SN and solamargine (SM, which display antiparasitic and anticancer properties. A method has been developed for the extraction and HPLC-UV analysis of the SN and SM in different parts of S. lycocarpum, mainly comprising ripe and unripe fruits, leaf, and stem. This analytical method was validated and gave good detection response with linearity over a dynamic range of 0.77–1000.00 μg mL−1 and recovery in the range of 80.92–91.71%, allowing a reliable quantitation of the target compounds. Unripe fruits displayed higher concentrations of glycoalkaloids (1.04% ± 0.01 of SN and 0.69% ± 0.00 of SM than the ripe fruits (0.83% ± 0.02 of SN and 0.60% ± 0.01 of SM. Quantitation of glycoalkaloids in the alkaloidic extract gave 45.09% ± 1.14 of SN and 44.37% ± 0.60 of SM, respectively.
-
Lifescience Database Archive (English)
Full Text Available QT75103 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 102.7-108.3 5.59 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75102 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 38.9-56.2 3.42 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75104 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr09 100.8-112.7 2.78 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae) is a key pest of potato (Solanum tuberosum L., Solanales: Solanaceae) and a vector of "Candidatus Liberibacter solanacearum," the pathogen associated with zebra chip disease. In addition to its presence on cultivated crops, the p...
-
Lifescience Database Archive (English)
Full Text Available QT97962 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536041 ... Chr01 67.8 3.83 ... 10.1007/s11032-015-0415-1 26612975
-
Lifescience Database Archive (English)
Full Text Available QT97965 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536863 ... Chr06 75.9 3.84 ... 10.1007/s11032-015-0415-1 26612975
-
Alvarez, A.E.; Garzo, E.; Verbeek, M.; Vosman, B.; Dicke, M.; Tjallingii, W.F.
2007-01-01
Potato leafroll virus (PLRV; genus Polerovirus, family Luteoviridae) is a persistently transmitted circulative virus that depends on aphids for spreading. The primary vector of PLRV is the aphid Myzus persicae (Sulzer) (Homoptera: Aphididae). Solanum tuberosum L. potato cv. Kardal (Solanaceae) has a
-
Directory of Open Access Journals (Sweden)
Causse Mathilde
2008-12-01
Full Text Available Abstract Background The natural phenotypic variability present in the germplasm of cultivated plants can be linked to molecular polymorphisms using association genetics. However it is necessary to consider the genetic structure of the germplasm used to avoid false association. The knowledge of genetic structure of plant populations can help in inferring plant evolutionary history. In this context, we genotyped 360 wild, feral and cultivated accessions with 20 simple sequence repeat markers and investigated the extent and structure of the genetic variation. The study focused on the red fruited tomato clade involved in the domestication of tomato and confirmed the admixture status of cherry tomatoes (Solanum lycopersicum var. cerasiforme. We used a nested sample strategy to set-up core collection maximizing the genetic diversity with a minimum of individuals. Results Molecular diversity was considerably lower in S. lycopersicum i.e. the domesticated form. Model-based analysis showed that the 144 S. lycopersicum var. cerasiforme accessions were structured into two groups: one close to the domesticated group and one resulting from the admixture of the S. lycopersicum and S. pimpinellifolium genomes. SSR genotyping also indicates that domesticated and wild tomatoes have evolved as a species complex with intensive level of hybridization. We compiled genotypic and phenotypic data to identify sub-samples of 8, 24, 32 and 64 cherry tomato accessions that captured most of the genetic and morphological diversity present in the entire S. lycopersicum var. cerasiforme collection. Conclusion The extent and structure of allelic variation is discussed in relation to historical events like domestication and modern selection. The potential use of the admixed group of S. lycopersicum var. cerasiforme for association genetics studies is also discussed. Nested core collections sampled to represent tomato diversity will be useful in diversity studies. Molecular and
-
Shaw, Scott R; Jones, Guinevere Z
2009-01-01
A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nymphalidae. A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nymphalidae.
-
Tai, Helen H; Worrall, Kraig; Pelletier, Yvan; De Koeyer, David; Calhoun, Larry A
2014-09-10
The Colorado potato beetle Leptinotarsa decemlineata (Say) (CPB) is a coleopteran herbivore that feeds on the foliage on Solanum species, in particular, potato. Six resistant wild Solanum species were identified, and two of these species had low levels of glycoalkaloids. Comparative analysis of the untargeted metabolite profiles of the foliage using UPLC-qTOF-MS was done to find metabolites shared between the wild species but not with Solanum tuberosum (L.) to identify resistance-related metabolites. It was found that only S. tuberosum produced the triose glycoalkaloids solanine and chaconine. Instead, the six wild species produced glycoalkaloids that shared in common tetrose sugar side chains. Additionally, there were non-glycoalkaloid metabolites associated with resistance including hydroxycoumarin and a phenylpropanoid, which were produced in all wild species but not in S. tuberosum.
-
Niu, Yiling; Zhao, Tingting; Xu, Xiangyang; Li, Jingfu
2017-01-01
Solanum lycopersicum , belonging to Solanaceae, is one of the commonly used model plants. The GRAS genes are transcriptional regulators, which play a significant role in plant growth and development, and the functions of several GRAS genes have been recognized, such as, axillary shoot meristem formation, radial root patterning, phytohormones (gibberellins) signal transduction, light signaling, and abiotic/biotic stress; however, only a few of these were identified and functionally characterized. In this study, a gene family was analyzed comprehensively with respect to phylogeny, gene structure, chromosomal localization, and expression pattern; the 54 GRAS members were screened from tomato by bioinformatics for the first time. The GRAS genes among tomato, Arabidopsis , rice, and grapevine were rebuilt to form a phylogenomic tree, which was divided into ten groups according to the previous classification of Arabidopsis and rice. A multiple sequence alignment exhibited the typical GRAS domain and conserved motifs similar to other gene families. Both the segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in tomato; the expression patterns across a variety of tissues and biotic conditions revealed potentially different functions of GRAS genes in tomato development and stress responses. Altogether, this study provides valuable information and robust candidate genes for future functional analysis for improving the resistance of tomato growth.
-
Pharmacognostic and phytochemical evaluation of the Solanun ...
African Journals Online (AJOL)
Solanum sisymbriifolium Lam. (Solanaceae) is an important medicinal herb in Ayurvedic medicine. In the present investigation, the detailed pharmacognostic study of S. sisymbriifolium leaf was carried out to lay down the standards which could be useful in future experimental studies. The study included macroscopy, ...
-
Lifescience Database Archive (English)
Full Text Available QT75157 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr09 106.5-112.7 2.41 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75239 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr12 39.4-64.0 2.02 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75106 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 50% of the ger...mination of viable seeds (h-1) 2 ... Chr04 65.1-80.4 2.29 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75274 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-31.3 2.94 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75205 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-26.6 3.43 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available QT75233 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 7.6-23.7 3.5 ... 10.1111/j.1365-3040.2011.02463.x 22074055
-
Lifescience Database Archive (English)
Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT
-
The Transcriptome of the Reference Potato Genome Solanum tuberosum Group Phureja Clone DM1-3 516R44
Massa, Alicia N.; Childs, Kevin L.; Lin, Haining; Bryan, Glenn J.; Giuliano, Giovanni; Buell, C. Robin
2011-01-01
Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family. PMID:22046362
-
Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum.
Huang, Shengxiong; Gao, Yongfeng; Liu, Jikai; Peng, Xiaoli; Niu, Xiangli; Fei, Zhangjun; Cao, Shuqing; Liu, Yongsheng
2012-06-01
The WRKY transcription factors have been implicated in multiple biological processes in plants, especially in regulating defense against biotic and abiotic stresses. However, little information is available about the WRKYs in tomato (Solanum lycopersicum). The recent release of the whole-genome sequence of tomato allowed us to perform a genome-wide investigation for tomato WRKY proteins, and to compare these positively identified proteins with their orthologs in model plants, such as Arabidopsis and rice. In the present study, based on the recently released tomato whole-genome sequences, we identified 81 SlWRKY genes that were classified into three main groups, with the second group further divided into five subgroups. Depending on WRKY domains' sequences derived from tomato, Arabidopsis and rice, construction of a phylogenetic tree demonstrated distinct clustering and unique gene expansion of WRKY genes among the three species. Genome mapping analysis revealed that tomato WRKY genes were enriched on several chromosomes, especially on chromosome 5, and 16 % of the family members were tandemly duplicated genes. The tomato WRKYs from each group were shown to share similar motif compositions. Furthermore, tomato WRKY genes showed distinct temporal and spatial expression patterns in different developmental processes and in response to various biotic and abiotic stresses. The expression of 18 selected tomato WRKY genes in response to drought and salt stresses and Pseudomonas syringae invasion, respectively, was validated by quantitative RT-PCR. Our results will provide a platform for functional identification and molecular breeding study of WRKY genes in tomato and probably other Solanaceae plants.
-
Directory of Open Access Journals (Sweden)
Raquel Bezerra Chiavegatto
2017-06-01
Full Text Available Solanum lycocarpum St.-Hil popularly known as ‘fruta-de-lobo’ or ‘lobeira’ is native to the Brazilian Cerrado, and used in folk medicine due to its phytotherapic properties. The action of S. lycocarpum on the cell cycle and chromosomes in order to demonstrate whether there are aneugenic and/or clastogenic effects is unknown. Thus, this study aimed at investigating the cytotoxic and genotoxic potential of methanol and hexane extracts of S. lycocarpum on growth and cell cycle of Lactuca sativa and Allium cepa. Roots from both species were exposed for 72 hours to methanol and hexane extracts with 50, 100, and 200 µg mL-1 of S. lycocarpum. Slides were prepared by the squash technique and then analyzed to determine the mitotic index and the total of chromosomal and nuclear abnormalities. The frequencies of chromosomal and nuclear abnormalities were high and significant with a dose-dependent effect, indicating that S. lycocarpum has a cytotoxic and genotoxic action depending on the dose used on meristem cells of A. cepa and L. sativa.
-
Reaction of genotypes of lulo (Solanum quitoense Lam. to Meloidogyne spp. under field conditions
Directory of Open Access Journals (Sweden)
Claudia Salazar-González
2017-05-01
Full Text Available In Colombia, root-knot nematodes Meloidog yne spp. are considered as one of the main constraints in lulo crop production . These nematodes can cause root damage resulting in low production. The aim of this study was to evaluate under field conditions the reaction of 16 genotypes of lulo, Solanum quitoense Lam. (Solanaceae, of the Castilla variety and the species S. hirtum Vahl., previously selected in a greenhouse experiment and categorized as moderately resistant and resistant to the attack by Meloidog yne sp. A chemical treatment and a control treatment, the latter based on the most susceptible genotype in greenhouse experiments were also included. The experiment was conducted in a lulo grove naturally infested with root-knot nematodes under a randomized complete block design with three replications and nine plants per experimental unit. The response variables were incidence, severity and yield. The incidence was higher than 80 % in all cases, but the severity varied because of their genetic condition; BR03 and BR01 being genotypes with lower rates of severity, with values of 1.0 % and 0.8 %, respectively. The yield analysis of variance showed significant differences, indicating that genotypes SQBR01 and SQLF04, reached the highest values with 4.77 and 4.74 t/ha in a total of three harvests.
-
Directory of Open Access Journals (Sweden)
Maria Cristina Gaglianone
2013-10-01
Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.
-
Directory of Open Access Journals (Sweden)
Mariana Scaramussa Deprá
2014-02-01
Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.
-
Kariyat, Rupesh R; Mauck, Kerry E; Balogh, Christopher M; Stephenson, Andrew G; Mescher, Mark C; De Moraes, Consuelo M
2013-04-22
Plant volatiles serve as key foraging and oviposition cues for insect herbivores as well as their natural enemies, but little is known about how genetic variation within plant populations influences volatile-mediated interactions among plants and insects. Here, we explore how inbred and outbred plants from three maternal families of the native weed horsenettle (Solanum carolinense) vary in the emission of volatile organic compounds during the dark phase of the photoperiod, and the effects of this variation on the oviposition preferences of Manduca sexta moths, whose larvae are specialist herbivores of Solanaceae. Compared with inbred plants, outbred plants consistently released more total volatiles at night and more individual compounds-including some previously reported to repel moths and attract predators. Female moths overwhelmingly chose to lay eggs on inbred (versus outbred) plants, and this preference persisted when olfactory cues were presented in the absence of visual and contact cues. These results are consistent with our previous findings that inbred plants recruit more herbivores and suffer greater herbivory under field conditions. Furthermore, they suggest that constitutive volatiles released during the dark portion of the photoperiod can convey accurate information about plant defence status (and/or other aspects of host plant quality) to foraging herbivores.
-
Highly Oxygenated Flavonoids from the Leaves of Nicotiana plumbaginifolia (Solanaceae)
Md. Shafiullah Shajib; Bidyut Kanti Datta; Md. Hossain Sohrab; Mohammad Abdur Rashid; Lutfun Nahar; Satyajit Dey Sarker
2017-01-01
Nicotiana plumbaginifolia Viv. is an annual herb of the family Solanaceae, which grows abundantly in the weedy lands of Bangladesh . This plant possesses analgesic, antibacterial, anti-anxiety and hepatoprotective properties, and produces various phenolic compounds including flavonoids. The present study afforded determination of total phenolic and flavonoid contents, and for the first time, the isolation and characterization of highly oxygenated flavonoids, e.g., 3,3' ,5,6,7,8-hexamethoxy- 4...
-
Lectotypifications, synonymy, and a new name in Capsicum (Solanoideae, Solanaceae)
Barboza, Gloria E.
2011-01-01
Abstract Considerable confusion exists within Capsicum (Solanaceae) regarding the status and typification of several names, in part due to misidentifications. Some types were destroyed in Berlin during the Second World War, some have not been found by modern systematics, while others exhibit uncertain locality data or contain material from more than one species. Fourteen lectotypes, synonyms, and a new name, Capsicum eshbaughii Barboza nom. nov.,are proposed here. PMID:22171173
-
Is Solanum ferox var. ferox (Solanaceae) extinct?
Heiser, C.B.
2001-01-01
In 1995 I wrote letters to over 50 people (botanists, agricultural scientists, and former students of Indiana University) in south-eastern Asia trying to obtain a few seeds of Solanumferox L. var. ferox (S. involucratum Blume). I had over 25 replies, five of which included seeds, but none of the
-
Energy Technology Data Exchange (ETDEWEB)
Pinto, Francisco das Chagas L.; Torres, Maria da conceicao M.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L., E-mail: opessoa@ufc.br [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Centro de Ciencias. Dept. de Quimica Organica e Inorganica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense, Campos, RJ (Brazil). Dept. de Quimica; Guedes, Maria Lenise da Silva [Universidade Federal da Bahia (UFBA), Ondina, BA (Brazil). Inst. de Biologia. Dept. de Botanica
2013-10-01
The chemical investigation of the stem EtOH extract of S. buddleifolium resulted in the isolation of terpenoids, amides, lignans and a steroidal alkaloid. Based on HRMS, IR and {sup 1}H and {sup 13}C NMR data analysis, the structures of the isolated compounds were identified as: 13-hydroxysolavetivone, betulinic acid, N-trans-caffeoyltyramine, N-trans-feruloyldopamine, N-trans-p-cumaroyltyramine, N-trans-feruloyltyramine, N-trans-feruloyl- 3'-O-methoxydopamine, alangilignoside C, isolariciresinol, polistachiol, (+)-(8R,7'S,8'S)-3{alpha}-O-({beta}-D-glucopiranosyl)-lioniresinol, (-)-(8S,7'R,8'R)-3{alpha}-O-({beta}-D-glucopiranosyl)-lioniresinol and solamargine. The occurrence of terpenoids and amides is common in Solanum, unlike lignans which are rare. The isolated lignans described in this work are reported for the first time in the genus Solanum. (author)
-
MOREIRA, RAQUEL R.D.; MARTINS, GILMARCIO Z.; MAGALHAES, NATHALIA O.; ALMEIDA, ADELIA E.; PIETRO, ROSEMEIRE C.L.R.; SILVA, FLAVIA A. J.; CICARELLI, REGINA M.B.
2013-01-01
O objetivo deste estudo foi avaliar a potencial atividade tripanocida do extrato bruto etanólico dos frutos de Solanum palinacanthum, Solanum lycocarpum e do glicoalcalóide solamargina. Pó do fruto seco de S. palinacanthum e S. lycocarpum foram submetidos a extracção por refluxo com etanol a 96% e solamargina foi isolada a partir do extrato bruto de S. palinacanthum. Foram determinadas de ambos os extratos e a solamargina a atividade tripanocida utilizando o ensaio colorimétrico MTT. O Extrat...
-
Lifescience Database Archive (English)
Full Text Available QT96907 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr11 ... 10.1007/s00122-013-2254-y 24408376
-
Lifescience Database Archive (English)
Full Text Available QT96905 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376
-
Taxonomy of Rhagoletis population associated with wild plums in Chile
International Nuclear Information System (INIS)
Frias, Daniel; Alvina, Andres
2000-01-01
In South America, there are about fifteen Rhagoletis species that live in association with wild and cultivated Solanaceae host plants (Foote 1981, Frias 1992). The principal information on taxonomy for these species is the morphology of adults. Thus, in the genus Rhagoletis, in general, there is little information about immature stages especially on first and second larva instars (Steck et al. 1990, Carrol and Wharton 1989, Steck and Wharton 1988, Persson 1963, White and Elson-Harris 1992, Hernandez-Ortiz 1992, 1993, Frias et al. 1993). Presently, in Chile, there are 4 species associated with Solanaceae host plants. R. tomatis Foote and R. nova (Schiner) are associated with cultivated Solanaceae Lycopersicum esculentum Miller or cultivated tomatoes and Solanum muricatum Aiton or sweet cucumber respectively. R. conversa Bethes has two Solanum host plants, S. nigrum L. and S. tomatillo (Remy) Phil. F. (Frias et al. 1984). The host for R. penela Foote is unknown. Moreover, in the last few years, a population on wild plums of the Myrobalan variety (Rosaceae) was detected (Gonzalez 1989). At present, there is no information about the origin and taxonomy of this population. In this work, we have studied the morphology of eggs, three instar larvae, pupae and adults of this population associated with wild plums as well as aspects of its geographical distribution in Chile
-
Effect of ripening period on composition of pepino (Solanum ...
African Journals Online (AJOL)
USER
% for raw and ... of glucose and fructose declined during ripening, whereas sucrose showed an increase in ... Solanaceae like tomato, potato, tobacco and pepper ... Abbreviation: NDF, Neutral detergent fiber; ADF, acid detergent fiber;. HPLC,.
-
Chromosome evolution in Solanum traced by cross-species BAC-FISH
Szinay, D.; Wijnker, E.; Berg, van den R.G.; Visser, R.G.F.; Jong, de J.H.S.G.M.; Bai, Y.
2012-01-01
Chromosomal rearrangements are relatively rare evolutionary events and can be used as markers to study karyotype evolution. This research aims to use such rearrangements to study chromosome evolution in Solanum. Chromosomal rearrangements between Solanum crops and several related wild species were
-
Content of atropine and scopolamine in poisonous solanaceae plants from Slovenia
Javor Kac; Uroš Klančar; Aleš Mlinarič; Aleš Krbavčič
2006-01-01
Background: Some species from the Solanaceae family are still the cause of serious poisoning among youth in Slovenia. Usually intoxication is due to abuse of these plants to provoke hallucinations. There is still not enough data about the alkaloid content of these plants growing in Slovenia.Methods: Different plant samples were analyzed for the content of atropine and scopolamine with capillary electrophoresis after solid phase extraction of alkaloids. Plants were gathered from different area...
-
Gupta, Ramesh K; Hussain, Talib; Panigrahi, G; Das, Avik; Singh, Gireesh Narayan; Sweety, K; Faiyazuddin, Md; Rao, Chandana Venkateswara
2011-12-01
To investigate the hepatoprotective potential of Solanum xanthocarpum (Solanaceae) (S. xanthocarpum) in experimental rats to validate its traditional claim. 50% ethanolic fruit extract of S. xanthocarpum (SXE, 100, 200 or 400 mg/kg body weight) was administered daily for 14 days in experimental animals. Liver injury was induced chemically, by CCl(4) administration (1 mL/kg i. p.). The hepatoprotective activity was assessed using various biochemical parameters like aspartate aminotransferase (AST), alanine aminotransferase (ALT), Serum alkaline phosphatise (SALP) and total bilirubin. Meanwhile, in vivo antioxidant activities as lipid peroxidation (LPO), reduced glutathione (GSH), superoxide dismutase (SOD) and catalase (CAT) were screened along with histopathological studies. Obtained results demonstrated that the treatment with SXE significantly (P<0.05-<0.001) and dose-dependently prevented chemically induced increase in serum levels of hepatic enzymes. Furthermore, SXE significantly (up to P<0.001) reduced the lipid peroxidation in the liver tissue and restored activities of defence antioxidant enzymes GSH, SOD and catalase towards normal levels. Histopathology of the liver tissue showed that SXE attenuated the hepatocellular necrosis and led to reduction of inflammatory cells inflltration. The results of this study strongly indicate the protective effect of SXE against acute liver injury which may be attributed to its hepatoprotective activity, and there by scientifically support its traditional use. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
-
Étude ethnobotanique et évaluation in vitro de l'activité antifongique ...
African Journals Online (AJOL)
SARAH
2016-02-29
Feb 29, 2016 ... Torréfaction, pulvérisation. Cutané, rectale. 25 Scoparia dulcis L. Scrophulariaceae Gnongnon. GC - SZ H np. 1,75 Écorce,. Feuille pétrissage. Cutané, rectale. 26 Solanum verbascifolium. Linn. Solanaceae. Vi ahovi. GC. Arb mp. 1,75 Feuille pétrissage. Cutané, rectale. 27 Solenostemon monostachyus (P.
-
Emergência de plântulas de Lulo (Solanum quitoense Lam. em função do tempo de armazenamento
Directory of Open Access Journals (Sweden)
Uirá do Amaral
2016-06-01
Full Text Available O Lulo (Solanum quitoense Lam pertencente à família Solanaceae é originário de regiões Andinas geralmente produz aproximadamente 1.000 sementes por fruto, sendo a reprodução sexuada a principal forma de propagação desta espécie. O presente estudo objetivou avaliar a influência do tempo de armazenamento na emergência de sementes de Lulo, oriundas de três épocas de colheita. O experimento foi conduzido em delineamento inteiramente casualizado, com três tratamentos (3 meses, 6 meses e 12 meses de armazenamento e sete repetições. As sementes foram semeadas em bandejas de poliestireno de 128 células em substrato comercial Bioflora®. Observou-se que a qualidade fisiológica das sementes de Lulo decresceu significativamente quando armazenadas em sacos de papel em temperatura ambiente por período superior a seis meses. No entanto, não houve diferença significativa entre os tratamentos sobre a variável tempo médio de emergência. As variáveis analisadas apresentaram as maiores médias em sementes armazenadas por três meses, com destaque para emergência de aproximadamente 70%.
-
Directory of Open Access Journals (Sweden)
Miguel Michereff-Filho
2012-09-01
ção. Desta forma, esses acessos do subgênero Leptostemonum podem ser considerados potenciais fontes de genes de resistência tanto para B. tabaci quanto para ToSRV. Essa diversidade genética pode ser transferida para outras espécies do gênero Solanum via técnicas de biologia celular e/ou isolamento e mobilização desses genes via transgenia. Os resultados também sugerem que, em condições naturais, espécies do subgênero Leptostemonum não representam importantes fontes de inóculo de ToSRV e/ou hospedeiras alternativas para B. tabaci.The whitefly (Bemisia tabaci and the infection by Begomovirus species are two major problems affecting yield and quality of the tomato (Solanum lycopersicum crop as well as other Solanaceae species of economic importance. The present work was conducted aiming to characterize the reaction of 36 accessions of the genus Solanum subgenus Leptostemonum (= spiny Solanum species and closely related species to Tomato severe rugose virus (ToSRV and B. tabaci. Seedlings of the accessions (43 days after sowing were exposed under greenhouse conditions to viruliferous whiteflies (B. tabaci biotype B carrying an isolate of ToSRV. Two susceptible tomato cultivars were used as susceptible controls. Reaction to the virus was evaluated using a symptom severity scale and the systemic ToSRV infection was evaluated via PCR with universal begomovirus primers. A group of accessions from S. stramonifolium, S. asperolanatum, and S. jamaiscense displayed mild symptoms and low virus accumulation. The accession S. mammosum 'CNPH 035', even though tolerant, was the only one displaying clear ToSRV symptoms and conspicuous systemic spread of the virus. The remaining accessions were found to be free of ToSRV symptoms and with no indication of systemic infection. This germplasm collection was also evaluated to B. tabaci in a free-choice assay under greenhouse conditions. Significant differences were observed for the number of eggs and number of 4th instar nymphs. A
-
Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...
African Journals Online (AJOL)
STORAGESEVER
2009-10-19
Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the ...
-
Nadakuduti, Satya Swathi; Uebler, Joseph B; Liu, Xiaoxiao; Jones, A Daniel; Barry, Cornelius S
2017-09-01
Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato ( Solanum lycopersicum ), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3', and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris , tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris , PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3' position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3' position in tomato, is absent in P. axillaris Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.
-
Uebler, Joseph B.; Liu, Xiaoxiao
2017-01-01
Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato (Solanum lycopersicum), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3ʹ, and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris, tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris, PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3ʹ position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3ʹ position in tomato, is absent in P. axillaris. Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. PMID:28701351
-
DEFF Research Database (Denmark)
Jäpelt, Rie Bak; Silvestro, Daniele; Smedsgaard, Jørn
2013-01-01
Changes in vitamin D3 and its metabolites were investigated following UVB- and heat-treatment in the leaves of Solanum glaucophyllum Desf., Solanum lycopersicum L. and Capsicum annuum L. The analytical method used was a sensitive and selective liquid chromatography electrospray ionisation tandem ...
-
Directory of Open Access Journals (Sweden)
Cáceres Nilton Carlos
2003-01-01
Full Text Available A study of removal of fruits of the wild tomato, Solanum granulosoleprosum Dunal (N = 5 plants, by vertebrates was carried out in an urban environment of southern Brazil from January to May 1997 and February 1998. To verify diurnal and nocturnal removals, fruits were counted in several fruit bunches, being classified by size and color. Diurnal observations were made on plants to verify bird removal. A mist net was placed among the plants from the evening to 23:00 h to verify bat consumption. Live traps baited with S. granulosoleprosum fruits were placed on the ground among plants to verify terrestrial removers. On average it was found two ripe fruits available per bunch/day, but unripe, small, fruits were dominant (70%. Nocturnal mammals and birds-diurnal mammals partitioned fruits similarly. Bats removing fruits were Artibeus lituratus (Olfers, 1818, Pygoderma bilabiatum (Wagner, 1843 and Sturnira lilium (E. Geoffroy, 1810. Birds were Saltator similis Lafresnaye & d'Orbigny, 1837 and Thraupis sayaca (Linnaeus, 1766. Terrestrial mammals were a marsupial and three rodent species. Except for rodents, these vertebrates must be promoting the seed dispersal of S. granulosoleprosum seeds in disturbed mixed forests of southern Brazil.
-
Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...
African Journals Online (AJOL)
Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the water extract were ...
-
Rapid screening of toxic glycoalkaloids and micronutrients in edible nightshades (Solanum spp.
Directory of Open Access Journals (Sweden)
Bo Yuan
2018-04-01
Full Text Available African indigenous vegetables (AIVs because of their nutrient density have the unique potential to reduce micronutrient deficiencies in sub-Saharan Africa, yet some may also contain anti-nutritive compounds. Vegetable nightshades from Solanum americanum, Solanum nigrum, Solanum scabrum and Solanum villosum are among the major AIVs used as a leafy vegetables and consumed regularly in many countries in sub-Sahara Africa. These under-recognized food crops have not been subjected to extensive studies for their nutritional and antinutritive factors. In this study, 15 entries of the vegetable nightshades were field-grown and the leaves which are the consumed product of commerce chemically profiled by LC/ESI-MS. Twenty-three flavones, eight saponins, and two glycoalkaloids along with a phenolic acid of chlorogenic acid were identified by MS and UV data. Anti-nutrient glycoalkaloids were quantified as total aglycones after acidic hydrolysis using MS detection and found to be within safe-consumption thresholds by comparison with the glycoalkaloid level in the globally consumed Solanum member eggplants. Edible nightshades were also found to be sources of β-carotene, vitamin E and total polyphenols and exhibited high antioxidant activity. Results of this study support that consumption of vegetable nightshades are safe from the presence of glycoalkaloids and thus, can contribute to the reduction of micronutrient deficiency in sub-Sahara Africa. Keywords: Alkaloids, Flavonoids, Carotene, Vitamin E, Antioxidant activity, Saponins, Solanum
-
Directory of Open Access Journals (Sweden)
Eunyoung Seo
2016-08-01
Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.
-
Pablo Mayorga; Karen R. Pérez; Sully M. Cruz; Armando Cáceres
2010-01-01
Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...
-
Mayorga,Pablo; Pérez,Karen R.; Cruz,Sully M.; Cáceres,Armando
2010-01-01
Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...
-
Steroidal glycoalkaloids in Solanum species : consequences for potato breeding and food safety
Gelder, van W.M.J.
1989-01-01
Tuberiferous and nontuberiferous wild Solanum species are increasingly being used in potato breeding as a source of genes for disease and pest resistances and for other valuable characteristics. A disadvantage of Solanum species, from a consumers point
-
The historical role of species from the Solanaceae plant family in genetic research
Gebhardt, Christiane
2016-01-01
Key message This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Abstract Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100?years...
-
Ramamurthy, C H; Subastri, A; Suyavaran, A; Subbaiah, K C V; Valluru, L; Thirunavukkarasu, C
2016-04-01
Increased levels of environmental pollutants are linked to almost all human disorders; the efficient method to manage the human health is through naturally available dietary molecule. Solanum torvum (ST) Swartz (Solanaceae) commonly called Turkey Berry is found in Africa, Asia, and South America. Its fruit, part of traditional Indian cuisine, is a widely consumed nutritious herb, acclaimed for its medicinal value. ST aqueous extract (STAe) (250, 500, and 1000 mg/kg b.w., 6 days; oral) against acute Cadmium (Cd) (6.3 mg/kg b.w., single dose; oral) toxicity was evaluated in rats. Protective effect was assessed using serum markers, tissue antioxidants, oxidant derivatives, glycoprotein, and histopathological studies. The activities of serum marker enzymes were increased (40-60 %); antioxidant enzymes such as SOD and CAT, GSH, and its metabolic enzyme activities were decreased (50-80 %) in the liver and kidney upon Cd intoxication. During STAe pre-treatment, at doses of 250 and 500 mg/kg b.w., the above changes were brought to near normal (25-63 %). Tissue 4-hydroxynonenal, 3-nitrotyrosine, and protein carbonyls were increased (8-15 fold) in Cd-alone-treated rats, whereas pre-supplementation of STAe significantly decreased their levels and inhibited the protein glycosylation effectively. The pharmacological effect of STAe was confirmed by histopathological observations. Based on previous literature and present investigation, we conclude that ST may serve as a potential functional food against environmental contaminant such as heavy metal-induced oxidative stress.
-
Chemical constituents of Solanum buddleifolium Sendtn
International Nuclear Information System (INIS)
Pinto, Francisco das Chagas L.; Torres, Maria da conceicao M.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo; Guedes, Maria Lenise da Silva
2013-01-01
The chemical investigation of the stem EtOH extract of S. buddleifolium resulted in the isolation of terpenoids, amides, lignans and a steroidal alkaloid. Based on HRMS, IR and 1 H and 13 C NMR data analysis, the structures of the isolated compounds were identified as: 13-hydroxysolavetivone, betulinic acid, N-trans-caffeoyltyramine, N-trans-feruloyldopamine, N-trans-p-cumaroyltyramine, N-trans-feruloyltyramine, N-trans-feruloyl- 3’-O-methoxydopamine, alangilignoside C, isolariciresinol, polistachiol, (+)-(8R,7’S,8’S)-3α-O-(β-D-glucopiranosyl)-lioniresinol, (-)-(8S,7’R,8’R)-3α-O-(β-D-glucopiranosyl)-lioniresinol and solamargine. The occurrence of terpenoids and amides is common in Solanum, unlike lignans which are rare. The isolated lignans described in this work are reported for the first time in the genus Solanum. (author)
-
Ecology, Impact and Potential Control of Solanum mauritianum in Kenya
International Nuclear Information System (INIS)
Hitimana, J; Mutiso, F.M; Kipiapi, J.L; Sang, F.K
2007-01-01
Solanum mauritianum is considered as an invasive plant with unknown economic value, fast growing and aggressive gap colonizer associated with forest disturbance. It belongs to the family of Solanaceae and can grow to over 20 m in height. It is native to Southern America and threatens integrity of several natural forest in Western kenya. Surveys were undertaken in 1998 and 2005/2006 at mount Elgon and Kakamega forests to evaluate the species ecology, spread and impact on other tree species. Total enumeration of seedlings, saplings and mature individuals was done over two 1-ha-blocks in each forest. The total number of 0.1 ha plots sampled was 20 per forest in relatively lightly and heavily disturbed areas. The results the species the species relative dominance in Mount Elgon increased from 1.0% in 1998 to 48.9% in 2006, out competing the regeneration of other trees. For example at Labaa, the once dominant Diospyros abyssinica with 36% relative dominance in 1998 declined to 1.9% in 2006. This threat to the health of ecosystems is not yet noticeable in Kakamega forest where the weed relative stocking was 0.2%. A strong positive correlation (n=5, r s =0.9, p=0.95) between S. mauritianum established and charcoal burning still exists in Mount Elgon. Thorough literature review and field observations confirmed about the characteristics of s. mauritanium as weed. Proliferation strategies and opportunities underlying the successive invasion by weed have been reviewed and elements of an integrated, multidisciplinary effort to control the adverse impact of the weed in forest and outside forests identified. Measures to check the invasiveness of these species include include reducing forest gaps, monitoring it's reproductive biology to eliminate mother trees before seeding, educative campaigns to prevent local communities from domesticating this species on their farms, research programme on S. mauritianum to understand causes of it's competitive advantage over others and search
-
Steroidal glycoalkaloids and molluscicidal activity of Solanum asperum Rich. fruits
Silva, Tania M. S.; Camara, Celso A.; Freire, Kristerson R. L.; Silva, Thiago G. da; Agra, Maria de F.; Bhattacharyya, Jnanabrata
2008-01-01
Bioassay-guided fractionation of the alkaloidal extract of the green fruits of Solanum asperum afforded a new compound, solanandaine along with solasonine and solamargine. The total crude alkaloids as well as the isolated pure alkaloids exhibited significant molluscicidal activity. O fracionamento bio-monitorado do extrato alcaloídico dos frutos verdes de Solanum asperum forneceu um novo alcalóide esteroidal, denominado solanandaina, juntamente com a solasonina e a solamargina. Tanto o ext...
-
Directory of Open Access Journals (Sweden)
Tânia Maria de Moura
2011-12-01
Full Text Available This study aimed to compare the genetic diversity of populations of Solanum lycocarpum A.St.-Hil between natural and human disturbed environments, with the assumption that protected areas have greater genetic diversity than disturbed areas. For this study, two populations were sampled in Goiás State, Brazil. One was located in a conservation unit, Serra de Caldas Novas State Park, in the Caldas Novas municipality. The other was located in a pasture area in the municipality of Morrinhos. The two populations are 41 km apart. We sampled 60 individuals from each population, which were genotyped with five microsatellite loci (SSR. The highest number of alleles was recorded in the population of the conservation unit, where we found 11 exclusive and five rare alleles. In the disturbed area, we recorded only three exclusive alleles and one rare allele. Although we did not observe significant inbreeding in these populations, genetic divergence between them was high (G ST (Hedrick=0.147 =0.147 for a species with long distance seed dispersal. The results corroborate the hypothesis that the population in the less disturbed area harbors greater allelic diversity. They also confirm the effectiveness of using protected areas to preserve the genetic diversity of the species.O presente trabalho teve por objetivo comparar a diversidade genética em populações de Solanum lycocarpum A.St.-Hil, em ambientes naturais e antropizados, sob a hipótese de que Unidades de Conservação abrigam maior diversidade genética que áreas antropizadas. Para isso foram estudadas duas populações da espécie, uma situada em uma Unidade de Conservação, o Parque Estadual da Serra de Caldas Novas (PESCAN em Caldas Novas/GO e outra situada em uma área de pastagem no município de Morrinhos-GO. As populações distanciam-se em 41 km. Foram amostrados 60 indivíduos de cada população e os mesmos foram genotipados com cinco locos microssatélites (SSR. Pode-se registrar a maior
-
The starch from Solanum lycocarpum St. Hill. fruit is not a hypoglycemic agent
Directory of Open Access Journals (Sweden)
A.C.P. Oliveira
2003-04-01
Full Text Available We have investigated the hypoglycemic effect induced by the starch obtained from the unripe fruits of Solanum lycocarpum (Solanaceae. Per os administration of the starch (1000 or 2000 mg/kg, twice daily for 7 days, N = 6 did not change glycemia levels of nondiabetic female Swiss mice weighing 25-30 g. In streptozotocin-induced diabetic mice, similar treatment with the starch did not change the elevated glycemia 3 h after the last dose (diabetic treated with saline = 288 ± 17/309 ± 18; starch 1000 mg/kg = 295 ± 33; starch 2000 mg/kg = 258 ± 37; N = 5. In animals fasted for 15 h, per os administration of glucose (600 mg/kg significantly increased glycemia 1 h later. Previous (-30 min treatment of the animals with the starch (1000 or 2000 mg/kg; N = 5 did not change the increase of glycemia. Per os administration of the starch (1000 or 2000 mg kg-1 day-1, twice daily for 7 days did not induce body weight gain or loss. The chemical analysis of the starch indicated the presence of glycoalkaloids, a finding that represents a reason for concern since many of these substances are generally toxic. In interviews with 56 diabetic patients, 29 medicinal plants were reported as useful in their treatment of diabetes and S. lycocarpum was the sixth most frequently mentioned. All patients interviewed reported that they also used insulin or oral hypoglycemic drugs. The results of the present study do not provide evidence for a hypoglycemic effect associated with the polysaccharide fraction of S. lycocarpum in either normal or hyperglycemic mice. These data demonstrate the need for adequate pharmacological investigation of the natural products widely used in folk medicine.
-
Zhang, Hongbo; Liu, Guanshan; Timko, Michael P; Li, Jiana; Wang, Wenjing; Ma, Haoran
2014-10-21
Water quality is under increasing threat from industrial and natural sources of pollutants. Here, we present our findings about a pollution incident involving the tap water of Chongqing City in China. In recent years, Solanaceae plants grown in greenhouses in this city have displayed symptoms of cupped, strappy leaves. These symptoms resembled those caused by chlorinated auxinic herbicides. We have determined that these symptoms were caused by the tap water used for irrigation. Using a bioactivity-guided fractionation method, we isolated a substance with corresponding auxinic activity from the tap water. The substance was named "solanicide" because of its strong bioactivity against Solanaceae plants. Further investigation revealed that the solanicide in the water system of Chongqing City is derived from the Jialing River, a major tributary of the Yangtze River. Therefore, it is also present in the Yangtze River downstream of Chongqing after the inflow of the Jialing River. Biological analyses indicated that solanicide is functionally similar to, but distinct from, other known chlorinated auxinic herbicides. Chemical assays further showed that solanicide structurally differs from those compounds. This study has highlighted a water pollution threat to the Yangtze River and its floodplain ecosystem.
-
Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh
2014-02-01
Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.
-
Carvallo, Marcela A.; Pino, María-Teresa; Jeknić, Zoran; Zou, Cheng; Doherty, Colleen J.; Shiu, Shin-Han; Chen, Tony H. H.; Thomashow, Michael F.
2011-01-01
Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of ...
-
Lubis, Adilah Wirdhani
2015-01-01
One of the benefit from coconut water is making nata de coco through phosphate pentose pathway by using Acetobacter xylinum bacteria. Making its became nata de coco by variation of Tamarillo (Solanum betaceum) bud grafting yield with Lancing (Solanum mauritianum) produced red colour of nata de coco that it fermented for 14 days and had good nutrient value. The yield of this product was analyzed with qualitative and quantitative analysis. The variation volume of it used 10, 20, 30, 40 and 50 ...
-
Krinitsyna, A A; Mel'nikova, N V; Belenikin, M S; Poltronieri, P; Santino, A; Kudriavtseva, A V; Savilova, A M; Speranskaia, A S
2013-01-01
Kunitz-type proteinase inhibitor proteins of group A (KPI-A) are involved in the protection of potato plants from pathogens and pests. Although sequences of large number of the KPI-A genes from different species of cultivated potato (Solanum tuberosum subsp. tuberosum) and a few genes from tomato (Solanum lycopersicum) are known to date, information about the allelic diversity of these genes in other species of the genus Solanum is lacking. In our work, the consensus sequences of the KPI-A genes were established in two species of subgenus Potatoe sect. Petota (Solanum tuberosum subsp. andigenum--5 genes and Solanum stoloniferum--2 genes) and in the subgenus Solanum (Solanum nigrum--5 genes) by amplification, cloning, sequencing and subsequent analysis. The determined sequences of KPI-A genes were 97-100% identical to known sequences of the cultivated potato of sect. Petota (cultivated potato Solanum tuberosum subsp. tuberosum) and sect. Etuberosum (S. palustre). The interspecific variability of these genes did not exceed the intraspecific variability for all studied species except Solanum lycopersicum. The distribution of highly variable and conserved sequences in the mature protein-encoding regions was uniform for all investigated KPI-A genes. However, our attempts to amplify the homologous genes using the same primers and the genomes of Solanum dulcamarum, Solanum lycopersicum and Mandragora officinarum resulted in no product formation. Phylogenetic analysis of KPI-A diversity showed that the sequences of the S. lycopersicum form independent cluster, whereas KPI-A of S. nigrum and species of sect. Etuberosum and sect. Petota are closely related and do not form species-specific subclasters. Although Solanum nigrum is resistant to all known races of economically one of the most important diseases of solanaceous plants oomycete Phytophthora infestans aminoacid sequences encoding by KPI-A genes from its genome have nearly or absolutely no differences to the same from
-
Directory of Open Access Journals (Sweden)
RAQUEL R.D. MOREIRA
2013-09-01
Full Text Available The present investigation was to evaluate the potential trypanocidal activity of crude ethanolic extract of the fruits of Solanum palinacanthum, Solanum lycocarpum and the glycoalcaloid, solamargine. S. palinacanthum and S. lycocarpum fruit powders were submitted to exhaustively extraction with 96% ethanol and solamargine were isolated from the extract of S. palinacanthum. Both extracts and solamargine were analysed for trypanocidal activity by using MTT colorimetric assay. Extracts of S. palinacanthum showed to be more active (IC50 = 175.9 µg.ml–1 than S. lycocarpum (IC50 = 194.7 µg.ml–1. Solamargine presented a strong activity (IC50 = 15.3 µg.ml–1, which can explain the better activity of the both extracts. Benznidazol (IC50 = 9.0 µg.ml–1 is the only drug used to treat Chagas' disease. These findings demonstrate for the first time that ethanol extracts obtained from both fruits of S. palinacanthum and S. lycocarpum and also solamargine have a potential anti-trypanosomal activity.
-
Numerical taxonomic study of some solanum l. Species (solanaceae ...
African Journals Online (AJOL)
) were employed to elucidate the relationship among the taxa of the genus, while similarity matrix and dendrogram were constructed. PCA factor loading of the characters showed that characters such as plant height, leaf margin and leaf base ...
-
Directory of Open Access Journals (Sweden)
Danila Montewka Melotto-Passarin
2008-01-01
Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.
-
Shaw, Scott R.; Jones, Guinevere Z.
2009-01-01
A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nympha...
-
Molecular diversity among seven Solanum (eggplant and relatives ...
African Journals Online (AJOL)
Admin
2012-11-08
Nov 8, 2012 ... Seven Solanum species (eggplants) were investigated for molecular diversity. Besides its ... Eggplant comprises three closely related cultivated species .... generated with SSR data was submitted to 2-way Mantel test (Man-.
-
Abdalla, M.M.F.
1970-01-01
Solanum verrucosum (2n = 24) is a self-compatible, highly fertile species. This conclusion is drawn from the results of studies on 21 various introductions of this species. In spite of self-compatibility and good male and female fertility, the species generally needs a pollinating agent to
-
Martine, Christopher T; Cantley, Jason T; Frawley, Emma S; Butler, Alice R; Jordon-Thaden, Ingrid E
2016-01-01
A new Australian species of functionally dioecious bush tomato of Solanum subgenus Leptostemonum is described. Solanum ossicruentum Martine & J.Cantley, sp. nov., is thought to be allied with members of the problematic "Dioicum Complex" lineage, but differs in its short silvery indumentum, long calyx lobes, larger stature, and an unusual fruit morphology that may represent "trample burr" seed dispersal. The species occurs in a range extending from the eastern Kimberley in Western Australia to far northwestern Northern Territory and has been recognized for decades as a variant of Solanum dioicum W.Fitzg. Specimens of this species were previously referred to by D.E. Symon and others as Solanum dioicum 'Tanami.' Ex situ crossing studies and SEM images of inaperturate pollen grains produced in morphologically hermaphrodite flowers indicate that this taxon is functionally dioecious. The scientific name was chosen with the help of 150 seventh grade life science students from Pennsylvania, USA.
-
Directory of Open Access Journals (Sweden)
Lívia Gracielle Oliveira Tomé
2009-04-01
Full Text Available Solanum commersonii subsp. commersonii Dun. e Solanum commersonii subsp. malmeanum Bitt. (2n=2x=24 - 1EBN não podem ser diretamente cruzadas com a batata cultivada de S. tuberosum subsp. tuberosum L. (2n=4x=48 -4 EBN em razão da barreira da ploidia e do número de equilíbrio do endosperma (EBN. No entanto, a produção de pólen não reduzido por S. commersonii ssp. (2x=2n=24 - 1EBN, permite o cruzamento desta com dihaplóides de batata e com as espécies diplóides S. phureja Juz. & Bukasov. e S. chacoense Bitt., que possuem 2 EBN. Conduziu-se este trabalho, com o objetivo de determinar o mecanismo meiótico e a freqüência dos grãos de pólen não reduzidos em cinco clones de Solanum commersonii ssp. Foram avaliados três clones de S. commersonii subsp. commersonii (SCC e dois de S. commersonii subsp. malmeanum (SCM. Nas avaliações, duzentos grãos de pólen viáveis foram corados (carmim acético 2% e mensurados, sendo considerados não reduzidos aqueles com o diâmetro igual ou superior a 25 µm. O clone Solanum commersonii subsp. commersonii Dun. (SCC 100 produz 26.1% de polen não reduzido, por fusos fundidos e fusos paralelos, o qual pode ser utilizado em programas de melhoramento.Solanum commersonii subsp. commersonii Dun. and Solanum commersonii subsp. malmeanum Bitt. (2n=2x=24 -1EBN cannot be directly crossed with the cultivated Solanum tuberosum subsp. Tuberosum L. (2n=4x=48 - 4EBN species due to ploidy barriers and endosperm balance number (EBN. However, non-reduced pollen production by the wild species S. commersonii ssp. (2x=2n=24 -1EBN, allows the crossing of these species with dihaploids of potato and with the diploids species, S. phureja Juz. & Bukasov. and S. chacoense Bitt., all with 2EBN. The aim of this work was to determine the meiotic mechanism and frequency of non-reduced pollen production of five clones of S. commersonii ssp. Three different clones of S. commersonii subsp. commersonii Dun. (SCC and two of S
-
Ortiz Luz Yineth; Flórez Víctor Julio
2008-01-01
De las 30 variedades de papa cultivadas en Colombia tan solo 10 poseen importancia comercial. Entre otros factores, este número es limitado por la acción de hormonas endógenas que aceleran diferentes fases del proceso de tuberización, especialmente en las especies más precoces. En este trabajo fueron recolectadas muestras de tubérculos de diferentes especies de papa (Solanum tuberosum L. var. ICA-Única y Tuquerreña, y Solanum phureja
-
Directory of Open Access Journals (Sweden)
Jenny Paola Jiménez Barreto
2009-07-01
Full Text Available La regeneración de plantas mediante el cultivo de tejidos es un importante componente de la biotecnología que es requerido para procesos tales como la obtención de plantas transgénicas. Se estableció un sistema eficiente de regeneración para la especie Solanum tuberosum L. var. Pastusa Suprema, susceptible de ser transformada genéticamente. Se evaluó el efecto de las fitohormonas zeatina ribósido (ZR, ácido naftalénacetico (ANA y ácido gibérelico (AG3, utilizadas en combinaciones específicas, sobre la inducción de callo, la regeneración y el número de brotes producidos por explante. La presencia de ANA demostró ser esencial en la respuesta callogénica y regenerativa de los explantes. Se encontró que la adición de 3,0 mg/L de ZR, 0,02 mg/L de ANA y 1,0 mg/L de AG3 sobre un medio básico M-S, es una formulación hormonal adecuada para inducir el proceso de organogénesis indirecta sobre la variedad de papa Pastusa Suprema; produce callogénesis y regeneración en porcentajes superiores al 90%, con un promedio de seis regenerantes por explante.
-
Phytonutrient analysis of Solanum sisymbriifolium Lam. berries
Solanum sisymbriifolium Lam. (Litchi tomato) is grown ornamentally, and in Europe it is used as a trap crop for management of the potato cyst nematode (PCN). Its berries are edible, but little is known about their nutritional content. If more was known about their nutritional value this could provid...
-
Labate, Joanne A; Robertson, Larry D
2012-08-07
Many highly beneficial traits (e.g. disease or abiotic stress resistance) have been transferred into crops through crosses with their wild relatives. The 13 recognized species of tomato (Solanum section Lycopersicon) are closely related to each other and wild species genes have been extensively used for improvement of the crop, Solanum lycopersicum L. In addition, the lack of geographical barriers has permitted natural hybridization between S. lycopersicum and its closest wild relative Solanum pimpinellifolium in Ecuador, Peru and northern Chile. In order to better understand patterns of S. lycopersicum diversity, we sequenced 47 markers ranging in length from 130 to 1200 bp (total of 24 kb) in genotypes of S. lycopersicum and wild tomato species S. pimpinellifolium, Solanum arcanum, Solanum peruvianum, Solanum pennellii and Solanum habrochaites. Between six and twelve genotypes were comparatively analyzed per marker. Several of the markers had previously been hypothesized as carrying wild species alleles within S. lycopersicum, i.e., cryptic introgressions. Each marker was mapped with high confidence (etomato whole genome shotgun chromosomes (SL2.40) database. Neighbor-joining trees showed high mean bootstrap support (86.8 ± 2.34%) for distinguishing red-fruited from green-fruited taxa for 38 of the markers. Hybridization and parsimony splits networks, genomic map positions of markers relative to documented introgressions, and historical origins of accessions were used to interpret evolutionary patterns at nine markers with putatively introgressed alleles. Of the 47 genetic markers surveyed in this study, four were involved in linkage drag on chromosome 9 during introgression breeding, while alleles at five markers apparently originated from natural hybridization with S. pimpinellifolium and were associated with primitive genotypes of S. lycopersicum. The positive identification of introgressed genes within crop species such as S. lycopersicum will help
-
Ortiz, Luz Yineth; Flórez, Víctor Julio
2008-01-01
De las 30 variedades de papa cultivadas en Colombia tan solo 10 poseen importancia comercial. Entre otros factores, este número es limitado por la acción de hormonas endógenas que aceleran diferentes fases del proceso de tuberización, especialmente en las especies más precoces. En este trabajo fueron recolectadas muestras de tubérculos de diferentes especies de papa (Solanum tuberosum L. var. ICA-Única y Tuquerreña, y Solanum phureja Juz. et Buk. var. Yema de Huevo), en los estadios fenológic...
-
Ortiz, Luz Yineth; Flórez, Víctor Julio
2010-01-01
De las 30 variedades de papa cultivadas en Colombia tan solo 10 poseen importancia comercial. Entre otros factores, este número es limitado por la acción de hormonas endógenas que aceleran diferentes fases del proceso de tuberización, especialmente en las especies más precoces. En este trabajo fueron recolectadas muestras de tubérculos de diferentes especies de papa (Solanum tuberosum L. var. ICA-Única y Tuquerreña, y Solanum phureja Juz. et Buk. var. Yema de Huevo), en los estadios...
-
Sunitha, J; Krishna, Swathy; Ananthalakshmi, R; Jeeva, J Sathiya; Girija, As Smiline; Jeddy, Nadeem
2017-06-01
Solanum nigrum and Phyllanthus niruri are common herbs which are indigeneous to India. Solanum nigrum commonly called 'manathakkali Keerai' in Tamil, forms an indispensable part of South Indian diet. Phyllanthus niruri (keezhanelli in Tamil) is a widely used medicinal plant, the leaves of which have been used extensively in Ayurveda and native medicine to cure various liver ailments. The herbs Solanum nigrum and Phyllanthus niruri have been found to be effective against numerous enteropathogens in various in vitro studies. To assess and compare the antibacterial efficacy of the crude alcoholic extract of the leaves of Solanum nigrum and Phyllanthus niruri against five cariogenic organisms. Standard strains of the micro-organisms were obtained from ATCC (American Type Culture Collection) and MTCC (Microbial Type Culture Collection) which comprised of Streptococcus mutans MTCC no. 890, Streptococcus oralis MTCC no 2696, Lactobacillus acidophillus MTCC no. 10307, Streptococcus sanguis ATCC no. 10556 and Streptococcus salivarius ATCC no. 13419. The organisms obtained were revived and lawn cultured on Trypticase Soy Agar-Blood Agar (TSA-BA) and de Man, Rogosa and Sharpe (MRS) agar media. The antibacterial effect of the dried and powdered leaves of Solanum nigrum and Phyllanthus niruri was tested using agar well diffusion method. The zones of inhibition obtained after incubation were measured and tabulated. The antibacterial activity for the two herbs was compared using the Mann-Whitney test. The antibacterial zones of inhibition obtained for the herb Solanum nigrum was in the range of 12.3-14.6 mm and ranged from 9.7-11.6 mm for the herb Phyllanthus niruri . When the zones of inhibition were compared for the herbs, Solanum nigrum showed significantly greater zones of inhibition compared to Phyllanthus niruri for the organisms Streptococcus sanguis , Streptococcus salivarius , Streptococcus oralis and Streptococcus mutans (p-valuecariogenic organisms, with Solanum nigrum
-
Effect of acaricidal activity of Solanum nigrum on Tetranychus ...
African Journals Online (AJOL)
Effect of acaricidal activity of Solanum nigrum on Tetranychus urticae Koch under laboratory conditions. Stephanie Johana Numa Vergel, Lorena Rodríguez Coy, Daniel Rodríguez Caicedo, Ericsson Coy-Barrera ...
-
Genetic relatedness among Solanum L. species assayed by seed morphology and isozyme markers
International Nuclear Information System (INIS)
Ahmed, S.M.; Fadl, M.A.
2016-01-01
In spite of their economic and medicinal value, no adequate attention has been paid to the diversity, characterization and taxonomical identification of Solanum L. species in Saudi Arabia. In this study, Scanning Electron Microscopy (SEM) of seed coat morphology and isozyme electrophoresis were employed for studying the genetic variability and relationships among seven Solanum L. species namely; S. incanum L., S. nigrum L., S. villosum L., S. schemprianum Hochst, S. galabratum Dunal, S. lycopersicum L. and S. melongena L. collected from Taif highlands. Scanning Electron Microscope (SEM) investigation of seed coat sculpturing showed three basic patterns namely; rugulate, reticulate and levigate. The analyses on six enzymes were coded by 19 loci. The number of alleles ranged from one to three with a mean of 1.58 alleles per locus. The proportion of polymorphic loci for Solanum L. species ranged from 0.87 for S. nigrum L. and S. villosum L. to 0.80 for S. lycopersicum L. The mean observed heterozygosity varied from 0.00 to 1.00, while mean expected heterozygosity ranged between 0.00 and 0.5. The UPGMA phenogram confirmed the extensive genetic diversity existed in the studied Solanum L. species and showed the close relationship between S. incanum L. and S. melongena L. (author)
-
Ordaz, Gabriel; D'Armas, Haydelba; Yáñez, Dayanis; Moreno, Shailili
2011-06-01
Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary metabolites in some plant species in order to contribute to their chemotaxonomy. Leaves from Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis and Solanum subinerme were collected and their essential oils were obtained by means of hydro-distillation. The oil fraction was analyzed and identified by GC/MS. The extraction yields were of 0.004, 0.032, 0.016 and 0.005%, and the oil constituents of 88.00, 89.80, 87.50 and 89.47%, respectively. The principal oils found were: non-terpenoids volatile secondary metabolites (30.28%) in H. guazumifolia; sesquiterpenoids (20.82 and 26.09%) and oxigen derivated (52.19 and 25.18%) in P. tuberculatum and S. dulcis; and oxigen diterpenoids (39.67%) in S. subinerme. The diisobuthylphtalate (13.11%) in H. guazumifolia, (-)-spathulenol (11.37%) in P. tuberculatum and trans-phytol (8.29 and 36.00%) in S. dulcis and S. subinerme, were the principal constituents in their respective essential oils. The diisooctylphtalate were the essential oil common to all species, but the volatile compounds such as trans-pinane, L-linalool, beta-ionone, isophytol, neophytadiene, trans-phytol, dibutylphtalate and methyl hexadecanoate, were only detected in three of these essences. This suggests that these plants may require similar secondary metabolites for their ecological interactions, possibly due to common environmental factors.
-
Een nieuwe variëteit van Solanum triflorum Nutt
Ooststroom, van S.J.
1966-01-01
A note on a new variety of Solanum triflorum Nutt., viz. var. dentatum Ooststr., found in 1938 near Nijmegen, prov. Gelderland. SANDWITH (2, p. 346) mentions a plant from Bristol, which is identical with this.
-
Czech Academy of Sciences Publication Activity Database
Soudek, Petr; Wimmer, Zdeněk; Vaněk, Tomáš
2014-01-01
Roč. 12, 3-4 (2014), s. 213-216 ISSN 1459-0255 R&D Projects: GA MŠk LH12162 Institutional support: RVO:61389030 Keywords : Solanum aviculare * Rheum palmatum * plant cell culture Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 0.435, year: 2012 http://world-food.net/ biotransformation -of-2-4-methoxybenzylcyclopentanone-by-solanum-aviculare-and-rheum-palmatum-plant-cells/
-
Martine, Christopher T.; Cantley, Jason T.; Frawley, Emma S.; Butler, Alice R.; Jordon-Thaden, Ingrid E.
2016-01-01
Abstract A new Australian species of functionally dioecious bush tomato of Solanum subgenus Leptostemonum is described. Solanum ossicruentum Martine & J.Cantley, sp. nov., is thought to be allied with members of the problematic “Dioicum Complex” lineage, but differs in its short silvery indumentum, long calyx lobes, larger stature, and an unusual fruit morphology that may represent “trample burr” seed dispersal. The species occurs in a range extending from the eastern Kimberley in Western Australia to far northwestern Northern Territory and has been recognized for decades as a variant of Solanum dioicum W.Fitzg. Specimens of this species were previously referred to by D.E. Symon and others as Solanum dioicum ‘Tanami.’ Ex situ crossing studies and SEM images of inaperturate pollen grains produced in morphologically hermaphrodite flowers indicate that this taxon is functionally dioecious. The scientific name was chosen with the help of 150 seventh grade life science students from Pennsylvania, USA. PMID:27489475
-
Quantitative resistance to Botrytis cinerea from Solanum neorickii
Finkers, H.J.; Bai, Y.; Berg, van den P.M.M.M.; Berloo, van R.; Meijer-Dekens, R.G.; Have, ten A.; Kan, van J.A.L.; Lindhout, P.; Heusden, van A.W.
2008-01-01
Tomato (Solanum lycopersicum) is susceptible to gray mold (Botrytis cinerea). Quantitative resistance to B. cinerea was previously identified in a wild relative, S. neorickii G1.1601. The 122 F3 families derived from a cross between the susceptible S. lycopersicum cv. Moneymaker and the partially
-
Solanum cultivar responses to arbuscular mycorrhizal fungi: growth ...
African Journals Online (AJOL)
A greenhouse experiment was carried out in a sandy soil with a low available phosphorus to evaluate responsiveness of four Solanum aethiopicum cultivars to indigenous arbuscular mycorrhizal fungi. Results showed clear interaction between genetic variability of cultivars and fungal isolates on shoot biomass and on ...
-
Resistance to Erwinia spp. in potato (Solanum tuberosum L.)
Allefs, S.
1995-01-01
Blackleg is a disease of potato, Solanum tuberosum , which is caused by the bacteria Erwinia carotovora subsp. carotovora ( Ecc ), E.c. subsp. atroseptica ( Eca ) or
-
Listado anotado de Solanum L. (Solanaceae) en el Perú
DEFF Research Database (Denmark)
Särkinen, Tiina; Baden, Maria; Gonzáles, Paúl
2015-01-01
), and Canta and Huarochirí (Lima). Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca), Santiago de Chuco (La Libertad), Oxapampa (Pasco), and Cusco (Cusco). Current diversity patterns are highly correlated with collection...
-
Aerobic Mesophilic Bacteria Associated With Irish Potato ( Solanum ...
African Journals Online (AJOL)
A total of 15 samples of spoilt Irish potatoes (Solanum tuberosum L.) were collected from five grocery shops in Ile-Ife, Osun State, Nigeria and were analysed for aerobic mesophilic bacterial load. The isolated aerobic mesophilic bacteria were phenotypically characterized by biochemical tests and their susceptibility to ...
-
Isolation barriers between petunia axillaris and Petunia integrifolia (Solanaceae).
Dell'olivo, Alexandre; Hoballah, Maria Elena; Gübitz, Thomas; Kuhlemeier, Cris
2011-07-01
The isolation barriers restricting gene flow between populations or species are of crucial interest for understanding how biological species arise and how they are maintained. Few studies have examined the entire range of possible isolation barriers from geographic isolation to next generation hybrid viability. Here, we present a detailed analysis of isolation barriers between two flowering plant species of the genus Petunia (Solanaceae). Petunia integrifolia and P. axillaris feature divergent pollination syndromes but can produce fertile hybrids when crossed in the laboratory. Both Petunia species are primarily isolated in space but appear not to hybridize in sympatry. Our experiments demonstrate that pollinator isolation is very high but not strong enough to explain the absence of hybrids in nature. However, pollinator isolation in conjunction with male gametic isolation (i.e., pollen-pistil interaction) can explain the lack of natural hybridization, while postzygotic isolation barriers are low or nonexistent. Our study supports the notion that reproductive isolation in flowering plants is mainly caused by pre- rather than postzygotic isolation mechanisms. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.
-
Highly Oxygenated Flavonoids from the Leaves of Nicotiana plumbaginifolia (Solanaceae
Directory of Open Access Journals (Sweden)
Md. Shafiullah Shajib
2017-11-01
Full Text Available Nicotiana plumbaginifolia Viv. is an annual herb of the family Solanaceae, which grows abundantly in the weedy lands of Bangladesh . This plant possesses analgesic, antibacterial, anti-anxiety and hepatoprotective properties, and produces various phenolic compounds including flavonoids. The present study afforded determination of total phenolic and flavonoid contents, and for the first time, the isolation and characterization of highly oxygenated flavonoids, e.g., 3,3' ,5,6,7,8-hexamethoxy- 4',5'-methylenedioxyflavone (1, 3,3' ,4' ,5',5,6,7,8-octamethoxyflavone (2, exoticin, 6,7,4',5'-dimethylenedioxy-3,5,3'-trimethoxyflavone (3 and ( 3,3' ,4',5,5',8-hexamethoxy-6,7-methylenedioxyflavone (4 from the leaves of N. plumbaginifolia . All these flavonoids are rather rare natural products, and only found in a few genera, e.g.,Polygonum and Murraya. The structures of the isolated flavonoids were elucidated by comprehensive spectroscopic analyses, e.g., UV, 1H, 13C NMR, DEPT, HSQC, HMBC and MS.
-
International Nuclear Information System (INIS)
Nunoo, J.
2010-01-01
Two separate experiments were conducted to determine the effects of recurrent irradiation and cross fertilization on the improvement of fruit quality and plant architecture of two tomato species (Solanum lycopersicon L.) and (Solanum pimpinellifolium L.) in Ghana. In the first experiment, a variant line of the wild tomato (Solanum pimpinellifolium L.) (SP 300/30.4.2.4) previously obtained through irradiation with gamma rays at 300 Gy was re-irradiated with gamma rays at 150 Gy and 300 Gy using gamma irradiation. The second experiment involved hybridization of the same variant line (SP 300/30.4.2.4) with five cultivars of the cultivated tomato (Solanum lycopersicon L). Progeny were assessed in both M1 and M2 generations for the first experiment but only at the F 2 generation for the second experiment. Significant variations were observed in number of days to first flowering and 50% fruiting. Fruit size increased from 1.36 g and 1.67 g to 1.77 g and 2.66 g in the M 1 and M 2 generations respectively following re-irradiation at 300 Gy. Three 150 Gy treated plants at the M 1 generation and two 300 Gy treated plants at the M 2 generations exhibited erect growth habit compared to the parental line (SP 300/30.4.2.4) which was sprawling. A variant line among the 300 Gy treated plants had a fused fruit of fruit weight of 3.57 g with four locules. Also, hybridization involving five cultivars of the cultivated tomato (S. lycopersicon L.) as female parents and the variant line (SP 300/30.4.2.4) generated variability in several traits including plant architecture, days to flowering and fruiting, fruit weight and number of seeds per fruit in the F 2 generation. Variations in style-length, number of locules, fruit shape and colour were also observed among the plants in the F 2 generation. Generally, significant improvements were obtained with respect to plant architecture (that is reduced plant height), earliness and fruit quality (that is fruit size and colour). Although no
-
SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species
Directory of Open Access Journals (Sweden)
Vleeshouwers Vivianne GAA
2011-08-01
Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a
-
Comparative genetics of hybrid incompatibility: sterility in two Solanum species crosses.
Moyle, Leonie C; Nakazato, Takuya
2008-07-01
The genetic basis of hybrid sterility can provide insight into the genetic and evolutionary origins of species barriers. We examine the genetics of hybrid incompatibility between two diploid plant species in the plant clade Solanum sect. Lycopersicon. Using a set of near-isogenic lines (NILs) representing the wild species Solanum pennellii (formerly Lycopersicon pennellii) in the genetic background of the cultivated tomato S. lycopersicum (formerly L. esculentum), we found that hybrid pollen and seed infertility are each based on a modest number of loci, male (pollen) and other (seed) incompatibility factors are roughly comparable in number, and seed-infertility QTL act additively or recessively. These findings are remarkably consistent with our previous analysis in a different species pair, S. lycopersicum x S. habrochaites. Data from both studies contrast strongly with data from Drosophila. Finally, QTL for pollen and seed sterility from the two Solanum studies were chromosomally colocalized, indicating a shared evolutionary history for these QTL, a nonrandom genomic distribution of loci causing sterility, and/or a proclivity of certain genes to be involved in hybrid sterility. We show that comparative mapping data can delimit the probable timing of evolution of detected QTL and discern which sterility loci likely evolved earliest among species.
-
Directory of Open Access Journals (Sweden)
Hunziker Armando T.
1986-12-01
Full Text Available Two new Colombian species of Cuatre sia (Solanaceae, are clescribed and illustrated. Con motivo de la preparación de una sinopsis preliminar sobre Cuatresia A. T. Hunz., ha quedado en evidencia una serie de especies indescritas, 2 de las cuales presento seguidamente. Es esta una buena oportunidad para llamar la atención de los colegas sobre este difícil y olvidado género de Solanáceas. En su gran mayoría, las dificultades se originan en los materiales disponibles, que son escasos y fragmentarios; varias especies se conocen por una única colección (a veces con apenas 1 o 2 flores, en la mayoría se ignora cómo son el fruto, la semilla y el embrión, y en otros casos, las observaciones sobre el color de la corola son contradictorias, o imprecisas, o faltan por completo. Por todo ello, quisiera incitar a quienes tienen el privilegio de acceder a las regiones donde crecen estas plantas, a que extremen los recaudos para que las colecciones de Cuatresia mejoren en calidad y cantidad.
-
Czech Academy of Sciences Publication Activity Database
Kavallieratos, N. G.; Tomanović, Ž.; Starý, Petr; Žikić, V.; Petrović-Obradović, O.
2010-01-01
Roč. 103, č. 2 (2010), s. 153-164 ISSN 0013-8746 R&D Projects: GA AV ČR IBS5007102 Grant - others:The Ministry of Science and Environment Protection(CS) 143006B Institutional research plan: CEZ:AV0Z50070508 Keywords : Aphidiinae * aphids * Solanaceae Subject RIV: EH - Ecology, Behaviour Impact factor: 1.031, year: 2010
-
Sánchez-Bel, Paloma; Egea, Isabel; Sánchez Ballesta, M. Teresa; Sevillano, Laura; Martínez Madrid, María Concepción; Romojaro Almela, Félix Ramón; Bolarín, María C.; Flores, Francisco B.
2012-01-01
Tomate (Solanum lycopersicum) y pimiento (Capsicum annuum), son dos especies hortofrutícolas pertenecientes a la familia Solanaceae susceptibles a sufrir daños por frío cuando se almacenan a bajas temperaturas, lo que afecta seriamente a la calidad de los frutos, siendo causa de importantes pérdidas económicas en el sector agro-alimentario. Una de las principales respuestas celulares al estrés por bajas temperaturas consiste en el mantenimiento de la homeostasis osmótica por la acumulación de...
-
Martine, Christopher T.; Cantley, Jason T.; Frawley, Emma S.; Butler, Alice R.; Jordon-Thaden, Ingrid E.
2016-01-01
Abstract A new Australian species of functionally dioecious bush tomato of Solanum subgenus Leptostemonum is described. Solanum ossicruentum Martine & J.Cantley, sp. nov., is thought to be allied with members of the problematic ?Dioicum Complex? lineage, but differs in its short silvery indumentum, long calyx lobes, larger stature, and an unusual fruit morphology that may represent ?trample burr? seed dispersal. The species occurs in a range extending from the eastern Kimberley in Western Aus...
-
In vitro methods for mutation induction in potato ( Solanum ...
African Journals Online (AJOL)
Potato (Solanum tuberosum L.) is an important vegetable and staple crop worldwide and mainly propagated vegetatively. Breeding of potato is problematic and therefore induced mutation is an attractive means of improving the crop. In vitro culture systems, and especially the production of microtubers, are ideal for such ...
-
Cytogenetic studies on some Nigerian species of Solanum L ...
African Journals Online (AJOL)
Cytogenetic studies to determine the chromosome number, structure and behaviour of some species of Solanum in Nigeria were carried out. Attempt was also made to induce polyploidy in the species. Comparative analysis of the cytological behaviour of the diploid and polyploid cytotypes was made. The studies show that ...
-
Eck, van H.J.; Jacobs, J.M.E.; Berg, van den P.M.M.M.; Stiekema, W.J.; Jacobsen, E.
1994-01-01
Two existing genetic models for anthocyanin pigmentation are compared: the genetic model as proposed by Lunden (1937, 1960, 1974) for tetraploid potato Solanum tuberosum group Tuberosum and the model by Dodds & Long (1955, 1956) for diploid cultivated Solanum species. By crossing well defined
-
Notes on some insect galls associated with Solanum plants in South ...
African Journals Online (AJOL)
1990-12-18
. Received 10 ... in press) related to the biological control of Solanum weed species. During ... in the Albany Museum (Natural History) and the National ..... identifying insect specimens. MJ. ... insects imported for weed control.
-
Directory of Open Access Journals (Sweden)
Yu-Jie Zhang
2016-09-01
Full Text Available Previous studies have shown that fruits have different effects on alcohol metabolism and alcohol-induced liver injury. The present work selected three fruits and aimed at studying the effects of Syzygium samarangense, Passiflora edulis and Solanum muricatum on alcohol-induced liver injury in mice. The animals were treated daily with alcohol and fruit juices for fifteen days. Chronic treatment with alcohol increased the levels of aspartate transaminase (AST, alanine transaminase (ALT, total bilirubin (TBIL, triglyceride (TG, malondialdehyde (MDA, and decreased total protein (TP. Histopathological evaluation also showed that ethanol induced extensive fat droplets in hepatocyte cytoplasm. Syzygium samarangense and Passiflora edulis normalized various biochemical parameters. Solanum muricatum increased the level of ALT and induced infiltration of inflammatory cells in the liver. These results strongly suggest that treatment with Syzygium samarangense and Passiflora edulis could protect liver from the injury of alcohol, while Solanum muricatum could aggravate the damage.
-
New Solanum species from Tanzanian coastal forests may already ...
African Journals Online (AJOL)
The unusually long inflorescences with a dense covering of long straight prickles on the rachis distinguish S. ruvu from all other African species of spiny Solanum. Its likely affinities lie with another coastal forest species, S. zanzibarense, which exhibits a similar scandent habit, subentire leaves, thin stems, and prickles that ...
-
Induced mutagenesis as a breeding strategy for improvement of Solanaceous vegetables
International Nuclear Information System (INIS)
Masuda, Masaharu; Ojiewo, Christopher O.
2008-01-01
The Solanaceae are a cosmopolitan family containing many essential vegetables and fruits such as potato (Solanum tuberosum L.), tomato (Lycopersicon esculentum L.), eggplant (Solanum melongena L.), paprika, chillies, green and red peppers (Capsicum annuum L.), jasmine nightshade (Solanum jasminoides Paxt.), winter cherry (Solanum pseudocapsicum L.), and Cape gooseberry, ornamentals such as Petunia, Schizanthus, and Lycium species, and medicinal plants such as bittersweet (Solanum dulcamara L.) and Solanum viarum Dun., both used as sources of corticosteroids. It also contains tobacco (Nicotiana spp.) - one of the most harmful yet economically important plants in the world - together with many other plants of both poisonous and medicinal value such as belladonna (Atropa belladona L.), stramonium (Datura stramonium L.), black henbane (Hyoscyamus niger L.), and African nightshade (Solanum villosum). Composed of approximately 90 genera and between 2000 and 3000 species, the family is widely distributed throughout the tropical and temperate regions of the world, with centers of diversity occurring in Central and South America, Australia, and Africa (EDMONDS 1978; SYMON 1981; D'ARCY 1991). Work to develop new varieties of improved solanaceous crops started more than 2 centuries ago. This paper reviews some of the recent developments in various aspects of varietal improvement of solanaceous vegetables through mutation breeding. Mutational work reported here includes the alteration of plant reproductive or vegetative growth and the development of locally adapted cultivars and popular breeding lines, or the induction of novel alleles. The potential for direct application of the mutants as new improved cultivars, their use in cross-breeding schemes, and their application in, for example, marker technology in genetic research are discussed. Specific examples of novel mutants developed in our laboratory that have the potential for application in improving solanaceous fruits
-
The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction
Directory of Open Access Journals (Sweden)
Garzón-Martínez Gina A
2012-04-01
Full Text Available Abstract Background Physalis peruviana commonly known as Cape gooseberry is a member of the Solanaceae family that has an increasing popularity due to its nutritional and medicinal values. A broad range of genomic tools is available for other Solanaceae, including tomato and potato. However, limited genomic resources are currently available for Cape gooseberry. Results We report the generation of a total of 652,614 P. peruviana Expressed Sequence Tags (ESTs, using 454 GS FLX Titanium technology. ESTs, with an average length of 371 bp, were obtained from a normalized leaf cDNA library prepared using a Colombian commercial variety. De novo assembling was performed to generate a collection of 24,014 isotigs and 110,921 singletons, with an average length of 1,638 bp and 354 bp, respectively. Functional annotation was performed using NCBI’s BLAST tools and Blast2GO, which identified putative functions for 21,191 assembled sequences, including gene families involved in all the major biological processes and molecular functions as well as defense response and amino acid metabolism pathways. Gene model predictions in P. peruviana were obtained by using the genomes of Solanum lycopersicum (tomato and Solanum tuberosum (potato. We predict 9,436 P. peruviana sequences with multiple-exon models and conserved intron positions with respect to the potato and tomato genomes. Additionally, to study species diversity we developed 5,971 SSR markers from assembled ESTs. Conclusions We present the first comprehensive analysis of the Physalis peruviana leaf transcriptome, which will provide valuable resources for development of genetic tools in the species. Assembled transcripts with gene models could serve as potential candidates for marker discovery with a variety of applications including: functional diversity, conservation and improvement to increase productivity and fruit quality. P. peruviana was estimated to be phylogenetically branched out before the
-
The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction.
Garzón-Martínez, Gina A; Zhu, Z Iris; Landsman, David; Barrero, Luz S; Mariño-Ramírez, Leonardo
2012-04-25
Physalis peruviana commonly known as Cape gooseberry is a member of the Solanaceae family that has an increasing popularity due to its nutritional and medicinal values. A broad range of genomic tools is available for other Solanaceae, including tomato and potato. However, limited genomic resources are currently available for Cape gooseberry. We report the generation of a total of 652,614 P. peruviana Expressed Sequence Tags (ESTs), using 454 GS FLX Titanium technology. ESTs, with an average length of 371 bp, were obtained from a normalized leaf cDNA library prepared using a Colombian commercial variety. De novo assembling was performed to generate a collection of 24,014 isotigs and 110,921 singletons, with an average length of 1,638 bp and 354 bp, respectively. Functional annotation was performed using NCBI's BLAST tools and Blast2GO, which identified putative functions for 21,191 assembled sequences, including gene families involved in all the major biological processes and molecular functions as well as defense response and amino acid metabolism pathways. Gene model predictions in P. peruviana were obtained by using the genomes of Solanum lycopersicum (tomato) and Solanum tuberosum (potato). We predict 9,436 P. peruviana sequences with multiple-exon models and conserved intron positions with respect to the potato and tomato genomes. Additionally, to study species diversity we developed 5,971 SSR markers from assembled ESTs. We present the first comprehensive analysis of the Physalis peruviana leaf transcriptome, which will provide valuable resources for development of genetic tools in the species. Assembled transcripts with gene models could serve as potential candidates for marker discovery with a variety of applications including: functional diversity, conservation and improvement to increase productivity and fruit quality. P. peruviana was estimated to be phylogenetically branched out before the divergence of five other Solanaceae family members, S
-
Solanum sisymbriifolium (Lam.) : a trap crop for potato cyst nematodes
Timmermans, B.G.H.
2005-01-01
Keywords:Solanumsisymbriifolium ,Globoderapallida ,Globoderarostochiensis ,
-
Solanum Tuberíferos nuevos para Colombia - II
Directory of Open Access Journals (Sweden)
López Jaramillo Luis E.
1986-06-01
Full Text Available Durante los 174 años que han transcurrido desde la descripción del primer Solanum tuberífero silvestre de Colombia (VALENZUELA, 1809, se han descubierto en total 10 especies de papa silvestre en el país (CORRELL,1962; BTTTER,1913; OCHOA, 1978; LOPEZ-JARAMILLO, 1983. Esas especies son: Solanum andreanum Baker, S. colombianum Dun., S. estradae L. López J. S. flahaultii Bitt., S. qarciabarrigae Ochoa, S. lobbianum. Bitt., S. moscopanum. Hawkes, S. pamplonense L. Lopez J., S. papa Valenzuela y S. tuquerrense Hawkes. Las especies S. jublandifolium Dun. y S. ochranthum Dun., son comunes en Colombia, Perú y Venezuela y, aunque no son tuberíferas, están clasificadas dentro clel grupo por su morfología.El objeto cle esta publicación es describir una nueva especie proveniente del Departamento cle Santander. Se confirma así la sospecha de que aún quedan en Colombia especies tuberíferas nativas por descubrir. Estas especies están bajo amenaza de extinción debido a la rápida destrucción de los páramos que constituyen su hábitat natural.
-
Late blight, caused by Phytophthora infestans, is a devastating disease on potato worldwide and new lineages of the pathogen continue to develop in the U.S. Breeding for resistance is important for economic and environmental purposes. The Solanaceae Coordinated Agricultural Project (SolCAP) focuses ...
-
Role of Solanum dulcamara L. in Potato Late Blight Epidemiology
Golas, T.M.; Weerden, van der G.M.; Berg, van den R.G.; Mariani, C.; Allefs, J.J.H.M.
2010-01-01
Four sites with naturally growing Solanum dulcamara were surveyed during 2006 and 2007 for the presence of late blight. Despite 2 years of observations, no late blight was detected among natural populations of bittersweet. Nevertheless, repeated infections occurred on few S. dulcamara plants from a
-
Total lipid profile with aqueous fruit extract of Solanum macrocarpum ...
African Journals Online (AJOL)
Abstract. Studies were undertaken to investigate the effects of the aqueous fruit extract of Solanum macrocarpum Linn. on the total lipid profile: total cholesterol, triglycerides, high density lipoprotein-cholesterol (HDL-C) and low density lipoprotein-cholesterol (LDL-C) on hypercholesterolaemic rats. Total serum cholesterol ...
-
Directory of Open Access Journals (Sweden)
Chandra Shekher Sanwal
2016-08-01
Full Text Available Background In mid hills of Western Himalayas, Himachal Pradesh India, growth, yield and economics of Solanum khasianum as a potential medicinal herb under Pinus roxburghii (Chir pine plantation has been studied for two consecutive years to assess the performance of Solanum khasianum in undercanopy of Pinus roxburghii for developing Solanum khasianum and Pinus roxburghii based innovative silvi-medicinal system. Methods Growth parameters such as plant height, number of branches per plant and leaf area index followed by yield were estimated after Solanum khasianum was grown on three topographical aspects as; Northern, North - western and Western at a spacing of 45 cm × 45 cm, followed by three tillage depths as; minimum (0 cm, medium (up to 10 cm and deep tillage (up to 15 cm, in open and below canopy conditions treatment. The study was conducted to explore the possibility of using Solanum khasianum based silvi-medicinal system to utilize the below canopy of Chir pine forest for enhancing the productivity of forests besides the conservation of the medicinal herb. Results The growth parameters such as plant height, number of branches per plant and leaf area index were non-significantly affected by topographical aspects and tillage practices, both below canopy and open conditions except fresh weight and dry weight of berries during harvesting stage. The maximum yield (0.61 t∙ha−1 was observed on Western aspect in open conditions as compared to below canopy of Chir pine. The highest gross returns were observed for the crop cultivated on Western aspect under deep tillage in open conditions than other aspect and tillage combinations. However the positive net returns from the crops raised in below canopy of Chir pine indicates its possible economic viability under agroforestry system as the gross returns was higher than the cost of cultivation. Conclusion Solanum khasianum when grown in below canopy of Pinus roxburghii, its growth and yield
-
Directory of Open Access Journals (Sweden)
Lizarazo H. Karol
2008-12-01
Full Text Available
El gusano cogollero Spodoptera frugiperda es una de las plagas que más afectan los cultivos en la región de Sumapaz (Cundinamarca, Colombia. En la actualidad se controla principalmente aplicando productos de síntesis química, sin embargo la aplicación de extractos vegetales surge como una alternativa de menor impacto sobre el ambiente. Este control se emplea debido a que las plantas contienen metabolitos secundarios que pueden inhibir el desarrollo de los insectos. Por tal motivo, la presente investigación evaluó el efecto insecticida y antialimentario de extractos vegetales de barbasco Polygonum hydropiperoides (Polygonaceae, carbonero Calliandra pittieri (Mimosaceae y hierba mora Solanum nigrum (Solanaceae sobre larvas de S. frugiperda biotipo maíz. Se estableció una cría masiva del insecto en el laboratorio utilizando una dieta natural con hojas de maíz. Posteriormente se obtuvieron extractos vegetales utilizando solventes de alta polaridad (agua y etanol y media polaridad (diclorometano los cuales se aplicaron sobre las larvas de segundo instar. Los resultados más destacados se presentaron con extractos de P. hydropiperoides, obtenidos con diclorometano en sus diferentes dosis, con los cuales se alcanzó una mortalidad de 100% 12 días después de la aplicación y un efecto antialimentario representado por un consumo de follaje de maíz inferior al 4%, efectos similares a los del testigo comercial (Clorpiriphos.
-
Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang
2017-12-01
Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.
-
Composición fitoquímica de los tallos y hojas de la especie Solanum nigrum L. que crece en Cuba
Chang Huerta, Lorenzo; Rosabal Carbonell, Yeisa; Morales León, José Ángel
2013-01-01
Introducción: Solanum nigrum L. se emplea como antiséptico, expectorante, cardiotónico, digestivo diaforético y sedativo. Las hojas son usadas como emplastos para el reumatismo, enfermedades de la piel, y para el tratamiento de la tuberculosis. Se considera un potente antiinflamatorio. Objetivos: determinar la composición fitoquímica de los extractos etéreo, alcohólico y acuoso de tallos y hojas de la especie Solanum nigrum L. Métodos: se recolectaron tallos y hojas de Solanum nigrum L., se l...
-
Molecular evolution of the disease resistance gene Rx in Solanum
Butterbach, P.B.E.
2007-01-01
Potato (Solanum tuberosum ssp. tuberosum) is the fourth most important food crop with an annual yield of about 300 million tons over the world. The history of the domestication of potato shows that disease-causing agents followed the tracks of potato cultivation in temperate climates
-
Steroidal glyco alkaloids and molluscicidal activity of Solanum asperum Rich. fruits
Energy Technology Data Exchange (ETDEWEB)
Silva, Tania M.S. [Instituto Multidisciplinar em Saude, Vitoria da Conquista, BA (Brazil). Campus Avancado Anisio Teixeira]. E-mail: sarmento@pesquisador.cnpq.br; Camara, Celso A. [Universidade Federal Rural de Pernambuco, Recife, PE (Brazil). Dept. de Quimica; Freire, Kristerson R.L.; Silva, Thiago G. da; Agra, Maria de F.; Bhattacharyya, Jnanabrata [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica
2008-07-01
Bioassay-guided fractionation of the alkaloidal extract of the green fruits of Solanum asperum afforded a new compound, solanandaine along with solasonine and solamargine. The total crude alkaloids as well as the isolated pure alkaloids exhibited significant molluscicidal activity. (author)
-
Expression of modified 7SL RNA gene in transgenic Solanum tuberosum plants
Czech Academy of Sciences Publication Activity Database
Vrba, Lukáš; Matoušek, Jaroslav
2005-01-01
Roč. 49, - (2005), 371-380 ISSN 0006-3134 Institutional research plan: CEZ:AV0Z50510513 Keywords : transgenic plants * Solanum tuberosum Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.792, year: 2005
-
Critical Period for Weed Removal in Garden Egg (Solanum Incanum ...
African Journals Online (AJOL)
Field experiments were conducted at the Teaching and Research Farm, Adeyemi College of Education, Ondo during the 2004 and 2005 cropping seasons to determine the extent of yield loss due to weed infestation and the critical time for weed removal in garden egg (Solanum incanum). The experiment which was ...
-
Directory of Open Access Journals (Sweden)
Raquel Frenedoso da Silva
2014-01-01
Full Text Available Methylmercury, organic form of mercury, can increase the number of abnormal sperm and decrease sperm concentration and testosterone levels possibly due to the damage caused by reactive species to germ and Leydig cells. Maná-cubiu (Solanum sessiliflorum Dunal is a native fruit from Amazon rich in iron, zinc, niacin, pectin, and citric acid, used in foods, beverages, and medicinal purposes, since it has been useful for treatment of various diseases caused by oxidative stress or nutritional deficiency. Therefore, this study evaluated the phytoremediation potential of this fruit on damages caused by exposure to MeHg on sperm quantity and quality and the histological aspect of the testis and epididymis. Wistar male rats (n=20 were randomly allocated into four groups: Control group (received distilled water, MeHg group (140 μg/Kg, Solanum group (1% of fruit Maná-cubiu on chow, and Solanum plus MeHg group (same treatment as MeHg and Solanum group. The organs were weighted, histopathology; sperm morphology and counts were obtained. The results showed reduction in body weight gain, testis weights, reduced sperm production, and increased histopathological abnormalities in the MeHg-treated group. However, treatment with Solanum plus MeHg revealed a protective effect of this fruit on damages caused by MeHg.
-
Structure of elementary module of Solanum dulcamara L.
Directory of Open Access Journals (Sweden)
Irina A. Zhuravlyeva
2014-04-01
Full Text Available The structures (metamers of Solanum dulcamara at the level of elementary module have been studied. The features for identification of their variability have been ascertained. 44 variants of metamers are described. The characteristic is represented for such individual features as: the type of lateral organ (leaf of a middle formation and axillary structure (bud, shoot, serial complex; the degree of development of the generative organs; and the presence and type of roots.
-
Directory of Open Access Journals (Sweden)
Elisalva T. Guimarães
2010-12-01
Full Text Available Physalis angulata L., Solanaceae, is an annual herb commonly used in popular medicine in many tropical and subtropical countries. P. angulata extracts contain a variety of substances, but little is known about their pharmacological activities. In this work we investigated the in vitro antileishmanial activity of seco-steroids (physalins purified from P. angulata. Addition of physalins B, F, and G caused a concentration-dependent inhibition in the growth of L. amazonensis promastigotes, being the IC50 values were 6.8, 1.4, and 9.2 μM, respectively. Physalin D was less active and had an IC50 value of 30.5 μM. Physalins were also active in cultures of other Leishmania species (L. major, L. braziliensis, and L. chagasi. Our results demonstrate the potent antileishmanial activity of physalins in cultures of Leishmania species of the New and Old Worlds and suggest the therapeutic potential of these seco-steroids in leishmaniasis.Physalis angulata L., Solanaceae, é uma erva anual utilizada na medicina popular em muitos países tropicais e subtropicais. Apesar dos extratos da P. angulata apresentarem uma grande variedade de substâncias, pouco é conhecido sobre a sua atividade farmacológica. Neste trabalho foi investigado a atividade antileishmania in vitro de seco-esteroides (fisalinas purificados da P. angulata. O tratamento com as fisalinas B, F e G causou uma inibição concentração-dependente do crescimento de promastigotas de Leishmania amazonensis em cultura axênica, com valores de IC50 de 6,8, 1,4, e 9,2 μM respectivamente. A fisalina D foi menos ativa, com valores de IC50 de 30,5 μM. Foi também observada uma atividade leishmanicida em culturas de outras espécies de Leishmania (L. major, L. braziliensis e L. chagasi. Nossos resultados demonstram que as fisalinas inibem o crescimento dos promastigotas com o tratamento de espécies de Leishmania do Velho e do Novo Mundos e sugerem o potencial terapêutico destas moléculas na
-
Finkers, H.J.; Heusden, van A.W.; Meijer-Dekens, R.G.; Kan, van J.A.L.; Maris, P.C.; Lindhout, P.
2007-01-01
Tomato (Solanum lycopersicum) is susceptible to grey mold (Botrytis cinerea). Partial resistance to this fungus has been identified in accessions of wild relatives of tomato such as Solanum habrochaites LYC4. In a previous F-2 mapping study, three QTLs conferring resistance to B. cinerea (Rbcq1,
-
Directory of Open Access Journals (Sweden)
Diana Marcela Ospina Monsalve
2007-12-01
Full Text Available Se hizo la caracterización reológica de la fruta de lulo (Solanum quitoense x Solanum hirtun a través de la respuesta mecánica bajo ensayos de compresión unidireccional a pruebas de firmeza y fractura, de acuerdo a dos grados de madurez comercial (pintón y maduro y tiempos de poscosecha (0, 3, 6, 9 días. Adicionalmente se determinaron propiedades físico-químicas tales como concentración de azúcares, pH y color. Las frutas fueron sometidas a ensayos de compresión unidireccional usando un analizador de textura a una velocidad de deformación de 1 mm∙s. Los ensayos para la prueba de fractura se realizaron según dos sentidos de carga (longitudinal y transversal y la prueba de firmeza se determinó en dos ángulos de incidencia. Los resultados mostraron que el comportamiento reológico de la fruta a ensayos de fractura y firmeza es altamente dependiente del tiempo transcurrido después de la cosecha de la fruta y condiciones fisiológicas (grado de madurez, situación ésta que refleja el comportamiento visco elástico y anisotrópico del producto. Los valores de la fuerza de fractura indicaron que la fruta pintona resiste mayor carga de aplastamiento con respecto al fruta madura. La fruta resiste más carga en sentido longitudinal que transversal, mostrando valores para frutas pintonas en posición longitudinal de 226 N y en posición transversal de 84,8 N, y para las frutas maduras se encontró una fuerza de fractura media en posición longitudinal de 180 N y en posición transversal de 68,5N. Para la fuerza de firmeza media (pulpa el valor máximo para frutas maduras fue de 1,4 N, y para frutas pintonas de 1,1 N. La fuerza de firmeza máxima (epicarpio tomó como valores máximos para las frutas maduras 14,4 N y para los frutas pintonas de 15,7 N.A rheological characterization of lulo fruits (Solanum quitoense x Solanum hirtum by using the test of unidirectional compression to firmness and fracture tests, according to two degrees of
-
Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda
2016-02-01
Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.
-
Krijger, D.; Schüttler, H.
2002-01-01
Solanum rantonnettii en Heliotropium peruvianum opgepot in week 41 2001 zijn in 4 kasafdelingen geplaatst waarbij, naast de als standaard ingestelde temperatuur van 15oC, DIF+kouval, natte kouval door middel van dagelijkse besproeiing met gekoeld water en belichting met SL-lampen is toegepast. Deze
-
Directory of Open Access Journals (Sweden)
M.F.O. Prates
2012-01-01
Full Text Available Objetivou-se neste trabalho determinar o tempo de secagem e modelar as curvas de secagem de folhas de fruta-de-lobo (Solanum lycocarpum A. St.-Hil. secas em temperaturas de 40, 50 e 60ºC, num secador de leito fixo em camada fina com velocidade do ar de 0,81 m s-1, bem como estimar o coeficiente de difusão efetivo e a energia de ativação. Aos dados experimentais foram ajustados oito modelos matemáticos. As magnitudes do coeficiente de determinação (R², do erro médio relativo (P e do erro médio estimado (SE foram utilizadas para verificar o grau de ajuste dos modelos. Concluiu-se que: a O tempo de secagem diminuiu com o aumento da temperatura; b os modelos de secagem Logaritmo e de Midilli et al. foram os que melhor se ajustaram aos dados experimentais; c Os valores do coeficiente de difusão aumentaram de acordo com a elevação da temperatura do ar de secagem e d O valor da energia de ativação para a folha Solanum lycocarpum A. St.-Hil. foi de 44, 60 kJ mol-1.The aims of this study were to determine the drying time and the shape of the drying curves of leaves of wolf apple (Solanum lycocarpum A. St.-Hil. dried at temperatures of 40, 50 and 60ºC in a thin layer fixed-bed dryer at air velocity of 0.81 m s-1, and to estimate the effective diffusion coefficient and activation energy. Eight mathematical models were fit to the experimental data. The magnitude of the coefficient of determination (R², the mean relative error (P and the estimated standard error (SE were used to verify the fitting degree of the models. It was concluded that: a The drying time decreased with increasing temperatures; b the drying models of Logarithm and of Midilli et al. best fit to the experimental data; c The values of the diffusion coefficient increased with the rising temperature of the drying air; d The value of activation energy for the leaf of Solanum lycocarpum A. St.-Hil. was 44.60 kJ mol-1.
-
Mazzari, Andre L D A; Milton, Flora; Frangos, Samantha; Carvalho, Ana C B; Silveira, Dâmaris; de Assis Rocha Neves, Francisco; Prieto, Jose M
2016-01-01
Erythrina mulungu Benth. (Fabaceae), Cordia verbenacea A. DC. (Boraginaceae), Solanum paniculatum L. (Solanaceae) and Lippia sidoides Cham. (Verbenaceae) are medicinal plant species native to Brazil shortlisted by the Brazilian National Health System for future clinical use. However, nothing is known about their effects in metabolic and transporter proteins, which could potentially lead to herb-drug interactions (HDI). In this work, we assess non-toxic concentrations (100 μg/mL) of the plant infusions for their in vitro ability to modulate CYP3A4 mRNA gene expression and intracellular glutathione levels in HepG2 cells, as well as P-glycoprotein (P-gp) activity in vincristine-resistant Caco-2 cells (Caco-2 VCR). Their mechanisms of action were further studied by measuring the activation of human pregnane X receptor (hPXR) in transiently co-transfected HeLa cells and the inhibition of γ-glutamyl transferase (GGT) in HepG2 cells. Our results show that P-gp activity was not affected in any case and that only Solanum paniculatum was able to significantly change CYP3A4 mRNA gene expression (twofold decrease, p effect upon hPXR (EC50 = 0.38 mg/mL). Total intracellular glutathione levels were significantly depleted by exposure to Solanum paniculatum (-44%, p Cordia verbenacea (-47%, p activity (-48%, p active pharmacovigilance is recommended for the other three species, especially in the case of Solanum paniculatum.
-
Directory of Open Access Journals (Sweden)
João Eduardo Cavalcanti Brito
2010-07-01
Full Text Available A abundância e a frugivoria de morcegos que compõem a taxocenose em uma área de mata ripária, à margem esquerda do rio Ivaí, foram foco do presente estudo. O Recanto Marista possui 57,6 hectares, dos quais 40,8 são cobertos por Floresta Estacional Semidecidual, situado no município de Doutor Camargo, região Noroeste do Estado do Paraná. Foram realizadas 14 noites de capturas de morcegos de maio de 2007 a janeiro de 2008, com redesneblina (7 x 2,5 m, totalizando 13.475 m² h de esforço amostral, distribuído em 72h de esforço. Foram capturados 193 indivíduos, representantes de dez espécies, pertencentes a duas famílias: Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus e Pygoderma bilabiatum e Vespertilionidae (Myotis nigricans, Eptesicus sp. e Lasiurus blossevillii. Um representante da família Molossidae (Molossus rufus foi encontrado morto no solo. Foram consumidos frutos pertencentes às famílias Moraceae (Ficus guaranitica, Ficus insipida, Ficus sp. e Maclura tinctoria, Solanaceae (Solanum aspero-lanatum e Solanum sp., Piperaceae (Piper aduncum, Piper amalago e Piper sp. e Urticaceae (Cecropia pachystachya e Cecropia sp..This study aims to evaluate the abundance and frugivory of bats from the Recanto Marista, a small riparian forest remnant in the margins of the Ivaí river. The Recanto Marista has 57.6 ha, of which 40.8 ha are covered by semideciduous seasonal forest and is located in the Doutor Camargo municipality. Collections were conducted from May 2007to January 2008 using mist nets (7 x 2.5 m totaling 13,475 m² h and comprising about 72 hours. Ten species were found pertaining to two families, Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus and Pygoderma bilabiatum and Vespertilionidae (Myotis nigricans, Eptesicus sp. and Lasiurus
-
Directory of Open Access Journals (Sweden)
Janaina Gazarini
2010-09-01
Full Text Available A abundância e a frugivoria de morcegos que compõem a taxocenose em uma área de mata ripária, à margem esquerda do rio Ivaí, foram foco do presente estudo. O Recanto Marista possui 57,6 hectares, dos quais 40,8 são cobertos por Floresta Estacional Semidecidual, situado no município de Doutor Camargo, região Noroeste do Estado do Paraná. Foram realizadas 14 noites de capturas de morcegos de maio de 2007 a janeiro de 2008, com redes-neblina (7 x 2,5 m, totalizando 13.475 m² h de esforço amostral, distribuído em 72h de esforço. Foram capturados 193 indivíduos, representantes de dez espécies, pertencentes a duas famílias: Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus e Pygoderma bilabiatum e Vespertilionidae (Myotis nigricans, Eptesicus sp. e Lasiurus blossevillii. Um representante da família Molossidae (Molossus rufus foi encontrado morto no solo. Foram consumidos frutos pertencentes às famílias Moraceae (Ficus guaranitica, Ficus insipida, Ficus sp. e Maclura tinctoria, Solanaceae (Solanum aspero-lanatum e Solanum sp. , Piperaceae (Piper aduncum, Piper amalago e Piper sp. e Urticaceae (Cecropia pachystachya e Cecropia sp..This study aims to evaluate the abundance and frugivory of bats from the Recanto Marista, a small riparian forest remnant in the margins of the Ivaí river. The Recanto Marista has 57.6 ha, of which 40.8 ha are covered by semideciduous seasonal forest and is located in the Doutor Camargo municipality. Collections were conducted from May 2007 to January 2008 using mist nets (7 x 2.5 m totaling 13,475 m² h and comprising about 72 hours. Ten species were found pertaining to two families, Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus and Pygoderma bilabiatum and Vespertilionidae (Myotis nigricans, Eptesicus sp. and Lasiurus
-
Directory of Open Access Journals (Sweden)
Fabiano Branco Rocha
2007-03-01
Full Text Available Samples of two toxic weeds, Solanum glaucophyllum and Xanthium strumarium, bearing leaf spots symptoms were found. Cercospora apii was found associated to these leaf spots in both plants. These are the first reports of this fungus on these hosts in Brazil and its first report on S. glaucophyllum worldwide.Foram encontrados plantas das espécies Solanum glaucophyllum e Xanthium strumaruium apresentando sintomas de manchas foliares. Cercospora apii foi encontrado associado lesões foliares em ambas as plantas. Estes são os primeiros relatos desse fungo nestes hospedeiros no Brasil e o primeiro relato de sua ocorrência em S. glaucophyllum no mundo.
-
AFLP analysis reveals a lack of phylogenetic structure within Solanum section Petota
Directory of Open Access Journals (Sweden)
Vleeshouwers Vivianne GAA
2008-05-01
Full Text Available Abstract Background The secondary genepool of our modern cultivated potato (Solanum tuberosum L. consists of a large number of tuber-bearing wild Solanum species under Solanum section Petota. One of the major taxonomic problems in section Petota is that the series classification (as put forward by Hawkes is problematic and the boundaries of some series are unclear. In addition, the classification has received only partial cladistic support in all molecular studies carried out to date. The aim of the present study is to describe the structure present in section Petota. When possible, at least 5 accessions from each available species and 5 individual plants per accession (totally approx. 5000 plants were genotyped using over 200 AFLP markers. This resulted in the largest dataset ever constructed for Solanum section Petota. The data obtained are used to evaluate the 21 series hypothesis put forward by Hawkes and the 4 clade hypothesis of Spooner and co-workers. Results We constructed a NJ tree for 4929 genotypes. For the other analyses, due to practical reasons, a condensed dataset was created consisting of one representative genotype from each available accession. We show a NJ jackknife and a MP jackknife tree. A large part of both trees consists of a polytomy. Some structure is still visible in both trees, supported by jackknife values above 69. We use these branches with >69 jackknife support in the NJ jackknife tree as a basis for informal species groups. The informal species groups recognized are: Mexican diploids, Acaulia, Iopetala, Longipedicellata, polyploid Conicibaccata, diploid Conicibaccata, Circaeifolia, diploid Piurana and tetraploid Piurana. Conclusion Most of the series that Hawkes and his predecessors designated can not be accepted as natural groups, based on our study. Neither do we find proof for the 4 clades proposed by Spooner and co-workers. A few species groups have high support and their inner structure displays also
-
Rodríguez Aguilar, Daniel Eduardo
2013-01-01
El almidón resistente retrogradado (AR3) de las variedades Pastusa (Solanum tuberosum grupo andigena) y Guaneña (Solanum tuberosum grupo phureja) fue evaluado como aditivo funcional con características similares a la fibra dietaria. En un primer experimento se comparó con manano oligosacáridos (MOS) a tres niveles de inclusión (0.5%, 1.0% y 1.5%) y un control sin suplementar, donde 600 pollos machos Ross de un día de edad fueron repartidos aleatoriamente a 10 tratamientos ex...
-
Effect of aqueous fruit extract of Solanum macrocarpum Linn. on cat ...
African Journals Online (AJOL)
The effects of the extract on the gastrointestinal propulsion of charcoal meal for laxative effect and on blood pressure of albino rats at known concentrations were monitored. Also ... The study shows that the aqueous fruit extract of Solanum macrocarpum could be useful as a laxative and hypotensive agent. Keywords: ...
-
Natural Medium for Growing of Endophytic Bacteria from Solanaceae in Malang-Indonesia
Directory of Open Access Journals (Sweden)
Purnawati Arika
2016-01-01
Full Text Available Endophytic bacteria are important microorganisms having potential as biocontrol agents for many pathogens. Until now, the growth of it always uses semi-synthetic or synthetic medium so it was difficult to be used by farmers in the field and it was expensive to have its propagation as biocontrol agents. Based on the problem, this research will study the natural medium as propagation medium of Endophytic bacteria. It had natural ingredients such as soybean, chicken broth, egg, worms, snail, sorghum and they were easy to get by farmers. This study used endophytic bacteria from Solanaceae in Malang- Indonesia. Four isolates of endophytic bacteria were grown in agar and liquid medium with ingredients of corn flour, soybean flour, sorghum flour, snail flour, and worm flour. There is no difference in the incubation period, color, shape, and surface colony. The population in medium with snail flour ingredients at a concentration of 107 cfu/ml is the highest and snail flour is the best medium for growing endophytic bacteria.
-
DEFF Research Database (Denmark)
Langkilde, Søren; Schrøder, Malene; Frank, Thomas
2012-01-01
Steroidal glycoalkaloids (GAs) are toxins, produced by plants of the Solanaceae family. The potato plant (Solanum tuberosum L.) and its tubers predominantly contain the two GAs α-chaconine and α-solanine. These compounds are believed to act in synergy, and the degree of toxicity may therefore...... for compositional similarity by analysing for a range of potato constituents, and (2) used in a 90-day feeding trial with the Syrian Golden hamster to study differential toxicity. The animal feeding study used diets with up to 60% freeze-dried potato powder from either line. Whilst data indicated some compositional...... concerns with regard to human (or animal) consumption....
-
Leaf Structure and Taxonomy of Petunia and Calibrachoa (Solanaceae
Directory of Open Access Journals (Sweden)
Claudia dos Reis
2002-03-01
Full Text Available We studied the leaf anatomy of sixteen species of Calibrachoa and eight species of Petunia. In Calibrachoa leaves, the vascular bundles sheath (endodermis was formed by parenchymatous developed cells, different from those of the mesophyll. In Petunia, this sheath did not show a marked morphological differentiation. The Calibrachoa leaves could be separated according to the type of leaf margins, the distribution of the stomata on leaf surfaces, the organization of the mesophyll and the morphology of the trichomes. Based on these results, an indented dichotomous identification key was elaborated for the species of the genus Calibrachoa.Foram estudados, sob o ponto de vista anatômico, os limbos foliares de dezesseis espécies de Calibrachoa Llav. & Lex. e de oito espécies de Petunia Juss. (Solanaceae. Em Calibrachoa, a bainha que envolve os feixes vasculares (endoderme é formada por células desenvolvidas e distintas das do mesofilo. Em Petunia, esta bainha não apresenta diferenciação morfológica marcante. As folhas das espécies de Calibrachoa foram separadas entre si levando-se em conta a distribuição dos estômatos nas faces foliares, a organização do mesofilo, o tipo de bordo e a morfologia dos tricomas. Com base nesses resultados, foi elaborada uma chave dicotômica indentada de identificação para as espécies do gênero Calibrachoa.
-
Identication of potivirus present in lulo (solanum quitoense lam
Directory of Open Access Journals (Sweden)
J. Vaca
1999-07-01
Full Text Available The Solanaceous fruit Solanum quitoense Lam, is originally from Andean región of South America. This fruit has commercial prospective. The Leaf Yellowing Disease in Lulo (Solanum quitoense Lam was first described by Zuluaga in 1991. It causes economically losses and has been associated with a virus attack. The disease's symptoms included stunting, yellow streaking or mosaic patterns in leaves, often with a curling of the leaf margins. In order to diagnostic the presence of virus, we applied two different strategies. The first one consisted of a modified technique of RNA double strand isolation (Morris and Dodds, 1979. The second one consisted on applying RT-PCR system using specific "primers" designed to amplify cDNA fragments spaning the 3'-terminal part of the Nlb cistron and the 5'-terminal part of the potyvirus CP cistron (Langeveld et al 1991. By applying the modified method of Morris and Dodds, it was possible to observe characteristic bands of double strand RNA. Amplification with "primers" POT1 and POT2 yielded a fragment of about 1 Kpb, whose length was in agreement with the known sequences of potyvirus. Here we report by the first time a potyvirus presence in Lulo plants affected with leaf yellowing disease, identified by dsRNA analysis and RT-PCR procedure.
-
Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong
2013-01-01
Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.
-
Directory of Open Access Journals (Sweden)
Miguel Sandoval-Vegas
2010-07-01
Full Text Available Introducción: Existen alternativas terapéuticas con productos naturales oriundos usados de manera empírica en la población. Tal es el caso del zumo de papa (Solanum tuberosum usado para problemas de mucosa gástrica. Objetivos: Evaluar la capacidad antioxidante y el efecto citoprotector a la mucosa gástrica del zumo de papa (Solanum tuberosum. Diseño: Experimental. Institución: Centro de Investigación de Bioquímica y Nutrición de la Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima. Materiales biológicos: Solanum tuberosum, variedad Tomasa y ratas albinas machos. Métodos: Se administró vía oral post ayuno las fracciones de sobrenadante y sedimento del zumo de Solanum tuberosum. Una hora después se administró alcohol como injuria de mucosa gástrica. Por laparotomía abdominal se obtuvo el tejido gástrico. Se midió en la mucosa gástrica el estrés oxidativo por lipoperoxidación, la formación de moco por alcian blue y la protección midiendo la extensión del área lacerada en imagen digitalizada. Principales medidas de resultados: Capacidad antioxidante y efecto citoprotector a la mucosa gástrica. Resultados: El sobrenadante de la dosis 5 mL/ kg produjo mayor protección al estrés oxidativo; el precipitado en dosis 5 mL/kg presentó mayor producción de moco, sin superar al control. El precipitado 20 mL/kg produjo mayor citoprotección (73,8%. Conclusión: La fracción sobrenadante del zumo de la papa (Solanum tuberosum posee actividad de defensa antioxidante y la fracción del sedimento, mayor actividad citoprotectora de la mucosa gástrica.
-
Susilo; Setyaningsih, M.
2018-01-01
Solanum melongena (eggplant) is one of the diversity of the Solanum family which is grown and widely spread in Indonesia and widely used by the community. This research explored the genetic diversity of four local Indonesian eggplant species namely leuca, tekokak, gelatik and kopek by using RAPD (Random Amplified Polymorphic DNA). The samples were obtained from Agricultural Technology Assessment Institute (BPTP) Bogor, Indonesia. The result of data observation was in the form of Solanum melongena plant’s DNA profile analyzed descriptively and quantitatively. 30 DNA bands (28 polymorphic and 2 monomorphic) were successfully scored by using four primers (OPF-01, OPF-02, OPF-03, and OPF-04). The Primers were used able to amplify all of the four eggplant samples. The result of PCR-RAPD visualization produces bands of 300-1500 bp. The result of cluster analysis showed the existence of three clusters (A, B, and C). Cluster A (coefficient of equal to 49%) consisted of a gelatik, cluster B (coefficient of 65% equilibrium) consisted of TPU (Kopek) and TK (Tekokak), and cluster C (55% equilibrium coefficient) consisted of LC (Leunca). These results indicated that the closest proximity is found in samples of TK (Tekokak) and TPU (Kopek).
-
Directory of Open Access Journals (Sweden)
O'Brien Kimberly
2008-06-01
Full Text Available Abstract Background The Solanaceae family contains a number of important crop species including potato (Solanum tuberosum which is grown for its underground storage organ known as a tuber. Albeit the 4th most important food crop in the world, other than a collection of ~220,000 Expressed Sequence Tags, limited genomic sequence information is currently available for potato and advances in potato yield and nutrition content would be greatly assisted through access to a complete genome sequence. While morphologically diverse, Solanaceae species such as potato, tomato, pepper, and eggplant share not only genes but also gene order thereby permitting highly informative comparative genomic analyses. Results In this study, we report on analysis 89.9 Mb of potato genomic sequence representing 10.2% of the genome generated through end sequencing of a potato bacterial artificial chromosome (BAC clone library (87 Mb and sequencing of 22 potato BAC clones (2.9 Mb. The GC content of potato is very similar to Solanum lycopersicon (tomato and other dicotyledonous species yet distinct from the monocotyledonous grass species, Oryza sativa. Parallel analyses of repetitive sequences in potato and tomato revealed substantial differences in their abundance, 34.2% in potato versus 46.3% in tomato, which is consistent with the increased genome size per haploid genome of these two Solanum species. Specific classes and types of repetitive sequences were also differentially represented between these two species including a telomeric-related repetitive sequence, ribosomal DNA, and a number of unclassified repetitive sequences. Comparative analyses between tomato and potato at the gene level revealed a high level of conservation of gene content, genic feature, and gene order although discordances in synteny were observed. Conclusion Genomic level analyses of potato and tomato confirm that gene sequence and gene order are conserved between these solanaceous species and that
-
Directory of Open Access Journals (Sweden)
Rosa Espejo
2013-03-01
Full Text Available Con la finalidad de obtener híbridos somáticos interespecíficos, se fusionaron protoplastos de la especie tetraploide Solanum tuberosum y de la especie silvestre diploide Solanum circaeifolium utilizando polietilenglicol. Los productos de fusión fueron cultivados en el medio V-KM suplementado con albúmina de suero bovino. Las primeras divisiones celulares ocurrieron a los 3 a 4 días de cultivo. Después de la formación de colonias se observó una rápida proliferación de callos, a partir de los cuales se regeneraron 19 plantas. El análisis molecular usando RAPD, confirmó que los regenerantes presentaban segmentos de ADN de ambos parentales, sugiriendo su posible naturaleza de híbridos somáticos. Las observaciones del número de cromosomas indicaron que todos los híbridos fueron aneuploides. En condiciones de invernadero, los regenerantes derivados de la fusión de protoplastos, mostraron características morfológicas intermedias entre las líneas parentales. Este estudio muestra la producción de híbridos somáticos de papa con el método de fusión presentado.
-
Improved efficiency of plant regeneration from protoplasts of eggplant Solanum melongena L.
Guri, A; Izhar, S
1984-12-01
Eggplant (Solanum melongena L.) mesophyll protoplasts were obtained from in vitro growing plants of line 410 and cv. 'Classic'. Relatively high (15%) plating efficiency was achieved using petri dishes with alternate quadrants containing reservoir medium (R medium + 1% activated charcoal) and culture medium. Shoot regeneration occurred within 6 weeks following initiation of protoplast culture.
-
Directory of Open Access Journals (Sweden)
Carmen Verónica Martín Vasallo
2017-07-01
Full Text Available Molluscs have become a serious problem for vegetable crops, especially the species Praticolella griseola (Pfeiffer. Therefore, the objective was to evaluate the percentage of mortality of the plant extracts on P. griseola in both laboratory and field conditions. An "in vitro" assay was performed with vegetable extracts of maguey (Furcraea hexapetala (Jacq. Family: Agavaceae, spiny güirito (Solanum globiferum L., Family: Solanaceae, chili pepper (Capsicum frutescens L., Solanaceae, cardon (Euphorbia lactea Haw., Family: Euphorbiaceae. When evaluating three concentrations of the extract of each botanical species, a completely randomized design was used in "in vitro" conditions and random blocks on the field. The extraction of the chili pepper extract was carried out using the fruit baking method, the S. globiferum was obtained from the milling of the dried fruits and the F. hexapetala and E. lactea were obtained through the fragmentation of stalks. Extracts of F. hexapetala, S. globiferum, C. frutescens, E. lactea, are alternatives to be used by producers in the control of P. griseola. The highest percentages of mortality are reached with the extracts of C. frutescens and S. globiferum at 72 hours of application.
-
Yang, Xu; Deng, Cao; Zhang, Yu; Cheng, Yufu; Huo, Qiuyue; Xue, Linbao
2015-04-07
WRKY transcription factors, which play critical roles in stress responses, have not been characterized in eggplant or its wild relative, turkey berry. The recent availability of RNA-sequencing data provides the opportunity to examine WRKY genes from a global perspective. We identified 50 and 62 WRKY genes in eggplant (SmelWRKYs) and turkey berry (StorWRKYs), respectively, all of which could be classified into three groups (I-III) based on the WRKY protein structure. The SmelWRKYs and StorWRKYs contain ~76% and ~95% of the number of WRKYs found in other sequenced asterid species, respectively. Positive selection analysis revealed that different selection constraints could have affected the evolution of these groups. Positively-selected sites were found in Groups IIc and III. Branch-specific selection pressure analysis indicated that most WRKY domains from SmelWRKYs and StorWRKYs are conserved and have evolved at low rates since their divergence. Comparison to homologous WRKY genes in Arabidopsis revealed several potential pathogen resistance-related SmelWRKYs and StorWRKYs, providing possible candidate genetic resources for improving stress tolerance in eggplant and probably other Solanaceae plants. To our knowledge, this is the first report of a genome-wide analyses of the SmelWRKYs and StorWRKYs.
-
International Nuclear Information System (INIS)
Gandolfo, D.; McKay, F.; Medal, J.C.; Cuda, J.P.
2007-01-01
An open-field experiment was conducted to assess the suitability of the South American leaf feeding beetle Gratiana boliviana Spaeth for biological control of Solanum viarum Dunal in the USA. An open-field test with eggplant, Solanum melongena L., was conducted on the campus of the University of Buenos Aires, Argentina, and a S. viarum control plot was established 40 km from the campus. One hundred adult beetles were released in each plot at the beginning of the experiment during the vegetative stage of the plants, and forty additional beetles were released in the S. melongena plot at the flowering stage. All the plants in each plot were checked twice a week and the number of adults, immatures, and eggs recorded. Results showed almost a complete rejection of eggplant by G. boliviana. No noticeable feeding damage was ever recorded on eggplant. The experiment was ended when the eggplants started to senesce or were severely damaged by whiteflies and spider mites. The results of this open-field experiment corroborate previous quarantine/laboratory host-specificity tests indicating that a host range expansion of G. boliviana to include eggplant is highly unlikely. Gratiana boliviana was approved for field release in May 2003 in the USA. To date, no non-target effects have been observed either on eggplant or native species of Solanum. (author) [es
-
Ventrella, Emanuela; Adamski, Zbigniew; Chudzińska, Ewa; Miądowicz-Kobielska, Mariola; Marciniak, Paweł; Büyükgüzel, Ender; Büyükgüzel, Kemal; Erdem, Meltem; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino Aurelio
2016-01-01
Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed) generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.
-
Directory of Open Access Journals (Sweden)
Emanuela Ventrella
Full Text Available Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.
-
Spyropoulou, E.A.; Haring, M.A.; Schuurink, R.C.
2014-01-01
BACKGROUND: Glandular trichomes are production and storage organs of specialized metabolites such as terpenes, which play a role in the plant's defense system. The present study aimed to shed light on the regulation of terpene biosynthesis in Solanum lycopersicum trichomes by identification of
-
Acosta-Quezada, P.G.; Raigón Jiménez, Mª Dolores; Riofrío-Cuenca, Tania; García Martínez, María Dolores; Plazas Ávila, María de la O; Burneo, J.I.; Figueroa, Jorge G.; Vilanova Navarro, Santiago; Prohens Tomás, Jaime
2015-01-01
[EN] We evaluated 23 tree tomato (Solanum betaceum) accessions from five cultivar groups and one wild relative (Solanum cajanumense) for 26 composition traits. For all traits we found highly significant differences (P < 0.001) among the materials studied. The high diversity found within S. betaceum for composition traits was matched by a high diversity within each of the cultivar groups. We found that sucrose and citric acid were the most important soluble sugar and organic acid, respectively...
-
Energy Technology Data Exchange (ETDEWEB)
Wasserman, R H; Bar, A; Corradino, R A; Taylor, A N; Peterlik, M
1974-01-01
Some properties of the vitamin D dependent CaBP have been briefly summarized. In addition to providing possible insight into the molecular basis of vitamin D action, the measurement of intestinal CaBP in animals subjected to different conditions and treatments has proven useful in assessing the effective vitamin D status of that animal. Using measurements of both the degree of intestinal /sup 47/Ca absorption in situ and duodenal CaBP levels, some aspects of the vitamin D-like factor in the South American plant Solanum malacoxylon were investigated. A vitamin D assay based on CaBP as end point indicated that the plant contains about 1.3 x 10/sup 5/ IU vitamin D/sub 3/ equivalents per kg. The Solanum factor, together with an adequate calcium intake, are necessary conditions for the product of gross toxic symptoms in the chick. Using experimental conditions that inhibit the conversion of 25-(OH)D/sub 3/ to 1,25-(OH)/sub 2/D/sub 3/ by the kidney enzyme system (i.e., a high stable strontium diet), it was shown that the Solanum factor can cause a reversal of this inhibition. This suggested that the Solanum factor mimics the action of 1,25-(OH)/sub 2/D/sub 3/, and this was confirmed by Walling and Kimberg (personal communication) since, in their hands, the administration of S. malacoxylon extract to nephrectomized rats was able to stimulate intestinal calcium transport in vitro. Similar results were brought forth at this meeting by Dr. Mautalen of Argentina. The Solanum factor was effective in an intestinal organ culture system, indicating that the factor acts directly on the gut and, if modification of the factor is needed for biological activity, the necessary enzymes are present in the intestinal tissue.
-
Mapeo de genes ribosómicos y heterocromatina en seis especies de Lycium de sudamérica (solanaceae
Directory of Open Access Journals (Sweden)
Soledad Blanco
2012-12-01
Full Text Available El clado Lycieae (Solanaceae reune 92 especies, actualmente agrupadas en un único género, Lycium. Se realizó un estudio citogenético en seis especies sudamericanas de este género, usándose por primera vez en el grupo la técnica de FISH, además de la técnica de bandeo CMA/DAPI. Se emplearon ápices radicales de las siguientes especies: L. boerhaviifolium (previamente Grabowskia, L. bridgesii (previamente Phrodus, el tetraploide L. chilense y los diploides L. cestroides, L. ciliatum y L. tenuispinosum. Se confirmó el número básico x=12. La técnica de bandeo reveló la presencia de una banda CMA+/DAPI- asociada a NORs en el primer par metacéntrico en las especies diploides, y en los dos primeros pares m en la tetraploide. Además, L. tenuispinosum mostró una banda intercalar CMA+/DAPI- en uno de sus cromosomas, en tanto que en L. bridgesii se encontraron bandas terminales e intercalares en todos los cromosomas. Con la técnica de FISH se observó que los loci 18-5,8-26S fueron consistentes con los bloques CMA+/DAPI-/NORs. Las especies diploides presentaron siempre un par cromosómico m portador de genes ADNr 5S, mientras que la especie tetraploide presentó dos pares, concordando con su nivel de ploidía. En las especies estudiadas, la diversificación no fue acompañada por rearreglos cromosómicos estructurales significativos, excepto L. bridgesii, que se destaca por poseer una fórmula cariotípica distinta y un mayor porcentaje de heterocromatina.Mapping of ribosomal genes and heterochromatin in Lycium of South America (Solanaceae. The clade Lycieae (Solanaceae embraces 92 species, currently gathered in a single genus, Lycium. A study was conducted in six South American species of this genus, using the FISH technique for the first time in the group, in addition to the CMA/DAPI banding technique. Root tips of the following species were employed: L. boerhaviifolium (previously Grabowskia, L. bridgesii (previously Phrodus, the
-
Solanum americanum: reservoir for Potato virus Y and Cucumber mosaic virus in sweet pepper crops
Directory of Open Access Journals (Sweden)
Monika Fecury Moura
2014-03-01
Full Text Available Weeds can act as important reservoirs for viruses. Solanum americanum (Black nightshade is a common weed in Brazil and samples showing mosaic were collected from sweet pepper crops to verify the presence of viruses. One sample showed mixed infection between Cucumber mosaic virus (CMV and Potato virus Y (PVY and one sample showed simple infection by PVY. Both virus species were transmitted by plant extract and caused mosaic in tomato (Solanum lycopersicum cv. Santa Clara, sweet pepper (Capsicum annuum cv. Magda, Nicotiana benthamiana and N. tabaccum TNN, and local lesions on Chenopodium quinoa, C. murale and C. amaranticolor. The coat protein sequences for CMV and PVY found in S. americanum are phylogenetically more related to isolates from tomato. We conclude that S. americanum can act as a reservoir for different viruses during and between sweet pepper crop seasons.
-
Flier, Wilbert G; Grünwald, Niklaus J; Kroon, Laurens P N M; Sturbaum, Anne K; van den Bosch, Trudy B M; Garay-Serrano, Edith; Lozoya-Saldaña, Hector; Fry, William E; Turkensteen, Lod J
2003-04-01
ABSTRACT The population structure of Phytophthora infestans in the Toluca Valley of central Mexico was assessed using 170 isolates collected from cultivated potatoes and the native wild Solanum spp., S. demissum and S. xendinense. All isolates were analyzed for mitochondrial DNA (mtDNA) haplotype and amplified fragment length polymorphism (AFLP) multi-locus fingerprint genotype. Isolate samples were monomorphic for mtDNA haplotype because all isolates tested were of the Ia haplotype. A total of 158 multilocus AFLP genotypes were identified among the 170 P. infestans isolates included in this study. P. infestans populations sampled in the Toluca Valley in 1997 were highly variable and almost every single isolate represented a unique genotype based on the analysis of 165 AFLP marker loci. Populations of P. infestans collected from the commercial potato-growing region in the valley, the subsistence potato production area along the slopes of the Nevado de Toluca, and the native Solanum spp. on the forested slopes of the volcano showed a high degree of genetic diversity. The number of polymorphic loci varied from 20.0 to 62.4% for isolates collected from the field station and wild Solanum spp. On average, 81.8% (135) of the AFLP loci were polymorphic. Hetero-zygosity varied between 7.7 and 19.4%. Significant differentiation was found at the population level between strains originating from cultivated potatoes and wild Solanum spp. (P = 0.001 to 0.022). Private alleles were observed in individual isolates collected from all three populations, with numbers of unique dominant alleles varying from 9 to 16 for isolates collected from commercial potato crops and native Solanum spp., respectively. Four AFLP markers were exclusively found present in isolates collected from S. demissum. Indirect estimation of gene flow between populations indicated restricted gene flow between both P. infestans populations from cultivated potatoes and wild Solanum hosts. There was no evidence
-
Induction and selection of lincomycin-resistant plants in Solanum melongena
International Nuclear Information System (INIS)
Sadanandam, A.; Farooqui, M.A.
1991-01-01
Cotyledon explants from axenic cultures of Solanum melongena were exposed to 1KR gamma rays and 0.1% ethylmethane sulphonate (EMS). Mutagenised were explants were implanted on shoot regeneration medium containing 100 mg 1 −1 limcomycin. Radiation treatment was efficient in inducing a high frequency of lincomcyn resistant shoots developing on cotyledon explants whereas EMS failed to induce antibiotic resistant shoots. The efficiency of irradiation in inducing lincomycin resistant adventitious shoots and kiloploid nature of chloroplast genome is discussed
-
The species boundaries of wild and cultivated potatoes, Solanum section Petota, are controversial with most of the taxonomic problems in a clade containing cultivated potatoes. We here provide the first in-depth phylogenetic study of the cultivated potato clade to explore possible causes of these pr...
-
Insight into the evolution of the Solanaceae from the parental genomes of Petunia hybrida.
Bombarely, Aureliano; Moser, Michel; Amrad, Avichai; Bao, Manzhu; Bapaume, Laure; Barry, Cornelius S; Bliek, Mattijs; Boersma, Maaike R; Borghi, Lorenzo; Bruggmann, Rémy; Bucher, Marcel; D'Agostino, Nunzio; Davies, Kevin; Druege, Uwe; Dudareva, Natalia; Egea-Cortines, Marcos; Delledonne, Massimo; Fernandez-Pozo, Noe; Franken, Philipp; Grandont, Laurie; Heslop-Harrison, J S; Hintzsche, Jennifer; Johns, Mitrick; Koes, Ronald; Lv, Xiaodan; Lyons, Eric; Malla, Diwa; Martinoia, Enrico; Mattson, Neil S; Morel, Patrice; Mueller, Lukas A; Muhlemann, Joëlle; Nouri, Eva; Passeri, Valentina; Pezzotti, Mario; Qi, Qinzhou; Reinhardt, Didier; Rich, Melanie; Richert-Pöggeler, Katja R; Robbins, Tim P; Schatz, Michael C; Schranz, M Eric; Schuurink, Robert C; Schwarzacher, Trude; Spelt, Kees; Tang, Haibao; Urbanus, Susan L; Vandenbussche, Michiel; Vijverberg, Kitty; Villarino, Gonzalo H; Warner, Ryan M; Weiss, Julia; Yue, Zhen; Zethof, Jan; Quattrocchio, Francesca; Sims, Thomas L; Kuhlemeier, Cris
2016-05-27
Petunia hybrida is a popular bedding plant that has a long history as a genetic model system. We report the whole-genome sequencing and assembly of inbred derivatives of its two wild parents, P. axillaris N and P. inflata S6. The assemblies include 91.3% and 90.2% coverage of their diploid genomes (1.4 Gb; 2n = 14) containing 32,928 and 36,697 protein-coding genes, respectively. The genomes reveal that the Petunia lineage has experienced at least two rounds of hexaploidization: the older gamma event, which is shared with most Eudicots, and a more recent Solanaceae event that is shared with tomato and other solanaceous species. Transcription factors involved in the shift from bee to moth pollination reside in particularly dynamic regions of the genome, which may have been key to the remarkable diversity of floral colour patterns and pollination systems. The high-quality genome sequences will enhance the value of Petunia as a model system for research on unique biological phenomena such as small RNAs, symbiosis, self-incompatibility and circadian rhythms.
-
Mariot, Roberta Fogliatto; Oliveira, De Luisa Abruzzi; Voorhuijzen, M.M.; Staats, Martijn; Hutten, R.C.B.; Dijk, Van J.P.; Kok, Esther; Frazzon, Jeverson
2015-01-01
Potato (Solanum tuberosum) yield has increased dramatically over the last 50 years and this has been achieved by a combination of improved agronomy and biotechnology efforts. Gene studies are taking place to improve new qualities and develop new cultivars. Reverse transcriptase quantitative
-
The present study determined whether young potato plants can be used as an assay to indicate potential effects of pesticides on asexual reproduction. Solanum tuberosum (Russet Burbank) plants were grown from seed pieces in a mineral soil in pots under greenhouse conditions. Plant...
-
Hovav, Ran; Chehanovsky, Noam; Moy, Michal; Jetter, Reinhard; Schaffer, Arthur A
2007-11-01
One of the most intriguing phenomena of fleshy fruit is the ability to maintain high water content at maturity, even following harvest. This is accomplished by a fruit cuticle that is highly impermeable to water diffusion. In this paper, we report on a novel genotype of tomato, developed via introgression from the wild species Solanum habrochaites, which is characterized by microfissuring of the fruit cuticle and dehydration of the mature fruit. The microfissure/dehydration phenotype is inherited as a single gene, termed Cwp1 (cuticular water permeability). The gene was fine mapped, and its identity was determined by map-based cloning and differential expression analysis in near-isogenic lines. Causality of the Cwp1 gene was shown by the heterologous transgenic expression of the gene in the cultivated tomato, which caused a microfissured fruit cuticle leading to dehydrated fruit. Cwp1 encodes for a protein of unidentified function in the DUF833 domain family. The gene is expressed in the fruit epidermis of the dehydrating genotype harbouring the wild-species introgression, but not in the cultivated tomato. It is expressed only in the primitive green-fruited wild tomato species, but is not expressed in the cultivated Solanum lycopersicum and the closely related Solanum cheesmaniae and Solanum pimpinellifolium, indicating a pre-adaptive role for Cwp1 silencing in the evolution and domestication of the cultivated tomato.
-
Czech Academy of Sciences Publication Activity Database
Gharbi, E.; Martínez, J. L.; Benahmed, H.; Hichri, I.; Dobrev, Petre; Motyka, Václav; Quineta, M.; Lutts, S.
2017-01-01
Roč. 258, MAY (2017), s. 77-89 ISSN 0168-9452 R&D Projects: GA ČR(CZ) GA16-14649S Institutional support: RVO:61389030 Keywords : antioxidant enzyme-activities * improves salinity tolerance * enhances salt tolerance * abscisic-acid * water-stress * na+-exclusion * accumulation * ethylene * growth * arabidopsis * Osmotic adjustment * Halophyte * Salinity * Solanum chilense * Hormone * Tomato Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 3.437, year: 2016
-
Directory of Open Access Journals (Sweden)
López Alfredo
2007-06-01
Full Text Available
Se ha demostrado que la transformación de papa (Solanum tuberosum mediada por Agrobacterium tumefaciens es dependiente del genotipo y que la mayoría de protocolos de transformación reportados son ineficientes al aplicarlos en la subespecie andigena. En esta propuesta se manejaron los procesos iniciales de mejoramiento genético de la nueva variedad colombiana de papa Pastusa suprema (Solanum tuberosum sp. andigena que es altamente androestéril, característica de gran importancia para los organismos modificados genéticamente. Esta variedad resultó de la hibridación interespecífica de tres especies de papa (Solanum stoloniferum, Solanum phureja var. Yema de huevo y Solanum tuberosum sp. andigena var. Parda pastusa. Se transformaron explantes internodales mediante el vector pCambia2301 que posee un gen reportero de la β-glucoronidasa y un gen de resistencia a la kanamicina. Se obtuvo un porcentaje de transformación inicial de 31 ± 2,5%, que se expresó mediante formación de callo sobre medios de selección y una frecuencia final con base en el ensayo GUS de 30%. Este es el primer reporte de transformación de un híbrido interespecífico de tres especies diferentes.
-
Mineral Content in Leaves of Tomato Plants Grafted on Solanum Rootstocks
松添, 直隆; 間, 浩美; 花田, 勝美; モハメド, アリ; 大久保, 敬; 藤枝, 國光
1995-01-01
Nutrient uptake of tomato plants cv. Momotaro grafted on Solanum sisymbriifoliulm, S. torvum and S. toxicarium which are resistant to soil-born disease were compared with tomato grafted on its own root, a tomato/tomato, scion/rootstock combination. Mineral content in leaves of tomato/S. sisymbriifoliulm was nearly equal to that of tomato/tomato. In leaves of tomato/S. torvum, nitrogen content was higher, and magnesium content was lower than those of tomato/tomato. Furthermore, phosphorus and ...
-
Szinay, D.
2010-01-01
In this thesis various fluorescence in situ hybridization (FISH) technologies are described to support genome projects, plant breeding and phylogenetic analysis on tomato (Solanum lycopersicum, 2n=24). Its genome is 980 Mb and only 30 % are single copy sequences, which are mostly found in the
-
Content of atropine and scopolamine in poisonous solanaceae plants from Slovenia
Directory of Open Access Journals (Sweden)
Javor Kac
2006-03-01
Full Text Available Background: Some species from the Solanaceae family are still the cause of serious poisoning among youth in Slovenia. Usually intoxication is due to abuse of these plants to provoke hallucinations. There is still not enough data about the alkaloid content of these plants growing in Slovenia.Methods: Different plant samples were analyzed for the content of atropine and scopolamine with capillary electrophoresis after solid phase extraction of alkaloids. Plants were gathered from different areas of Slovenia between April and September 2004.Results: Results were compared and possible correlations between the alkaloid content and species, plant parts, growth conditions, and time of harvest were suggested. Atropine and scopolamine contents were assessed in deadly nightshade (Atropa belladonna L., thorn apple (Datura stramonium L., scopolia (Scopolia carniolica Jacq. and angel trumpet. The common name angel trumpet is used for Datura inoxia Mill. as well as for different Brugmansia Pers. species. The most intriguing results were the variable alkaloid content in various Brugmansia species and generally great differences in alkaloid content among various plants and their plant parts.Conclusions: All investigated plants have noticeable atropine and/or scopolamine content. The content is variable between various plants and their plant parts and therefore special care should be taken in cases of possible intoxication. It was shown that smaller or greater amounts of ingested drug can cause the same level of intoxication due to the variability in alkaloid content.
-
Plastid transformation in potato: Solanum tuberosum.
Valkov, Vladimir T; Gargano, Daniela; Scotti, Nunzia; Cardi, Teodoro
2014-01-01
Although plastid transformation has attractive advantages and potential applications in plant biotechnology, for long time it has been highly efficient only in tobacco. The lack of efficient selection and regeneration protocols and, for some species, the inefficient recombination using heterologous flanking regions in transformation vectors prevented the extension of the technology to major crops. However, the availability of this technology for species other than tobacco could offer new possibilities in plant breeding, such as resistance management or improvement of nutritional value, with no or limited environmental concerns. Herein we describe an efficient plastid transformation protocol for potato (Solanum tuberosum subsp. tuberosum). By optimizing the tissue culture system and using transformation vectors carrying homologous potato flanking sequences, we obtained up to one transplastomic shoot per bombardment. Such efficiency is comparable to that usually achieved in tobacco. The method described in this chapter can be used to regenerate potato transplastomic plants expressing recombinant proteins in chloroplasts as well as in amyloplasts.
-
Directory of Open Access Journals (Sweden)
Gabriel Ordaz
2011-06-01
Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.
-
Chacón, M.G.; Adler, N.E.; Jarrin, F.; Flier, W.G.; Gessler, C.; Forbes, G.A.
2006-01-01
Thirty-nine isolates of Phytophthora infestans were collected from the wild host Solanum ochranthum in the highland tropics of Ecuador and characterized with a set of phenotypic and molecular markers (mating type, metalaxyl sensitivity, the allozyme loci Gpi, and Pep, mitochondrial DNA haplotype,
-
Kalayou, Shewit; Haileselassie, Mekonnen; Gebre-Egziabher, Gebremedhin; Tiku'e, Tsegay; Sahle, Samson; Taddele, Habtamu; Ghezu, Mussie
2012-07-01
To screen the antibacterial activity of nine ethnoveterinary plants traditionally used for the treatment of mastitis, wound and gastrointestinal complications. Hydroalcoholic exctracts of medicinal plants namely, Achyranthes aspera (A. aspera) L. (Family Asparagaceae), Ficus caria (F. caria) (Family Moraceae), Malvi parviflora (M. parviflora) (Family Malvaceae), Vernonia species (V. species) (local name Alakit, Family Asteraceae), Solanum hastifolium (S. hastifolium) (Family Solanaceae), Calpurinia aurea (C. aurea) (Ait) Benth (Family Fabaceae), Nicotiana tabacum (N. tabacum) L. (Family Solanaceae), Ziziphus spina-christi (Z. spina-christi) (Family Rhamnaceae), Croton macrostachys (C. macrostachys) (Family Euphorbiaceae), were screened against clinical bacterial isolates of veterinary importance from October 2007 to April 2009. The antibacterial activity was tested using disc diffusion at two concentrations (200 mg/mL and 100 mg/mL) and broth dilution methods using 70% methanol macerated leaf extracts. With the exception of S. hastifolium all plant extracts exhibited antibacterial activity. Among the medicinal plants tested C. aurea, C. macrostachyus, A. aspera, N. tabacum and vernonia species (Alakit) showed the most promising antimicrobial properties. It can be concluded that many of the tested plants have antibacterial activity and supports the traditional usage of the plants for mastitis, wound and gastrointestinal complications treatment. Further studies into their toxicity and phytochemistry is advocated.
-
Induced micro-mutations in Solanum khasianum Clarke
International Nuclear Information System (INIS)
Bhattacharyya, B.; Borua, P.K.; Talukdar, P.
1996-01-01
Extent of genetic variability for plant height, branches/plant, leaves/plant, spines/leaf, fruits/plant, seeds/fruit, fresh weight of fruits/plant and dry weight of fruits/plant was studied in spined and spineless strains of Solanum khasianum Clarke, following exposure of seeds to seven doses of gamma rays. Gamma ray treatments induced sufficient genetic variability in M 2 generation for the characters particularly in spined strain. Genotypic and phenotypic coefficient of variation and heritability in broad sense were high for spines/leaf, fruits/plant, fresh and dry weight of fruits/plant. High heritability was accompanied by high genetic advance for fresh and dry weight of fruits/plant, seeds/fruit and fruits/plant. Spineless strain was found to be more sensitive to increased gamma ray exposure in comparison to spined strain. (author). 7 refs., 4 tabs
-
Hamidou F. Sakhanokho; M. Nurul Islam-Faridi; Eugene K. Blythe; Barbara J. Smith; Kanniah Rajasekaran; M. A. Majid
2014-01-01
Solanum aethiopicum L. is native to sub-Saharan Africa but is now found in many parts of the world. It is used for food, medicinal, and ornamental purposes. It has also been used as a rootstock for tomato and common eggplant because of its resistance to certain pathogens. However, very little is known about its genetics, so the purpose of this work was to assess...
-
Svubure, O.
2015-01-01
Keywords: Irish potato, food security, stakeholder analysis, sustainability indicators, Cool Farm Tool-Potato, yield gap, resource use efficiency, LINTUL-POTATO model, Zimbabwe.
Oniward Svubure (2015). Agronomic and environmental studies of potato (Solanum
-
Directory of Open Access Journals (Sweden)
M Goldani
2015-04-01
Full Text Available In order to study the competition effects of Solanum nigrum on Vigna radiate yield, an additive experiment was conducts at Ferdowsi University of Mashhad experimental Greenhouse. The type of design was completely randomized block. Treatments included three density of Solanum nigrum (2, 4, and 6 plants m-2 and three types of competition (root, shoot and both of them planted at constant density of Vigna radiate plus weed free check in each block. The results indicated that competitions had significant effects (P
-
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
-
Directory of Open Access Journals (Sweden)
Echur Natarajan Sundaram
2015-01-01
Full Text Available Background and Objective: In Homoeopathy, Solanum nigrum is clinically used in the treatment of ergotism, meningitis, irritation during dentition and some of the symptoms of neurological disorders but its Central Nervous System (CNS potential has not been explored experimentally yet. Therefore, a preliminary study was conducted with an objective to evaluate the analgesic and CNS depressant effects of homoeopathic potencies of S. nigrum in experimental animal models. Materials and Methods: The study was conducted in Wistar albino rats using a hot plate, ice plate and Randall-Selitto assay for analgesic; rota-rod and open field test for CNS depressant activities. The different potencies (3X, 6X, 12X and 30C of Solanum nigrum were administered orally (0.5 ml/rat/day for 30 days and response was assessed after 30 minutes of drug administration on 10 th , 20 th and 30 th day. Results: The result shows that all the four potencies of Solanum nigrum has increased the latency time required to raise and lick the paws for thermal sensation on hot plate test and for cold sensation on ice plate test and also increased the degree of threshold pressure to mechanically induced pain on Randall-Selitto assay but depressed the motor coordination and locomotor activities. Conclusion: The result obtained from this preliminary study suggests that homoeopathic preparation of Solanum nigrum in different potencies possess analgesic and CNS depressant activities. Further detailed investigations are required for its possible human use.
-
Numerous studies have reported the volatile profiles in the whole fruit or pericarp tissue of tomato (Solanum lycopersicum) fruit; however, information is limited on the volatile composition in the inner tissue and its contribution to tomato aroma. For this, the pericarps and inner tissues of “Money...
-
Variation of germination of eggplant (Solanum melongena L.) seed during storage life
Ristić, Nevena; Todorović, Vesna; Adžić, Slađan; Zdravković, Jasmina
2013-01-01
Eggplant (Solanum melongena L.) seed is dormant, which means that the maximum germination is achieved after some time. The research was performed on one genotype (Domaci srednje dugi - DSD). The seed, studied for germination rate, originates from year 2007 and the germination variation was studied for period 2007 - 2011. Eggplant seed was dormant after yield in 2007, but the germination increased over the years. The trial was conducted at the standard germination test method, defined in the R...
-
Directory of Open Access Journals (Sweden)
Andre Luis Dias Araujo Mazzari
2016-08-01
Full Text Available Erythrina mulungu Benth. (Fabaceae, Cordia verbenacea A. DC. (Boraginaceae, Solanum paniculatum L. (Solanaceae and Lippia sidoides Cham. (Verbenaceae are medicinal plants species native to Brazil shortlisted by the Brazilian National Health System for future clinical use. However, nothing is known about their effects in metabolic and transporter proteins, which could potentially lead to herb-drug interactions (HDI. In this work we assess non-toxic concentrations (100μg/mL of their infusions for their in vitro ability to modulate CYP3A4 mRNA gene expression and intracellular glutathione levels in HepG2 cells, as well as P-glycoprotein (P-gp activity in vincristine-resistant Caco-2 cells (Caco-2 VCR. Their mechanisms of action were further studied by measuring the activation of human pregnane X receptor (hPXR in transiently co-transfected HeLa cells and the inhibition of γ-glutamyl transferase (GGT in HepG2 cells. Our results show that P-gp activity was not affected in any case and that only Solanum paniculatum was able to significantly change CYP3A4 mRNA gene expression (two-fold decrease, p<0.05, this being correlated with an antagonist effect upon hPXR (EC50 = 0.38mg/mL. Total intracellular glutathione levels were significantly depleted by exposure to Solanum paniculatum (-44%, p<0.001, Lippia sidoides (-12%, p<0.05 and Cordia verbenacea (-47%, p<0.001. The later plant extract was able to decrease GGT activity (-48%, p<0.01. In conclusion, this preclinical study shows that the administration of some of these herbal medicines may be able to cause disturbances to metabolic mechanisms in vitro. Although Erythrina mulungu appears safe in our tests, active pharmacovigilance is recommended for the other three species, especially in the case of Solanum paniculatum.
-
Toxicological, Antidiarrheal and Spasmolytic Activities of Solanum paniculatum.
Clementino-Neto, José; Pereira, Joedna C; Vasconcelos, Luiz H C; de Souza, Iara L L; Silva, Anne D S; Silva, Telma M G; Ramos, Natalia S M; Pessôa, Hilzeth L F; Silva, Tania M S; da Silva, Bagnólia A; de Cavalcante, Fabiana A
2016-01-01
Solanum paniculatum is popularly known as "jurubeba-verdadeira". In folk medicine, its roots, stems, and leaves are used as tonics, anti-inflammatories, carminatives, diuretics, and for gastrointestinal disorders. This species is listed in the Brazilian Pharmacopoeia and belongs to the "Relação Nacional de Plantas Medicinais de Interesse ao SUS". Based on folk medicine data of the Solanum genus, we decided to investigate whether the crude ethanol extract from S. paniculatum aerial parts presents toxicological, antidiarrheal, and spasmolytic activities. The crude ethanol extract from S. paniculatum aerial parts did not produce in vitro or in vivo toxicity and showed dose-dependent antidiarrheal activity, inhibiting equipotently both the defecation frequency (ED50 = 340.3 ± 35.1 mg/kg) and liquid stool formation (ED50 = 370.1 ± 19.4 mg/kg) in mice. Conversely, the crude ethanol extract from S. paniculatum aerial parts did not inhibit normal intestinal transit, even though it has shown a dose-dependent reduction of both the castor oil-induced intestinal transit (Emax = 36.9 ± 1.3 %, ED50 = 242.0 ± 8.6 mg/kg) and intestinal fluid content (Emax = 74.8 ± 2.4 %, ED50 = 328.9 ± 15.9 mg/kg). Additionally, the crude ethanol extract from S. paniculatum aerial parts was approximately 2-fold more potent in antagonizing the phasic contractions induced with histamine (IC50 = 63.7 ± 3.5 µg/mL) than carbachol 10(-6) M (IC50 = 129.3 ± 14.1 µg/mL). Therefore, we concluded that the crude ethanol extract from S. paniculatum aerial parts presents antidiarrheal activity in mice related to the inhibition of small intestinal motility and secretion as well as nonselective spasmolytic activity on the guinea pig ileum. Georg Thieme Verlag KG Stuttgart · New York.
-
Occurrence of horse nettle (Solanum carolinense L.) in North Rhine-Westphalia
Klingenhagen, Günter; Wirth, Martin; Wiesmann, Bernd; Ahaus, Hermann
2012-01-01
In autumn 2008 during corn harvest (Zea mays L.), the driver of the combine harvester spotted an unfamiliar plant species in the field. It turned out that Solanum carolinense L. was the unknown weed species. The species had overgrown 40 % of the corn field which had a size of 10.2 ha. The farmer who usually effectively controls all weeds on his field had so far not noticed the dominance of the solanaceous herb species. From his point of view, the weed must have germinated after the corn had c...
-
Bolivia is the poorest country in South America with over 80% of the rural population under the poverty line. Agricultural productivity is closely correlated with poverty levels across rural Bolivia. Potato (Solanum tuberosum L.) is one of the most important crops for food security in Bolivia and th...
-
Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E; Vieira, Cristina P
2015-06-02
Fabaceae species are important in agronomy and livestock nourishment. They have a long breeding history, and most cultivars have lost self-incompatibility (SI), a genetic barrier to self-fertilization. Nevertheless, to improve legume crop breeding, crosses with wild SI relatives of the cultivated varieties are often performed. Therefore, it is fundamental to characterize Fabaceae SI system(s). We address the hypothesis of Fabaceae gametophytic (G)SI being RNase based, by recruiting the same S-RNase lineage gene of Rosaceae, Solanaceae or Plantaginaceae SI species. We first identify SSK1 like genes (described only in species having RNase based GSI), in the Trifolium pratense, Medicago truncatula, Cicer arietinum, Glycine max, and Lupinus angustifolius genomes. Then, we characterize the S-lineage T2-RNase genes in these genomes. In T. pratense, M. truncatula, and C. arietinum we identify S-RNase lineage genes that in phylogenetic analyses cluster with Pyrinae S-RNases. In M. truncatula and C. arietinum genomes, where large scaffolds are available, these sequences are surrounded by F-box genes that in phylogenetic analyses also cluster with S-pollen genes. In T. pratense the S-RNase lineage genes show, however, expression in tissues not involved in GSI. Moreover, levels of diversity are lower than those observed for other S-RNase genes. The M. truncatula and C. arietinum S-RNase and S-pollen like genes phylogenetically related to Pyrinae S-genes, are also expressed in tissues other than those involved in GSI. To address if other T2-RNases could be determining Fabaceae GSI, here we obtained a style with stigma transcriptome of Cytisus striatus, a species that shows significant difference on the percentage of pollen growth in self and cross-pollinations. Expression and polymorphism analyses of the C. striatus S-RNase like genes revealed that none of these genes, is the S-pistil gene. We find no evidence for Fabaceae GSI being determined by Rosaceae, Solanaceae, and
-
Yuan, H.; Cheung, C.Y. Maurice; Poolman, M.G.; Hilbers, P.A.J.; van Riel, N.A.W.
2016-01-01
Tomato (Solanum lycopersicum L.) has been studied extensively due to its high economic value in the market, and high content in health-promoting antioxidant compounds. Tomato is also considered as an excellent model organism for studying the development and metabolism of fleshy fruits. However, the
-
Jaarsma, R.; Vries, R.S.M.; de Boer, A.H.
2013-01-01
Potato (Solanum tuberosum) is a major crop world-wide and the productivity of currently used cultivars is strongly reduced at high soil salt levels. We compared the response of six potato cultivars to increased root NaCl concentrations. Cuttings were grown hydroponically and treated with 0 mM, 60 mM
-
Physcio chemical analysis of browning inhibitors treated solanum turberosum powder
International Nuclear Information System (INIS)
Alizai, M.N.K.; Abid, H.
2008-01-01
White potatoes (Solanum turberosum) were procured from agriculture Research Institute Tarnab Farm Peshawar to use for the preparation of potato powder. The process involves sorting. Washing, peeling slicing, blanching, treating with poly phenol oxidase inhibitors, dehydration, grinding and packing. All these parameters used in process were standardized. Chemical analysis of fresh potato and potato powder were carried out. Microbiological examination, functional properties and storage life studies of the potato powder were also performed. The product prepared by drying in cabinet dryer at 55 C for 7 hours was off white colour potatoes chips which was grinded to make off white potato powder. The potato powder possessed taste and texture. (author)
-
Medicinal plants used to treat TB in Ghana.
Nguta, Joseph Mwanzia; Appiah-Opong, Regina; Nyarko, Alexander K; Yeboah-Manu, Dorothy; Addo, Phyllis G A
2015-06-01
The current study was designed to document medicinal plant species that are traditionally used to treat tuberculosis (TB) by Ghanaian communities. The medicinal plants used against TB or its signs and symptoms were selected using library and online published data searches. A guided questionnaire interview was also conducted with a botanist involved in plant collection at the Centre for Scientific Research into Plant Medicine (CSRPM) at Mampong. Data obtained were entered in Excel and summarized into means and frequencies using SPSS 12.0.1 for windows, and expressed as tables and bar graphs. A total of 15 medicinal plant species distributed between 13 genera and 13 families were documented. The following medicinal plant species were found to be used against TB in Greater Accra and Eastern parts of Ghana: Azadirachta indica A. Juss. Stem bark (Meliaceae), Hygrophila auriculata Heine, whole plant (Acanthaceae), Chenopodium ambrosioides L. leaves (Amaranthaceae), Coix lacryma-jobi L. glumes (Poaceae), Solanum torvum Sw. unripe fruits (Solanaceae), Solanum torvum Sw. leaves (Solanaceae), Bidens pilosa L. whole plant (Asteraceae), Phyllanthus fraternus G.L. Webster leaves (Phyllanthaceae), Dissotis rotundifolia (Sm.) Triana, leaves (Melastomataceae), Cymbopogon giganteus Chiov. Leaves (Poaceae), Cyperus articulatus L. roots (Cyperaceae), Allium sativum L. bulb (Amaryllidaceae), Zingiber officinale Roscoe, rhizomes (Zingiberaceae), Allium cepa L. bulbs (Amaryllidaceae), Allium cepa L. leaves (Amaryllidaceae), Aloe vera var. barbadensis aqueous extract from leaves (Xanthorrhoeaceae), Aloe vera var. barbadensis organic extract from leaves (Xanthorrhoeaceae), Cocos nucifera Linn, water (Arecaceae) and Cocos nucifera Linn. Husk (Arecaceae). The collected plant species could be a source of a new class of drugs against TB. Bioactivity guided fractionation is recommended to identify lead compounds for antimycobacterial activity. The current paper documents for the first time
-
Mazzari, Andre L. D. A.; Milton, Flora; Frangos, Samantha; Carvalho, Ana C. B.; Silveira, Dâmaris; de Assis Rocha Neves, Francisco; Prieto, Jose M.
2016-01-01
Erythrina mulungu Benth. (Fabaceae), Cordia verbenacea A. DC. (Boraginaceae), Solanum paniculatum L. (Solanaceae) and Lippia sidoides Cham. (Verbenaceae) are medicinal plant species native to Brazil shortlisted by the Brazilian National Health System for future clinical use. However, nothing is known about their effects in metabolic and transporter proteins, which could potentially lead to herb-drug interactions (HDI). In this work, we assess non-toxic concentrations (100 μg/mL) of the plant infusions for their in vitro ability to modulate CYP3A4 mRNA gene expression and intracellular glutathione levels in HepG2 cells, as well as P-glycoprotein (P-gp) activity in vincristine-resistant Caco-2 cells (Caco-2 VCR). Their mechanisms of action were further studied by measuring the activation of human pregnane X receptor (hPXR) in transiently co-transfected HeLa cells and the inhibition of γ-glutamyl transferase (GGT) in HepG2 cells. Our results show that P-gp activity was not affected in any case and that only Solanum paniculatum was able to significantly change CYP3A4 mRNA gene expression (twofold decrease, p Cordia verbenacea (-47%, p < 0.001). The latter plant extract was able to decrease GGT activity (-48%, p < 0.01). In conclusion, this preclinical study shows that the administration of some of these herbal medicines may be able to cause disturbances to metabolic mechanisms in vitro. Although Erythrina mulungu appears safe in our tests, active pharmacovigilance is recommended for the other three species, especially in the case of Solanum paniculatum. PMID:27594838
-
Delaplace, P.; Fauconnier, M.L.; Sergeant, K.; Dierick, J.F.; Oufir, M.; Wal, van der F.; America, A.H.P.; Renaut, J.; Hausman, J.F.; Jardin, du P.
2009-01-01
During post-harvest storage, potato tubers age as they undergo an evolution of their physiological state influencing their sprouting pattern. In the present study, physiological and biochemical approaches were combined to provide new insights on potato (Solanum tuberosum L. cv. Desiree) tuber
-
In Ecuador, tamarillo (Solanum betaceum) represents an important cash crop for hundreds of small farmers. In 2013, leaves from tamarillo plants showing severe virus-like symptoms (mosaic, mottling and leaf deformation) were collected from old orchards in Pichincha and Tungurahua. Double-stranded RN...
-
Directory of Open Access Journals (Sweden)
Ortiz Luz Yineth
2008-04-01
Full Text Available
De las 30 variedades de papa cultivadas en Colombia tan solo 10 poseen importancia comercial. Entre otros factores, este número es limitado por la acción de hormonas endógenas que aceleran diferentes fases del proceso de tuberización, especialmente en las especies más precoces. En este trabajo fueron recolectadas muestras de tubérculos de diferentes especies de papa (Solanum tuberosum L. var. ICA-Única y Tuquerreña, y Solanum phureja Juz. et Buk. var. Yema de Huevo, en los estadios fenológicos de desarrollo 03, 10 y 40. Posteriormente, las concentraciones de ácido abscísico (ABA presentes en la fracción ácida y de citoquininas presentes en la fracción orgánica de los extractos fueron determinadas a través de Cromatografía Líquida de Alta Eficiencia. Los resultados en las variedades estudiadas relacionan la precocidad de la tuberización con la ausencia de ABA y los periodos de mayor latencia con su presencia; por otro lado, las concentraciones de citoquininas fueron evidentes en las variedades con mayor precocidad. Es decir, en S. phureja Juz. et Buk. var. Yema de Huevo se encontraron concentraciones bajas de ABA y altas de citoquininas; mientras que en ICA-Única y, en especial, en Tuquerreña, variedades con periodos de latencia mayor, las concentraciones de ABA fueron altas y las de citoquininas menos significativas.
-
Marsaro Júnior, A L; Peronti, A L B G; Penteado-Dias, A M; Morais, E G F; Pereira, P R V S
2013-05-01
The pink hibiscus mealybug (PHM), Maconellicoccus hirsutus (Green) (Hemiptera: Pseudococcidae) and the associated hymenopterous parasitoid, Anagyrus kamali Moursi, 1948 (Hymenoptera: Encyrtidae), are reported for the first time in Brazil. Specimens of the PHM were collected on nine hosts plants, Annona muricata L. (Anonnaceae), Glycine max (L.) Merr. (Fabaceae), Centrolobium paraensis Tul. (Fabaceae), Inga edulis Mart. (Fabaceae), Hibiscus rosa-sinensis L. (Malvaceae), Psidium guajava L. (Myrtaceae), Averrhoa carambola L. (Oxalidaceae), Citrus sinensis (L.) Osbeck (Rutaceae) and Solanum lycopersicum L. (Solanaceae), in four municipalities in the north-northeast of the state of Roraima. The plants C. paraensis, I. edulis and C. sinensis are recorded for the first time as a hosts for PHM. Characteristic injuries observed on the host plants infested by PHM and suggestions for its management are presented.
-
Efficiency of Buzzing Bees in Fruit Set and Seed Set of Solanum violaceum in Sri Lanka
Directory of Open Access Journals (Sweden)
R. W. M. U. M. Wanigasekara
2012-01-01
Full Text Available Plant-pollinator interactions are often considered as tightly coevolved, mutualistic relationships. The present study aimed at determining the flower visiting bees of the vegetable crop, Solanum violaceum, and the efficiency of buzz pollination by bees on fruit and seed production in Sri Lanka. Seven bee species: Hoplonomia westwoodi, Amegilla comberi, Patellapis kaluterae, Xylocopa tenuiscapa, Apis dorsata, Trigona iridipennis, and Ceratina hieroglyphica visited the flowers of S. violaceum, and the first four species were buzzing bees. Buzzing bees were the first to visit Solanum flowers and were followed by nonbuzzing bees. Handling time of H. westwoodi and P. kaluterae varied with the availability of pollen in anthers that deplete with the age of flower and stayed longer at new flowers than at old flowers. Handling time of the larger buzzing bee, H. westwoodi, was higher than that of the smaller P. kaluterae. The fruit set, seed set, and seed germinability in flowers visited by buzzing bees were significantly higher than those of the flowers bagged to exclude pollinators.
-
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2017-01-01
Wild tomatoes are a valuable source of disease resistance germplasm for tomato ( Solanum lycopersicum ) breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense , both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense . We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens ( Alternaria solani , Phytophthora infestans and a Fusarium sp .) and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense , resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved.
-
Tempelaar, MJ; Drenth - Diephuis, L.J.; SAAT, TAWM; Jacobsen, E.
Rate and extent of spontaneous and induced chromosome loss have been determined at the callus level of somatic hybrids of mutants of Solanum tuberosum and Nicotiana plumbaginifolia. AEC (amino ethyl cystein) resistance in potato and Nitrate-Reductase deficiency in N. plumbaginifolia have been used
-
Fasano, Carlo; Diretto, Gianfranco; Aversano, Riccardo; D'Agostino, Nunzio; Di Matteo, Antonio; Frusciante, Luigi; Giuliano, Giovanni; Carputo, Domenico
2016-06-01
Polyploids are generally classified as autopolyploids, derived from a single species, and allopolyploids, arising from interspecific hybridization. The former represent ideal materials with which to study the consequences of genome doubling and ascertain whether there are molecular and functional rules operating following polyploidization events. To investigate whether the effects of autopolyploidization are common to different species, or if species-specific or stochastic events are prevalent, we performed a comprehensive transcriptomic and metabolomic characterization of diploids and autotetraploids of Solanum commersonii and Solanum bulbocastanum. Autopolyploidization remodelled the transcriptome and the metabolome of both species. In S. commersonii, differentially expressed genes (DEGs) were highly enriched in pericentromeric regions. Most changes were stochastic, suggesting a strong genotypic response. However, a set of robustly regulated transcripts and metabolites was also detected, including purine bases and nucleosides, which are likely to underlie a common response to polyploidization. We hypothesize that autopolyploidization results in nucleotide pool imbalance, which in turn triggers a genomic shock responsible for the stochastic events observed. The more extensive genomic stress and the higher number of stochastic events observed in S. commersonii with respect to S. bulbocastanum could be the result of the higher nucleoside depletion observed in this species. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
-
Directory of Open Access Journals (Sweden)
JORGE D. MERCADO-GÓMEZ
2013-12-01
Full Text Available Se caracterizó la morfología polínica de las especies pertenecientes a las familias, Hypericaceae, Lamiaceae, Lobeliaceae, Polygonaceae, Rhamnaceae, Rosaceae, Rubiaceae, Scrophulariaceae y Solanaceae, encontradas en la zona El Volcán (Pamplona, Colombia. Las observaciones, descripciones y microfotografías de los granos de polen se realizaron con microscopio de luz, contando un mínimo de 25 granos por especie. Todas las familias presentan un carácter euripalinologico, excepto Melastomataceae la cual es estenopalinologica. Asimismo, al realizar comparaciones sobre algunas especies que fueron descritas en otras zonas del bosque altoandino y páramo en la cordillera Central y Occidental, fue posible determinar variaciones en la morfología polínica.
-
Directory of Open Access Journals (Sweden)
Flávio França
1996-06-01
Full Text Available This paper records the plants used in the treatment of cutaneous leishmaniasis due to Leishmania (Viannia braziliensis (L(Vb among the rural population of a cocoa- producing coastal area of Bahia state, Brazil. An enquiry conducted among a hundred patients identified 49 plant species used to treat skin ulceration caused by this Leishmania species. The principal plants used are caju-branco (Anacardium occidentale - Anacardiaceae, used by 65% of the population, folha-fogo (Clidemia hirta - Melastomataceae 39%, alfavaca-grossa (Plectranthus amboinicus - Lamiaceae 33%, mastruz (Chenopodium ambrosioides - Chenopodiaceae 31%, erva-de-santa-maria (Solatium americanum - Solanaceae (25% and transagem (Plantago major - Plantaginaceae. 2%.Este trabalho relata as plantas usadas no tratamento da leishmaniose cutânea, causada por Leishmania (Viannia braziliensis (L(Vb, na população rural da faixa litorânea produtora de cacau do estado da Bahia, Brasil. Um inquérito realizado entre 100 pacientes, identificou 49 espécies de plantas usadas para tratar úlceras de pele causadas por esta espécie de Leishmânia. As principais plantas usadas foram o cajueiro-branco (Anacardium occidentale - Anacardiaceae usado por 65% da população, a folha-fogo (Clidemia hirta - Melastomataceae 39%, a alfavaca-grossa (Plectranthus amboinicus - Lamiaceae 33%, o mastruz (Chenopodium ambrosioides - henopodiaceae 31%, a erva-de-santa-maria (Solanum americanum - Solanaceae 25% e a transagem (Plantago major - Plantaginaceae 2%.
-
Cold-induced sweetening and browning in the Maillard reaction have driven extensive research in the areas of plant physiology, biochemistry, and food science in Solanum tuberosum. To date, research in these areas excluded wild relatives of potato. This is the first assessment of cold-stored tuber c...
-
Interspecific somatic hybrid plants between eggplant (Solanum melongena) and Solanum torvum.
Guri, A; Sink, K C
1988-10-01
Mesophyll protoplasts of eggplant (cv Black Beauty) and of Solanum torvum (both 2n=2x=24) were fused using a modification of the Menczel and Wolfe PEG/DMSO procedure. Protoplasts post-fusion were plated at 1 × 10(5)/ml in modified KM medium, which inhibited division of S. torvum protoplasts. One week prior to shoot regeneration, ten individual calluses had a unique light-green background and were verified as cell hybrids by the presence of the dimer isozyme patterns for phosphoglucoisomerase (PGI) and glutamate oxaloacetate transaminase (GOT). Hybridity was also confirmed at the plant stage by DNA-DNA hybridization to a pea 45S ribosomal RNA gene probe. The ten somatic hybrid plants were established in the greenhouse and exhibited intermediate morphological characteristics such as leaf size and shape, flower size, shape, color and plant stature. Their chromosome number ranged from 46-48 (expected 2n=4x=48) and pollen viability was 5%-70%. In vitro shoots taken from the ten hybrid plants exhibited resistance to a verticillium wilt extract. Total DNA from the ten hybrids was restricted and hybridized with a 5.9 kb Oenothera chloroplast cytochrome f gene probe, a 2.4 kb EcoRI clone encoding mitochondrial cytochrome oxidase subunit II from maize and a 22.1 kb Sal I mitochondrial clone from Nicotiana sylvestris. Southern blot hybridization patterns showed that eight of ten somatic hybrids contained the eggplant cpDNA, while two plants contained the cpDNA hybridization patterns of both parents. The mtDNA analysis revealed the presence of novel bands, loss of some specific parental bands and mixture of specific bands from both parents in the restriction hybridization profiles of the hybrids.
-
DEFF Research Database (Denmark)
Silva, Eder Lana e; Almeida-Lafetá, Rita C.; Borges, Ricardo Moreira
2017-01-01
Solanum americanum is one of the most prominent species used to treat type 2 diabetes in Guatemala. In our ongoing efforts to find antidiabetic and antioxidative compounds from natural sources, an ethyl acetate extract of this medicinal herb was investigated using dual high-resolution α-glucosida......Solanum americanum is one of the most prominent species used to treat type 2 diabetes in Guatemala. In our ongoing efforts to find antidiabetic and antioxidative compounds from natural sources, an ethyl acetate extract of this medicinal herb was investigated using dual high-resolution α...
-
DEFF Research Database (Denmark)
Wang, Huiqun; Liu, Fulai; Andersen, Mathias Neumann
2009-01-01
The effects of partial root-zone drying (PRD) as compared with deficit irrigation (DI) and full irrigation (FI) on nitrogen (N) uptake and partitioning in potato (Solanum tuberosum L.) were investigated. Potato plants were grown in split-root pots and were exposed to FI, PRD, and DI treatments...
-
Directory of Open Access Journals (Sweden)
Rabia Rehman
2015-01-01
Full Text Available The aim of this study is to check the feasibility of Psidium guajava (Guava leaves and peels of Solanum tuberosum (Potato as biosorbents in removal of Brilliant Green (BG in batch mode. Surface analysis of biosorbents was done by FT-IR and quantitatively analyzed by Boehm titration. The removal of dye was confirmed by UV-VIS spectroscopy. Isothermal modeling was studied by using Langmuir, Freundlich, and Temkin isotherms. Various isothermal parameters for adsorption of Brilliant Green such as qm=1.075 mg/g, 1.173 mg/g ΔG°=-3.397, and −2.397 KJ/mol were noted for Solanum tuberosum peels (PP and Psidium guajava leaves (GL, respectively. Similarly pH, moisture content, and various metals were quantitatively analyzed. Results showed that leaves of Psidium guajava were more effective for removal of Brilliant Green.
-
Acosta-Quezada, P.G.; Martinez-Laborde, J.B.; Vilanova Navarro, Santiago; Prohens Tomás, Jaime
2011-01-01
Instituto Nacional de Investigaciones Agrarias y Agroalimentarias (RF2008-00008-00-00) Acosta-Quezada, P.; Martinez-Laborde, J.; Vilanova Navarro, S.; Prohens Tomás, J. (2011). Morphological and molecular diversity in a collection of the Andean tree tomato (Solanum betaceum Cav.). Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca : Horticulture. 68(1):500-501. http://hdl.handle.net/10251/63083 Senia 500 501 68 1
-
Acosta-Quezada, Pablo G; Raigón, María D; Riofrío-Cuenca, Tania; García-Martínez, María D; Plazas, Mariola; Burneo, Juan I; Figueroa, Jorge G; Vilanova, Santiago; Prohens, Jaime
2015-02-15
We evaluated 23 tree tomato (Solanum betaceum) accessions from five cultivar groups and one wild relative (Solanum cajanumense) for 26 composition traits. For all traits we found highly significant differences (Ptree tomato. Fruit in the anthocyanin pigmented (purple) group had a carotenoid content similar to that in the yellow-orange cultivar groups. Total phenolic content was significantly correlated (r=0.8607) with antioxidant activity. Analyses of mineral content showed that tree tomato is a good source of K, Mg, and Cu. Multivariate principal components analysis (PCA) confirmed that an important diversity exists within each cultivar group. The results we have obtained indicate that the high diversity found within the tree tomato could be exploited for selection and breeding for developing the tree tomato as a commercial crop. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Cara, Nicolás; Marfil, Carlos F; Masuelli, Ricardo W
2013-01-01
Interspecific hybridization is known for triggering genetic and epigenetic changes, such as modifications on DNA methylation patterns and impact on phenotypic plasticity and ecological adaptation. Wild potatoes (Solanum, section Petota) are adapted to multiple habitats along the Andes, and natural hybridizations have proven to be a common feature among species of this group. Solanum × rechei, a recently formed hybrid that grows sympatrically with the parental species S. kurtzianum and S. microdontum, represents an ideal model for studying the ecologically and evolutionary importance of hybridization in generating of epigenetic variability. Genetic and epigenetic variability and their correlation with morphological variation were investigated in wild and ex situ conserved populations of these three wild potato species using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP) techniques. We observed that novel methylation patterns doubled the number of novel genetic patterns in the hybrid and that the morphological variability measured on 30 characters had a higher correlation with the epigenetic than with the genetic variability. Statistical comparison of methylation levels suggested that the interspecific hybridization induces genome demethylation in the hybrids. A Bayesian analysis of the genetic data reveled the hybrid nature of S. × rechei, with genotypes displaying high levels of admixture with the parental species, while the epigenetic information assigned S. × rechei to its own cluster with low admixture. These findings suggested that after the hybridization event, a novel epigenetic pattern was rapidly established, which might influence the phenotypic plasticity and adaptation of the hybrid to new environments. PMID:24198938
-
Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).
Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich
2016-07-01
Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin
-
Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)
Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich
2016-01-01
Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The
-
Directory of Open Access Journals (Sweden)
Víctor Hugo Ramírez-Builes
2010-04-01
Full Text Available En un suelo derivado de cenizas volcánicas bien drenado y de alta fertilidad del municipio Ansermanuevo (zona cafetera de Colombia, en el cultivo de lulo (Solanum quitoense x S. hirtum se evaluaron tres fuentes orgánicas tipo bocashi, provenientes de los procesos de fermentación de pulpa de café, lombricompuesto y gallinaza y un tratamiento con fertilizante químico (10-30-10 más un testigo absoluto sin aplicación de fertilizantes. Se empleó un diseño experimental en bloques completos al azar con tres repeticiones, cada repetición estuvo constituida por 58 plantas. Las aplicaciones de materiales orgánicos mejoraron las características del suelo, estabilizando el pH, aumentando la capacidad de intercambio catiónico y la materia orgánica. En términos generales, el tratamiento de mejor desempeño fue el bocashi de gallinaza, con un promedio de cuajamiento de fruto de 38.3% y un mayor rendimiento (4.7 t/ha. Los bocashis de lombricompuesto y pulpa de café no fueron estadísticamente diferentes al tratamiento químico y todos los tratamientos fueron distintos (P In this study four fertilization treatments in lulo crop (Solanum quitoense x S.hirtum were evaluated, three organic with several manure sources like coffee skin , earthworm residues and chicken manure, and a four treatment consisted of inorganic fertilizer with a composition of 10-30-30 ( N,P,K and a control without fertilizer applications. A complete block random design with three replications was used and each replication with 58 plants. The organic fertilization increase the soil pH, cation exchange capacity and soil organic matter. The best treatment was the aerobic fermented, based on chicken manure with a fruit yield average of 4731 kg .ha-1, the rest of the organic treatments did no showed statistical differences with the inorganic fertilization and all were statistical different with the control without fertilizer applications, which showed a good crop response to the
-
Successful in vitro regeneration of plantlets was obtained from shoot tips of five Solanum aethiopicum (African eggplants) accessions evaluated in two media, M1 and M2. The M1 medium consisted of Murashige and Skoog (MS) basal salt mixture supplemented with 20 g/L sucrose, 0.75 g/L MgCl2, and 2 g/L ...
-
Directory of Open Access Journals (Sweden)
Luciano Façanha Marques
2010-01-01
Full Text Available A murcha bacteriana, causada por Ralstonia solanacearum, é a principal doença vascular de plantas em todo o mundo. O agente causal é uma bactéria que ocorre em todas as regiões do Brasil, predominando em condições de umidade e temperatura elevadas, fatores propícios aodesenvolvimento do patógeno. Este agente causal é de difícil controle, pois sobrevive nos mais diversos hospedeiros, especialmente Solanaceas, além de outras famílias de importância alimentar, condimentar e medicinal. O uso de espécies do gênero Solanum na enxertia convencional e minienxertia em tomateiro Lycopersicon esculentum é limitada em função da incompatibilidade. Neste trabalho, utilizou-se o método da microenxertia para obtenção de plantas resistentes a doenças como a murcha bacteriana, tendo como cavalo a espécie Solanum palinacanthum Dun. Utilizaram-se dois métodos de microenxertia: convencional em T-invertido e corte em bisel. Foram testados meios de culturas para execução das duas práticas demicropropagação; para isso, realizou-se experimento em diferentes condições ambientais, com presença e ausência de luminosidade e diferentes tratamentos correspondentes a teores de açúcares e sais, submetidos a cinco avaliações com intervalos semanais. Melhor resultado foi encontrado quando se utilizou microenxertia em T-invertido e meio de cultura constituído de sais de MS1/8 de força acrescido de 30 g L-1 de sacarose.The bacterial wilt, caused by Ralstonia solanacearum, is the most important vascular disease among plants in the world. The causal agent is a strain of bacteria found in all regions of Brazil, mainly in places with high humidity and temperature. This bacterium is difficult to control with chemical products, being able to survive in diverse hosts, especially in species of Solanaceae as well as other families of great food, condimental, or medicinal importance. The use of species of the genus Solanum has been attempted, but the
-
Slugina, M A; Shchennikova, A V; Kochieva, E Z
2017-10-01
Understanding the genetic mechanisms underlying carbohydrate metabolism can promote the development of biotechnological advances in fruit plants. The flesh tomato fruit represents an ideal system for examining the role of sucrose cleavage enzymes in fruit development, and wild tomato species differing in storage sugars serve as an excellent research material for this purpose. Plant vacuolar invertase is a key enzyme of sucrose metabolism in the sink organs. In the present study, we identified complete gene sequences encoding the TAI vacuolar invertase in 11 wild and one cultivated tomato accessions of the Solanum section Lycopersicon. The average level of interspecific polymorphism in TAI genes was 8.58%; however, in the green-fruited tomatoes, the TAI genes contained 100 times more SNPs than those in the red-fruited accessions. The TAI proteins demonstrated 8% variability, whereas the red-fruited species had none. A TAI-based phylogenetic tree revealed two main clusters containing self-compatible and self-incompatible species, which concurs with the previous crossability-based division and demonstrates that the TAI genes reflect the evolutionary relationships between the red- and green-fruited tomatoes. Furthermore, we detected differential expression patterns of the TAI genes in the fruits of wild and cultivated tomatoes, which corresponded to sugar composition. The polymorphism analysis of the TAI acid invertases of Solanum section Lycopersicon species will contribute to the understanding of the genetic potential of TAI genes to impact tomato breeding through genetic engineering of the carbohydrate composition in the fruit.
-
Directory of Open Access Journals (Sweden)
Maria Manuela Rigano
2016-10-01
Full Text Available Solanum lycopersicum represents an important dietary source of bioactive compounds including the antioxidants flavonoids and phenolic acids. We previously identified two genotypes (IL7-3 and IL12-4 carrying loci from the wild species Solanum pennellii, which increased antioxidants in the fruit. Successively, these lines were crossed and two genotypes carrying both introgressions at the homozygous condition (DHO88 and DHO88-SL were selected. The amount of total antioxidant compounds was increased in DHOs compared to both ILs and the control genotype M82. In order to understand the genetic mechanisms underlying the positive interaction between the two wild regions pyramided in DHO genotypes, detailed analyses of the metabolites accumulated in the fruit were carried out by colorimetric methods and LC/MS/MS. These analyses evidenced a lower content of flavonoids in DHOs and in ILs, compared to M82. By contrast, in the DHOs the relative content of phenolic acids increased, particularly the fraction of hexoses, thus evidencing a redirection of the phenylpropanoid flux towards the biosynthesis of phenolic acid glycosides in these genotypes. In addition, the line DHO88 exhibited a lower content of free phenolic acids compared to M82. Interestingly, the two DHOs analyzed differ in the size of the wild region on chromosome 12. Genes mapping in the introgression regions were further investigated. Several genes of the phenylpropanoid biosynthetic pathway were identified, such as one 4-coumarate:CoA ligase and two UDP-glycosyltransferases in the region 12-4 and one chalcone isomerase and one UDP-glycosyltransferase in the region 7-3. Transcriptomic analyses demonstrated a different expression of the detected genes in the ILs and in the DHOs compared to M82.These analyses, combined with biochemical analyses, suggested a central role of the 4-coumarate:CoA ligase in redirecting the phenylpropanoid pathways towards the biosynthesis of phenolic acids in the
-
Directory of Open Access Journals (Sweden)
Remco Stam
2017-01-01
Full Text Available Wild tomatoes are a valuable source of disease resistance germplasm for tomato (Solanum lycopersicum breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense, both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense. We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens (Alternaria solani, Phytophthora infestans and a Fusarium sp. and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense, resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved.
-
Scheikl, Daniela; Tellier, Aurélien
2017-01-01
Wild tomatoes are a valuable source of disease resistance germplasm for tomato (Solanum lycopersicum) breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense, both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense. We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens (Alternaria solani, Phytophthora infestans and a Fusarium sp.) and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense, resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved. PMID:28133579
-
International Nuclear Information System (INIS)
Ji Puhui; Sun Tieheng; Song Yufang; Ackland, M. Leigh; Liu Yang
2011-01-01
Field trials contribute practical information towards the development of phytoremediation strategies that cannot be provided by laboratory tests. We conducted field experiments utilizing the Cd hyperaccumulator plant Solanum nigrum L., on farmland contaminated with 1.91 mg kg -1 Cd in the soil. Our study showed that S. nigrum has a relatively high biomass. Planting density had a significant effect on the plant biomass and thus on overall Cd accumulation. For double harvesting, an optimal cutting position influenced the amount of Cd extracted from soils. Double cropping was found to significantly increase the amount of Cd extracted by S. nigrum. Fertilizing had no significant effect on plant biomass or on the Cd remediation of the soil over the short-term period. Our study indicates that S. nigrum can accumulate Cd from soils where the concentrations are relatively low, and thus has application for use in decontamination of slightly to moderately Cd-contaminated soil. - Research highlights: →S. nigrum L. is an effective phytoremediation plant for Cd-polluted soils. →Agronomy practices that increase harvested biomass improve bioremediation efficiency. →Double cropping of S. nigrum L. is an effective phytoremediation strategy. →Field experiments are necessary to effectively assess phytoremediation techniques. - Agronomic practice for the phytoremediation potential of Solanum nigrum L. for Cd uptake was demonstrated in field contaminated soils.
-
Energy Technology Data Exchange (ETDEWEB)
Ji Puhui [Key Laboratory of Terrestrial Ecological Process, Institute of Applied Ecology, Chinese Academy of Sciences, Shenyang 110016 (China); Graduate School, Chinese Academy of Sciences, Beijing 100049 (China); Sun Tieheng [Key Laboratory of Terrestrial Ecological Process, Institute of Applied Ecology, Chinese Academy of Sciences, Shenyang 110016 (China); Song Yufang, E-mail: jipuhui1983@163.com [Key Laboratory of Terrestrial Ecological Process, Institute of Applied Ecology, Chinese Academy of Sciences, Shenyang 110016 (China); Ackland, M. Leigh [School of Life and Environmental Sciences, Deakin University, Burwood 3125, Melbourne (Australia); Liu Yang [Key Laboratory of Terrestrial Ecological Process, Institute of Applied Ecology, Chinese Academy of Sciences, Shenyang 110016 (China); Graduate School, Chinese Academy of Sciences, Beijing 100049 (China)
2011-03-15
Field trials contribute practical information towards the development of phytoremediation strategies that cannot be provided by laboratory tests. We conducted field experiments utilizing the Cd hyperaccumulator plant Solanum nigrum L., on farmland contaminated with 1.91 mg kg{sup -1} Cd in the soil. Our study showed that S. nigrum has a relatively high biomass. Planting density had a significant effect on the plant biomass and thus on overall Cd accumulation. For double harvesting, an optimal cutting position influenced the amount of Cd extracted from soils. Double cropping was found to significantly increase the amount of Cd extracted by S. nigrum. Fertilizing had no significant effect on plant biomass or on the Cd remediation of the soil over the short-term period. Our study indicates that S. nigrum can accumulate Cd from soils where the concentrations are relatively low, and thus has application for use in decontamination of slightly to moderately Cd-contaminated soil. - Research highlights: > S. nigrum L. is an effective phytoremediation plant for Cd-polluted soils. > Agronomy practices that increase harvested biomass improve bioremediation efficiency. > Double cropping of S. nigrum L. is an effective phytoremediation strategy. > Field experiments are necessary to effectively assess phytoremediation techniques. - Agronomic practice for the phytoremediation potential of Solanum nigrum L. for Cd uptake was demonstrated in field contaminated soils.
-
Directory of Open Access Journals (Sweden)
Cristian Gelpud Chaves
2011-01-01
Full Text Available El cultivo del lulo (Solanum quitoense L.) presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne spp., en el Departamento de Nariño (Colombia), se han reportado incidencias cercanas al 79%, y pérdidas del 50%. En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense L.) en los Departamentos de Nariño y Putumayo y 4 genotipos silvestres (S. mammosum, S. hirtum, S. marginatum y S. umbellatum) buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz) y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en todos los genotipos, 2.04% genotipos resistentes, 34.7% moderadamente resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raíz, (R² = 0.71 y 0.98), el genotipo silvestre (S. mammosum) es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.The green orange (Solanum quitoense L.) crop has decreased in its productivity due to the pathogens attack such as the root knot nematode Meloidogyne spp. In the Nariño Department of Colombia, pest incidences near to 79% and losses of 50% have been reported. In this study, 45 genotypes of Solanum quitoense were collected in Nariño and Putumayo
-
Ivanchenko, Maria G.; den Os, Desiree; Monshausen, Gabriele B.; Dubrovsky, Joseph G.; Bednarova, Andrea; Krishnan, Natraj
2013-01-01
The hormone auxin and reactive oxygen species (ROS) regulate root elongation, but the interactions between the two pathways are not well understood. The aim of this study was to investigate how auxin interacts with ROS in regulating root elongation in tomato, Solanum lycopersicum. Wild-type and
-
Directory of Open Access Journals (Sweden)
Zahra Shakeran
2015-09-01
Full Text Available Studying explants affected by Agrobacterium rhizogenes shows that in addition to possible formation of hairy roots, it is likely that callogenesis can be induced in these tissues. The T-DNA region of A. rhizogenes codes enzymes that participate in biosynthesis of plants growth hormones. These hormones also affect callogenesis, hence, the formation of various calluses with different morphological properties are possible. It is very likely that the level of biosynthetic growth hormone, the plasmid carried by each bacteria strain, the position of T-DNA, and the level of gene expression contribute to this morphologic variation. In this study, the root explants of four species of the family Solanaceae namely Atropa belladonna, Datura metel, D. stramonium and Hyoscyamus niger were induced by using different strains of A. rhizogenes (A4, A7, AR15834, AR318, AR9402 and AR9543. Some of these explants entered callus phase and formed various calluses with different colors and shapes. Moreover, in some callus samples hairy roots were also appeared. These variations were probably caused by variations in the levels and ratios of auxin and cytokinine hormons after the induction. As shown in previous studies, the amount of secondary metabolites is reduced due to undifferentiated tissue produced in the callogenesis process.
-
International Nuclear Information System (INIS)
Abdel-Magied, N.; Ahmed, A.G.; Abo zid, N.M.
2012-01-01
The aim of the study was to evaluate the potential benefits of dietary supplementation of eggplant (Solanum melongena) as antioxidant against γ- rays-induced biochemical changes in male albino rats by estimating some of the components of antioxidant defense in the; liver glutathione content (GSH), superoxide dismutase activity (SOD) and malondialdehyde (MDA), serum aspartate amino transferase,(AST), alanine amino transferase (ALT), alkaline phosphatase (ALP), gamma glutamyl transaminase (GGT), cholesterol, triglycerides, low density lipoprotein cholesterol (LDL-C) and high density lipoprotein cholesterol(HDL-C). Male albino rats (120-150 g) were divided into four groups as Control group, group 2 received diet supplemented with 10% of eggplant (Solanum melongnea) fruit for 21 successive days , group 3: irradiated with a single dose (6.5 Gy), group 4 received eggplant for 21 successive days then exposed to 6.5 Gy. All animals were sacrificed after 1, 3 and 8 days post irradiation. Rats exposed to γ-rays exhibited a profound elevation of AST, ALT, ALP and GGT activities, and lipid abnormalities .Noticeable drop in liver GSH content and SOD activity associated with increase of MDA was recorded. Treatment with dietary eggplant for 21 days before irradiation significantly abolished radiation induced elevations in MDA and significantly elevates hepatic GSH content and SOD activity. The levels of cholesterol, TG, HDL-C, LDL-C as well as the activities of AST, ALT, and GGT in serum were significantly ameliorated and noticeable improvement in the lipid profile levels
-
Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.
Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G
2015-07-14
Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.
-
Directory of Open Access Journals (Sweden)
Sarah C. Caldas Oliveira
2004-09-01
Full Text Available Alelopatia pode ser definida como o efeito maléfico ou benéfico que uma planta exerce sobre a outra por meio de compostos químicos liberados no ambiente. Diversas espécies do gênero Solanum apresentam evidências de propriedades alelopáticas. S. lycocarpum A. St.-Hil (lobeira é espécie de ampla distribuição em ambientes perturbados do Cerrado. No presente trabalho foram investigados efeitos alelopáticos de extratos de folhas de lobeira na germinação e no crescimento do gergelim (Sesamum indicum L.. Extratos aquosos das folhas foram preparados nas concentrações de 1%, 2%, 3%, 4% e 5% (p/v. A osmolaridade dos extratos foi medida e soluções de polietileno glicol (PEG 6000, de osmolaridade similar, foram preparadas para avaliar possíveis efeitos osmóticos dos extratos aquosos. Nos testes de germinação, as sementes de gergelim foram colocadas em placas de Petri forradas com papel de filtro com a solução a ser testada e observadas a cada 8h. Para os experimemtos de crescimento, sementes de gergelim foram germinadas em água e posteriormente dispostas para crescimento nos extratos. Após 5 dias, foram medidos os comprimentos da parte aérea e radicular das plântulas. Todos os experimentos foram conduzidos a 22 ºC, 30 ºC e 38 ºC. Observou-se que os extratos de folhas não afetaram a germinabilidade, mas aumentaram o tempo médio de germinação em uma relação próxima à dose-dependente, nas três temperaturas. Quanto ao crescimento, a parte radicular foi a mais afetada pelos extratos aquosos, apresentando redução no tamanho, necroses, ausência de pêlos absorventes e formação de raízes laterais. Os efeitos dos extratos no crescimento das plântulas foram mais evidentes a 38 ºC. Os experimentos conduzidos com soluções de PEG 6000 mostraram que os efeitos observados na presença dos extratos não são de natureza osmótica.Allelopathy should be defined as any stimulatory or inhibitory effect by one plant on another
-
Cytological observation of solanum pimpinellifolium l. microspore development
International Nuclear Information System (INIS)
Qu, H.; Rylosona, J.S.
2015-01-01
Tomato (Solanum lycopersicum L.) is one of the most important horticultural crops worldwide, and has also been adapted as a model plant in a wide range of research disciplines. However, stamen development in tomato is less known than other model species, such as Arabidopsis thaliana and Oryza sativa L. (rice). In order to understand tomato flower development in more detail, the key goal of this study was to establish a precise correlation between visual morphological features and cytological events. To this end, we characterized a wild tomato species, S. pimpinellifolium (accession LA1585), to define stamen developmental stages using semi-thin sectioning. Based on distinct stages of flower development, S. pimpinellifolium anther/stamen development was divided into ten stages, and characteristic morphological and cytological features in stamens at each developmental stage were identified. In this way, flower characteristics and microspore development were correlated. In addition, specific cytological key events in S. pimpinellifolium were compared with those in A. thaliana and rice at corresponding stages, as well as with those in domesticated tomato (S. lycopersicum L.), and the differences are discussed. (author)
-
The historical role of species from the Solanaceae plant family in genetic research.
Gebhardt, Christiane
2016-12-01
This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100 years. The tomato was one of the principal models in twentieth century classical genetics and a pacemaker of genome analysis in plants including molecular linkage maps, positional cloning of disease resistance genes and quantitative trait loci (QTL). Besides that, tomato is the model for the genetics of fruit development and composition. Tobacco was the major model used to establish the principals and methods of plant somatic cell genetics including in vitro propagation of cells and tissues, totipotency of somatic cells, doubled haploid production and genetic transformation. Petunia was a model for elucidating the biochemical and genetic basis of flower color and development. The cultivated potato is the economically most important Solanaceous plant and ranks third after wheat and rice as one of the world's great food crops. Potato is the model for studying the genetic basis of tuber development. Molecular genetics and genomics of potato, in particular association genetics, made valuable contributions to the genetic dissection of complex agronomic traits and the development of diagnostic markers for breeding applications. Pepper and eggplant are horticultural crops of worldwide relevance. Genetic and genomic research in pepper and eggplant mostly followed the tomato model. Comparative genome analysis of tomato, potato, pepper and eggplant contributed to the understanding of plant genome evolution.
-
In 1990, the latest comprehensive taxonomic monograph of Solanum section Petota Dumort recognized 232 species partitioned into 21 series. PBI-sponsored research has drastically altered knowledge of their species boundaries and interrelationships. The series contains diploids (2n = 2x = 24), tetraplo...
-
[Effects of illumination and seed-soaking reagent on seed germination of Solanum nigrum].
Yang, Chuan-Jie; Wei, Shu-He; Zhou, Qi-Xing; Hu, Ya-Hu; Niu, Rong-Cheng
2009-05-01
To explore a rapid seed germination method for hyperaccumulator Solanum nigrum, a germination experiment with different illumination and seed-soaking treatments was conducted in constant temperature box and greenhouse, with filter as burgeon base. Under illumination, the germination rate was about 5 times high of that without illumination (P seed germination of S. nigrum. All test seed-soaking reagents could significantly improve the germination rate of S. nigrum (P seeds treated with H2O2 had the shortest germination time. The germination rate of seeds soaked but without cleaning was 2-3 times as high as that of seeds soaked and cleaned with water.
-
A new source of russet germplasm has been identified as a parent for processing and fresh market breeding programs. It was derived via bilateral sexual polyploidization following a cross between a diploid cultivated potato and the diploid wild species Solanum infundibuliforme. This clone, designated...
-
Rodriguez Pérez, Loyla
2015-01-01
En esta tesis se evalúo la respuesta fisiológica, bioquímica y de fenología de tres variedades colombianas de papa (Solanum tuberosum L.) sometidas a déficit hídrico y rehidratación. La hipótesis planteada fue que con base en el comportamiento de las variedades en las zonas de producción, las tres variedades de Solanum tuberosum L. presentarían respuesta diferencial a un período de déficit hídrico por suspensión del riego. El objetivo de este estudio fue determinar el comportam...
-
Background: Potato (Solanum tuberosum) is the world’s most important vegetable crop and central to global food security. Cultivated potato is a highly heterozygous autotetraploid that presents challenges in genome analyses and breeding. Numerous wild potato species serve as a resource for introgress...
-
International Nuclear Information System (INIS)
Fehér, A.; Preiszner, J.; Litkey, Z.; Csanádi, G; Dudits, D.
1992-01-01
Asymmetric somatic hybrids between Solanum tuberosum L. and S. brevidens Phil. have been obtained via the fusion of protoplasts from potato leaves and from cell suspension culture of S. brevidens. The wild Solanum species served as donor after irradiation of its protoplasts with a lethal X-ray dose (200 Gy). Selection of the putative hybrids was based on the kanamycin-resistance marker gene previously introduced into the genome of Solanum brevidens by Agrobacterium-mediated gene transfer. Thirteen out of the 45 selected clones exhibited reduced morphogenic potential. The morphological abnormalities of the regenerated plantlets were gradually eliminated during the extended in vitro culture period. Cytological investigations revealed that the number of chromosomes in the cultured S. brevidens cells used as protoplast source ranged between 28-40 instead of the basic 2n=24 value. There was a high degree of aneuploidy in all of the investigated hybrid clones, and at least 12 extra chromosomes were observed in addition to the potato chromosomes (2n=48). Interand intraclonal variation and segregation during vegetative propagation indicated the genetic instability of the hybrids, which can be ascribed to the pre-existing and X-ray irradiation-induced chromosomal abnormalities in the donor S. brevidens cells. The detection of centromeric chromosome fragments and long, poly-constrictional chromosomes in cytological preparations as well as non-parental bands in Southern hybridizations with restriction fragment length polymorphism (RFLP) markers revealed extensive chromosome rearrangements in most of the regenerated clones. On the basis of the limited number of RFLP probes used, preferential loss of S. brevidens specific markers with a non-random elimination pattern could be detected in hybrid regenerants
-
Cytogenetical effects of gamma rays and ethyl methanesulphonate in brinjal (Solanum melongena L. )
Energy Technology Data Exchange (ETDEWEB)
Zeerak, N.A. (Kashmir Univ., Srinagar (India). Dept. of Botany)
1991-12-01
Relative effects of differential and combined treatments of gamma rays, and ethyl methanesulphonate on the meiosis and on pollen and seed fertility in M{sub 1} generation of a local brinjal cultivar of Kashmir valley (Solanum melongena var. Local Long) were studied. Radiations and combined treatments were more efficient in inducing meiotic abnormalities than EMS treatments. However combined treatments and EMS treatments induced greater pollen and seed sterility than radiations. Radiation induced sterility might be the result of chromosomal aberrations which in turn were dose dependent while sterility induced by EMS might be attributed to cryptic deletions and specific gene mutations. A dose dependent increase in chiasma frequency was observed with all single and combination treatments. (author).
-
Directory of Open Access Journals (Sweden)
Daniele Rosado
Full Text Available Although the importance of light for tomato plant yield and edible fruit quality is well known, the PHYTOCHROME INTERACTING FACTORS (PIFs, main components of phytochrome-mediated light signal transduction, have been studied almost exclusively in Arabidopsis thaliana. Here, the diversity, evolution and expression profile of PIF gene subfamily in Solanum lycopersicum was characterized. Eight tomato PIF loci were identified, named SlPIF1a, SlPIF1b, SlPIF3, SlPIF4, SlPIF7a, SlPIF7b, SlPIF8a and SlPIF8b. The duplication of SlPIF1, SlPIF7 and SlPIF8 genes were dated and temporally coincided with the whole-genome triplication event that preceded tomato and potato divergence. Different patterns of mRNA accumulation in response to light treatments were observed during seedling deetiolation, dark-induced senescence, diel cycle and fruit ripening. SlPIF4 showed similar expression profile as that reported for A. thaliana homologs, indicating an evolutionary conserved function of PIF4 clade. A comprehensive analysis of the evolutionary and transcriptional data allowed proposing that duplicated SlPIFs have undergone sub- and neofunctionalization at mRNA level, pinpointing the importance of transcriptional regulation for the maintenance of duplicated genes. Altogether, the results indicate that genome polyploidization and functional divergence have played a major role in diversification of the Solanum PIF gene subfamily.
-
International Nuclear Information System (INIS)
Krishnan, R.; Nanda Kumar, D.; Subhas Chander, M.
1988-01-01
In the domestication of the wild, spinous and steroid-bearing Solanum viarum (syn. S. khasianum var. chatterjeeanum) induced mutations play a major role. The development of Glaxo and BARC mutants catalysed commercial cultivation of this species for its berries containing solasodine, used in steroid industries. The commercially more popular Glaxo mutant population consists predominantly of plants that are totally free of spines in aerial parts except lamina where few straight spines develop. The BARC mutant still possesses spines on aerial parts including the persistent calyx. However, the laminary spines of the BARC mutant are curved and vestigial. Comparative studies on morphology, growth behaviour and agronomic characters of the two mutants, their wild progenitor and their hybrid progenies showed that the three types differ only for spine character. In F 2 generation of a cross involving the Glaxo and BARC mutants, a double mutant recombinant was recovered. The recombinant is devoid of spines in aerial parts like its Glaxo mutant parent, but possesses laminary curved vestigial spines like the BARC parent. The spine characters of the recombinant are inherited double recessive. Three advanced lines of this recombinant type (IIHR 2n - 1,2 and 3) were tested in replicated trials 1985 and 1986. They showed parity in berry yield and solasodine content with the Glaxo mutant and three promising lines evolved elsewhere viz. 'RRL (Bhuhaneswar) Y-14', 'RRL (Jorhat)' and 'Pusa'. The results indicate gainful use of induced mutants in hybridization leading to development of superior less-spiny lines of steroid bearing Solanum viarum
-
Directory of Open Access Journals (Sweden)
Damaris Desgarennes
2009-12-01
Full Text Available Se determinaron y clasificaron en grupos tróficos las especies de nematodos asociados a la rizosfera de Solanum tuberosum en suelos altamente infectados por el nematodo dorado de la papa (Globodera rostochiensis en un ciclo de cultivo, en la zona productora del Cofre de Perote, Veracruz, México. Se identificaron 7 géneros (Aphelenchoides, Aphelenchus, Crassolabium, Mesodorylaimus, Plectus y Steinernema y 8 especies (Aporcelaimellus obtusicaudatus, Ecumenicus monohystera, Acrobeles mariannae, Acrobeles singulus, Acrobeloides nanus, Cruznema tripartitum, Eucephalobus oxyuroides, y Globodera rostochiensis en asociación con la rizosfera de papas cultivadas. Crassolabium sp. y E. monohystera se registran por primera vez para México.Nematode species associated with the rhizosphere of Solanum tuberosum were identified and classified into trophic groups from soils highly infected by the golden potato cyst nematode (Globodera rostochiensis in a single crop cycle in the producing zone on the Cofre de Perote, Veracruz, Mexico. Seven genera (Aphelenchoides, Aphelenchus, Crassolabium, Mesodorylaimus, Plectus and Steinernema and 8 species (Aporcelaimellus obtusicaudatus, Ecumenicus monohystera, Acrobeles mariannae, Acrobeles singulus, Acrobeloides nanus, Cruznema tripartitum, Eucephalobus oxyuroides, and Globodera rostochiensis were found in association with the rhizosphere of cultivated potatoes. Crassolabium sp. and E. monohystera are recorded for the first time in México.
-
Gemechis, Ambecha O.
2017-01-01
Tomato (Solanum lycopersicum L.) is a vegetable crop with high potential to contribute to poverty reduction via increased income and food security. It is widely grown by smallholders, has high productivity and its demand is increasing. Ethiopia produced about 30,700 Mg of tomatoes on
-
Directory of Open Access Journals (Sweden)
Javed Iqbal Wattoo
2016-11-01
Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.
-
Wenke, Torsten; Döbel, Thomas; Sörensen, Thomas Rosleff; Junghans, Holger; Weisshaar, Bernd; Schmidt, Thomas
2011-09-01
Short interspersed nuclear elements (SINEs) are non-long terminal repeat retrotransposons that are highly abundant, heterogeneous, and mostly not annotated in eukaryotic genomes. We developed a tool designated SINE-Finder for the targeted discovery of tRNA-derived SINEs. We analyzed sequence data of 16 plant genomes, including 13 angiosperms and three gymnosperms and identified 17,829 full-length and truncated SINEs falling into 31 families showing the widespread occurrence of SINEs in higher plants. The investigation focused on potato (Solanum tuberosum), resulting in the detection of seven different SolS SINE families consisting of 1489 full-length and 870 5' truncated copies. Consensus sequences of full-length members range in size from 106 to 244 bp depending on the SINE family. SolS SINEs populated related species and evolved separately, which led to some distinct subfamilies. Solanaceae SINEs are dispersed along chromosomes and distributed without clustering but with preferred integration into short A-rich motifs. They emerged more than 23 million years ago and were species specifically amplified during the radiation of potato, tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum). We show that tobacco TS retrotransposons are composite SINEs consisting of the 3' end of a long interspersed nuclear element integrated downstream of a nonhomologous SINE family followed by successfully colonization of the genome. We propose an evolutionary scenario for the formation of TS as a spontaneous event, which could be typical for the emergence of SINE families.
-
Wenke, Torsten; Döbel, Thomas; Sörensen, Thomas Rosleff; Junghans, Holger; Weisshaar, Bernd; Schmidt, Thomas
2011-01-01
Short interspersed nuclear elements (SINEs) are non-long terminal repeat retrotransposons that are highly abundant, heterogeneous, and mostly not annotated in eukaryotic genomes. We developed a tool designated SINE-Finder for the targeted discovery of tRNA-derived SINEs. We analyzed sequence data of 16 plant genomes, including 13 angiosperms and three gymnosperms and identified 17,829 full-length and truncated SINEs falling into 31 families showing the widespread occurrence of SINEs in higher plants. The investigation focused on potato (Solanum tuberosum), resulting in the detection of seven different SolS SINE families consisting of 1489 full-length and 870 5′ truncated copies. Consensus sequences of full-length members range in size from 106 to 244 bp depending on the SINE family. SolS SINEs populated related species and evolved separately, which led to some distinct subfamilies. Solanaceae SINEs are dispersed along chromosomes and distributed without clustering but with preferred integration into short A-rich motifs. They emerged more than 23 million years ago and were species specifically amplified during the radiation of potato, tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum). We show that tobacco TS retrotransposons are composite SINEs consisting of the 3′ end of a long interspersed nuclear element integrated downstream of a nonhomologous SINE family followed by successfully colonization of the genome. We propose an evolutionary scenario for the formation of TS as a spontaneous event, which could be typical for the emergence of SINE families. PMID:21908723
-
Schimmel, Bernardus C J; Ataide, Livia M S; Kant, Merijn R
2017-10-03
When feeding from tomato (Solanum lycopersicum), the generalist spider mite Tetranychus urticae induces jasmonate (JA)- and salicylate (SA)-regulated defense responses that hamper its performance. The related T. evansi, a Solanaceae-specialist, suppresses these defenses, thereby upholding a high performance. On a shared leaf, T. urticae can be facilitated by T. evansi, likely via suppression of defenses by the latter. Yet, when infesting the same plant, T. evansi outcompetes T. urticae. Recently, we found that T. evansi intensifies suppression of defenses locally, i.e., at its feeding site, after T. urticae mites were introduced onto adjacent leaf tissue. This hyper-suppression is paralleled by an increased oviposition rate of T. evansi, probably promoting its competitive population growth. Here we present additional data that not only provide insight into the spatiotemporal dynamics of defense induction and suppression by mites, but that also suggest T. evansi to manipulate more than JA and SA defenses alone.
-
Castro, Ruth M; Moreira, Lisela; Rojas, María R; Gilbertson, Robert L; Hernández, Eduardo; Mora, Floribeth; Ramírez, Pilar
2013-09-01
Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1) was obtained from a chayote (S. edule) leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV) and Pepper golden mosaic virus (PepGMV) were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV) infecting chayote in the Western Hemisphere.
-
Directory of Open Access Journals (Sweden)
Ruth M. Castro
2013-09-01
Full Text Available Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1 was obtained from a chayote (S. edule leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV and Pepper golden mosaic virus (PepGMV were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV infecting chayote in the Western Hemisphere.
-
Energy Technology Data Exchange (ETDEWEB)
MacLean, D.C.; Schneider, R.C.; Weinstein, L.H.
1982-09-01
The differential responses of plants exposed to hydrogen fluoride (HF) in continuous light or darkness were investigated in Jerusalem cherry Solanum pseudo-capsicum L. Plants exposed to HF in the dark develop few, if any, foliar symptoms by the end of the exposure period, but severe foliar injury develops rapidly upon transfer to the light after exposure. The results suggest that light is required for the expression of responses induced by exposure to HF in the dark.
-
Energy Technology Data Exchange (ETDEWEB)
MacLean, D.C.; Schneider, R.E.; Weinstein, L.H.
1982-01-01
The differential responses of plants exposed to hydrogen fluoride (HF) in continuous light or darkness were investigated in Jerusalem cherry Solanum pseudo-capsicum L. Plants exposed to HF in the dark develop few, if any, foliar symptoms by the end of the exposure period, but severe folia injury develops rapidly upon transfer to the light after exposure. The results suggest that light is required for the expression of responses induced by exposure to HF in the dark.
-
Czech Academy of Sciences Publication Activity Database
Hichri, I.; Muhovski, Y.; Žižková, Eva; Dobrev, Petre; Gharbi, E.; Franco-Zorrilla, J.M.; Lopez-Vidriero, I.; Solano, R.; Clippe, A.; Errachid, A.; Motyka, Václav; Lutts, S.
2017-01-01
Roč. 8, JUL 31 (2017), č. článku 1343. ISSN 1664-462X R&D Projects: GA ČR(CZ) GA16-14649S Institutional support: RVO:61389030 Keywords : agrobacterium-mediated transformation * transgenic arabidopsis plants * dna-binding * salinity tolerance * defense responses * drought tolerance * abiotic stresses * water-stress * genes * tobacco * Solanum lycopersicum * SlWRKY3 * transcription factor * salinity tolerance * plant physiology Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 4.298, year: 2016
-
Gullian Klanian, Mariel; Delgadillo Diaz, Mariana; Aranda, Javier; Rosales Juárez, Carolina
2018-04-20
The objective of this study was to evaluate the potential of tomato plants to efficiently use the nitrogen (N) of a recirculation aquaponic system (RAS) and to evaluate the effects of foliar fertilization as a complement to the water nutrition on the growth of the two tomato cultivars. The significant effect of six macro- and seven micronutrients was evaluated on the plant growth and on the fruit yield. Two experiments were performed in a nutrient film aquaponic unit. The first experiment was designed to study the effects of foliar fertilization on the seedlings of two tomato cultivars Costoluto Genovese (CG) (Solanum lycopersicum L.) and Currant tomato (Ct) (Solanum pimpinellifolium) with 8% of weekly water exchange (WE8%-RAS). The foliar fertilizer was formulated with N restriction in the last 11 weeks (TF1). In the second experiment, two other foliar fertilization treatments (TF2 and TF3) were applied with a concentration of nutrients twice and triple that in TF1, but with a lower proportion of NPK ratio. These treatments were tested on the cultivar CG in a RAS with zero water exchange (WE0%-RAS). The data from the 1st experiment showed a positive effect of the foliar fertilization on the yield of both cultivars. The fertilization markedly influenced the dry matter weight of the CG; however, this effect was not observed in the Ct. The root length of both cultivars was positively influenced by the P content, whereas the plant height was affected by the excess of Co and S. According to the results from the 2nd experiment, the TF2 plants had the highest number of fruits with a high mean weight. The system was efficient in utilizing N from fish tank; the water K favored the yield of the CG fruit and the foliar K favored the growth of the TF2 plants. With a decrease in the foliar N, the CG plants were able to absorb 27.5% of the NO 3 - and 7.06% of total ammonia nitrogen from water. The absolute and relative growth rate of Nile tilapia was not affected by the rate
-
Aversano, Riccardo; Contaldi, Felice; Ercolano, Maria Raffaella; Grosso, Valentina; Iorizzo, Massimo; Tatino, Filippo; Xumerle, Luciano; Dal Molin, Alessandra; Avanzato, Carla; Ferrarini, Alberto; Delledonne, Massimo; Sanseverino, Walter; Cigliano, Riccardo Aiese; Capella-Gutierrez, Salvador; Gabaldón, Toni; Frusciante, Luigi; Bradeen, James M.; Carputo, Domenico
2015-01-01
Here, we report the draft genome sequence of Solanum commersonii, which consists of ∼830 megabases with an N50 of 44,303 bp anchored to 12 chromosomes, using the potato (Solanum tuberosum) genome sequence as a reference. Compared with potato, S. commersonii shows a striking reduction in heterozygosity (1.5% versus 53 to 59%), and differences in genome sizes were mainly due to variations in intergenic sequence length. Gene annotation by ab initio prediction supported by RNA-seq data produced a catalog of 1703 predicted microRNAs, 18,882 long noncoding RNAs of which 20% are shown to target cold-responsive genes, and 39,290 protein-coding genes with a significant repertoire of nonredundant nucleotide binding site-encoding genes and 126 cold-related genes that are lacking in S. tuberosum. Phylogenetic analyses indicate that domesticated potato and S. commersonii lineages diverged ∼2.3 million years ago. Three duplication periods corresponding to genome enrichment for particular gene families related to response to salt stress, water transport, growth, and defense response were discovered. The draft genome sequence of S. commersonii substantially increases our understanding of the domesticated germplasm, facilitating translation of acquired knowledge into advances in crop stability in light of global climate and environmental changes. PMID:25873387
-
Horsman, K.; Gavrilenko, T.; Bergervoet, M.; Huigen, D.J.; Tjin Wong Joe, A.; Jacobsen, E.
2001-01-01
Fusion experiments were performed with a first (BC1-6738) and a second (BC2-9017) generation backcross hybrid of 6x Solanum nigrum (+) 2x potato somatic hybrids with potato cultivars. Because no progeny was obtained from the BC2 genotypes, alternative approaches were sought to overcome the sexual
-
Energy Technology Data Exchange (ETDEWEB)
Silva, Tania Maria Sarmento da [Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE (Brazil). Dept. de Quimica], e-mail: sarmento@pesquisador.cnpq.br; Carvalho, Mario Geraldo de [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Ciencias Exatas. Dept. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense (UENF), Campos dos Goytacazes, RJ (Brazil). Setor de Quimica de Produtos Naturais
2009-07-01
The NMR (RMN{sup 1}H, {sup 13}C, COSY, HMQC, HMBC, NOE-DIFF, NOESY) and mass spectra data analysis of sixteen flavonoids, including nine natural, 7-O-methylkanferol (rhamnocitrin), 3,7-di-O-methylkanferol (kumatakenin), 3-O-methylquercetin, 3,7,3',4'-tetra-O-methylquercetin (retusin), 3,7,8,4'-tetra-O-methylgossipetin, 3,7,8,3',4'-penta-O-methylgossipetin, 7-O-methylapigenin (genkwanin), 3,7,8-tri-O-methylherbacetin, 7,4'- di-O-methylquercetin (ombuine), isolated from Solanum paludosum and S. jabrense, and seven prepared methyl and acetyl derivatives, are discussed according the substitution on the rings A, B and C. (author)
-
Extrafloral nectar secretion from wounds of Solanum dulcamara.
Lortzing, Tobias; Calf, Onno W; Böhlke, Marlene; Schwachtje, Jens; Kopka, Joachim; Geuß, Daniel; Kosanke, Susanne; van Dam, Nicole M; Steppuhn, Anke
2016-04-25
Plants usually close wounds rapidly to prevent infections and the loss of valuable resources such as assimilates(1). However, herbivore-inflicted wounds on the bittersweet nightshade Solanum dulcamara appear not to close completely and produce sugary wound secretions visible as droplets. Many plants across the plant kingdom secrete sugary nectar from extrafloral nectaries(2) to attract natural enemies of herbivores for indirect defence(3,4). As ants forage on wound edges of S. dulcamara in the field, we hypothesized that wound secretions are a form of extrafloral nectar (EFN). We show that, unlike EFN from known nectaries, wound secretions are neither associated with any specific structure nor restricted to certain locations. However, similar to EFN, they are jasmonate-inducible and the plant controls their chemical composition. Wound secretions are attractive for ants, and application of wound secretion mimics increases ant attraction and reduces herbivory on S. dulcamara plants in a natural population. In greenhouse experiments, we reveal that ants can defend S. dulcamara from two of its native herbivores, slugs and flea beetle larvae. Since nectar is defined by its ecological function as a sugary secretion involved in interactions with animals(5), such 'plant bleeding' could be a primitive mode of nectar secretion exemplifying an evolutionary origin of structured extrafloral nectaries.
-
Involvement of potato (Solanum tuberosum L.) MKK6 in response to potato virus Y.
Lazar, Ana; Coll, Anna; Dobnik, David; Baebler, Spela; Bedina-Zavec, Apolonija; Zel, Jana; Gruden, Kristina
2014-01-01
Mitogen-activated protein kinase (MAPK) cascades have crucial roles in the regulation of plant development and in plant responses to stress. Plant recognition of pathogen-associated molecular patterns or pathogen-derived effector proteins has been shown to trigger activation of several MAPKs. This then controls defence responses, including synthesis and/or signalling of defence hormones and activation of defence related genes. The MAPK cascade genes are highly complex and interconnected, and thus the precise signalling mechanisms in specific plant-pathogen interactions are still not known. Here we investigated the MAPK signalling network involved in immune responses of potato (Solanum tuberosum L.) to Potato virus Y, an important potato pathogen worldwide. Sequence analysis was performed to identify the complete MAPK kinase (MKK) family in potato, and to identify those regulated in the hypersensitive resistance response to Potato virus Y infection. Arabidopsis has 10 MKK family members, of which we identified five in potato and tomato (Solanum lycopersicum L.), and eight in Nicotiana benthamiana. Among these, StMKK6 is the most strongly regulated gene in response to Potato virus Y. The salicylic acid treatment revealed that StMKK6 is regulated by the hormone that is in agreement with the salicylic acid-regulated domains found in the StMKK6 promoter. The involvement of StMKK6 in potato defence response was confirmed by localisation studies, where StMKK6 accumulated strongly only in Potato-virus-Y-infected plants, and predominantly in the cell nucleus. Using a yeast two-hybrid method, we identified three StMKK6 targets downstream in the MAPK cascade: StMAPK4_2, StMAPK6 and StMAPK13. These data together provide further insight into the StMKK6 signalling module and its involvement in plant defence.
-
Directory of Open Access Journals (Sweden)
José Diomedes Barbosa
2010-12-01
ões necrosadas observou-se um halo de hepatócitos com vacuolização.Based on the history and clinical and pathological data, as well as on inspection of the pastures, a mortality of buffaloes in the county of Itaguaí/RJ, Brazil, was diagnosed as poisoning by Cestrum laevigatum Schlecht., a plant of the Solanaceae family. The poisoning was reproduced in two buffaloes. Dried leaves of the shrub were administered by hand, in single doses corresponding to 20g/kg and 40g/kg of the fresh leaves, to four buffaloes of the Murrah breed. The dose corresponding to 40g/kg of the fresh leaves caused signs of poisoning, as apathy, anorexia, absence of rumen movements, dysmetria, excitement and aggressiveness, followed by death of the two buffaloes within 65 hours after administration. From the two buffaloes that received the corresponding dose of 20g/kg of the fresh plant, one presented clinical signs characterized mainly by decrease of the rumen movements, but recovered 97h22min after the administration; the other buffalo did not show symptoms of poisoning. Laboratory analyses for biochemical evaluation accused hepatic alterations. In one buffalo that died, the main macroscopic finding was an orange liver with a clear nutmeg appearance; in the second buffalo, the orange liver had no nutmeg appearance. Other alterations found in these two buffaloes were slight edema of the gall bladder wall, a slightly reddish mucous membrane of the abomasum, extensive echymoses in the endocard of the left ventricle and few petechiae in the endocard of the right ventricle; the abomasum content was slightly dry, and the large intestine had little and slightly dry contents wrapped by mucus. Histopatological examination revealed severe coagulative necrosis of the liver parenchyma in the centrolobular and intermediate lobular areas, with a halo of vacuolated hepatocytes at the periphery of the necrotic areas.
-
Flier, W.G.; Grünwald, N.J.; Kroon, L.P.N.M.; Sturbaum, A.K.; Bosch, van den G.B.M.; Garay-Serrano, E.; Lozoya-Saldaña, H.; Fry, W.E.; Turkensteen, L.J.
2003-01-01
The Population structure of Phytophthora infestans in the Toluca Valley of central Mexico was assessed using 170 isolates collected front cultivated potatoes and the native wild Solanum spp., S. demissum and S. xedinense. All isolates were analyzed for mitochondrial DNA (mtDNA) haplotype and
-
Directory of Open Access Journals (Sweden)
Jéferson Nunes Fregonezi
2007-01-01
Full Text Available Retroelements are a diversified fraction of eukaryotic genomes, with the Ty1/copia and Ty3/gypsy groups being very common in a large number of plant genomes. We isolated an internal segment of the Ty3/gypsy retroelement of Cestrum strigilatum (Solanaceae using PCR amplification with degenerate primers for a conserved region of reverse transcriptase. The isolated segment (pCs12 was sequenced and showed similarity with Ty3/gypsy retroelements of monocotyledons and dicotyledons. This segment was used as probe in chromosomes of C. strigilatum and Cestrum intermedium. Diffuse hybridization signals were observed along the chromosomes and more accentuated terminal signals in some chromosome pairs, always associated with nucleolus organizer regions (NORs. The physical relationship between the hybridization sites of pCs12 and pTa71 ribosomal probes was assessed after sequential fluorescence in situ hybridization (FISH. Hybridization signals were also detected in the B chromosomes of these species, indicating an entail among the chromosomes of A complement and B-chromosomes.
-
K.B.Himabindu; M.Shanthi Priya; D.Mohan Reddy; P.Sudhakar; Y.Srinivasulu; M.Reddisekhar; P.Latha; B.Rupesh Kumar Reddy
2012-01-01
Studies on the effectiveness of various sterilants and culture conditions on in-vitro seed germination in tomato (Solanum lycopersicum L.) cv. PKM-1 revealed that among three sterilants used, surface sterilization of seeds with 5 % NaOCl for 20 minutes was found to be more effective resulting in high germination rate and contamination free cultures. Similarly among the different media and culture conditions considered in the present experiment, MS medium without sucrose with dark incubation f...
-
Directory of Open Access Journals (Sweden)
Germano Leão Demolin Leite
2002-07-01
Full Text Available Este trabalho objetivou determinar os efeitos de pluviosidade e temperatura, predadores e parasitóides, dossel e idade das plantas, tipos e densidades de tricomas foliares, compostos químicos foliares, níveis de N e de K foliares, sobre a intensidade de ataque de mosca-branca Bemisia tabaci (Hemiptera: Aleyrodidae em jiloeiro Solanum gilo var. 'Gigante Portuguesa'. As densidades de ninfas e de adultos de B. tabaci foram maiores nas folhas baixeiras do que nas apicais das plantas de jiloeiro. Com o aumento da temperatura do ar, observou-se incremento na densidade de adultos de B. tabaci nas folhas de jiloeiro.The objective of this study was to determine the effect of rainfall and temperature, predators and parasitoids, height within the canopy and plant age, chemical composition of leaves, levels of nitrogen and potassium in leaves and density of trichomes in leaves, on attack intensity of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae on Solanum gilo var. 'Portuguese giant'. Densities of nymphs and of adults of B. tabaci were higher on leaves of the lower part than on those of the apical parts of plants of S. gilo. The number of adults of B. tabaci on leaves of S. gilo increased with temperature.
-
Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana
2016-01-01
Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,
-
Directory of Open Access Journals (Sweden)
Paula A. Fontana
2009-03-01
Full Text Available Solanum glaucophyllum (Sg [= S. malacoxylon] is a calcinogenic plant inducing "Enzootic Calcinosis" in cattle. The 1,25-dihydroxyvitamin D3, its main toxic principle, regulates bone and calcium metabolism and also exerts immunomodulatory effects. Thymocyte precursors from bone marrow-derived progenitor cells differentiate into mature T-cells. Differentiation of most T lymphocytes is characterized not only by the variable expression of CD4/CD8 receptor molecules and increased surface density of the T cell antigen receptor, but also by changes in the glycosylation pattern of cell surface glycolipids or glycoproteins. Thymocytes exert a feedback influence on thymic non-lymphoid cells. Sg-induced modifications on cattle thymus T-lymphocytes and on non-lymphoid cells were analysed. Heifers were divided into 5 groups (control, intoxicated with Sg during 15, 30 or 60 days, and probably recovered group. Histochemical, immunohistochemical, lectinhistochemical and morphometric techniques were used to characterize different cell populations of the experimental heifers. Sg-poisoned heifers showed a progressive cortical atrophy that was characterized using the peanut agglutinin (PNA lectin that recognizes immature thymocytes. These animals also increased the amount of non-lymphoid cells per unit area detected with the Picrosirius technique, WGA and DBA lectins, and pancytokeratin and S-100 antibodies. The thymus atrophy found in intoxicated animals resembled that of the physiological aging process. A reversal effect on these changes was observed after suppression of the intoxication. These findings suggest that Sg-intoxication induces either directly, through the 1,25-dihydroxyvitamin D3 itself, or indirectly through the hypercalcemia, the observed alteration of the thymus.Solanum glaucophyllum (Sg [= S. malacoxylon] é uma planta calcinogênica que induz "Calcinose Enzoótica" em bovinos. O 1,25-dihidroxivitamina D3, seu principal agente tóxico, regula o
-
Directory of Open Access Journals (Sweden)
Luis Enrique Cuca
2008-02-01
Full Text Available Del extracto etanólico de la parte aérea de Solanum cornifolium, utilizando técnicas cromatográficas para la separación y purificaciónde cada uno de los compuestos, fueron aislados dos esteroles, B-sitosterol y Estigmasterol, un triterpeno pentacíclico,Lupeol, y un nuevo alcaloide esteroidal 2-(-metil-tetrahirofurano-Solanidina.Sus estructuras fueron elucidadas por RMN, incluyendo técnicas 2D y por comparación con datos de la literatura.
-
International Nuclear Information System (INIS)
Kumar, Girish
1991-01-01
Modification of induced genetic damage after exposure to LD 50 and LD 90 doses of 60 Co gamma-irradiation on dormant seeds of Solanum incanum L. by pre- and post-treatments of thiourea was investigated. Thiourea pre-treatment reduced cellular lesions, growth injury and the death of seedlings, while post-treatment increased lethality. Incorporation of 3 H-tymidine into DNA fraction gradually increased with 10 -4 to 10 -2 M thiourea treatment when applied before irradiation. Post-treatment of the thiourea, on the other hand, not only showed poor labelling of DNA but also delayed its synthesis. (author)
-
International Nuclear Information System (INIS)
Elhag, A. Z.; Mix-Wagnar, G.; Elbassam, N.; Horst, W.
2008-01-01
This study was conducted to find how far in vitro explants stem cuttings technique could be suitable for quick screening of NaCl tolerance solanum genotypes and to identify some aspects of their NaCl tolerance. Fifteen solanum genotypes were tested on four NaCl concentrations both in vitro and in vivo, two-node stem cuttings of in vitro produced explants were grown on Murashige and Skoog (MS) salts supplemented with four NaCl concentrations (0,40,80 and 120 mM) for six weeks in vitro. The other part of the in vitro grown explants were transplanted in Kick- Brauck- Manns pots containing sandy loam soil supplemented also with four NaCl concentration (0, 0.1, 0.2 and 0.3 NaCl, w/w) and grown further either for eight weeks or till harvest in a green house. Both experiments were in a completely randomized design with four replicates. The main stem length, shoot dry matter and tuber yield as well as mineral element (Na''+, K + , Ca''2''+ and Cl''-) were measured. The growth of all genotypes was affected by increasing of NaCl. There was a close correlation between growth response (length of explant main stem) in vitro and shoot dry matter and tuber yield in vivo (r=0.81** for dry matter and 0.72** for tuber yield. Na''+ and Cl''- concentrations in shoots wee inversely correlated with the vegetative growth (r=-0.73** for both in vitro and r=-0.89** and r=-0.88** in vivo, respectively). The genotypes showed varied ability to reduce the transport of Na''+ and Cl''- to the shoots, where by NaCl tolerant genotypes showed lower content of both elements than the sensitive ones. K''+ and Ca''2''+ concentrations were decreased with increasing NaCl concentration. The responses for mineral element (Na''+ and Cl - ) accumulation or restriction of explants in vitro and intact plants in vivo were also closely correlated (r=0.79** and 0.71**, respectively) especially at the medium NaCl concentrations (80 mM and 0.2% NaCl). The similar response of the explant and the intact plant
-
Directory of Open Access Journals (Sweden)
Tania Maria Sarmento da Silva
2009-01-01
Full Text Available The NMR (RMN¹H, 13C, COSY, HMQC, HMBC, NOE-DIFF, NOESY and mass spectra data analysis of sixteen flavonoids, including nine natural, 7-O-methylkanferol (ramnocitrin, 3,7-di-O-methylkanferol (kumatakenin, 3-O-methylquercetin, 3,7,3',4'-tetra-O-methylquercetin (retusin, 3,7,8,4'-tetra-O-methylgossipetin, 3,7,8,3',4'-penta-O-methylgossipetin, 7-O-methylapigenin (genkwanin, 3,7,8-tri-O-methylherbacetin, 7,4'- di-O-methylquercetin (ombuine, isolated from Solanum paludosum and S. jabrense, and seven prepared methyl and acetyl derivatives, are discussed according the substitution on the rings A, B and C.
-
Flexible tools for gene expression and silencing in tomato.
Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre
2009-12-01
As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.
-
In vitro antimalarial activity of extracts of some plants from a biological reserve in Costa Rica.
Chinchilla, Misael; Valerio, Idalia; Sánchez, Ronald; Mora, Víctor; Bagnarello, Vanessa; Martínez, Laura; Gonzalez, Antonieta; Vanegas, Juan Carlos; Apestegui, Alvaro
2012-06-01
Treatment with the usual antimalarial drugs, have induced parasite resistance, reinforcing the need to finding natural antimalarial components that would be found on plants from the forest. Therefore, we decided to look for these components in Costa Rican plants from a protected forest area. Fresh and dry extracts of roots, bark, leaves, flowers and fruits of 25 plants from a biological reserve in Costa Rica, Reserva Biol6gica Alberto Manuel Brenes (REBAMB), were studied in vitro for the presence of substances with antimalarial activity. By studying the inhibition of P berghei schizogony, we assessed the antimalarial activity of several plant extracts: Aphelandra aurantiaca, A. tridentata (Acanthaceae); Xanthosoma undipes (Araceae); Iriartea deltoidea (Arecaceae); Neurolaena lobata (Asteraceae); Senna papillosa, Pterocarpus hayessi, Lonchocarpus pentaphyllus (Fabaceae); Nectandra membranacea, Persea povedae, Cinamomum chavarrianum (Lauraceae); Hampea appendiculata (Malvaceae); Ruagea glabra, Guarea glabra (Meliaceae); Psidium guajava (Myrtaceae); Bocconia frutescens (Papaveraceae); Piper friedrichsthalii (Piperaceae); Clematis dioica (Ranunculaceae); Prunus annularis (Rosaceae); Siparuna thecaphora (Siparunaceae); Solanum arboreum, Witheringia solanacea (Solanaceae); Ticodendrum incognitum (Ticodendraceae); Heliocarpus appendiculatus (Tiliaceae) and Myriocarpa longipes (Urticaceae). We used different parts of the plants as well as fresh and dried extracts for testing IC50. The solid content of the extracts ranged from 1-71.9 microg/mL. The fresh extracts showed stronger activity than the dry ones. Since the plants showing the strongest antimalarial activity are very common in Central America, and some similar genera of these plants have shown positives results in South America, we considered important to present these findings for discussion. On the other hand, this is the first systematic study of this kind ever realized in a circumscribed and protected area of
-
Miyatake, Koji; Saito, Takeo; Negoro, Satomi; Yamaguchi, Hirotaka; Nunome, Tsukasa; Ohyama, Akio; Fukuoka, Hiroyuki
2016-02-01
This is the first report on genetic mapping of a resistance locus against Fusarium wilt caused by the plant pathogen Fusarium oxysporum f. sp. melongenae in cultivated eggplant. Fusarium wilt, caused by the plant pathogen Fusarium oxysporum f. sp. melongenae, is a major soil-borne disease threatening stable production in eggplant (Solanum melongena). Although three eggplant germplasms, LS1934, LS174, and LS2436, are known to be highly resistant to the pathogen, their resistance loci have not been mapped. In this study, we performed quantitative trait locus analyses in F2:3 populations and detected a resistance locus, FM1, at the end of chromosome 2, with two alleles, Fm1(L) and Fm1(E), in the F2 populations LWF2 [LS1934 × WCGR112-8 (susceptible)] and EWF2 [EPL-1 (derived from LS174) × WCGR112-8], respectively. The percentage of phenotypic variance explained by Fm1(L) derived from LS1934 was 75.0% [Logarithm of the odds (LOD) = 29.3], and that explained by Fm1(E) derived from EPL-1 was 92.2% (LOD = 65.8). Using backcrossed inbred lines, we mapped FM1 between two simple sequence repeat markers located ~4.881 cM apart from each other. Comparing the location of the above locus to those of previously reported ones, the resistance locus Rfo-sa1 from an eggplant ally (Solanum aethiopicum gr. Gilo) was mapped very close to FM1, whereas another resistance locus, from LS2436, was mapped to the middle of chromosome 4. This is the first report of mapping of a Fusarium resistance locus in cultivated eggplant. The availability of resistance-linked markers will enable the application of marker-assisted selection to overcome problems posed by self-incompatibility and introduction of negative traits because of linkage drag, and will lead to clear understanding of genetic mechanism of Fusarium resistance.
-
Thabuis, A; Palloix, A; Pflieger, S; Daubèze, A-M; Caranta, C; Lefebvre, V
2003-05-01
Phytophthora capsici Leonian, known as the causal agent of the stem, collar and root rot, is one of the most serious problems limiting the pepper crop in many areas in the world. Genetic resistance to the parasite displays complex inheritance. Quantitative trait locus (QTL) analysis was performed in three intraspecific pepper populations, each involving an unrelated resistant accession. Resistance was evaluated by artificial inoculations of roots and stems, allowing the measurement of four components involved in different steps of the plant-pathogen interaction. The three genetic maps were aligned using common markers, which enabled the detection of QTLs involved in each resistance component and the comparison of resistance factors existing among the three resistant accessions. The major resistance factor was found to be common to the three populations. Another resistance factor was found conserved between two populations, the others being specific to a single cross. This comparison across intraspecific germplasm revealed a large variability for quantitative resistance loci to P. capsici. It also provided insights both into the allelic relationships between QTLs across pepper germplasm and for the comparative mapping of resistance factors across the Solanaceae.
-
Physico-chemical and sensory evaluation of potato (Solanum tuberosum L. after irradiation
Directory of Open Access Journals (Sweden)
IVANESA G.M. SOARES
2016-06-01
Full Text Available ABSTRACT This work evaluated the effects of ionizing radiation on the physico-chemical and sensory characteristics of the potato cultivar Ágata (Solanum tuberosum L., including budding and deterioration, with the end goal of increasing shelf life. For this, four groups of samples were harvested at the maturation stage. Three of them were separately exposed to a Co-60 source, receiving respective doses of 0.10, 0.15 and 2.00 kGy, while the non-irradiated group was kept as a control. All samples were stored for 35 days at 24 °C (± 2 and at 39% relative humidity. The following aspects were evaluated: budding, rot, loss of weight, texture, flesh color, moisture, external and internal appearance, aroma, soluble solids, titratable acidity, vitamin C, protein, starch and glucose. The results indicated that 0.15 kGy was the most effective dose to reduce sprouting and post-harvest losses, under the conditions studied.
-
Methods to overcome dormancy in tree tomato (Solanum betaceum seeds
Directory of Open Access Journals (Sweden)
Carlos Kosera Neto
2015-12-01
Full Text Available The tree tomato (Solanum betaceum is a poorly known species that has fruits with great economic potential, as it can be consumed in natura or industrialized. However, for reaching this potential, it is necessary the development of technologies for seedlings production. The propagation of this species is mainly done by seeds, but the seed germination process is usually slow, especially under stress conditions. This study aimed at verifying whether tree tomato seeds have dormancy and which is the best method to obtain fast and uniform germination. A completely randomized design was adopted in a 5 x 2 factorial arrangement (methods to overcome dormancy x light, with four replications of 50 or 60 seeds, depending on the production cycle. The methods tested were cold stratification, hydropriming, priming with GA3 solution and control, with or without light. Seed germination and germination rate index, as well as the beginning and average time of germination, were also evaluated. The use of GA3 at a concentration of 100 mg L-1 or 300 mg L-1 is recommended to the germination of tree tomato seeds.
-
Expresión diferencial durante la interacción Solanum tuberosum - Phytophthora infestans
Directory of Open Access Journals (Sweden)
Zulma Isabel Monsalve-Fonnegra
2012-01-01
Full Text Available Título en ingles: Differential expression during Solanum tuberosum- Phytophthora infestans interaction Resumen: La papa (Solanum tuberosum L. es el cuarto cultivo más importante a nivel mundial y es el producto agrícola con mayor demanda de fungicidas, insecticidas y fertilizantes químicos. Las pérdidas mundiales ocasionadas por Phytophthora infestans (Mont. de Bary en este cultivo, ascienden a 6,7 billones de dólares al año y su control químico genera un aumento en los costos, perjudica la salud humana y el ambiente. Todo esto justifica la búsqueda constante de mecanismos alternativos para el control de la enfermedad, entre ellos la obtención de variedades resistentes mediante cisgenesis usando genotipos silvestres. Como un aporte en este sentido, y dada la falta de conocimiento de lo que controla y constituye la diferencia entre una respuesta compatible e incompatible, en el presente estudio se compararon los perfiles de expresión génica obtenidos mediante Despliegue Diferencial de variedades resistentes y susceptibles durante su interacción con P. infestans. Los resultados evidenciaron diferencias en la expresión génica, tanto a distintos tiempos post-inoculación como en el tipo de cambio de expresión, incluyendo la presencia y ausencia de bandas diferenciales y el aumento o disminución en su intensidad. Al analizar las secuencias de fragmentos diferencialmente expresados, se encontró que algunos fragmentos sobre-expresados en las variedades susceptibles, tenían homología con secuencias que codifican para una serina-acetiltranferasa y para la subunidad β de la RNA polimerasa. Por su parte, fragmentos sobre-expresados en la variedad resistente, tenían homología con una secuencia codificante para un dominio transmembranal. Palabras claves: pastusa suprema; diacol-capiro; parda pastusa; despliegue diferencial Abstract: Potato (Solanum tuberosum L. is the fourth most important crop worldwide; also, is the agriculture
-
In vitro micropropagation of solanum villosum-a potential alternative food plant
International Nuclear Information System (INIS)
Iftikhar, A.; Qureshi, R.; Munir, M.
2015-01-01
Solanum villosum Miller is annual to biennial herb which is used as potherb as well as fodder/forage that limits its distribution in Pakistan. The aim of this study was to develop a suitable protocol for S. villosum through direct organogenesis. Leaf, stem node and shoot tip explants from the tested plant were inoculated in three different hormonal combinations of BAP (6-benzyl amino purine) alone along NAA (alpha-naphthalene acetic acid) and Kin (Kinetin). Maximum shoot induction was recorded for stem node and leaf (91% each) in MS medium comprising of BAP (1.9 mg/l) and NAA (0.1 mg/l), while shoot tip showed somewhat moderate (81%) response. The highest mean number of shoot (9.1 ± 2 was also obtained for the same medium using leaf explants. Plantlets were successfully rooted in auxin free medium and shifted to green house for multiplication after acclimatizing them. This study may contribute in providing quick and disease free propagation of this neutraceutically and economically potential plant. (author)
-
Pruski, K.; Kozai, T.; Lewis, T.; Astatkie, T.; Nowak, J.
2000-01-01
Cultures of potato (Solanum tuberosum) cv. Atlantic, chokecherry ( Prunus virginiana L.) cv. Garrington and saskatoon berry (Amelancher alnifolia Nutt.) cv. Northline grown in vitro for 3 weeks at 24/22 °C, 16-h photoperiod, 150 μmol m-2 s-1 photosynthetic photon flux density (PPFD) mixed
-
Gerszberg, Aneta; Wiktorek-Smagur, Aneta; Hnatuszko-Konka, Katarzyna; Łuchniak, Piotr; Kononowicz, Andrzej K
2012-03-01
One of the most dynamically developing sectors of green biotechnology is molecular farming using transgenic plants as natural bioreactors for the large scale production of recombinant proteins with biopharmaceutical and therapeutic values. Such properties are characteristic of certain proteins of bacterial origin, including staphylokinase. For many years, work has been carried out on the use of this protein in thrombolytic therapy. In this study, transgenic Solanum tuberosum plants expressing a CaMV::sak-mgpf-gusA gene fusion, were obtained. AGL1 A. tumefaciens strain was used in the process of transformation. The presence of the staphylokinase gene was confirmed by PCR in 22.5% of the investigated plants. The expression of the fusion transgene was detected using the β-glucuronidase activity assay in 32 putative transgenic plants. Furthermore, on the basis of the GUS histochemical reaction, the transgene expression pattern had a strong, constitutive character in seven of the transformants. The polyacrylamide gel electrophoresis of a protein extract from the SAK/PCR-positive plants, revealed the presence of a119 kDa protein that corresponds to that of the fusion protein SAK-mGFP-GUSA. Western blot analysis, using an antibody against staphylokinase, showed the presence of the staphylokinase domain in the 119 kDa protein in six analyzed transformants. However, the enzymatic test revealed amidolytic activity characteristic of staphylokinase in the protein extract of only one plant. This is the first report on a Solanum tuberosum plant producing a recombinant staphylokinase protein, a plasminogen activator of bacterial origin.
-
Hirsch, Candice N; Hirsch, Cory D; Felcher, Kimberly; Coombs, Joseph; Zarka, Dan; Van Deynze, Allen; De Jong, Walter; Veilleux, Richard E; Jansky, Shelley; Bethke, Paul; Douches, David S; Buell, C Robin
2013-06-21
Cultivated potato (Solanum tuberosum L.), a vegetatively propagated autotetraploid, has been bred for distinct market classes, including fresh market, pigmented, and processing varieties. Breeding efforts have relied on phenotypic selection of populations developed from intra- and intermarket class crosses and introgressions of wild and cultivated Solanum relatives. To retrospectively explore the effects of potato breeding at the genome level, we used 8303 single-nucleotide polymorphism markers to genotype a 250-line diversity panel composed of wild species, genetic stocks, and cultivated potato lines with release dates ranging from 1857 to 2011. Population structure analysis revealed four subpopulations within the panel, with cultivated potato lines grouping together and separate from wild species and genetic stocks. With pairwise kinship estimates clear separation between potato market classes was observed. Modern breeding efforts have scarcely changed the percentage of heterozygous loci or the frequency of homozygous, single-dose, and duplex loci on a genome level, despite concerted efforts by breeders. In contrast, clear selection in less than 50 years of breeding was observed for alleles in biosynthetic pathways important for market class-specific traits such as pigmentation and carbohydrate composition. Although improvement and diversification for distinct market classes was observed through whole-genome analysis of historic and current potato lines, an increased rate of gain from selection will be required to meet growing global food demands and challenges due to climate change. Understanding the genetic basis of diversification and trait improvement will allow for more rapid genome-guided improvement of potato in future breeding efforts.
-
Structure and histochemistry of medicinal species of Solanum
Directory of Open Access Journals (Sweden)
Laudineia J. Matias
Full Text Available ABSTRACT Studies on native medicinal plants strengthen initiatives to preserve the environments where those species naturally occur, many of them already strongly menaced even before their potential to humankind is known. Root and stem barks, leaves, and pericarps samples of Solanum agrarium Sendtn., S. lycocarpum A. St.-Hil., S. palinacanthum Dunal, S. paniculatum L., and S. stipulaceum Roem. & Schult., species that occur in the Cerrado (Brazililan savanna were processed according to common light microscopy techniques for structural analysis, and histochemical tests were performed to locate and identify classes of chemical compounds. The distinctive features identified were low concentration of crystal sand in the root and stem, presence of terpene resin in the root, and absence of hypodermis in the leaf, in S. agrarium; bright spots (group of sclereids in the root, isobilateral mesophyll, thickened cell walls with hemicelluloses and strong aroma in the fruit, in S. lycocarpum; high concentration of crystal sand in the root and stem, oval-shaped limb, presence of isolated crystals in the exocarp, in S. palinacanthum; strong sclerification and rays with great height in the root and stem, in S. paniculatum; and accumulation of soluble protein in the root and stem, presence of conspicuous membranaceous stipules, absence of spiniform trichomes, in S. stipulaceum. This work identifies distinctive structural features, its ecological importance, and determines the distribution of secondary compounds associated with the medicinal properties reported for these species and contributes to the conservation of the natural environments where they occur.
-
Plant regeneration from leaf protoplasts of Solanum torvum.
Guri, A; Volokita, M; Sink, K C
1987-07-01
A protocol to obtain regenerated plants from protoplasts of Solanum torvum Sw a wild species of eggplant resistant to Verticillium wilt is reported. Leaf protoplasts were enzymatically isolated from six-week old seedlings grown in a controlled environment chamber. Protoplasts were plated on modified KM medium (0.4 M glucose)+(mg/l): 1.0 p-chlorophenoxyacetic acid (CPA)+1.0 naphthaleneacetic acid (NAA)+0.5 6-benzylaminopurine (BAP) and 0.02 abscisic acid (ABA). The protoplast density was 5×10(4) per ml with 5 ml placed in each of two quadrants in X-dishes (100×15 mm). The reservoir medium was modified KM+(mg/l): 0.1 NAA+0.5 BAP+0.1 M sucrose+0.1 M mannitol+0.6% washed agar+1% activated charcoal. Dishes were initially placed in the dark at 27°C. Protoplast division was initiated in 1-2 weeks and 4 weeks later p-calli were 1-3 mm. Plating efficiency was 11% when measured at 3 weeks. Six-week old p-calli were transferred individually onto Whatman No. 1 filter paper layered on modified KM (0.15 M sucrose)+mg/l: 2.0 indoleacetic acid (IAA)+2.0 zeatin+0.5% washed agar for 2 weeks. Subsequently, shoots occurred within 4 weeks at 70% efficiency on MS+30 g/l sucrose+2 mg/l zeatin. Shoots were rooted on half strength MS+10 g/l sucrose.
-
Fiallos Montalvo, Henry Edison
2011-01-01
During the period 2009-2010 research was done on "The Inhibition of Botrytis cinerea on alcoholic and aqueous based extracts of black nightshade (Solanum nigrum) roses." The variable evaluated in Laboratory: Control percentage of Botrytis cinerea in petri dish, whereas the statistical design was evaluated in the variable field: control percentage of Botrytis cinerea on flower buds in Freedom roses variety. This work investigated the inhibition of Botrytis cinerea on roses by apply...
-
Directory of Open Access Journals (Sweden)
Fátima Aparecida da Silva-Barreto
2010-06-01
Full Text Available Os grupos 3 e 4 de anastomose (AG-3 e AG-4 do fungo Rhizoctonia solani são importantes grupos associados à batata no mundo. No Brasil, o AG-3 é relatado afetando principalmente batata e fumo. Já o AG-4 causa perdas consideráveis em culturas de importância econômica, como a soja, o feijão e o amendoim, podendo ocorrer também em hortaliças como o espinafre, o pimentão, o brócolis, o tomate, a batata e frutíferas como o melão. Recentemente foi constatada, em Brasília-DF, a associação de R. solani a plantas invasoras em áreas de cultivo de batata. Entretanto, não há informação a respeito da etiologia do patógeno bem como do papel de espécies invasoras como outras hospedeiras no ciclo do patógeno. Objetivou-se com esse estudo caracterizar isolados de R. solani obtidos de batata e de outras três espécies de plantas invasoras associadas a áreas de cultivo da cultura: juá-de-capote [Nicandra physaloides (L. Pers., Solanaceae], beldroega (Portulaca oleracea L., Portulacaceae, e caruru (Amaranthus deflexus L., Amaranthaceae. Foi confirmada a hipótese de que os isolados obtidos de R. solani de beldroega, caruru e juá-de-capote pertencem ao grupo 4 de anastomose e são patogênicos à batata, exceto o isolado de beldroega. Estes isolados apresentaram patogenicidade cruzada às três espécies e também patogênicos à maria-pretinha (Solanum americanum Mill., uma outra espécie de Solanaceae invasora. A classificação dos isolados no grupo AG-4 HGI ou no grupo AG-4 HGIII (isolado de caruru foi confirmada através de características culturais e moleculares (seqüenciamento da região ITS-5.8S do rDNA. Os resultados deste trabalho trazem implicações importantes para o manejo das podridões radiculares de Rhizoctonia em batata.The anastomosis groups 3 and 4 (AG-3 and AG-4 of the fungus Rhizoctonia solani are important groups associated with potatoes worldwide. In Brazil, the AG-3 is reported affecting mainly potatoes and
-
Directory of Open Access Journals (Sweden)
MISAEL CHINCHILLA-CARMONA
2011-03-01
Full Text Available Se realizó una evaluación in vivo de la actividad antimalárica de las hojas, flores, frutos, corteza y raíz de 25 plantas de la Reserva Biológica Alberto Manuel Brenes (REBAMB, situada en San Ramón, Alajuela, Costa Rica. Las plantas estudiadas fueron Aphelandra aurantiaca (Scheidw. Lindl., Aphelandra tridentata Hemsl. (Acanthaceae, Xanthosoma undipes (K. Koch & C.D. Bouché K. Koch. (Araceae, Iriartea deltoidea Ruiz & Pav. (Arecaceae, Neurolaena lobata (L. Cass. (Asteraceae, Lonchocarpus pentaphyllus (Poir. Kunth ex DC., Pterocarpus hayesii Hemsl., Senna papillosa (Britton & Rose H.S. Irwin & Barneby., Cinnamomum chavarrianum (Hammel Kosterm. (Fabaceae, Nectandra membranacea (Sw. Griseb., Persea povedae W.C. Burger. (Lauraceae, Hampea appendiculata (Donn. Sm. Standl. (Malvaceae, Guarea glabra Vahl., Ruagea glabra Triana & Planch. (Meliaceae, Psidium guajava L. (Myrtaceae, Bocconia frutescens L. (Papaveraceae, Piper friedrichsthalii C. DC. (Piperaceae, Clematis dioica L. (Ranunculaceae, Prunus annularis Koehne. (Rosaceae, Siparuna thecaphora (Poepp. & Endl. A. DC. (Siparunaceae, Solanum arboreum Dunal., Witheringia solanacea L'Hér. (Solanaceae, Ticodendron incognitum Gómez-Laur. & L.D. Gómez. (Ticodendraceae, Heliocarpus appendiculatus Turcz. (Tiliaceae y Myriocarpa longipes Liebm. (Urticaceae. Los extractos alcohólicos frescos y secos, fueron evaluados por su actividad inhibitoria de la parasitemia causada por Plasmodium berghei en ratones Swiss. Al realizar las prueba de CI50 las plantas en que esa actividad fue muy relevante fueron (en mg kg-1 de peso: 12 para la corteza de B. frutescens, 18 para la raíz de H. appendiculata, 14 para la raíz de I. deltoidea, 4 para el fruto inmaduro de M. longipes, 21 para la raíz de N. membranacea, 19 para las hojas tiernas de P. povedae y 16 para el fruto inmaduro de S. tecaphora. Los extractos frescos presentaron una mayor actividad antimalárica que los sometidos a desecación. Este estudio es
-
Pérez-Rojas, Fernanda; León-Quispe, Jorge; Galindo-Cabello, Nadia
2015-01-01
Una de las formas de control de fitopatógenos es a través del uso de microorganismos antagonistas. El compost, un producto orgánico es fuente de microorganismos capaces de producir metabolitos secundarios de interés agrícola. Se aislaron y evaluaron mediante cultivos in vitro la capacidad antagonista de 85 actinomicetos frente a fitopatógenos que afectan a Solanum tuberosum. De los aislados, 23.5% tuvieron actividad antagonista a Ralstonia solanacearum, 16.4% a Pectobacterium carotovorum, 43....
-
Ramos, Clécio S; Ramos, Natália S M; Da Silva, Rodolfo R; Da Câmara, Cláudio A G; Almeida, Argus V
2012-12-01
The chemical volatiles from plant leaves and their biological activities have been extensively studied. However, no studies have addressed plant-chemical volatiles after undergoing the digestive process in host insects. Here we describe for the first time chemical profiles of volatile constituents from Solanum paniculatum and Mangifera indica leaves metabolized by grasshoppers. Both profiles were qualitatively and quantitatively different from the profiles of non-metabolized leaves. The amount of nerolidol, the major constituent of S. paniculatum leaves, decreased and other sesquiterpenes, such as spathulenol, were formed during the digestive process of the grasshopper Chromacris speciosa. In M. indica, the presence of phenylpropanoids was observed (dillapiole, Z-asarone, E-asarone and γ-asarone) in the leaves metabolized by the grasshopper Tropidacris collaris, but these compounds were not found in the non-metabolized leaves. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Consuelo Montes Rojas
2010-04-01
Full Text Available En el noroccidente de Popayán, Colombia, se evaluó la presencia de plagas causadas por patógenos en 42 clones de lulo (Solanum quitoense Lam.. Los clones fueron plantados en bolsas plásticas, donde se desarrollaron por 3 semanas antes de ser trasplantados al campo. Se utilizó un diseño de bloques completos al azar con cuatro repeticiones, la parcela útil estuvo conformada por 6 plantas, las cuales se sembraron a ‘tresbolillo’ a 2.5 m entre surcos y 2 m entre plantas. Para determinar el efecto de las plagas en el cultivo, se calculó el porcentaje de incidencia y severidad del ataque. La incidencia se evaluó como porcentaje de plantas afectadas, y la severidad como porcentaje de tejido afectado por el patógeno. Las enfermedades más limitantes para los 42 clones fueron: gota (Phytophthora infestans que provocó una mortalidad de plantas superior a 40%; fusarium (Fusarium oxysporum que se presentó en 12 de los clones evaluados; antracnosis (Colletotrichum sp. que afectó 21 clones, los cuales se clasificaron entre tolerantes y medianamente tolerantes; y mancha clorótica (Cladosporium sp. que afectó 21 clones, clasificados como susceptibles. Los clones PL19, PL24, PL11, PL35 fueron medianamente tolerantes. Se seleccionaron por supervivencia los clones: JY E1 (52.2%, PH E 1 (45.8%, VM E2 (45.8%; por supervivencia y por tolerancia a Fusarium oxysporum los clones PL35, PL11, PL24, PL8, PL19, 120052, 120043, ORE1, AGE1. Los clones SER 7, SER 15, SER 9, SEC 31, SEC 27 presentaron alta mortalidad pero se seleccionaron por ser medianamente tolerantes a gota, tolerantes a antracnosis y medianamente resistentes a nematodos, con buen vigor y producción.Presence of plant disease caused by pathogens on 42 clones of Solanum quitoense Lam. were evaluated in the north-western region of Popayán, Colombia. The seed of the clons were planted in plastic bags during three weeks and afterwards transplanted to the field. The statistical design
-
Korompis, Olga S; Mamuaja, Christine F; Mandey, Lucia C
2016-01-01
Potato (Solanum tuberosum L.), corn (Zea mays L.) and sago (Arenga microcarpa Beccari) are crops containing high carbohydrate, as source of calory food, and those can be made into rice analog. This study aimed: (1) to determine the formulations by organoleptic test in manufacture analog rice from potato flour, corn flour and sago flour, and (2) to analyze the physical properties, chemical properties of rice analog from potato flour with the addition of corn flour and sago flour. The research ...
-
Directory of Open Access Journals (Sweden)
Gelpud Chaves Cristian
2011-03-01
Full Text Available
El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne spp., en el Departamento de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%. En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense L. en los Departamentos de Nariño y Putumayo y 4 genotipos silvestres (S. mammosum, S. hirtum, S. marginatum y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en todos los genotipos, 2.04% genotipos resistentes, 34.7% moderadamente resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raIz, (R2 = 0.71 y 0.98,el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.
-
VIEIRA JÚNIOR, Geraldo
2004-01-01
Solanum lycocarpum A. St.-Hil., popularmente conhecida como lobeira, é facilmente encontrada no cerrado. Caracteriza-se como uma planta arbustiva com até cinco metros de altura, ramos frágeis, apresentando fruto tipo baga globosa, de oito a quinze centímetros de diâmetro, cor verde-amarelada mesmo quando maduro, polpa carnosa e suculenta. A lobeira é usada na medicina popular para diversos fins terapêuticos, como por exemplo, bronquite, verminose, diabete e úlcera. Estudo co...
-
Antibacterial effects of Solanum tuberosum peel ethanol extract in vitro
Directory of Open Access Journals (Sweden)
Amanpour Raana
2015-04-01
Full Text Available Introduction: Today, medicinal plants are being widely used due to being natural, available, and cheaper than synthetic drugs and having minimum side effects. Since there were reports about the antibacterial properties of Solanum tuberosum (SE, the aim of this study was to investigate the antibacterial effects of SE ethanol extract in vitro condition on Streptococcus pyogenes, Staphylococcus aureus, Pseudomonas aeruginosa and Klebsiella pneumoniae. Methods: Ethanol extract of SE peel was prepared by maceration method. Initially, antibacterial activity of ethanol extract of SE was qualitatively determined by disk diffusion test; then, the minimum inhibitory concentration and minimum bactericidal concentration were qualitatively determined by micro-dilution method. Results: SE peel extract had antibacterial properties and its effect was more pronounced on gram-positive bacteria, especially S. aureus (0.62±0.00 mg/ml. The extract had antibacterial activity on gram-negative bacteria, P. aeruginosa, too (8.33±2.88 mg/ml. Conclusion: SE peel extract has antibacterial activity and its effect on gram-positive bacteria was more pronounced than the investigated gram-negative bacteria. Therefore, it is suggested that SE peel constituent compounds be determined and to determine the exact mechanism of its antibacterial properties, and more comprehensive research be done to apply it, clinically.
-
Morpho-histological analysis of tomato (Solanum lycopersicum L. plants after treatment with juglone
Directory of Open Access Journals (Sweden)
Anna Milewska-Hendel
2017-06-01
Full Text Available Juglone is a substance that limits plant growth and has a toxic effect on plant development. In this study, we analyzed the influence of juglone at two different concentrations (10−3 M and 10−4 M, which were applied to different parts of Solanum lycopersicum L. plants (root system, stem after decapitation, and surface of a younger leaf or after autografting for a short period of time (7 days, on the morphology and histology of stems. At a lower concentration, juglone had positive effects on plant growth, which resulted in an increase in interfascicular cambial cell divisions, faster development of a continuous cambium layer along the stem circumference, and development of fibers. Additionally, under the influence of juglone, the number of developing leaves increased and adventitious roots developed. The results are discussed based on the current literature concerning the reaction of plants to juglone and to stress conditions.
-
Enhanced bioremediation of lead-contaminated soil by Solanum nigrum L. with Mucor circinelloides.
Sun, Liqun; Cao, Xiufeng; Li, Min; Zhang, Xu; Li, Xinxin; Cui, Zhaojie
2017-04-01
Strain selected from mine tailings in Anshan for Pb bioremediation was characterized at the genetic level by internal transcribed spacer (ITS) sequencing. Results revealed that the strain belongs to Mucor circinelloides. Bioremediation of lead-contaminated soil was conducted using Solanum nigrum L. combined with M. circinelloides. The removal efficacy was in the order microbial/phytoremediation > phytoremediation > microbial remediation > control. The bioremediation rates were 58.6, 47.2, and 40.2% in microbial/phytoremediation, microbial remediation, and phytoremediation groups, respectively. Inoculating soil with M. circinelloides enhanced Pb removal and S. nigrum L. growth. The bioaccumulation factor (BF, 1.43), enrichment factor (EF, 1.56), and translocation factor (TF, 1.35) were higher than unit, suggesting an efficient ability of S. nigrum L. in Pb bioremediation. Soil fertility was increased after bioremediation according to change in enzyme activities. The results indicated that inoculating S. nigrum L. with M. circinelloides enhanced its efficiency for phytoremediation of soil contaminated with Pb.
-
Chemical Constituents from Solanum glabratum Dunal var. sepicula
Directory of Open Access Journals (Sweden)
Essam Abdel-Sattar
2015-01-01
Full Text Available In the course of screening program of Saudi plants for their potential biological activity, the methanolic extract of Solanum glabratum Dunal var. sepicula as well as its different fractions were tested for its possible cytoxicity in prostate cancer (PC3 and colon cancer (HT29 cell lines using the MTT assay. In the present study, three spirostan saponins and one flavonoid glycoside were isolated from the active n-butanol fraction through a bio-guided fractionation approach. Two new saponin glycosides were identified as 23-β-D-glucopyranosyl (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (2 and (25R-spirost-5-en-3-ol 3-O-α-L-rhamnopyranosyl-(1→2-O-[β-D-glucopyranosyl-(1→3]-β-D-galactopyranoside (3. In addition, two known compounds were also isolated and identified as isorhamnetin-3-O-α-L-rhamnopyranosyl (1→6 β-D-glucopyranoside (1 and (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (4. The structures of the isolated compounds were elucidated based on their MS, one dimensional and extensive two dimensional NMR spectral data. Among the isolated metabolites, compound 3 showed the highest cytotoxic activity in both PC3 and HT29 cell lines with an IC 50 values of 14.8 and 19.5 m g/mL, respectively.
-
Molecular characterization of native potato (Solanum spp. Chungui, Ayacucho, using AFLP
Directory of Open Access Journals (Sweden)
Juan C. Gonzales Mamani
2014-12-01
Full Text Available Genetic diversity of 25 morphotypes of native potatoes Solanum spp. from Chungui (La Mar, Ayacucho were assess. Morphotypes collected were micropropagated in Murashigue Skoog medium (1962. DNA extraction proceeded using the CTAB method modified from 3 weeks leaves crop, good quality and quantity of DNA was able to use the AFLP. Enzymatic digestion of the DNA was performed using EcoRI and MseI. Three combinations of AFLP primers with three selective nucleotides were used, resulting in a total of 85 clearly discernable bands, of which 63 were polymorphic. The combination E37 – M50 showed the most informative polymorphic index content of 0.43. The presence/absence of polymorphic bands was evaluated using the Simple Matching coefficient similarity and clustering analysis using the UPGMA. The dendrogram produced had a cophenetic correlation coefficient r= 0.7. At the level 0.64 of Simple Matching coefficient similarity, the dendrogram grouped the morphotypes of native potatoes in 4 genetic groups, it not found duplicated morphotypes, despite having some morphotypes very similar. Our results would be showing the highly informative power of AFLP markers for the analysis of genetic diversity of native potatoes.
-
Efficient plant regeneration of bittersweet (Solanum dulcamara L., a medicinal plant
Directory of Open Access Journals (Sweden)
Arzu Ucar Turker
2011-01-01
Full Text Available Solanum dulcamara L. (bittersweet is a medicinal plant that has been used to treat skin diseases, warts, tumors, felons, arthritis, rheumatism, bronchial congestion, heart ailments, ulcerative colitis, eye inflammations, jaundice and pneumonia. A reliable in vitro culture protocol for bittersweet was established. Explants (leaf and petiole segments were cultured on Murashige and Skoog minimal organics (MSMO medium with various plant growth regulator combinations. Leaf explants formed more shoots than petiole explants. Plant regeneration was observed through indirect organogenesis with both explants. Best shoot proliferation was obtained from leaf explants with 3 mg/l BA (benzyladenine and 0.5 mg/l IAA (indole-3-acetic acid. Regenerated shoots were transferred to rooting media containing different levels of IAA (indole-3-acetic acid, IBA (indole-3-butyric acid, NAA (naphthalene acetic acid or 2,4-D (2,4 dichlorophenoxyacetic acid. Most shoots developed roots on medium with 0.5 mg/l IBA. Rooted explants were transferred to vermiculate in Magenta containers for acclimatization and after 2 weeks, they were planted in plastic pots containing potting soil and maintained in the plant growth room.
-
Roy, Kaushik; Sarkar, C K; Ghosh, C K
2015-07-05
In this study, we have reported a fast and eco-benign procedure to synthesis silver nanoparticle at room temperature using potato (Solanum tuberosum) infusion along with the study of its photocatalytic activity on methyl orange dye. After addition of potato infusion to silver nitrate solution, the color of the mixture changed indicating formation of silver nanoparticles. Time dependent UV-Vis spectra were obtained to study the rate of nanoparticle formation with time. Purity and crystallinity of the biogenic silver nanoparticles were examined by X-ray diffraction (XRD). Average size and morphology of the nanoparticles were characterized by dynamic light scattering (DLS) and transmission electron microscopy (TEM). Fourier transform infra-red spectroscopy (FTIR) was employed to detect functional bio-molecules responsible that contribute to the reduction and capping of biosynthesized Ag nanoparticles. Further, these synthesized nanoparticles were used to investigate their ability to degrade methyl orange dye under sunlight irradiation and the results showed effective photocatalytic property of these biogenic silver nanoparticles. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Silvia Blair Trujillo; César Segura; Mary Luz López
2004-01-01
En el mundo existen pocas alternativas terapéuticas para malaria. El Grupo Malaria ha aislado esteroides de la planta Solanum nudum, usada para el tratamiento de fiebres por la edicina tradicional colombiana, y ha encontrado que tienen ctividad antimalárica in vitro e in vivo contra P. falciparum, P. vivax y P. berghei. Los compuestos aislados de S. nudum son de tipo esteroidal y se conoce que los esteroles pueden afectar la elación colesterol/fosfolípidos en la membrana del eritroci...
-
Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V
2016-05-19
Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.
-
Directory of Open Access Journals (Sweden)
Hermes Araméndiz Tatis
2012-06-01
Full Text Available Resumen: Se evaluó la viabilidad del polen de berenjena (Solanum melongena L. mediante el método de germinación in vitro. Botones florales de la variedad Lila criolla con características de pre-antesis fueron colectados de las 07:00 a las 08:00 horas. Los granos de polen fueron extraídos con un vibrador eléctrico y rehidratados en cámara húmeda durante dos horas a temperatura de 25 ºC. Posteriormente, para la germinación en condiciones in vitro, los granos fueron dispersados, utilizando un pincel, en un medio de cultivo constituido por 100 g de sacarosa (C12H22O11, 500 mg de nitrato de calcio [Ca (NO32 4H2O], 120 mg de sulfato de magnesio (MgSO4, 100 mg de nitrato de potasio (KNO3 y 120 mg de ácido bórico (H3BO3 disueltos en 1.000 mL de agua destilada. Seguidamente, se agregaron 10 g de agar y el pH fue ajustado a 6,0. El polen fresco fue incubado durante ocho horas con lecturas cada dos horas. Los resultados indican que el método es confiable para cuantificar la viabilidad de granos de polen, ya que después de ocho horas de incubación se logró un 79% de germinación, 0,50 mm de longitud del tubo polínico y 0,0532 mm de diámetro del mismo. Por lo tanto, el uso de polen con ocho horas de almacenamiento es favorable para la producción de semilla híbrida a través de la hibridación artificial, por haber registrado un aumento de germinación de 0,4942% con efecto cuadrático, por cada hora de incubación.Abstract: We assessed the viability of pollen of eggplant (Solanum melongena L. using in vitro germination method. The collection of flower buds in pre-anthesis of the Lila criolla variety was carried out in the morning from 07:00 to 08:00 hours. Pollen grains were extracted with an electric vibrator and rehydrated in a humid chamber for two hours at a temperature of 25 ºC. Subsequently, for germination in vitro, were dispersed, using a paintbrush, in a culture medium container 100 g of saccharose (C12H22O11, 500 mg of calcium
-
Directory of Open Access Journals (Sweden)
Pietro Gramazio
2017-08-01
Full Text Available Advanced backcrosses (ABs and introgression lines (ILs of eggplant (Solanum melongena can speed up genetics and genomics studies and breeding in this crop. We have developed the first full set of ABs and ILs in eggplant using Solanum incanum, a wild eggplant that has a relatively high tolerance to drought, as a donor parent. The development of these ABs and IL eggplant populations had a low efficiency in the early stages, because of the lack of molecular markers and genomic tools. However, this dramatically improved after performing genotyping-by-sequencing in the first round of selfing, followed by high-resolution-melting single nucleotide polymorphism genotyping in subsequent selection steps. A set of 73 selected ABs covered 99% of the S. incanum genome, while 25 fixed immortal ILs, each carrying a single introgressed fragment in homozygosis, altogether spanned 61.7% of the S. incanum genome. The introgressed size fragment in the ILs contained between 0.1 and 10.9% of the S. incanum genome, with a mean value of 4.3%. Sixty-eight candidate genes involved in drought tolerance were identified in the set of ILs. This first set of ABs and ILs of eggplant will be extremely useful for the genetic dissection of traits of interest for eggplant, and represents an elite material for introduction into the breeding pipelines for developing new eggplant cultivars adapted to the challenges posed by the climate-change scenario.
-
Directory of Open Access Journals (Sweden)
Manuel Francisco Polanco Puerta
2018-05-01
Full Text Available The aim of this study was to cross lulo plants of cv. La Selva to obtain a hybrid with tolerance to the fruit borer Neoleucinodes elegantalis Guenée (Lepidoptera: Crambidae and to the nematode Meloidogyne incognita (Kofoid & White (Nematoda: Heteroderidae, to obtain better-adapted plants to the conditions of the Colombian coffee-growing region and with bigger and non-dehiscent fruits. La Selva cultivar is a hybrid developed from the interspecific backcross of Solanum quitoense Lam. × Solanum hirtum Vahl with plants of lulo cv. Castilla Larga Vida. The experiment was conducted in the municipality of Dosquebradas, Risaralda, Colombia, located at 1,465 m a.s.l. F1 plants were obtained from reciprocal crossings. When inoculated with the nematode M. incognita, plants showed susceptibility in their seedling stage; however, when we carried out the evaluation six months after transplantation under field conditions, nematode infestation was less than 1%, which likely indicates the tolerance of these materials to the nematode. When assessing the resistance of the hybrid to the attack of N. elegantalis, we found that the evaluated materials were resistant to this insect. The resulting hybrids showed good agronomic characteristics, such as a good morphological structure and vigor, high productivity, good solar exposure adaptation, large fruits (5.6 cm average diameter similar to those of cv. Castilla, with yellow peel, green pulp and non-dehiscent fruits with pleasant aroma and flavor. As an undesirable characteristic plants had thorns on leaves and stems.
-
Directory of Open Access Journals (Sweden)
Silvia Blair Trujillo
2004-02-01
Full Text Available
En el mundo existen pocas alternativas terapéuticas para malaria. El Grupo Malaria ha aislado esteroides de la planta Solanum nudum, usada para el tratamiento de fiebres por la edicina tradicional colombiana, y ha encontrado que tienen ctividad antimalárica in vitro e in vivo contra P. falciparum, P. vivax y P. berghei. Los compuestos aislados de S. nudum son de tipo esteroidal y se conoce que los esteroles pueden afectar la elación colesterol/fosfolípidos en la membrana del eritrocito 1, igualmente, pueden cambiar su permeabilidad para Na+ y + (2. En los eritrocitos parasitados con Plasmodium la edistribución del colesterol en la membrana y la presencia de roteínas del parásito aumentan la permeabilidad. En la membrana el eritrocito se presentan microdominios: arreglos de ípidos y colesterol a los cuales se anclan las proteínas a través el glicosilfosfatidilinositol. Se ha observado como la extracción el colesterol de los microdominios del eritrocito interfiere en la invasión del glóbulo rojo por Plasmodium (3, sugiriendo que pueden ser aprovechados funcionalmente como blanco erapéutico. El objetivo de este trabajo es determinar el efecto de los esteroles de la planta Solanum nudum en la membrana el eritrocito humano normal e infectado con P. falciparum, mediante el análisis de permeabilidad y de microdominios.
-
International Nuclear Information System (INIS)
Srinivasappa, K.N.; Ramanjini Gowda, P.H.; Thimmaiah, S.K.; Mahadevu, P.
1998-01-01
Shoot and fruit borer (Leucinodes orbonalis Guenee) is a serious pest in brinjal and no variety is found to be resistant to this dreaded pest. Solanum macrocarpon, a wild relative of brinjal is found to be resistant to shoot and fruit borer infestation. Attempts were made to hybridise between S. melongena and S. macrocarpon, but it was unsuccessful due to ovule abortion. The present study was undertaken to evaluate the promising mutants in M 3 generation for improved fruit quality besides its unbroken resistance and for further crop improvement
-
Directory of Open Access Journals (Sweden)
MC. Souza
2009-06-01
Full Text Available The purpose of this study was to update the floristic inventory found in the Upper Paraná River floodplain. Floristic surveys were performed from February 2000 through March 2008, as part of the Brazilian Long-Term Ecological Research Program (PELD/CNPq -Site 6. The material collected was identified from 774 species, 442 genera, and 116 families. The ten families with high species richness were Leguminosae, Poaceae, Rubiaceae, Asteraceae, Euphorbiaceae, Myrtaceae, Cyperaceae, Solanaceae, Sapindaceae, and Orchidaceae, which contributed to 46.1% of the total number of species. Genera with high richness were Solanum, Cyperus, Panicum, Eugenia, Tillandsia, Serjania, Casearia, and Polygonum, which together contributed to 10.2% of the total number of species. These data, combined with information published in 1997, recorded 955 species, 575 genera, and 128 families. These organisms were from several riparian environments and were distributed as herbs, shrubs, trees, climbers and epiphytes. Panicum maximum, Pennisetum purpureum, Ricinus communis, and Urochloa decumbens are considered weeds due to the wide distributions determined for these species. The results presented herein suggest the need to further investigate the control of these potential weed species.Com o objetivo de ampliar os conhecimentos sobre a flora da planície de inundação do Alto Rio Paraná, foram conduzidos inventários florísticos no período de fevereiro de 2000 a março de 2008, incluídos no Programa Brasileiro de Pesquisas Ecológicas de Longa Duração (PELD/CNPq - Sítio 6. O material coletado foi identificado em 774 espécies, 442 gêneros e 116 famílias. As dez famílias de maior riqueza de espécies foram Leguminosae, Poaceae, Rubiaceae, Asteraceae, Euphorbiaceae, Myrtaceae, Cyperaceae, Solanaceae, Sapindaceae e Orchidaceae, que juntas reuniram 46,1% do total do número de espécies. Os gêneros com maior riqueza de espécies foram Solanum, Cyperus, Panicum, Eugenia
-
Zasada, Inga A; Peetz, Amy; Wade, Nadine; Navarre, Roy A; Ingham, Russ E
2013-09-01
Globodera ellingtonae was detected in Oregon in 2008. In order to make decisions regarding the regulation of this nematode, knowledge of its biology is required. We determined the host status of a diversity of potato (Solanum tuberosum) varieties in soil-based experiments and identified hatching stimulants in in vitro hatching assays. 'Russet Burbank,' 'Desiree,' 'Modac,' 'Norland,' 'Umatilla,' and 'Yukon Gold' were good hosts (RF > 14) for G. ellingtonae. Potato varieties 'Maris Piper,' 'Atlantic,' and 'Satina,' all which contain the Ro1 gene that confers resistance to G. rostochiensis, were not hosts for G. ellingtonae. In in vitro hatching assays, G. ellingtonae hatched readily in the presence of diffusates from potato (PRD) and tomato (Solanum lycopersicum; TRD). Egg hatch occurred in an average of between 87% and 90% of exposed cysts, with an average of between 144 and 164 juveniles emerging per cyst, from PRD- and TRD-treated cysts, respectively. This nematode hatched rapidly in the presence of PRD and TRD, with at least 66% of total hatch occurring by day 3 of exposure. There was no dose-response of egg hatch to concentrations of PRD or TRD ranging from 1:5 to 1:100 diffusate to water. When G. ellingtonae was exposed to root diffusates from 21 different plants, hatch occurred in 0% to 70% of exposed cysts, with an average of between 0 to 27 juveniles emerging per cyst. When root diffusate-exposed cysts were subsequently transferred to PRD to test viability, root diffusates from arugula (Eruca sativa), sudangrass (Sorghum bicolor subsp. drummondii), and common vetch (Vicia sativa) continued to inhibit egg hatch compared with the other root diffusates or water in which hatch occurred readily (60 to 182 juveniles emerging per cyst). Previously known hatching stimulants of G. rostochiensis and G. pallida, sodium metavanadate, sodium orthovanadate, and sodium thiocyanate, stimulated some egg hatch. Although, Globodera ellingtonae hatched readily in PRD and TRD
-
Directory of Open Access Journals (Sweden)
Ofelia Banihashemi
2017-07-01
Full Text Available Background & Aim:A new sustainable tissue-based system is presented by plant hairy roots, preserving all of the several specialized types of cell with critical roles in allowing bioactive secondary molecules to be synthesized more consistently as usual. The system is also essential for studying the production of alkaloid in culture. Experimental: The Atropa komarovii leaves were wounded and infected with soil gram-negative bacterium Agrobacterium rhizogenes ATCC15834. After three weeks, the transformation roots and control roots without infection, appeared, and for confirming that T-DNA Ri plasmid fragments were transformed and integrated to plant genome, the rolB gene region, was amplified using PCR. HPLC method was then used for assaying how two tropane alkaloids such as atropine (hyosciamine and scopolamine (hyoscine were produced in hairy roots,control roots, leaves and roots of plantlet. Results: The data indicated that diagnostic 500bp rol B product amplification was exhibited to be present by all the transformed hairy roots. Scopolamine content in hairy roots was considerably greater than that in control roots but greatest (Hyoscyamine atropine content was observed in control roots. Analysis of DW, FW and root length showed that fresh and dry root weight increased in hairy roots compared with that in non transformed root. Recommended applications/industries: The present study demonstrated that secondary metabolite production using medicinal plants concerns many researchers worldwide today and hairy root culture is a useful method for producing tropane alkaloids in solanaceae.
-
Directory of Open Access Journals (Sweden)
Tiani Melissa Gómez Pulgarín
2012-06-01
Full Text Available Resumen. El cultivo de la papa ocupa el cuarto lugar en el mundo en importancia después del arroz, trigo y maíz. La papa criolla (Solanum phureja posee características valiosas desde el punto de vista culinario y nutricional, por su alto contenido de vitaminas, minerales, fibra y calidad de proteína. Colombia es un centro de diversidad y origen de papas criollas, lo que representa un enorme potencial de recurso genético para el fitomejoramiento. En la Universidad Nacional de Colombia se conserva el banco de germoplasma de papas criollas de Colombia. El estudio de los cariotipos es importante para entender las bases genéticas que apoyan los cruces que se realizan en los programas de mejoramiento. A pesar de la importancia de este recurso, la caracterización de los cariotipos de las accesiones no ha sido realizada completamente. En este estudio se caracterizaron dos materiales de la colección de S. phureja y tres provenientes de la F1 del cruce de un genotipo resistente y otro susceptible a la enfermedad conocida como gota de la papa. El análisis comparativo permitió identificar diferencias en la morfología celular, dos niveles de ploidía (diploide y triploide, con dos variaciones aneugénicas (hipodiploide y trisomía doble y cuatro números cromosómicos (18, 24, 26 y 36 para los cinco genotipos evaluados.Abstract. Potato crop is forth in importance worldwide after rice, wheat, and corn. Diploid potato cv. Criolla (Solanum phureja shows highly desired culinary and nutritional characteristics, such as vitamins, minerals, fiber and protein quality. Colombia is a diversity and origin center of diploid potatoes cv. Criolla, which represents an enormous genetic resource potential for plant breeding. At Universidad Nacional de Colombia the potato "criollas" germplasm bank is mantained. Karyotype analysis is important for understanding genetic basis of plant breeding. Despite the importance of this resource karyotype analysis of this
-
Directory of Open Access Journals (Sweden)
Bruno Eduardo C de Miranda
2010-12-01
Full Text Available A murcha-de-verticílio (Verticillium dahliae é uma das doenças mais severas do tomateiro (Solanum lycopersicum L.. Duas raças fisiológicas de V. dahliae foram caracterizadas infectando o tomateiro e ambas estão presentes no Brasil. A estratégia de controle mais efetiva para isolados da raça 1 tem sido a utilização de cultivares resistentes em associação com práticas culturais. Entretanto, não existem cultivares comerciais de tomate resistentes à raça 2 do patógeno. Neste contexto, torna-se importante a identificação de novas fontes de resistência que sejam efetivas contra as duas raças de V. dahliae. Buscou-se fontes de resistência a isolados de V. dahliae (raças 1 e 2. Cem acessos de uma coleção de germoplasma contendo espécies cultivadas e selvagens de Solanum (secção Lycopersicon foram inicialmente inoculados pelo método de imersão de raízes com um isolado de V. dahliae raça 1 (5 mL de uma suspensão de 10(6 conídios/mL em condições de casa de vegetação. A avaliação foi feita aos 30 dias após a inoculação, usando uma escala de notas variando de 1 (planta sadia a 5 (planta morta. Foram considerados resistentes os acessos que apresentaram nota média entre 1 e 2. Um grupo composto por 38 acessos classificados como resistentes neste primeiro ensaio foi reavaliado para resistência a outros quatro isolados de V. dahliae pertencentes às raças 1 e 2. As cultivares Ponderosa e Floradade foram utilizadas como controles. O ensaio foi conduzido em casa de vegetação em delineamento experimental de blocos ao acaso em arranjo fatorial 5 x 40, com três repetições (vasos com quatro plantas. A avaliação foi feita baseada nos parâmetros epidemiológicos: período de incubação e índice de doença. Foram identificados acessos com resistência raça-específica e também com resistência a ambas as raças. Estes acessos podem ser indicados para futuros programas de melhoramento genético visando incorporar
-
Directory of Open Access Journals (Sweden)
Barbouche N.
2001-01-01
Full Text Available Contribution to the study of the biological activity of Cestrum parqui L'Herit. extracts against the locust Schistocerca gregaria (Forsk. The leaves of Cestrum parqui L'Herit. (Solanaceae, a common ornamental shrub in North Africa showed strong insecticide activity against the locust Schistocerca gregaria. The first part of this paper deals with a phytochemical survey of C. parqui. The second one reports on the toxicity of methanolic extracts (EB of leaves and fractions thereof. The mortality in treated insects (at the 5th instar injected with aqueous solutions of EB or fractions reached 100/ within a period of 2 to 4 days. The bioassays undertaken with two fractions F37 (recovered from EB by solid phase extraction and ESB (resulting from the diethylether precipitation from EB methanolic solution exhibited a similar toxicity. The n-hexane extracts obtained after F37 and ESB acidic hydrolysis showed the same TLC patterns. The toxicity of C. parqui is related to the occurrence of saponins.
-
van Eldik, G J; Ruiter, R K; Colla, P H; van Herpen, M M; Schrauwen, J A; Wullems, G J
1997-03-01
Successful sexual reproduction relies on gene products delivered by the pistil to create an environment suitable for pollen tube growth. These compounds are either produced before pollination or formed during the interactions between pistil and pollen tubes. Here we describe the pollination-enhanced expression of the cp100 gene in pistils of Solanum tuberosum. Temporal analysis of gene expression revealed an enhanced expression already one hour after pollination and lasts more than 72 h. Increase in expression also occurred after touching the stigma and was not restricted to the site of touch but spread into the style. The predicted CP100 protein shows similarity to leguminous isoflavone reductases (IFRs), but belongs to a family of IFR-like NAD(P)H-dependent oxidoreductases present in various plant species.
-
Ji, Puhui; Sun, Tieheng; Song, Yufang; Ackland, M Leigh; Liu, Yang
2011-03-01
Field trials contribute practical information towards the development of phytoremediation strategies that cannot be provided by laboratory tests. We conducted field experiments utilizing the Cd hyperaccumulator plant Solanum nigrum L., on farmland contaminated with 1.91 mg kg(-1) Cd in the soil. Our study showed that S. nigrum has a relatively high biomass. Planting density had a significant effect on the plant biomass and thus on overall Cd accumulation. For double harvesting, an optimal cutting position influenced the amount of Cd extracted from soils. Double cropping was found to significantly increase the amount of Cd extracted by S. nigrum. Fertilizing had no significant effect on plant biomass or on the Cd remediation of the soil over the short-term period. Our study indicates that S. nigrum can accumulate Cd from soils where the concentrations are relatively low, and thus has application for use in decontamination of slightly to moderately Cd-contaminated soil. Copyright © 2010 Elsevier Ltd. All rights reserved.
-
Andrade J?nior, Moacir Couto de
2006-01-01
O c?bio (Solanum sessiliflorum Dunal) ? um fruto com elevado potencial agroindustrial devido ? sua alta produtividade anual e caracter?sticas nutricionais (alto teor em fibras diet?ticas). Al?m disso, as fibras est?o contidas nos alimentos vegetais e t?m fun??es preventivas de doen?as cr?nico-degenerativas, a exemplo do diabetes mellitus e (ou) das dislipidemias, o que as situa na categoria de alimentos funcionais ou nutrac?uticos. N?o obstante, se, por um lado, algum conhecimento acerca do ...
-
Caracterización química del aceite y harina residual de solanum sisymbriifolium lam
Directory of Open Access Journals (Sweden)
Wiese, B.
2001-04-01
Full Text Available Seeds from Solanum sisymbriifolium Lam harvested at Olavarría (Buenos Aires, Argentine were defatted with hexane and the raw oil obtained with a yield of 20,6 % dry basis. The physicochemical characteristics of crude oil were: refractive index: 1,4610 (at 25ºC, iodine value: 112,8; saponification index: 170,0; unsaponifiable matter: 14,0 % and free fatty acid content: 2,4 (mg KOH/g. The fatty acid composition of seed oil was studied by gas-liquid chromatography. Major fatty acids of seed oil were: linoleic (52,3%, oleic (23,4 % and palmitic acid (16,4 %. The residual seed meal contained moderate level of crude protein (14,75%, dry basis, low level of available lysine (2,25 g/16gN and high content of crude fiber (51,5%, dry basis. Total and phytic acid phosphorous, calcium, ash, sugar and polysaccharides contents are reported.Semillas de Solanum sisymbriifolium Lam cosechadas en Olavarría (prov. de Buenos Aires, Argentina se trataron con hexano (soxhlet obteniéndose el aceite crudo (rendimiento:20,6% y la harina residual de extracción. Las características fisicoquímicas del aceite crudo fueron: Índice de refracción: 1.4610 (a 25ºC; Índice de iodo: 112,8; Índice de saponificación: 170,0; Insaponificable: 14,0%, Índice de acidez: 2,4 (mgKOH/g. Se determinó la composición acídica del aceite por cromatografía gas-líquido. Los ácidos grasos mayoritarios fueron: ácido linoleico (52,3%, ácido oleico (23,4% y ácido palmítico (16,4%. La harina residual de extracción contenía una moderada proporción de proteína cruda (14,75% b.s, baja proporción de lisina disponible (2,25 g/16gN y un alto contenido de fibra cruda (51,5 %b.s. Se informan valores de fósforo total y de ácido fítico, cenizas, calcio e hidratos de carbono.
-
Radiation hormesis in potatoes (Solanum tuberosum L.) part 1: Laboratory research
International Nuclear Information System (INIS)
Wiendl, F.M.; Arthur, V.; Wiendl, J.A.
1995-01-01
This paper describes the results of irradiation of potato (Solanum tuberosum L.) tubers of two varieties. Bintje and Baraka, with gamma radiations of Cobalt-60 at a dose of: 0.0. 2.5. 5.0 and 7.5 Gy, at the dose rate of 150 Gy per hour. Twenty eight potatoes of each variety were irradiated with each dose. Half of these potatoes were planted individually into aluminium cages of about 15 X 10 X 3 cm, using circa 120 ml of vermiculite in each cage, immediately after radiation. After seven days the rest of the potatoes was planted under the same conditions. The whole experiment was conducted into a chamber under dark conditions and temperature between 23 and 27 centigrade. Almost every two or three days each potato received circa 50 ml of plain water. After 143 to 154 days of irradiation the experiment was finished, and the following parameter were determined. Weight of potatoes without sprouts or roots; number of the eyes on which occurred sprouting; length of the longest sprout of its respective eye; humid weight of the sprouts; dry weight of the sprouts; humid weight of the roots; dry weight of the roots. (author). 19 refs, 2 tabs
-
Morphology and biomass variations in root system of young tomato plants (Solanum sp.)
International Nuclear Information System (INIS)
Álvarez Gil, Marta A.; Fernández, Ana Fita; Ruiz Sánchez, María del C.; Bolarín Jiménez, María del C.
2016-01-01
The scarce exploitation of genotypic variability present in plant roots is an attractive breeding choice with regard to abiotic stresses and supports the objective of this work, which is to identify genotypic variation in root system traits of tomato genotypes (Solanum sp.). Thus, five tomato genotypes were studied: the commercial hybrid cultivar Jaguar (S. lycopersicum), Pera, Volgogradiskij and PE-47 entry (S. pennellii), which were collected in Peru, and the interspecific hybrid PeraxPE-47. Plants were grown in hydroponics for 26 days since germination; their roots were extracted and images were digitalized on scanner to evaluate total length, average diameter, the projected area and root length, following the categories per diameter of the whole root system through software Win Rhizo Pro 2003. The dry mass of roots and aerial parts was also recorded. Results indicated that genotypes differed in morphology, length according to diameter, root system spatial configuration and biomass, mainly with respect to the wild salinity resistant species PE-47. The interspecific hybrid PxPE-47 could be used as a rootstock to increase salt tolerance of susceptible cultivars. (author)
-
Investigation of drought stress in pepino (solanum muricatum ait. cv. miskl) leaves
International Nuclear Information System (INIS)
Duman, S.; Sivaci, A.
2015-01-01
In this study, the effects of drought stress on pepino seedlings (Solanum muricatum cv. Miski) under natural greenhouse conditions were examined. The control plants were watered at field capacity, and the stress group was not watered. Samples were collected on the 6th, 12th, 24th and 36th days from the leaves of S. muricatum seedlings that, were exposed to drought stress. The relative water content, the total phenolic compounds, and the malondialdehyde, total photosynthetic pigments (chlorophyll a, chlorophyll b and carotenoids), and proline contents in these samples were determined. Depending on drought stress, the relative water content, the chlorophyll a, chlorophyll b and carotenoid contents, and the total chlorophylls were found to be lower in the stress group compared with the control group. In contrast, the total phenolic compounds (24th and 36th days) and the proline (12th, 24th and 36th days) levels increased significantly compared with the control group. In addition, a significant increase in the malondialdehyde contents was obtained on the 36th day in the stress group compared with the control group. Such studies may be important for evaluation of metabolic changes in pepino under the drought stress. (author)
-
Remediation of heavy metal contaminated soils by using Solanum nigrum: A review.
Rehman, Muhammad Zia Ur; Rizwan, Muhammad; Ali, Shafaqat; Ok, Yong Sik; Ishaque, Wajid; Saifullah; Nawaz, Muhammad Farrakh; Akmal, Fatima; Waqar, Maqsooda
2017-09-01
Heavy metals are among the major environmental pollutants and the accumulation of these metals in soils is of great concern in agricultural production due to the toxic effects on crop growth and food quality. Phytoremediation is a promising technique which is being considered as an alternative and low-cost technology for the remediation of metal-contaminated soils. Solanum nigrum is widely studied for the remediation of heavy metal-contaminated soils owing to its ability for metal uptake and tolerance. S. nigrum can tolerate excess amount of certain metals through different mechanism including enhancing the activities of antioxidant enzymes and metal deposition in non-active parts of the plant. An overview of heavy metal uptake and tolerance in S. nigrum is given. Both endophytic and soil microorganisms can play a role in enhancing metal tolerance in S. nigrum. Additionally, optimization of soil management practices and exogenous application of amendments can also be used to enhance metal uptake and tolerance in this plant. The main objective of the present review is to highlight and discuss the recent progresses in using S. nigrum for remediation of metal contaminated soils. Copyright © 2017 Elsevier Inc. All rights reserved.
-
In vitro antimalarial activity of extracts of some plants from a biological reserve in Costa Rica
Directory of Open Access Journals (Sweden)
Misael Chinchilla
2012-06-01
Full Text Available Treatment with the usual antimalarial drugs, have induced parasite resistance, reinforcing the need to finding natural antimalarial components that would be found on plants from the forest. Therefore, we decided to look for these components in Costa Rican plants from a protected forest area. Fresh and dry extracts of roots, bark, leaves, flowers and fruits of 25 plants from a biological reserve in Costa Rica, Reserva Biológica Alberto Manuel Brenes (REBAMB, were studied in vitro for the presence of substances with antimalarial activity. By studying the inhibition of P. berghei schizogony, we assessed the antimalarial activity of several plant extracts: Aphelandra aurantiaca, A. tridentata (Acanthaceae; Xanthosoma undipes (Araceae; Iriartea deltoidea (Arecaceae; Neurolaena lobata (Asteraceae; Senna papillosa, Pterocarpus hayessi, Lonchocarpus pentaphyllus (Fabaceae; Nectandra membranacea, Persea povedae, Cinamomum chavarrianum (Lauraceae; Hampea appendiculata (Malvaceae; Ruagea glabra, Guarea glabra (Meliaceae; Psidium guajava (Myrtaceae; Bocconia frutescens (Papaveraceae; Piper friedrichsthalii (Piperaceae; Clematis dioica (Ranunculaceae; Prunus annularis (Rosaceae; Siparuna thecaphora (Siparunaceae; Solanum arboreum, Witheringia solanácea (Solanaceae; Ticodendrum incognitum (Ticodendraceae; Heliocarpus appendiculatus (Tiliaceae and Myriocarpa longipes (Urticaceae. We used different parts of the plants as well as fresh and dried extracts for testing IC50. The solid content of the extracts ranged from 1-71.9μg/mL. The fresh extracts showed stronger activity than the dry ones. Since the plants showing the strongest antimalarial activity are very common in Central America, and some similar genera of these plants have shown positives results in South America, we considered important to present these findings for discussion. On the other hand, this is the first systematic study of this kind ever realized in a circumscribed and protected area of
-
African Journals Online (AJOL)
GRACE
2006-05-02
May 2, 2006 ... centromeric positions and arm lengths. Meiotic behaviour of the chromosomes involved a combination of bivalent and multivalent associations especially at the polyploid levels. The significance of this work in the understanding of cytogenetic behaviour of plants and crop improvement efforts are discussed.
-
Directory of Open Access Journals (Sweden)
Paulo de Tarso Oliveira Ferreira
2007-09-01
Full Text Available Solano-violeta (Solanum violaefolium é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C.Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes
-
Directory of Open Access Journals (Sweden)
M. Shyamala
2011-01-01
Full Text Available A comparative study of the inhibitory effect of plant extracts, Ocimum sanctum, Aegle marmelos, and Solanum trilobatum, on the corrosion of mild steel in 1N HCl medium was investigated using weightloss method, electrochemical methods, and hydrogen permeation method. Polarization method indicates plant extracts behave as mixed-type inhibitor. The impedance method reveals that charge-transfer process mainly controls the corrosion of mild steel. On comparison, maximum inhibition efficiency was found in Ocimum sanctum with 99.6% inhibition efficiency at 6.0% v/v concentration of the extract. The plant extracts obey Langmuir adsorption isotherm. The SEM morphology of the adsorbed protective film on the mild steel surface has confirmed the high performance of inhibitive effect of the plant extracts. From hydrogen permeation method, all the plant extracts were able to reduce the permeation current. The reason for the reduced permeation currents in presence of the inhibitors may be attributed to the slow discharge step followed by fast electrolytic desorption step. Results obtained in all three methods were very much in good agreement in the order Ocimum sanctum > Aegle marmelos > Solanum trilobatum.
-
Calapai, Gioacchino; Minciullo, Paola L; Miroddi, Marco; Chinou, Ioanna; Gangemi, Sebastiano; Schmidt, Richard J
2016-03-01
This review focuses on contact dermatitis as an adverse effect of a selection of topically used herbal medicinal products for which the European Medicines Agency has completed an evaluation up to the end of November 2013 and for which a Community herbal monograph - now (since 2015)(†) called a European Union herbal monograph - has been produced. Part 3: Mentha × piperita L.-Solanum dulcamara L. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
-
Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi
2017-12-01
Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.
-
Directory of Open Access Journals (Sweden)
Ouyang Shu
2005-09-01
Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.
-
Intoxicação natural e experimental por Metternichia princeps (Solanaceae em caprinos
Directory of Open Access Journals (Sweden)
Juliana da Silva Prado
2012-09-01
Full Text Available Entre os anos de 2007 e 2009 ocorreu uma doença nefrotóxica de evolução subaguda com alta mortandade em caprinos em uma propriedade no município de Itaguaí, estado do Rio de Janeiro. Levantou-se a suspeita de que Metternichia princeps, planta pertencente à família Solanaceae, seria a causa. Através de experimentação em caprinos o quadro clínico-patológico de intoxicação por esta planta e a dose letal foram estabelecidos. Na experimentação foram utilizados 12 caprinos de diferentes raças, de ambos os sexos, jovens a adultos, com pesos acima de 15 kg. Os animais que receberam as doses de 30g/kg em 5 dias, 15g/kg em 3 dias, doses únicas de 10g/kg e de 5g/kg, morreram. Dos três animais que receberam as doses únicas de 2,5g/kg, dois morreram e um não apresentou sinais clínicos e o animal que recebeu a dose única de 1,25g/kg, também não apresentou sinais clínicos. O início dos sinais clínicos após a administração da planta variou entre 7h e 46h45min. A evolução variou entre 3h6min e 126h40min. Os primeiros sinais clínicos apresentados foram inapetência, adipsia, apatia e relutância ao movimento. Em seguida os animais entravam em decúbito esternal e ao serem colocados em estação, mantinham os membros anteriores flexionados, apoiavam apenas os posteriores no chão até evoluírem para flexão dos quatro membros e seguia-se o decúbito lateral. À necropsia destacaram-se o edema de tecido adiposo perirrenal, rins pálidos e, ao corte, com estriação esbranquiçada desde o córtex até a região medular. À histopatologia foi verificada acentuada necrose coagulativa das células epiteliais dos túbulos uriníferos. Comparativamente aos casos naturais, os caprinos intoxicados experimentalmente por M. princeps apresentaram quadro clínico-patológico semelhante. Desta maneira foi comprovado que Metternichia princeps é responsável pela doença nefrotóxica em caprinos no Rio de Janeiro; a menor dose que causou a
-
Zhang, Yanjie; Hu, Zongli; Chu, Guihua; Huang, Cheng; Tian, Shibing; Zhao, Zhiping; Chen, Guoping
2014-04-02
Eggplant (Solanum melongena L.) is an edible fruit vegetable cultivated and consumed worldwide. The purple eggplant is more eye-catching and popular for the health-promoting anthocyanins contained in the fruit skin. Two kinds of anthocyanin were separated and identified from purple cultivar (Zi Chang) by high-performance liquid chromatography-electrospray ionization tandem mass spectrometry. To investigate the molecular mechanisms of anthocyanin accumulation in eggplant, the transcripts of anthocyanin biosynthetic and regulatory genes were analyzed in the fruit skin and the flesh of the purple cultivar and the white cultivar (Bai Xue). Compared with the other tissues, SmMYB1 and all anthocyanin biosynthetic genes except PAL were dramatically upregulated in the fruit skin of the purple cultivar. Overexpression of SmMYB1 activated abundant anthocyanin accumulation in the regenerating shoots of eggplant. These results prove that transcriptional activation of SmMYB1 accounts for constitutive upregulation of most anthocyanin biosynthetic genes and the onset of anthocyanin biosynthesis in the purple cultivar.
-
Suwalsky, Mario; Ramírez, Patricia; Avello, Marcia; Villena, Fernando; Gallardo, María José; Barriga, Andrés; Manrique-Moreno, Marcela
2016-06-01
In order to gain insight into the molecular mechanism of the antioxidant properties of Solanum crispum, aqueous extracts of its leaves were assayed on human erythrocytes and molecular models of its membrane. Phenolics and alkaloids were detected by HPLC-MS. Scanning electron and defocusing microscopy showed that S. crispum changed erythrocytes from the normal shape to echinocytes. These results imply that molecules present in the aqueous extracts were located in the outer monolayer of the erythrocyte membrane. Dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylethanolamine (DMPE) were chosen as representative of phospholipid classes located in the outer and inner monolayers of the erythrocyte membrane, respectively. X-ray diffraction showed that S. crispum preferentially interacted with DMPC bilayers. Experiments regarding its antioxidant properties showed that S. crispum neutralized the oxidative capacity of HClO on DMPE bilayers; defocusing microscopy and hemolysis assays demonstrated the protective effect of S. crispum against the oxidant effects of HClO on human erythrocytes.
-
Directory of Open Access Journals (Sweden)
Hristina Kutinkova
2016-06-01
Full Text Available The Guatemalan moth (GTPM, Tecia solanivora Povolny (Lepidoptera: Gelechiidae, was first registered in Guatemala and most recently invaded and became a key pest of the potato, Solanum tuberosum L., in Central and South America. Larvae feed exclusively on potato tubers, in the field and in store. Tuber quality is much reduced and heavily infested tubers can no longer be used for human or animal consumption. Stocks can be totally destroyed in less than 3 months. The potato tuber moth (PTM, Phthorimaea operculella Zeller (Lepidoptera: Gelechiidae, is one of the most damaging pests of potatoes in field and storage and is generally of greatest importance in warmer climates. After pest detection, synthetic sex pheromones are principally used to monitor population levels and trigger applications of chemicals or other control methods. In this article we described our results for using pheromone traps Delta VI of the company of Trécé Inc. USA for monitoring of the both pests in a Carchi province in Zona 1 in Ecuador. We give conclusions and recommendation for using these pheromone traps for detection and monitoring of these very important pests on Solanaceae crops.
-
Dinesh, Diwakar Singh; Kumari, Seema; Kumar, Vijay; Das, Pradeep
2014-03-01
Use of chemical pesticides is the current method for controlling sandflies. However, resistance is being developed in sandflies against the insecticide of choice that is DDT (dichlorodiphenyl trichloroethane). Botanicals have potential to act as an alternative to chemical insecticides as the crude extracts and active molecules of some plants show insecticidal effect to sandflies. This will lead to safe, easy and environment friendly method for control of sandflies. Therefore, information regarding botanicals acting as alternative to chemical insecticide against sandflies assumes importance in the context of development of resistance to insecticides as well as to prevent environment from contamination. This review deals with some plants and their products having repellent and insecticidal effect to sandflies in India and abroad. Different methods of extraction and their bioassay on sandflies have been emphasized in the text. Various extracts of some plants like Ricinus communis (Euphorbiaceae), Solanum jasminoides (Solanaceae), Bougainvillea glabra (Nyctaginaceae), Capparis spinosa (Capparidaceae), Acalypha fruticosa (Euphorbiaceae) and Tagetes minuta (Asteraceae) had shown repellent/insecticidal effect on sandflies. This review will be useful in conducting the research work to find out botanicals of Indian context having insecticidal effect on sandflies.
-
Directory of Open Access Journals (Sweden)
Ana Paula Araújo da Cruz
2015-06-01
Full Text Available The aim of this study was to identify, by sediment pollen analysis, the plant species used as floral resources for the provisioning of brood cells in Centris (Hemisiella tarsata, in an area of Caatinga, within the municipality of Nova Soure, Bahia State, Brazil. The analysis of pollen contents from three brood cells revealed 11 pollen types, corresponding to four botanical families. Malpighiaceae was represented most, followed by Leguminosae, Ochnaceae, and Solanaceae, the latter two represented by just a single pollen type each. On the basis of the percentages in the samples, it was possible to infer that C. tarsata visited distinct plants, but intensified its pollen collection in species related to Aeschynomene martii and Solanum paniculatumpollen types, which are considered the most important pollen sources in the larval diet of this bee. In addition to the pollen sources, we have also recorded seven pollen types regarded as oil ones, all related to the Malpighiaceae family. The information about the resources for C. tarsata can be of great relevance, in view of the importance of these bees in the pollination of native flora.
-
Bossolini, Eligio; Klahre, Ulrich; Brandenburg, Anna; Reinhardt, Didier; Kuhlemeier, Cris
2011-04-01
Two linkage maps were constructed for the model plant Petunia. Mapping populations were obtained by crossing the wild species Petunia axillaris subsp. axillaris with Petunia inflata, and Petunia axillaris subsp. parodii with Petunia exserta. Both maps cover the seven chromosomes of Petunia, and span 970 centimorgans (cM) and 700 cM of the genomes, respectively. In total, 207 markers were mapped. Of these, 28 are multilocus amplified fragment length polymorphism (AFLP) markers and 179 are gene-derived markers. For the first time we report on the development and mapping of 83 Petunia microsatellites. The two maps retain the same marker order, but display significant differences of recombination frequencies at orthologous mapping intervals. A complex pattern of genomic rearrangements was detected with the related genome of tomato (Solanum lycopersicum), indicating that synteny between Petunia and other Solanaceae crops has been considerably disrupted. The newly developed markers will facilitate the genetic characterization of mutants and ecological studies on genetic diversity and speciation within the genus Petunia. The maps will provide a powerful tool to link genetic and genomic information and will be useful to support sequence assembly of the Petunia genome.
-
Infra-red thermography for high throughput field phenotyping in Solanum tuberosum.
Directory of Open Access Journals (Sweden)
Ankush Prashar
Full Text Available The rapid development of genomic technology has made high throughput genotyping widely accessible but the associated high throughput phenotyping is now the major limiting factor in genetic analysis of traits. This paper evaluates the use of thermal imaging for the high throughput field phenotyping of Solanum tuberosum for differences in stomatal behaviour. A large multi-replicated trial of a potato mapping population was used to investigate the consistency in genotypic rankings across different trials and across measurements made at different times of day and on different days. The results confirmed a high degree of consistency between the genotypic rankings based on relative canopy temperature on different occasions. Genotype discrimination was enhanced both through normalising data by expressing genotype temperatures as differences from image means and through the enhanced replication obtained by using overlapping images. A Monte Carlo simulation approach was used to confirm the magnitude of genotypic differences that it is possible to discriminate. The results showed a clear negative association between canopy temperature and final tuber yield for this population, when grown under ample moisture supply. We have therefore established infrared thermography as an easy, rapid and non-destructive screening method for evaluating large population trials for genetic analysis. We also envisage this approach as having great potential for evaluating plant response to stress under field conditions.
-
Somatic hybrid plants between Lycopersicon esculentum and Solanum lycopersicoides.
Handley, L W; Nickels, R L; Cameron, M W; Moore, P P; Sink, K C
1986-02-01
Leaf mesophyll protoplasts of Lycopersicon esculentum (2n=2x=24) were fused with suspension culture-derived protoplasts of Solanum lycopersicoides (2n=2x=24) and intergeneric somatic hybrid plants were regenerated following selective conditions. A two phase selection system was based on the inability of S. lycopersicoides protoplasts to divide in culture in modified medium 8E and the partial inhibition of L. esculentum protoplasts by the PEG/DMSO fusion solution. At the p-calli stage, putative hybrids were visually selected based on their hybrid vigor and lime-green coloration in contrast to slower growing parental calli characterized by a watery, whitish-brown coloration. Early identification of the eight hybrid plants studied was facilitated by isozyme analysis of leaf tissue samples taken from plants in vitro at the rooting stage. Regenerated plants growing in planting medium were further verified for hybridity by 5 isozymes marking 7 loci on 5 chromosomes in tomato. These included Skdh-1 mapped to chromosome 1 of tomato, Pgm-2 on chromosome 4, Got-2 and Got-3 on chromosome 7, Got-4 on chromosome 8, and Pgi-1 and Pgdh-2 both on chromosome 12. Fraction I protein small subunits further confirmed the hybrid nature of the plants with bands of both parents expressed in all hybrids. The parental chloroplasts could not be differentiated by the isoelectric points of the large subunit. Seven of the eight somatic hybrids had a chromosome number ranging from the expected 2n=4x=48 to 2n=68. Mixoploid root-tip cells containing 48, 53, 54 or 55 chromosomes for two of the hybrids were also observed.
-
Directory of Open Access Journals (Sweden)
Ramírez-Builes Víctor Hugo
2010-06-01
Full Text Available En un suelo derivado de cenizas volcánicas bien drenado y de alta fertilidad del municipio Ansermanuevo (zona cafetera de Colombia, en el cultivo de lulo (Solanum quitoense x S. hirtum se evaluaron tres fuentes orgánicas tipo bocashi, provenientes de los procesos de fermentación de pulpa de café, lombricompuesto y gallinaza y un tratamiento con fertilizante químico (10-30-10 más un testigo absoluto sin aplicación de fertilizantes. Se empleó un diseño experimental en bloques completos al azar con tres repeticiones, cada repetición estuvo constituida por 58 plantas. Las aplicaciones de materiales orgánicos mejoraron las características del suelo, estabilizando el pH, aumentando la capacidad de intercambio catiónico y la materia orgánica. En términos generales, el tratamiento de mejor desempeño fue el bocashi de gallinaza, con un promedio de cuajamiento de fruto de 38.3% y un mayor rendimiento (4.7 t/ha. Los bocashis de lombricompuesto y pulpa de café no fueron estadísticamente diferentes al tratamiento químico y todos los tratamientos fueron distintos (P < 0.05 al testigo, lo que demuestra la buena respuesta del cultivo de lulo a las aplicaciones de fuentes orgánicas.
-
Directory of Open Access Journals (Sweden)
Víctor Hugo Ramírez-Builes
2010-04-01
Full Text Available En un suelo derivado de cenizas volcánicas bien drenado y de alta fertilidad del municipio Ansermanuevo (zona cafetera de Colombia, en el cultivo de lulo (Solanum quitoense x S. hirtum se evaluaron tres fuentes orgánicas tipo bocashi, provenientes de los procesos de fermentación de pulpa de café, lombricompuesto y gallinaza y un tratamiento con fertilizante químico (10-30-10 más un testigo absoluto sin aplicación de fertilizantes. Se empleó un diseño experimental en bloques completos al azar con tres repeticiones, cada repetición estuvo constituida por 58 plantas. Las aplicaciones de materiales orgánicos mejoraron las características del suelo, estabilizando el pH, aumentando la capacidad de intercambio catiónico y la materia orgánica. En términos generales, el tratamiento de mejor desempeño fue el bocashi de gallinaza, con un promedio de cuajamiento de fruto de 38.3% y un mayor rendimiento (4.7 t/ha. Los bocashis de lombricompuesto y pulpa de café no fueron estadísticamente diferentes al tratamiento químico y todos los tratamientos fueron distintos (P < 0.05 al testigo, lo que demuestra la buena respuesta del cultivo de lulo a las aplicaciones de fuentes orgánicas.
-
Directory of Open Access Journals (Sweden)
A. A. Famuwagun
2017-01-01
Full Text Available Optimization of the yield, total phenolic content (TPC, and total antioxidant activities (TAA of polyphenol concentrates extracted from Solanum macrocarpon leaves was studied using response surface methodology. The process variables investigated included extraction temperature (30, 50, and 70°C, extraction time (2, 4, and 6 h, and dried leaf powder : water ratio (1 : 10, 1 : 20, and 1 : 30 w/v. Box–Behnken design resulted in 15 experimental runs. The results showed the following optimum extraction conditions: temperature, 49.05°C; extraction time, 243 min; leaf powder : water ratio, 1 : 22 w/v. The optimized extraction conditions gave polyphenol concentrate yield, TPC, and TAA values of 24.94%, 421.09 mg GAE/g, and 23.81 mg AAE/g, respectively. Results of the in vitro antioxidant activities of the polyphenol concentrate showed 2, 2-diphenyl-2-picrylhydrazyl hydrate, metal chelating ability, and ferric reducing ability values of 76.78%, 80.22%, and 56.46 mg AAE/g, respectively. The study concludes that the experimental values compared closely with the predicted values, which indicates suitability of the model employed for polyphenol extraction optimization from dried S. macrocarpon leaves.
-
Chemical-assisted phytoremediation of CD-PAHs contaminated soils using Solanum nigrum L.
Yang, Chuanjie; Zhou, Qixing; Wei, Shuhe; Hu, Yahu; Bao, Yanyu
2011-09-01
A well-characterized cadmium (Cd) hyperaccumulating plant Solanum nigrum was grown in Cd and polycyclic aromatic hydrocarbons (PAHs) co-contaminated soil that was repeatedly amended with chemicals, including EDTA, cysteine (CY), salicylic acid (Sa), and Tween 80 (TW80), to test individual and combined treatment effects on phytoremediation of Cd-PAHs contaminated soils. Plant growth was negatively affected by exogenous chemicals except for EDTA. S. nigrum could accumulate Cd in tissues without assistant chemicals, while there was no visible effect on the degradation of PAHs. Cysteine had significant effects on phytoextraction of Cd and the highest metal extraction ratio (1.27%) was observed in 0.9 mmol/kg CY treatment. Both salicylic acid and Tween 80 had stimulative effects on the degradation of PAHs and there was the maximal degradation rate (52.6%) of total PAHs while 0.9 mmol/kg Sa was applied. Furthermore, the combined treatment T(0.1EDTA+0.9CY+0.5TW80) and T(0.5EDTA+0.9CY+03Sa) could not only increase the accumulation of Cd in plant tissues, but also promote the degradation of PAHs. These results indicated that S. nigrum might be effective in phytoextracting Cd and enhancing the biodegradation of PAHs in the co-contaminated soils with assistant chemicals.
-
Bacillus effect on the germination and growth of tomato seedlings (Solanum lycopersicum L.
Directory of Open Access Journals (Sweden)
Teresa Cabra Cendales
2017-01-01
Full Text Available The capacity to solubilize phosphate and to produce indole compounds Indole Acetic Acid type, was evaluated in 15 strains isolated from castor bean lignocellulosic residues (Ricinus communis. To determine the solubilizing activity of phosphates a qualitative test by using Pikovskaya culture medium was employed and for the evaluation of the production of indole compounds (IAA a Salkowsky colorimetric analysis technique was applied. Among the microorganisms tested, the Bacillus pumilus GIBI 206 demonstrated capacity to solubilize phosphates and Bacillus subtilis GIBI 200 showed of capacity to solubilize phosphates and to produce Indoleacetic Acid (IAA. To determine the effect of the Bacillus subtilis strain on germination and growth promotion, tomato seeds (Solanum lycopersicum ‘Santa Clara’ were inoculated; the inoculation of the seeds along with the microorganism revealed statistically significant differences, during the germination stage compared to the control treatment. Nevertheless, it revealed a positive influence on the development of tomato plants, originating a significant increase on the mass and length of its stem and root. The results of this research offer the possibility of using the Bacillus subtilis as a growth promoter in tomato seedlings and in the formulation of bio-products.
-
Transformation of PRT6 RNAi construct into tomato (Solanum lycopersicum) cv. Micro-Tom
Suka, Intan Elya; Chew, Bee Lynn; Goh, Hoe-Han; Isa, Nurulhikma Md
2018-04-01
PROTEOLYSIS 6 plays major role in the N-end rule pathway as N-recognin which functions as E3 ligase enzyme. It mediates ubiquitin processes that lead to degradation of unstable substrate protein. The aim of the current study is to transform the PRT6 gene into tomato (Solanum lycopersicum) from the cultivar Micro-Tom and to investigate its function in regulating ripening in tomato fruits. The PRT6_RNAi construct was successfully transformed into Agrobacterium C58 via heat shock method and transformed into seven days old cotyledon explants. Factors affecting transformation efficiency such as co-cultivation time and type of plant growth regulator combination were evaluated. Results from this study found that pre-cultured cotyledons from seven days old seedlings incubated for 2 days in co-cultivation medium increased shoot regeneration. Plant growth hormones zeatin combine with auxin produced a higher number of callus formation but lower shoot proliferation and transformation frequency compared to treatments of single plant hormone in the selection medium. Polymerase chain reaction (PCR) was performed on the regenerated shoots to confirm the integration of PRT6 fragment into the genome of transgenic plants. Based on PCR analysis, all putative shoots were positive transformants.
-
Directory of Open Access Journals (Sweden)
Maraelys Morales González
2018-04-01
Full Text Available One of the most challenging problems of electrochemical therapy is the design and selection of suitable electrode array for cancer. The aim is to determine how two-dimensional spatial patterns of tissue damage, temperature, and pH induced in pieces of potato (Solanum tuberosum L., var. Mondial depend on electrode array with circular, elliptical, parabolic, and hyperbolic shape. The results show the similarity between the shapes of spatial patterns of tissue damage and electric field intensity, which, like temperature and pH take the same shape of electrode array. The adequate selection of suitable electrodes array requires an integrated analysis that involves, in a unified way, relevant information about the electrochemical process, which is essential to perform more efficiently way the therapeutic planning and the personalized therapy for patients with a cancerous tumor.
-
Srivastava, Mrinalini; Sharma, Swati; Misra, Pratibha
2016-05-01
Rauwolfia serpentina and Solanum khasianum are well-known medicinally important plants contained important alkaloids in their different parts. Elicitation of these alkaloids is important because of associated pharmaceutical properties. Targeted metabolites were ajmaline and ajmalicine in R. serpentina; solasodine and α-solanine in S. khasianum. Enhancement of secondary metabolites through biotic and abiotic elicitors in hairy root cultures of R. serpentina and S. khasianum. In this report, hairy root cultures of these two plants were established through Agrobacterium rhizogenes mediated transformation by optimizing various parameters as age of explants, duration of preculture, and co-cultivation period. NaCl was used as abiotic elicitors in these two plants. Cellulase from Aspergillus niger was used as biotic elicitor in S. khasianum and mannan from Saccharomyces cerevisiae was used in R. serpentina. First time we have reported the effect of biotic and abiotic elicitors on the production of important metabolites in hairy root cultures of these two plants. Ajmalicine production was stimulated up to 14.8-fold at 100 mM concentration of NaCl after 1 week of treatment. Ajmaline concentration was also increased 2.9-fold at 100 mg/l dose of mannan after 1 week. Solasodine content was enhanced up to 4.0-fold and 3.6-fold at 100 mM and 200 mM NaCl, respectively, after 6 days of treatments. This study explored the potential of the elicitation strategy in A. rhizogenes transformed cell cultures and this potential further used for commercial production of these pharmaceutically important secondary metabolites. Hairy roots of Rauwolfia serpentina were subjected to salt (abiotic stress) and mannan (biotic stress) treatment for 1 week. Ajmaline and ajmalicine secondary metabolites were quantified before and after stress treatmentAjmalicine yield was enhanced up to 14.8-fold at 100 mM concentration of NaCl. Ajmaline content was also stimulated 2.9-fold at 100 mg/l dose of mannan
-
International Nuclear Information System (INIS)
Wei Shuhe; Li Yunmeng; Zhou Qixing; Srivastava, Mrittunjai; Chiu Siuwai; Zhan Jie; Wu Zhijie; Sun Tieheng
2010-01-01
Phytoremediation is a cost-effective, simple and sustainable beneficiary technique to purify the polluted environment. Solanum nigrum L., a newly found cadmium (Cd) hyperaccumulator, has shown the potential to remediate Cd-contaminated soils. Present study investigated the effects of fertilizer amendments on the Cd uptake by S. nigrum. Chicken manure and urea are usual agricultural fertilizers and more environmental friendly. The results showed that Cd concentrations in shoots of S. nigrum were significantly decreased (p -1 ) in shoot biomass of S. nigrum were significantly increased (p < 0.05) due to increased shoot biomass. In addition, available Cd concentration in soil significantly decreased due to addition of chicken manure. Thus, urea might be a better fertilizer for strengthening phytoextraction rate of S. nigrum to Cd, and chicken manure may be a better fertilizer for phytostabilization.
-
DEFF Research Database (Denmark)
Gyetvai, Gabor; Sønderkær, Mads; Göbel, Ulrike
2012-01-01
of the compatible and incompatible interaction were captured by DeepSAGE analysis of 44 biological samples comprising five genotypes, differing only by the presence or absence of the R1 transgene, three infection time points and three biological replicates. 30.859 unique 21 base pair sequence tags were obtained......Late blight, caused by the oomycete Phytophthora infestans, is the most important disease of potato (Solanum tuberosum). Understanding the molecular basis of resistance and susceptibility to late blight is therefore highly relevant for developing resistant cultivars, either by marker...... interactions over the infection time course and between compatible and incompatible genotypes. Transcriptional changes were more numerous in compatible than in incompatible interactions. In contrast to incompatible interactions, transcriptional changes in the compatible interaction were observed predominantly...
-
DEFF Research Database (Denmark)
Shahnazari, Ali; Andersen, Mathias Neumann; Liu, Fulai
2008-01-01
Partial root zone drying (PRD) is a new water-saving irrigation strategy being tested in many crop species. Until now it has not been investigated in potatoes (Solanum tuberosum L.). A field experiment on sandy soil in Denmark was conducted under a mobile rainout shelter to study effects of two...... subsurface drip irrigation treatments ((1) Full Irrigation (FI) receiving 100% of evaporative demand; and (2) PRD receiving 70% water of FI) on potato yield, tuber size, leaf water relations and irrigation water use efficiency (IWUE). The PRD treatment was started just after the end of tuber initiation...... for two months during tuber bulking and maturing stage and was shifted from one side to the other side of the plants every 5-10 days when FI plants had used 20-25 mm. Compared to FI plants, stomatal conductance was generally lower in the PRD-treated plants, whereas leaf water potential tended to be lower...
-
Directory of Open Access Journals (Sweden)
Enio Nazaré de Oliveira Junior
2003-08-01
Full Text Available Neste trabalho estudaram-se os teores de alguns nutrientes da fruta-de-lobo (Solanum lycocarpum St. Hil. madura, comparando-os com os de outros frutos comestíveis, visando ao seu aproveitamento alimentar. Os frutos utilizados neste estudo foram colhidos de plantas nativas no município de Perdões, Minas Gerais, no estádio verde maturo e armazenados durante 18 dias à temperatura ambiente no Laboratório de Bioquímica do Departamento de Química da Universidade Federal de Lavras. As amostras foram preparadas do dia zero (dia da colheita ao 18° dia, com intervalos de 2 dias entre os estágios de amadurecimento. O delineamento experimental utilizado foi o inteiramente casualizado com 4 repetições de 3 frutos. Os frutos foram lavados com água destilada, descascados, tendo suas polpas picadas, congeladas em nitrogênio líquido e liofilizadas até massa constante. Os teores de açúcares solúveis totais e açúcares não-redutores aumentaram gradativamente com a diminuição dos teores de amido. Os teores de vitamina C também aumentaram gradativamente durante o amadurecimento. Os teores encontrados na fruta-de-lobo de vitamina C, açúcares solúveis totais, sacarose, fósforo e ferro, comparados aos de outros frutos como abacaxi, banana, laranja, manga e outros, são equivalentes ou superiores aos dos frutos em questão, podendo-se concluir que o fruto da lobeira representa mais uma alternativa como fonte desses nutrientes.The contents of some nutrients in ripe "fruta-de-lobo" (Solanum lycocarpum St. Hil. fruits were investigated and compared with those in other comestible fruits in order to estimate its alimentary utilization. The fruits utilized in this study were harvested from native plants in the rural perimeter of Perdões city, Minas Gerais State, in the stage of green maturation, and were stored during 18 days at room temperature in the Biochemistry Laboratory of the Department of Chemistry, UFLA. The samples were prepared from the
-
Pant, Gaurav; Nayak, Nitesh; Gyana Prasuna, R.
2013-10-01
The present investigation describes simple and effective method for synthesis of silver nanoparticles via green route. Solanum trilobatum Linn extract were prepared by both conventional and homogenization method. We optimized the production of silver nanoparticles under sunlight, microwave and room temperature. The best results were obtained with sunlight irradiation, exhibiting 15-20 nm silver nanoparticles having cubic and hexagonal shape. Biosynthesized nanoparticles were highly toxic to various bacterial strains tested. In this study we report antibacterial activity against various Gram negative ( Klebsiella pneumoniae, Vibrio cholerae and Salmonella typhi) and Gram positive ( Staphylococcus aureus, Bacillus cereus and Micrococcus luteus) bacterial strains. Screening was also performed for any antifungal properties of the nanoparticles against human pathogenic fungal strains ( Candida albicans and Candida parapsilosis). We also demonstrated that these nanoparticles when mixed with shampoo enhance the anti-dandruff effect against dandruff causing fungal pathogens ( Pityrosporum ovale and Pityrosporum folliculitis). The present study showed a simple, rapid and economical route to synthesize silver nanoparticles and their applications hence has a great potential in biomedical field.
-
International Nuclear Information System (INIS)
Jan, S.; Hamayun, M.
2016-01-01
The current work was designed to test the effect of sodium chloride on germination, seedling establishment, vegetative growth, yield, chemical contents and ionic composition of eggplant. The consequences of foliar application of ascorbic acid (AA) on mitigation of adverse effects of sodium chloride were also tested. The seeds of Solanum melongena were germinated using NaCl (60 mM, 100 mM) and ascorbic acid (100 and 200 mM). High levels of salinity significantly affected the seed germination and seedling fresh and dry weights. Plants grown under salinity stress with foliar application of ascorbic acid showed significant increase in germination percentage and seedlings growth as compare to control plants. Sodium chloride stress showed adverse effects on plant height, root length, number of leaves, leaf area, fresh and dry biomass, total chlorophyll, carbohydrates and proteins as compared to untreated plants. The relative water content, electrolyte leakage were increased and Na+ and K+ ions balance was disturbed in different plant parts. Ascorbic acid (100 and 200ppm) enhanced all the growth parameters affected adversely by sodium chloride stress. (author)
-
International Nuclear Information System (INIS)
Akamatsu, T.; Yoshida, M.; Shiga, T.
1990-01-01
Full text: In order to transfer the Fusarium resistant gene from the wild species into eggplants, asymmetric fusions were done between Solanum integrifolium and S. melongena. Protoplasts of S. melongena were isolated from hypocotyIes, and protoplasts of S. integrifolium were isolated from young leaves. Protoplasts of S. integrifolium were irradiated by soft x-rays (40-60kR), and fused with protoplasts of S. melongena by electric pulses. Fused protoplasts were cultured using TM-2 basal medium supplemented with 2,4-D (0.5 mg/l), NAA (0.35mg/l), and BA (2mg/l). After 30 days, calli of 1-2 mm in diameter were subcultured on agar medium supplemented with IAA (0.2mg/l) and Zeatin (4mg/l). After 15-30 days, shoots were regenerated from green calli. Regenerated plants were transplanted to the greenhouse and 382 plants were inoculated with Fusarium oxysporum. Thirty-two plants were resistant or tolerant, their chromosome numbers varied in the range of 35-42 (S. integrifolium, S. melongena 2n=2x=24). (author)
-
Directory of Open Access Journals (Sweden)
Isabel Alvarez G.
2009-07-01
Full Text Available Empleando papa pardo'pastusa (Solanum tuberosum como control, se determinó el contenido de Vitamina C total en la papa criolla, variedad Yema de Huevo (Solanum phureja, Juz et Buck y se evaluaron las pérdidas durante la cocción y el freído. Se utilizaron los métodos colorimétrico y densitométrico: el primero dio resultados altos debido a sustancias interferentes; el segundo reportó los siguientes valores: criolla 21 mg/100 g, pardo-pastusa 18 mg/100 g (para muestra fresca. Las pérdidas de Vitamina C de papa criolla con piel fueron durante la cocción {92°C durante 25' de 1 9 % y en el freído (175°C por 3' de 30%. También se analizaron los carotenos y xantofilas dando: carotenos en papa criolla, 1.5 mg/100 g, en pardo-pastusa 0.5 mg/100 g (muestra fresca y xantofilas en papa criolla 0.6 mg/100 g, en pardo-pastusa 0.13 mg/100 g. Se procesó en las siguientes formas no tradicionales: en harinas compuestas aceptadas por ios consumidores, en una sustitución del 2 0% con puré; frita en tajadas con piel y pasabocas de puré. El tiempo de vida fue para frita tres semanas a 16°C V más de una semana a 25°C; para pasabocas cinco semanas y media a 16 C y un mes a 30°C.
-
Directory of Open Access Journals (Sweden)
Ortiz Luz Yineth
2001-12-01
Full Text Available En Colombia, existen importantes áreas con amplio potencial
agrícola, las cuales presentan restricciones ambientales para su utilización durante determinadas épocas del año, a causa de las heladas que provocan las bajas temperaturas. Éste es el caso del Altiplano Cundiboyasence, en el cual el fenómeno en mención afecta, drásticamente, los cultivos hasta ocasionar disminución del rendimiento o perdidas totales. El presente trabajo tuvo como finalidad detectar la presencia de Acido Abscísico (ABA en las siguientes variedades de papa de la especie Solanum sp.: 'Capiro', 'Única', 'Chitagá', 'Morita', 'Pastusa', 'ICA-Zipa' y 'Nativa' (silvestre. El análisis se hizo en el estadio de prefloración bajo condiciones de temperatura ambiente (-20°C y expuestas a una simulación de helada (-4°C. Para la extracción de ABA, se recolectaron hojas del tercio superior de la planta y se sometieron a extracción Líquido-Líquido y, para su cuantificación, se utilizó el bioensayo de la inhibición del coleóptilo de trigo (Triticun tensa vulgare L., el cual se realizó por cromatografía de capa fina. Entre las variedades estudiadas, se obtuvieron dos grupos de respuesta: susceptibles y tolerantes, las cuales están asociadas con la posible ausencia o presencia de ABA. En las variedades 'ICA-Zipa' y 'Chitagá' no se detectó la presencia de ABA, como tampoco, se observó tolerancia a las bajas temperaturas. En las variedades 'Capiro', 'Pastusa', 'Nativa', 'Única' y 'Morita', se observó mayor tolerancia a las bajas temperaturas.
There are many important geographical areas in Colombia with a high agricultural potential. They have environmental
constrains, however, to be used in certain periods during the
year because of the low temperature. This happens in the
Cundiboyasence plateau, in which, this phenomenon affects
dramatically the growing of potato crops up to the point of
causing a decrease in production or -
International Nuclear Information System (INIS)
Abbasi, A.; Bilal, M.; Hussain, J.; Shah, M. M.; Hassan, A.
2016-01-01
Plant genetic transformation requires robust regeneration system. Plant growth regulators (PGRs) such as cytokinins (CKs) play a pivotal role in organogenesis; however, CKs are the most expensive PGRs. In the current study, an efficient yet economical protocol for regeneration of potato plant was developed. Stem inter-nodal and leaf explants were cultured on different regeneration media supplemented with varying concentration of different CKs such as kinetin and zeatin. Murashige- Skoog media added with zeatin (1, 1.5 mg/L) was designated as RZ1, RZ1.5, respectively or kinetin (1.5, 2 mg/L) was designated as RK1.5 and RK2, respectively, however, concentrations of other hormones such as NAA (1-Naphthaleneacetic acid) and GA3 (Gibberellic acid A3) were kept same. RZ1 and RZ1.5 gave significantly better Results as compared to RK-type media in all aspects studied such as callus initiation, days to first shoot emergence, number of shoots per explants. RZ1 medium was then selected as regeneration media for Agrobacterium-mediated transformation of potato plants with cyanobacterial phosphoenol pyruvate carboxylase gene, which provided multiple putative transformants on selection media. The transformants were further confirmed through PCR. The current protocol is found to be cost effective and efficient for the regeneration of Solanum tuberosum and can be successfully implied for the Agrobacterium-mediated transformation. (author)
-
Directory of Open Access Journals (Sweden)
Sinar David Granada García
2014-09-01
Full Text Available Microorganisms for biological control are capable of producing active compounds that inhibit the development of phytopathogens, constituting a promising tool toob tain active principles that could replace synthetic pesticides. This study evaluatedtheability of severalpotentialbiocontrol microorganismsto produce active extracellular metabolites. In vitro antagonistic capability of 50 bacterial isolates from rhizospheric soils of "criolla" potato (Solanum phureja was tested through dual culture in this plant with different plant pathogenic fungi and bacteria. Isolates that showed significantly higher antagonistic activity were fermented in liquid media and crude extracts from the supernatants had their biological activities assessed by optical density techniques. Inhibitory effecton tested pathogens was observed for concentrations between 0.5% and 1% of crude extracts. There was a correlation between the antimicrobial activity of extracts and the use of nutrient-rich media in bacteria fermentation. Using a bioguided method, a peptidic compound, active against Fusarium oxysporum, was obtained from the 7ANT04 strain (Pyrobaculum sp.. Analysis by nuclear magnetic resonance and liquid chromatography coupled to mass detector evidenced an 11-amino acid compound. Bioinformatic software using raw mass data confirmed the presence of a cyclic peptide conformed by 11 mostly non-standard amino acids.
-
Tu, Tieyao; Volis, Sergei; Dillon, Michael O; Sun, Hang; Wen, Jun
2010-12-01
The cosmopolitan Solanaceae contains 21 tribes and has the greatest diversity in South America. Hyoscyameae and Mandragoreae are the only tribes of this family distributed exclusively in Eurasia with two centers of diversity: the Mediterranean-Turanian (MT) region and the Tibetan Plateau (TP). In this study, we examined the origins and biogeographical diversifications of the two tribes based on the phylogenetic framework and chronogram inferred from a combined data set of six plastid DNA regions (the atpB gene, the ndhF gene, the rps16-trnK intergenic spacer, the rbcL gene, the trnC-psbM region and the psbA-trnH intergenic spacer) with two fossil calibration points. Our data suggest that Hyoscyameae and Mandragoreae each forms a monophyletic group independently derived from different New World lineages in the early Miocene. Phylogenetic relationships within both tribes are generally well resolved. All genera of Hyoscyameae are found to be monophyletic and they diversified in middle to late Miocene. At nearly the same time, Mandragoreae split into two clades, corresponding to the MT region and the TP region, respectively. Both the phylogenetic relationships and the estimated ages of Hyoscyameae and Mandragoreae support two independent dispersal events of their ancestors from the New World into Eurasia. After their arrivals in Eurasia, the two tribes diversified primarily in the MT region and in the TP region via multiple biogeographic processes including vicariance, dispersal, recolonization or being preserved as relicts, from the mid Miocene to the late Quaternary. Published by Elsevier Inc.
-
Lin, Chih-Hui; Sheu, Fuu; Lin, Hsin-Tang; Pan, Tzu-Ming
2010-02-24
Cucumber mosaic virus (CMV) has been identified as the causal agent of several disease epidemics in most countries of the world. Insect-mediated virus diseases, such as those caused by CMV, caused remarkable loss of tomato (Solanum lycopersicon) production in Taiwan. With expression of the CMV coat protein gene (Cmvcp) in a local popular tomato cultivar L4783, transgenic tomato line R8 has showed consistent CMV resistance through T(0) to T(8). In this report, the allergenicity of the CMV coat protein (CMV cp) expressed in transgenic tomato R8 was assessed by investigation of the expression of the transgene source of protein, sequence similarity with known allergens, and resistance to pepsin hydrolysis. There is no known account for either the CMV or its coat protein being an allergen. The result of a bioinformatic search also showed no significant homology between CMV cp and any known allergen. The pepsin-susceptible property of recombinant CMV cp was revealed by a simulated gastric fluid (SGF) assay. Following the most recent FAO/WHO decision tree, all results have indicated that CMV cp was a protein with low possibility to be an allergen and the transgenic tomato R8 should be considered as safe as its host.
-
Botina G., Bibiana; Velásquez I., ángel; Bacca, Tito; Castillo F., Jesús; Dias, Lucimar G.
2012-01-01
El objetivo de esta investigación fue evaluar la diversidad, abundancia y biomasa de la macrofauna en cuatro diferentes usos del suelo; cultivo de papa con labranza mínima, cultivo de papa con labranza tradicional, suelo desnudo y una pradera de kikuyo. Para evaluar la fauna fue utilizada la metodología del programa Tropical Soil Biology and Fertility (TSBF). La macrofauna del suelo fue identificada hasta nivel de orden y familia. La mayor abundancia y diversidad de macroinvertebrados fue enc...
-
Nicotine Analysis in Several Non-Tobacco Plant Materials
Directory of Open Access Journals (Sweden)
Moldoveanu Serban C.
2016-04-01
Full Text Available Present study describes the determination of nicotine in various plant samples with a low content of this compound. Nicotine is found naturally in plants from the Solanaceae family. The plants from Nicotiana genus contain large levels of nicotine. However, only low levels are present in plants from Solanum genus including potato, tomato, eggplant, and from Capsicum genus, which are used as food. Because the levels of nicotine in these materials are in the range of parts per billion, the measurements are difficult and the results are very different from study to study. The present study evaluated the level of nicotine in a number of plants (fruits, roots, leaves, tubers from Solanaceae family (not including Nicotiana genus and from several other vegetables commonly used as food. The analysis consisted of the treatment of plant material with an aqueous solution 5% NaOH at 70°C for 30 min, followed by extraction with TBME containing d3-nicotine as an internal standard. The TBME organic layer was analyzed on a 7890B/7000C GC-MS/MS system with a 30 m × 0.25 mm, 0.25 μm film CAM column. The MS/MS system worked in MRM positive ionization mode monitoring the transition 162 - 84 for nicotine and 165 - 87 for d3-nicotine. Particular attention was given to the preservation of the intact levels of nicotine in the plant material. The plant material was analyzed as is, without drying and with minimal exposure to contaminations. Separately, the moisture of the plant material was measured in order to report the nicotine level on a dry-basis. Levels of nicotine around 180 ng/g dry material were obtained for tomatoes and eggplant (fruit and lower levels were obtained for green pepper and potato. Similar levels to that in the tomato fruit were detected in tomato leaves. Materials from other plant families also showed traces of nicotine. [Beitr. Tabakforsch. Int. 27 (2016 54-59
-
Use of organic waste as biofumigant for controlling root knot nematodes (Meloidogyne spp.) on potato
Sari, D. I. P.; Lisnawita; Oemry, S.; Safni, I.; Lubis, K.; Tantawi, A. R.
2018-02-01
Root knot nematode (Meloidogyne spp.) is one of the important pathogens that causes big impact on potato crop yields. One of the control strategies for controlling this nematode is the use of biofumigants. Biofumigants are volatile toxic compound derived from plants, and have biocide properties against insects and plant pathogens. Organic waste such as Brassicaceae, Leguminoceae, and Solanaceae can be used as biofumigant sources. This research was conducted to determine the effectiveness of Brassicaceae, Leguminoceae, and Solanaceae as biofumigants against Meloidogyne spp. The experiment was set in a completely randomized design (CRD) with the treatments were organic wastes including Brassicaceae, Leguminoceae, and Solanaceae, both single and combinations, and 2 controls (positive and negative controls) with 3 replications. Each of the biofumigant treatments was prepared and stored for 2 weeks. Potato tubers were transplanted 15 days after germination into polybag inoculated with 1,000 Meloidogyne spp. J2s. The results showed that Brassicaceae + Solanaceae were effective in decreasing the number of galls in potato plants, however only Solanaceae improved plant growth.
-
Atherton, Daniel
Early detection of disease and insect infestation within crops and precise application of pesticides can help reduce potential production losses, reduce environmental risk, and reduce the cost of farming. The goal of this study was the advanced detection of early blight (Alternaria solani) in potato (Solanum tuberosum) plants using hyperspectral remote sensing data captured with a handheld spectroradiometer. Hyperspectral reflectance spectra were captured 10 times over five weeks from plants grown to the vegetative and tuber bulking growth stages. The spectra were analyzed using principal component analysis (PCA), spectral change (ratio) analysis, partial least squares (PLS), cluster analysis, and vegetative indices. PCA successfully distinguished more heavily diseased plants from healthy and minimally diseased plants using two principal components. Spectral change (ratio) analysis provided wavelengths (490-510, 640, 665-670, 690, 740-750, and 935 nm) most sensitive to early blight infection followed by ANOVA results indicating a highly significant difference (p potato plants.
-
Delgado Fernández, Ernesto; Vásquez Matute, Santiago
2010-01-01
La antracnosis, en el tomate de árbol (Solanum betaceum) conocida por nuestros agricultores como “ojo de pollo” se produce por un hongo del género Colletotrichum Sp. es una enfermedad que causa pérdidas incalculables, y hasta el momento su control, se hace mediante productos químicos, que en algunos casos son nocivos y atentan contra el medio ambiente. El uso de microorganismos como inhibidores del desarrollo de microorganismos fitopatógenos, se presenta como una alternativa para ...
-
Lagos Burbano, Tulio César; Andrade Díaz, Danita; Córdoba Figueroa, Mónica Eliana; Criollo Escobar, Hernando
2014-01-01
Se evaluaron los medios de cultivo Hussey-Stacey (A), Hendrix et al. (H), Atkinson et al. (AT) y mitad de Murashyge y Skoog (½MS) para la propagación in vitro de semillas y explantes de Solanum mammosum, S. marginatum, S. hirtum y S. umbellatum. En la fase de propagación sexual se evaluó el porcentaje de germinación, número de raíces, longitud de planta, días a formación de hojas y raíces, días a morfogénesis completa y materia seca. Se determinó el tipo de morfogénesis a través de callos, vá...
-
Silva Paz, Reynaldo Justino; Della Rocca, Patricia A.; Tisocco, Osvaldo D.; Mascheroni, Rodolfo Horacio
2016-01-01
El principal objetivo de este trabajo fue estudiar la cinética de deshidratación osmótica de papa (Solanum Tuberosum L.). Se comparó el ajuste de los datos experimentales con el modelo cinético fenomenológico y con el modelo de Azuara. Para ello, en cubos de 1 cm de arista se evaluó el efecto de la temperatura (30 ºC, 40 ºC y 50 ºC) sobre los coeficiente de difusión efectiva del agua y sólidos. Se determinó la pérdida de peso de agua y la ganancia de sólidos. Las mayores pérdidas de agua se o...
-
Directory of Open Access Journals (Sweden)
du Jardin P.
2008-01-01
Full Text Available Assessment methods of physiological age of potato seed tuber (Solanum tuberosum L.. The study of potato tuber ageing possesses both fundamental and applied interests. Because of potential economical impacts, numerous attempts have been made to develop reliable biophysical, physiological or biochemical markers of physiological age of seed tubers intended for vegetative multiplication. At the present time, biophysical markers do not meet this objective, the obtained results being contradictory or not very transposable. Some physiological markers seem well-suited but they are not predictive. The biochemical studies often focus on potato tuber developmental process or are undertaken without accurate physiological reference frame. After defining the main concepts, this study synthesizes and critically evaluates the different methods used to assess physiological age. An integrated research strategy based on existing data is finally proposed to study potato tuber ageing.
-
In vitro plant regeneration from leaf explants of Solanum pimpinellifolium L.
Directory of Open Access Journals (Sweden)
Shirley Valderrama-Alfaro
2011-01-01
Full Text Available Tomato is a species of agricultural importance. Besides, it is a source of vitamins, minerals and antioxidant compounds. Therefore it is essential to obtain varieties resistant to diseases. Solanum pimpinellifolium L. ‘Tomatillo wild’, one of the wild relatives of tomato, is considered multipurpose reservoir of genes. This characteristic must be exploited. In vitro plantlets from leaves of ‘wild tomatillo’ were regenerated with this objective. A system for in vitro germination of seeds obtained from ex vitro sources was created. The use of seed allowed obtaining adequate seedlings in a short time to start regeneration. Thein vitro response of explants was evaluated in four treatments. The Murashige and Skoog (MS basal culture medium supplemented with a-naphthaleneacetic acid (NAA and 6-benzyl aminopurine (BAP was used in different combinations. The higher percentage (30% of shoot induction was achieved with 0.1 mg l1 NAA / 1 mg l1 BAP. The presence of callus and roots was observed after seven days of culture in the combination treatment with 1 mg l1 NAA / 0.1 mg l1 BAP. Callus showed 1 or 2 adventitious shoots per explant after 30 days of culture and 3 to 6 shoots after seventy days. Furthermore, the presence of fully formed adventitious plantlets (shoot and root was observed after the fifth week of culture. Therefore, the best combination for in vitro regeneration is NAA 0.1 mg l1 / 1 mg l1 BAP. Keywords: auxin, cytokinins, indirect organogenesis
-
Directory of Open Access Journals (Sweden)
Ranjeet Singh
2013-01-01
Full Text Available The respiration rate and respiratory quotient of mature tomato (Solanum lycopersicum L. cv. ‘Himsona’ fruits harvested at the turning stage were determined under closed system at 5, 10, 15, 20, 25 and 35 °C (ambient temperatures. The rate of respiration was higher at the start of the experiment and gradually declined as the storage period prolonged, before becoming almost constant. The steady-state respiration rate for CO2 evolution were observed to be 14.35, 15.04,19.95, 21.7 and 20.3 ml/kg-h at 10 °C, 15 °C, 20 °C, 25 °C and 35 °C, respectively. The RQ values for tomato varied from 0.55 to 1.10 with time under the experimental conditions. The respiration rate at steady state based on carbon dioxide evolution and oxygen consumption in closed condition decreased by about 46 % and 73 %, respectively relative to initial respiration rate values at normal air atmosphere. The results suggest that the respiration rate of tomato increased with temperature and decrease with storage time.
-
Bracho, Geracimo E.; Whitaker, John R.
1990-01-01
Effect of several parameters on inhibition of potato (Solanum tuberosum) invertase by its endogenous proteinaceous inhibitor was determined using homogeneous preparations of both proteins. The inhibitor and invertase formed an inactive complex with an observed association rate constant at pH 4.70 and 37°C of 8.82 × 102 per molar per second and a dissociation rate constant of 3.3 × 10−3 per minute. The inhibitor appeared to bind to invertase in more than one step. Initial interaction (measured by loss of invertase activity) was rapid, relatively weak, readily reversible (Ki of 2 × 10−6 molar) and noncompetitive with substrate at pH 4.70. Initial interaction was probably followed by isomerization to a tighter (Ki of 6.23 × 10−8 molar) complex, which dissociated slowly with a half-time of 3.5 hour. Interaction between enzyme and inhibitor appeared to be of ionic character and essentially pH independent between pH 3.5 and 7.4. PMID:16667286
-
Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng
2016-05-01
Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.
-
Potato plants (Solanum tuberosum L.) are chloride-sensitive: Is this dogma valid?
Hütsch, Birgit W; Keipp, Katrin; Glaser, Ann-Kathrin; Schubert, Sven
2018-06-01
Chloride sensitivity of the potato (Solanum tuberosum L.) cultivars Marabel and Désirée was investigated in two pot experiments (soil/sand mixture and hydroponics). It was tested whether there are differential effects of KCl and K 2 SO 4 application on tuber yield and tuber quality, and whether both potato cultivars differ in their chloride sensitivity. Tuber yield, dry matter percentage of the tubers, starch concentration and starch yield were not significantly affected by potassium source (K 2 SO 4 or KCl). After exposure to salt stress in hydroponics (100 mmol L -1 NaCl, 50 mmol L -1 Na 2 SO 4 , 50 mmol L -1 CaCl 2 ) for 5 days, 3-week-old potato plants had significantly reduced shoot dry mass after NaCl and Na 2 SO 4 application. However, CaCl 2 treatment did not significantly affect shoot growth, although the chloride concentration reached 65 to 74 mg Cl - mg -1 dry matter, similar to the NaCl treatment. In contrast, growth reductions were closely related to sodium concentrations, thus plants suffered sodium toxicity and not chloride toxicity. Both potato cultivars are chloride-resistant and can be fertilised with KCl instead of K 2 SO 4 without the risk of depression in tuber yield or tuber quality. The statement that potatoes are chloride-sensitive and that chloride has negative effects on yield performance needs reconsideration. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
-
Campbell, Raymond; Pont, Simon D A; Morris, Jenny A; McKenzie, Gaynor; Sharma, Sanjeev Kumar; Hedley, Pete E; Ramsay, Gavin; Bryan, Glenn J; Taylor, Mark A
2014-09-01
Genome-wide QTL analysis of potato tuber carotenoid content was investigated in populations of Solanum tuberosum Group Phureja that segregate for flesh colour, revealing a novel major QTL on chromosome 9. The carotenoid content of edible plant storage organs is a key nutritional and quality trait. Although the structural genes that encode the biosynthetic enzymes are well characterised, much less is known about the factors that determine overall storage organ content. In this study, genome-wide QTL mapping, in concert with an efficient 'genetical genomics' analysis using bulked samples, has been employed to investigate the genetic architecture of potato tuber carotenoid content. Two diploid populations of Solanum tuberosum Group Phureja were genotyped (AFLP, SSR and DArT markers) and analysed for their tuber carotenoid content over two growing seasons. Common to both populations were QTL that explained relatively small proportions of the variation in constituent carotenoids and a major QTL on chromosome 3 explaining up to 71 % of the variation in carotenoid content. In one of the populations (01H15), a second major carotenoid QTL was identified on chromosome 9, explaining up to 20 % of the phenotypic variation. Whereas the major chromosome 3 QTL was likely to be due to an allele of a gene encoding β-carotene hydroxylase, no known carotenoid biosynthetic genes are located in the vicinity of the chromosome 9 QTL. A unique expression profiling strategy using phenotypically distinct bulks comprised individuals with similar carotenoid content provided further support for the QTL mapping to chromosome 9. This study shows the potential of using the potato genome sequence to link genetic maps to data arising from eQTL approaches to enhance the discovery of candidate genes underlying QTLs.
-
Directory of Open Access Journals (Sweden)
Mayra Janeth Esparza-Araiza
2015-12-01
Full Text Available Clavibacter michiganensis subsp. michiganensis (Cmm causes bacterial wilt and canker of tomato. Currently, no Solanum lycopersicum resistant varieties are commercially available, but some degree of Cmm resistance has been identified in Solanum peruvianum. Previous research showed up-regulation of a SUMO E2 conjugating enzyme (SCEI transcript in resistant S. peruvianum compared to susceptible S. lycopersicum following infection by Cmm. In order to test the role of SCEI in resistance to Cmm, a fragment of the gene from S. peruvianum was cloned into a novel virus-induced gene-silencing (VIGS vector based on the geminivirus Tomato Mottle Virus (ToMoV. Using biolistic inoculation, the ToMoV-based VIGS vector was shown to be effective in S. peruvianum by silencing the magnesium chelatase gene, which resulted in leaf bleaching. The ToMoV_SCEI construct resulted in approx. 61% silencing of SCEI in leaves of S. peruvianum as determined by quantitative RT-PCR. VIGS of SCEI in S. peruvianum resulted in unilateral wilting (15 dpi and subsequent death (20 dpi of the entire plant after Cmm inoculation, whereas empty vector-treated plants only showed wilting in the Cmm-inoculated leaf. SCEI-silenced plants also showed higher Cmm colonization with an average of 4.5 times more damaged tissue compared to the empty vector control plants. SCEI appears to play an important role in the innate immunity of S. peruvianum against Cmm, perhaps through the regulation of WRKY transcription factors, which may lead to expression of proteins involved in salicylic acid-dependent defense responses.
-
Osmotic Effect of Conditioning on Seeds of Tomato (Solanum Lycopersicum L. Santa Clara Variety
Directory of Open Access Journals (Sweden)
Brigitte Liliana Moreno Medina
2013-12-01
Full Text Available The tomato (Solanum lycopersicum L. is one of the most important vegetables in the world, taking into account its nutritional potential and high economic value. In this crop the quality of seed depends on various factors, one of which is its physiology, which is determined by a germination and viability test. Osmotic seed conditioning is reported to be a technique for improving the physiological quality through the uniformity of the germination percentage. For this reason, the objective of this research was to evaluate the osmotic conditioning on tomato seeds of the Santa Clara variety. Using treatments of four doses of potassium nitrate (0, 100, 200 and 400 mg L-1 , the seeds were imbibitioned for 24 hours in solution and then washed with distilled water. They were placed in petri dishes in random order with three replications for a total of 12 experimental units, consisting of 35 seeds. The method seeks to hydrate the seeds with a solution of given concentration and for a period of time, in order to activate the seed metabolism. The best result was obtained with the treatment of 200 mg L-1 of potassium nitrate, followed by 400 mg L-1 , represented by a lower TMG , lower and higher PG VMG.
-
Wang, Zemin; Zhang, Ning; Zhou, Xiangyan; Fan, Qiang; Si, Huaijun; Wang, Di
2015-04-01
Ethylene response factor (ERF) is a major subfamily of the AP2/ERF family and plays significant roles in the regulation of abiotic- and biotic-stress responses. ERF proteins can interact with the GCC-box cis-element and then initiate a transcriptional cascade activating downstream ethylene response and enhancing plant stress tolerance. In this research, we cloned five StERF genes from potato (Solanum tuberosum L.). The expressional analysis of StERF genes revealed that they showed tissue- or organ-specific expression patterns and the expression levels in leaf, stem, root, flower, and tuber were different. The assays of quantitative real-time polymerase chain reaction (qRT-PCR) and the reverse transcription-PCR (RT-PCR) showed that the expression of five StERF genes was regulated by ethephon, methyl jasmonate (MeJA), salt and drought stress. The result from the yeast one-hybrid experiment showed that five StERFs had trans-activation activity and could specifically bind to the GCC-box cis-elements. The StERFs responded to abiotic factors and hormones suggested that they possibly had diverse roles in stress and hormone regulation of potato. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Noeli Juarez Ferla
2002-12-01
Full Text Available This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the families Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species, was met in Morus spp. (Moraceae and Tabebuia spp. (Bignoniaceae; Phaseolus vulgaris (Papilionaceae; only one species of the mite was met in Campomanesia spp. (Myrtaceae, Phaseolus vulgaris (Papilionaceae and Rosa spp. (Rosaceae. In Alamanda spp.(Apocinaceae, Ficus spp. (Moraceae, Jacaranda mimosifolia (Bignoniaceae and Solanum spp. (Solanaceae were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.
-
International Nuclear Information System (INIS)
Medina Ruth; Reina Miriam; Herrera Edna; Avila Fabio Andres; Chaparro Omar; Cortes B, Rocio
2010-01-01
A preliminary checklist of the vascular flora of the Reserva Biologica Cachalu is presented. Cachalu is located on the western slope of the Eastern Andes (Encino - Santander), and represents a sample of the sub - Andean forest of the Colombian Andes. The material was collected over a period of seven months in 2007 and 2008. General collections were carried out through Cachalu, and in a permanent plot at an altitudinal range between 1800 and 2350 m. A total of 443 species, included in 257 genera, and 101 families were recorded. Angiosperms represent 96% of the vascular flora, while pteridophyta 3.5% and gymnosperms only 0.5%. The Rubiaceae family has the highest richness at the genus and species level (18/36), followed by Melastomataceae (13/30), Orchidaceae (13/25), Asteraceae (13/21) and Solanaceae (8/21). The genera Psychotria, Miconia, Solanum and Anthurium show the highest number of species. For each species, the catalog contains the scientific name, collections used, habit, and the altitudinal range. The affinities of the flora of Cachalu with similar forests at the Guantiva - La Rusia - Iguaque biological corridor are discussed. Additionally, species considered at any level of threat are pointed so that they may be prioritized in restoration and conservation programs.