DEFF Research Database (Denmark)
Meneau, Aurélie Y. B.; Olivier, Yoann; Backlund, Tomas
2016-01-01
In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld-effect tran......In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld......-effect transistor and CMS measurements as a function of temperature that in certain molecular semiconductors, such as solution-processible pentacene, charge carriers become trapped at low temperatures in environments in which the charges become highly localized on individual molecules, while in some other molecules...
Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.
2016-01-01
Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and
Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K
2014-12-01
The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.
Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık
2016-05-01
A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.
Influence of capture to excited states of multiply charged ion beams colliding with small molecules
International Nuclear Information System (INIS)
Montenegro, P; Monti, J M; Fojón, O A; Hanssen, J; Rivarola, R D
2015-01-01
Electron capture by multiply charged ions impacting on small molecules is theoretically investigated. Particular attention is paid to the case of biological targets. The interest is focused on the importance of the transition to excited final states which can play a dominant role on the total capture cross sections. Projectiles at intermediate and high collision energies are considered. Comparison with existing experimental data is shown. (paper)
Charge migration induced by attosecond pulses in bio-relevant molecules
International Nuclear Information System (INIS)
Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero
2016-01-01
After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)
Detecting and identifying small molecules in a nanopore flux capacitor
International Nuclear Information System (INIS)
Bearden, Samuel; Zhang, Guigen; McClure, Ethan
2016-01-01
A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)
International Nuclear Information System (INIS)
Talik, N.A.; Yeoh, K.H.; Ng, C.Y.B.; Tan, C.Y.; Yap, B.K.
2016-01-01
We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN 6 has been used for tandem OLED. • The improvement attributes to the lower V bi and larger ΔV L in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.
Energy Technology Data Exchange (ETDEWEB)
Talik, N.A., E-mail: azrina_talik@hotmail.com [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yeoh, K.H. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Centre for Photonics and Advanced Materials Research (CPR), Lee Kong Chian Faculty of Engineering and Science, University Tunku Abdul Rahman, 43000 Kajang, Selangor (Malaysia); Ng, C.Y.B. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Tan, C.Y. [Centre of Advanced Manufacturing & Material Processing (AMMP), Department of Mechanical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yap, B.K., E-mail: kbyap@uniten.edu.my [Centre of Microelectronic and Nano Engineering (CeMNE), College of Engineering, Universiti Tenaga Nasional, 43000 Kajang, Selangor (Malaysia)
2016-01-15
We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN{sub 6} has been used for tandem OLED. • The improvement attributes to the lower V{sub bi} and larger ΔV{sub L} in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.
Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures
Directory of Open Access Journals (Sweden)
Bohinc, K.
2014-03-01
Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.
Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay
2017-06-01
Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.
Interplay between efficiency and device architecture for small molecule organic solar cells.
Williams, Graeme; Sutty, Sibi; Aziz, Hany
2014-06-21
Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.
The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells
Gasparini, Nicola
2018-01-29
Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.
The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells
Gasparini, Nicola; Wadsworth, Andrew; Moser, Maximilian; Baran, Derya; McCulloch, Iain; Brabec, Christoph J.
2018-01-01
Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.
Alqahtani, Obaid; Babics, Maxime; Gorenflot, Julien; Savikhin, Victoria; Ferron, Thomas; Balawi, Ahmed H.; Paulke, Andreas; Kan, Zhipeng; Pope, Michael; Clulow, Andrew J.; Wolf, Jannic Sebastian; Burn, Paul L.; Gentle, Ian R.; Neher, Dieter; Toney, Michael F.; Laquai, Fré dé ric; Beaujuge, Pierre; Collins, Brian A.
2018-01-01
The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.
Alqahtani, Obaid
2018-03-25
The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.
Small molecule hydration energy and entropy from 3D-RISM
Johnson, J.; Case, D. A.; Yamazaki, T.; Gusarov, S.; Kovalenko, A.; Luchko, T.
2016-09-01
Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases.
Small molecule hydration energy and entropy from 3D-RISM
International Nuclear Information System (INIS)
Johnson, J; Case, D A; Yamazaki, T; Gusarov, S; Kovalenko, A; Luchko, T
2016-01-01
Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases. (paper)
Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST).
Entzian, Clemens; Schubert, Thomas
2016-03-15
Aptamers are potent and versatile binding molecules recognizing various classes of target molecules. Even challenging targets such as small molecules can be identified and bound by aptamers. Studying the interaction between aptamers and drugs, antibiotics or metabolites in detail is however difficult due to the lack of sophisticated analysis methods. Basic binding parameters of these small molecule-aptamer interactions such as binding affinity, stoichiometry and thermodynamics are elaborately to access using the state of the art technologies. The innovative MicroScale Thermophoresis (MST) is a novel, rapid and precise method to characterize these small molecule-aptamer interactions in solution at microliter scale. The technology is based on the movement of molecules through temperature gradients, a physical effect referred to as thermophoresis. The thermophoretic movement of a molecule depends - besides on its size - on charge and hydration shell. Upon the interaction of a small molecule and an aptamer, at least one of these parameters is altered, leading to a change in the movement behavior, which can be used to quantify molecular interactions independent of the size of the target molecule. The MST offers free choice of buffers, even measurements in complex bioliquids are possible. The dynamic affinity range covers the pM to mM range and is therefore perfectly suited to analyze small molecule-aptamer interactions. This section describes a protocol how quantitative binding parameters for aptamer-small molecule interactions can be obtained by MST. This is demonstrated by mapping down the binding site of the well-known ATP aptamer DH25.42 to a specific region at the adenine of the ATP molecule. Copyright © 2015 Elsevier Inc. All rights reserved.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
Buyukdagli, Sahin
2016-01-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...
Lee, Jaewon; Singh, Ranbir; Sin, Dong Hun; Kim, Heung Gyu; Song, Kyu Chan; Cho, Kilwon
2016-01-06
A new 3D nonfullerene small-molecule acceptor is reported. The 3D interlocking geometry of the small-molecule acceptor enables uniform molecular conformation and strong intermolecular connectivity, facilitating favorable nanoscale phase separation and electron charge transfer. By employing both a novel polymer donor and a nonfullerene small-molecule acceptor in the solution-processed organic solar cells, a high-power conversion efficiency of close to 6% is demonstrated. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Okuno, Kazuhiko
2007-04-01
Systematic cross section measurements for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions in low energy collisions with atoms and molecules have been performed continuously by the identical apparatus installed with an octo-pole ion beam guide (OPIG) since 1980 till 2004. Recently, all of accumulated cross section data for a hundred collision systems has been entered into CMOL and CHART of the NIFS atomic and molecular numerical database together with some related cross section data. In this present paper, complicated ion-molecule reactions in hydrogen systems are revealed and the brief outlines of specific properties in low energy charge transfer collisions of multiply charged ions with atoms and molecules are introduced. (author)
Paterson, Alexandra F.
2017-12-27
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.
2017-01-01
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
International Nuclear Information System (INIS)
Kim, Eunae; Yeom, Min Sun
2014-01-01
Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge
Optical Spectroscopy Of Charged Quantum Dot Molecules
Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2007-04-01
Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
International Nuclear Information System (INIS)
Bian, Tengfei; Autry, Joseph M.; Casemore, Denise; Li, Ji; Thomas, David D.; He, Gaohong; Xing, Chengguo
2016-01-01
We have developed a charge-mediated fusion method to reconstitute the sarco/endoplasmic reticulum Ca 2+ -ATPase (SERCA) in giant unilamellar vesicles (GUV). Intracellular Ca 2+ transport by SERCA controls key processes in human cells such as proliferation, signaling, and contraction. Small-molecule effectors of SERCA are urgently needed as therapeutics for Ca 2+ dysregulation in human diseases including cancer, diabetes, and heart failure. Here we report the development of a method for efficiently reconstituting SERCA in GUV, and we describe a streamlined protocol based on optimized parameters (e.g., lipid components, SERCA preparation, and activity assay requirements). ATP-dependent Ca 2+ transport by SERCA in single GUV was detected directly using confocal fluorescence microscopy with the Ca 2+ indicator Fluo-5F. The GUV reconstitution system was validated for functional screening of Ca 2+ transport using thapsigargin (TG), a small-molecule inhibitor of SERCA currently in clinical trials as a prostate cancer prodrug. The GUV system overcomes the problem of inhibitory Ca 2+ accumulation for SERCA in native and reconstituted small unilamellar vesicles (SUV). We propose that charge-mediated fusion provides a widely-applicable method for GUV reconstitution of clinically-important membrane transport proteins. We conclude that GUV reconstitution is a technological advancement for evaluating small-molecule effectors of SERCA.
Domain-based small molecule binding site annotation
Directory of Open Access Journals (Sweden)
Dumontier Michel
2006-03-01
Full Text Available Abstract Background Accurate small molecule binding site information for a protein can facilitate studies in drug docking, drug discovery and function prediction, but small molecule binding site protein sequence annotation is sparse. The Small Molecule Interaction Database (SMID, a database of protein domain-small molecule interactions, was created using structural data from the Protein Data Bank (PDB. More importantly it provides a means to predict small molecule binding sites on proteins with a known or unknown structure and unlike prior approaches, removes large numbers of false positive hits arising from transitive alignment errors, non-biologically significant small molecules and crystallographic conditions that overpredict ion binding sites. Description Using a set of co-crystallized protein-small molecule structures as a starting point, SMID interactions were generated by identifying protein domains that bind to small molecules, using NCBI's Reverse Position Specific BLAST (RPS-BLAST algorithm. SMID records are available for viewing at http://smid.blueprint.org. The SMID-BLAST tool provides accurate transitive annotation of small-molecule binding sites for proteins not found in the PDB. Given a protein sequence, SMID-BLAST identifies domains using RPS-BLAST and then lists potential small molecule ligands based on SMID records, as well as their aligned binding sites. A heuristic ligand score is calculated based on E-value, ligand residue identity and domain entropy to assign a level of confidence to hits found. SMID-BLAST predictions were validated against a set of 793 experimental small molecule interactions from the PDB, of which 472 (60% of predicted interactions identically matched the experimental small molecule and of these, 344 had greater than 80% of the binding site residues correctly identified. Further, we estimate that 45% of predictions which were not observed in the PDB validation set may be true positives. Conclusion By
Modulation and Control of Charge Transport Through Single-Molecule Junctions.
Wang, Kun; Xu, Bingqian
2017-02-01
The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge
International Nuclear Information System (INIS)
Sharma, G. D.
2011-01-01
Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm 2 has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.
Electrostrictive deformations in small carbon clusters, hydrocarbon molecules, and carbon nanotubes
International Nuclear Information System (INIS)
Cabria, I.; Lopez, M. J.; Alonso, J. A.; Amovilli, C.; March, N. H.
2006-01-01
The electrostrictive response of small carbon clusters, hydrocarbon molecules, and carbon nanotubes is investigated using the density functional theory. For ringlike carbon clusters, one can get insight on the deformations induced by an electric field from a simple two-dimensional model in which the positive charge of the carbon ions is smeared out in a circular homogeneous line of charge and the electronic density is calculated for a constant applied electric field within a two-dimensional Thomas-Fermi method. According to the Hellmann-Feynman theorem, this model predicts, for fields of about 1 V/A ring , only a small elongation of the ring clusters in the direction of the electric field. Full three-dimensional density functional calculations with an external electric field show similar small deformations in the ring carbon clusters compared to the simple model. The saturated benzene and phenanthrene hydrocarbon molecules do not experience any deformation, even under the action of relatively intense (1 V/A ring ) electric fields. In contrast, finite carbon nanotubes experience larger elongations (∼2.9%) induced by relatively weak (0.1 V/A ring ) applied electric fields. Both C-C bond length elongation and the deformation of the honeycomb structure contribute equally to the nanotube elongation. The effect of the electric field in hydrogen terminated nanotubes is reduced with respect to the nanotubes with dangling bonds in the edges
Velagapudi, Sai Pradeep; Luo, Yiling; Tran, Tuan; Haniff, Hafeez S; Nakai, Yoshio; Fallahi, Mohammad; Martinez, Gustavo J; Childs-Disney, Jessica L; Disney, Matthew D
2017-03-22
RNA drug targets are pervasive in cells, but methods to design small molecules that target them are sparse. Herein, we report a general approach to score the affinity and selectivity of RNA motif-small molecule interactions identified via selection. Named High Throughput Structure-Activity Relationships Through Sequencing (HiT-StARTS), HiT-StARTS is statistical in nature and compares input nucleic acid sequences to selected library members that bind a ligand via high throughput sequencing. The approach allowed facile definition of the fitness landscape of hundreds of thousands of RNA motif-small molecule binding partners. These results were mined against folded RNAs in the human transcriptome and identified an avid interaction between a small molecule and the Dicer nuclease-processing site in the oncogenic microRNA (miR)-18a hairpin precursor, which is a member of the miR-17-92 cluster. Application of the small molecule, Targapremir-18a, to prostate cancer cells inhibited production of miR-18a from the cluster, de-repressed serine/threonine protein kinase 4 protein (STK4), and triggered apoptosis. Profiling the cellular targets of Targapremir-18a via Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP), a covalent small molecule-RNA cellular profiling approach, and other studies showed specific binding of the compound to the miR-18a precursor, revealing broadly applicable factors that govern small molecule drugging of noncoding RNAs.
Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery
2007-07-01
Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can
Influence of Electrostatics on Small Molecule Flux through a Protein Nanoreactor.
Glasgow, Jeff E; Asensio, Michael A; Jakobson, Christopher M; Francis, Matthew B; Tullman-Ercek, Danielle
2015-09-18
Nature uses protein compartmentalization to great effect for control over enzymatic pathways, and the strategy has great promise for synthetic biology. In particular, encapsulation in nanometer-sized containers to create nanoreactors has the potential to elicit interesting, unexplored effects resulting from deviations from well-understood bulk processes. Self-assembled protein shells for encapsulation are especially desirable for their uniform structures and ease of perturbation through genetic mutation. Here, we use the MS2 capsid, a well-defined porous 27 nm protein shell, as an enzymatic nanoreactor to explore pore-structure effects on substrate and product flux during the catalyzed reaction. Our results suggest that the shell can influence the enzymatic reaction based on charge repulsion between small molecules and point mutations around the pore structure. These findings also lend support to the hypothesis that protein compartments modulate the transport of small molecules and thus influence metabolic reactions and catalysis in vitro.
Directory of Open Access Journals (Sweden)
Oleg Meshcheryakov
2010-01-01
Full Text Available In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles by electrostatically accelerated polar water vapour molecules rather than nonaccelerated nonpolar oxygen gas molecules. Intense electrostatic hydration of charged combustible nanoparticles converts the nanoparticle's oxide-based shells into the hydroxide-based electrolyte shells, transforming these nanoparticles into reductant/air core-shell nanobatteries, periodically short-circuited by intraparticle field and thermionic emission. Partially synchronized electron emission breakdowns within trillions of nanoparticles-nanobatteries turn a cloud of charged nanoparticles-nanobatteries into a powerful radiofrequency aerosol generator. Electrostatic oxidative hydration and charge-catalyzed oxidation of charged combustible nanoparticles also contribute to a self-oscillating thermocycling process of evolution and periodic autoignition of inflammable gases near to the nanoparticle's surface. The described effects might be of interest for the improvement of certain nanotechnological heterophase processes and to better understand ball lightning phenomenon.
Nonexistence in Thomas-Fermi-Dirac-von Weizsäcker Theory with Small Nuclear Charges
Energy Technology Data Exchange (ETDEWEB)
Nam, Phan Thành, E-mail: pnam@ist.ac.at [Institute of Science and Technology Austria (Austria); Den Bosch, Hanne Van, E-mail: hannevdbosch@fis.puc.cl [Pontificia Universidad Católica de Chile, Instituto de Física (Chile)
2017-06-15
We study the ionization problem in the Thomas-Fermi-Dirac-von Weizsäcker theory for atoms and molecules. We prove the nonexistence of minimizers for the energy functional when the number of electrons is large and the total nuclear charge is small. This nonexistence result also applies to external potentials decaying faster than the Coulomb potential. In the case of arbitrary nuclear charges, we obtain the nonexistence of stable minimizers and radial minimizers.
Recent advances in developing small molecules targeting RNA.
Guan, Lirui; Disney, Matthew D
2012-01-20
RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.
Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep
2010-01-01
We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than
Park, Miso; Cella, Lakshmi N; Chen, Wilfred; Myung, Nosang V; Mulchandani, Ashok
2010-12-15
In recent years, there has been a growing focus on use of one-dimensional (1-D) nanostructures, such as carbon nanotubes and nanowires, as transducer elements for label-free chemiresistive/field-effect transistor biosensors as they provide label-free and high sensitivity detection. While research to-date has elucidated the power of carbon nanotubes- and other 1-D nanostructure-based field effect transistors immunosensors for large charged macromolecules such as proteins and viruses, their application to small uncharged or charged molecules has not been demonstrated. In this paper we report a single-walled carbon nanotubes (SWNTs)-based chemiresistive immunosensor for label-free, rapid, sensitive and selective detection of 2,4,6-trinitrotoluene (TNT), a small molecule. The newly developed immunosensor employed a displacement mode/format in which SWNTs network forming conduction channel of the sensor was first modified with trinitrophenyl (TNP), an analog of TNT, and then ligated with the anti-TNP single chain antibody. Upon exposure to TNT or its derivatives the bound antibodies were displaced producing a large change, several folds higher than the noise, in the resistance/conductance of SWNTs giving excellent limit of detection, sensitivity and selectivity. The sensor detected between 0.5 ppb and 5000 ppb TNT with good selectivity to other nitroaromatic explosives and demonstrated good accuracy for monitoring TNT in untreated environmental water matrix. We believe this new displacement format can be easily generalized to other one-dimensional nanostructure-based chemiresistive immuno/affinity-sensors for detecting small and/or uncharged molecules of interest in environmental monitoring and health care. Copyright © 2010 Elsevier B.V. All rights reserved.
Mapping the Small Molecule Interactome by Mass Spectrometry.
Flaxman, Hope A; Woo, Christina M
2018-01-16
Mapping small molecule interactions throughout the proteome provides the critical structural basis for functional analysis of their impact on biochemistry. However, translation of mass spectrometry-based proteomics methods to directly profile the interaction between a small molecule and the whole proteome is challenging because of the substoichiometric nature of many interactions, the diversity of covalent and noncovalent interactions involved, and the subsequent computational complexity associated with their spectral assignment. Recent advances in chemical proteomics have begun fill this gap to provide a structural basis for the breadth of small molecule-protein interactions in the whole proteome. Innovations enabling direct characterization of the small molecule interactome include faster, more sensitive instrumentation coupled to chemical conjugation, enrichment, and labeling methods that facilitate detection and assignment. These methods have started to measure molecular interaction hotspots due to inherent differences in local amino acid reactivity and binding affinity throughout the proteome. Measurement of the small molecule interactome is producing structural insights and methods for probing and engineering protein biochemistry. Direct structural characterization of the small molecule interactome is a rapidly emerging area pushing new frontiers in biochemistry at the interface of small molecules and the proteome.
Potential of Nonfullerene Small Molecules with High Photovoltaic Performance.
Li, Wanning; Yao, Huifeng; Zhang, Hao; Li, Sunsun; Hou, Jianhui
2017-09-05
Over the past decades, fullerene derivatives have become the most successful electron acceptors in organic solar cells (OSCs) and have achieved great progress, with power conversion efficiencies (PCEs) of over 11 %. However, fullerenes have some drawbacks, such as weak absorption, limited energy-level tunability, and morphological instability. In addition, fullerene-based OSCs usually suffer from large energy losses of over 0.7 eV, which limits further improvements in the PCE. Recently, nonfullerene small molecules have emerged as promising electron acceptors in OSCs. Their highly tunable absorption spectra and molecular energy levels have enabled fine optimization of the resulting devices, and the highest PCE has surpassed 12 %. Furthermore, several studies have shown that OSCs based on small-molecule acceptors (SMA) have very efficient charge generation and transport efficiency at relatively low energy losses of below 0.6 eV, which suggests great potential for the further improvement of OSCs. In this focus review, we analyze the challenges and potential of SMA-based OSCs and discuss molecular design strategies for highly efficient SMAs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Facilities for small-molecule crystallography at synchrotron sources.
Barnett, Sarah A; Nowell, Harriott; Warren, Mark R; Wilcox, Andrian; Allan, David R
2016-01-01
Although macromolecular crystallography is a widely supported technique at synchrotron radiation facilities throughout the world, there are, in comparison, only very few beamlines dedicated to small-molecule crystallography. This limited provision is despite the increasing demand for beamtime from the chemical crystallography community and the ever greater overlap between systems that can be classed as either small macromolecules or large small molecules. In this article, a very brief overview of beamlines that support small-molecule single-crystal diffraction techniques will be given along with a more detailed description of beamline I19, a dedicated facility for small-molecule crystallography at Diamond Light Source.
Toward Generalization of Iterative Small Molecule Synthesis.
Lehmann, Jonathan W; Blair, Daniel J; Burke, Martin D
2018-02-01
Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the "building block approach", i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach.
Toward Generalization of Iterative Small Molecule Synthesis
Lehmann, Jonathan W.; Blair, Daniel J.; Burke, Martin D.
2018-01-01
Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the “building block approach”, i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach. PMID:29696152
International Nuclear Information System (INIS)
Hedegard, Per; Bjornholm, Thomas
2005-01-01
The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond
Protein Scaffolding for Small Molecule Catalysts
Energy Technology Data Exchange (ETDEWEB)
Baker, David [Univ. of Washington, Seattle, WA (United States)
2014-09-14
We aim to design hybrid catalysts for energy production and storage that combine the high specificity, affinity, and tunability of proteins with the potent chemical reactivities of small organometallic molecules. The widely used Rosetta and RosettaDesign methodologies will be extended to model novel protein / small molecule catalysts in which one or many small molecule active centers are supported and coordinated by protein scaffolding. The promise of such hybrid molecular systems will be demonstrated with the nickel-phosphine hydrogenase of DuBois et. al.We will enhance the hydrogenase activity of the catalyst by designing protein scaffolds that incorporate proton relays and systematically modulate the local environment of the catalyticcenter. In collaboration with DuBois and Shaw, the designs will be experimentally synthesized and characterized.
Mezey, Paul G.
2017-11-01
Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.
Strategy to discover diverse optimal molecules in the small molecule universe.
Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N
2015-03-23
The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.
Small molecule probes for cellular death machines.
Li, Ying; Qian, Lihui; Yuan, Junying
2017-08-01
The past decade has witnessed a significant expansion of our understanding about the regulated cell death mechanisms beyond apoptosis. The application of chemical biological approaches had played a major role in driving these exciting discoveries. The discovery and use of small molecule probes in cell death research has not only revealed significant insights into the regulatory mechanism of cell death but also provided new drug targets and lead drug candidates for developing therapeutics of human diseases with huge unmet need. Here, we provide an overview of small molecule modulators for necroptosis and ferroptosis, two non-apoptotic cell death mechanisms, and discuss the molecular pathways and relevant pathophysiological mechanisms revealed by the judicial applications of such small molecule probes. We suggest that the development and applications of small molecule probes for non-apoptotic cell death mechanisms provide an outstanding example showcasing the power of chemical biology in exploring novel biological mechanisms. Copyright © 2017 Elsevier Ltd. All rights reserved.
Highly parallel translation of DNA sequences into small molecules.
Directory of Open Access Journals (Sweden)
Rebecca M Weisinger
Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.
Guerrero, Antonio; Loser, Stephen; Garcia-Belmonte, Germà; Bruns, Carson J; Smith, Jeremy; Miyauchi, Hiroyuki; Stupp, Samuel I; Bisquert, Juan; Marks, Tobin J
2013-10-21
Using impedance spectroscopy, we demonstrate that the low fill factor (FF) typically observed in small molecule solar cells is due to hindered carrier transport through the active layer and hindered charge transfer through the anode interfacial layer (IFL). By carefully tuning the active layer thickness and anode IFL in BDT(TDPP)2 solar cells, the FF is increased from 33 to 55% and the PCE from 1.9 to 3.8%. These results underscore the importance of simultaneously optimizing active layer thickness and IFL in small molecule solar cells.
RNA as a small molecule druggable target.
Rizvi, Noreen F; Smith, Graham F
2017-12-01
Small molecule drugs have readily been developed against many proteins in the human proteome, but RNA has remained an elusive target for drug discovery. Increasingly, we see that RNA, and to a lesser extent DNA elements, show a persistent tertiary structure responsible for many diverse and complex cellular functions. In this digest, we have summarized recent advances in screening approaches for RNA targets and outlined the discovery of novel, drug-like small molecules against RNA targets from various classes and therapeutic areas. The link of structure, function, and small-molecule Druggability validates now for the first time that RNA can be the targets of therapeutic agents. Copyright © 2017 Elsevier Ltd. All rights reserved.
Small molecule annotation for the Protein Data Bank.
Sen, Sanchayita; Young, Jasmine; Berrisford, John M; Chen, Minyu; Conroy, Matthew J; Dutta, Shuchismita; Di Costanzo, Luigi; Gao, Guanghua; Ghosh, Sutapa; Hudson, Brian P; Igarashi, Reiko; Kengaku, Yumiko; Liang, Yuhe; Peisach, Ezra; Persikova, Irina; Mukhopadhyay, Abhik; Narayanan, Buvaneswari Coimbatore; Sahni, Gaurav; Sato, Junko; Sekharan, Monica; Shao, Chenghua; Tan, Lihua; Zhuravleva, Marina A
2014-01-01
The Protein Data Bank (PDB) is the single global repository for three-dimensional structures of biological macromolecules and their complexes, and its more than 100,000 structures contain more than 20,000 distinct ligands or small molecules bound to proteins and nucleic acids. Information about these small molecules and their interactions with proteins and nucleic acids is crucial for our understanding of biochemical processes and vital for structure-based drug design. Small molecules present in a deposited structure may be attached to a polymer or may occur as a separate, non-covalently linked ligand. During curation of a newly deposited structure by wwPDB annotation staff, each molecule is cross-referenced to the PDB Chemical Component Dictionary (CCD). If the molecule is new to the PDB, a dictionary description is created for it. The information about all small molecule components found in the PDB is distributed via the ftp archive as an external reference file. Small molecule annotation in the PDB also includes information about ligand-binding sites and about covalent and other linkages between ligands and macromolecules. During the remediation of the peptide-like antibiotics and inhibitors present in the PDB archive in 2011, it became clear that additional annotation was required for consistent representation of these molecules, which are quite often composed of several sequential subcomponents including modified amino acids and other chemical groups. The connectivity information of the modified amino acids is necessary for correct representation of these biologically interesting molecules. The combined information is made available via a new resource called the Biologically Interesting molecules Reference Dictionary, which is complementary to the CCD and is now routinely used for annotation of peptide-like antibiotics and inhibitors. © The Author(s) 2014. Published by Oxford University Press.
Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2008-01-01
The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)
Large tunable image-charge effects in single-molecule junctions.
Perrin, M.L.; Verzijl, C.J.; Martin, C.A.; Shaikh, A.J.; Eelkema, R.; Esch, J.H. van; Ruitenbeek, J.M. van; Thijssen, J.M.; Zant, H.S. van der; Dulic, D.
2013-01-01
Metal/organic interfaces critically determine the characteristics of molecular electronic devices, because they influence the arrangement of the orbital levels that participate in charge transport. Studies on self-assembled monolayers show molecule-dependent energy-level shifts as well as
Small Molecule PET-Radiopharmaceuticals
Elsinga, Philip H.; Dierckx, Rudi A. J. O.
This review describes several aspects required for the development of small molecule PET-tracers. Design and selection criteria are important to consider before starting to develop novel PET-tracers. Principles and latest trends in C-11 and F-18-radiochemistry are summarized. In addition an update
Energy Technology Data Exchange (ETDEWEB)
Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)
2014-11-16
Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an
A series of dithienobenzodithiophene based small molecules for highly efficient organic solar cells
Institute of Scientific and Technical Information of China (English)
Huanran Feng; Miaomiao Li; Wang Ni; Bin Kan; Yunchuang Wang; Yamin Zhang; Hongtao Zhang; Xiangjian Wan; Yongsheng Chen
2017-01-01
Three acceptor-donor-acceptor(A-D-A) small molecules DCAODTBDT,DRDTBDT and DTBDTBDT using dithieno[2,3-d:2’,3’-d’]benzo[l,2-b:4,5-b’]dithiophene as the central building block,octyl cyanoacetate,3-octylrhodanine and thiobarbituric acid as the end groups were designed and synthesized as donor materials in solution-processed photovoltaic cells(OPVs).The impacts of these different electron withdrawing end groups on the photophysical properties,energy levels,charge carrier mobility,morphologies of blend films,and their photovoltaic properties have been systematically investigated.OPVs device based on DRDTBDT gave the best power conversion efficiency(PCE) of 8.34%,which was significantly higher than that based on DCAODTBDT(4.83%) or DTBDTBDT(3.39%).These results indicate that rather dedicated and balanced consideration of absorption,energy levels,morphology,mobility,etc.for the design of small-molecule-based OPVs(SM-OPVs)and systematic investigations are highly needed to achieve high performance for SM-OPVs.
A series of dithienobenzodithiophene based small molecules for highly efficient organic solar cells
Institute of Scientific and Technical Information of China (English)
Huanran Feng; Miaomiao Li; Wang Ni; Bin Kan; Yunchuang Wang; Yamin Zhang; Hongtao Zhang; Xiangjian Wan; Yongsheng Chen
2017-01-01
Three acceptor-donor-acceptor (A-D-A) small molecules DCAODTBDT,DRDTBDT and DTBDTBDT using dithieno[2,3-d∶2',3'-d']benzo[1,2-b∶4,5-b']dithiophene as the central building block,octyl cyanoacetate,3-octylrhodanine and thiobarbituric acid as the end groups were designed and synthesized as donor materials in solution-processed photovoltaic cells (OPVs).The impacts of these different electron withdrawing end groups on the photophysical properties,energy levels,charge carrier mobility,morphologies of blend films,and their photovoltaic properties have been systematically investigated.OPVs device based on DRDTBDT gave the best power conversion efficiency (PCE) of 8.34%,which was significantly higher than that based on DCAODTBDT (4.83%) or DTBDTBDT (3.39%).These results indicate that rather dedicated and balanced consideration of absorption,energy levels,morphology,mobility,etc.for the design of small-molecule-based OPVs (SM-OPVs) and systematic investigations are highly needed to achieve high performance for SM-OPVs.
Global analysis of small molecule binding to related protein targets.
Directory of Open Access Journals (Sweden)
Felix A Kruger
2012-01-01
Full Text Available We report on the integration of pharmacological data and homology information for a large scale analysis of small molecule binding to related targets. Differences in small molecule binding have been assessed for curated pairs of human to rat orthologs and also for recently diverged human paralogs. Our analysis shows that in general, small molecule binding is conserved for pairs of human to rat orthologs. Using statistical tests, we identified a small number of cases where small molecule binding is different between human and rat, some of which had previously been reported in the literature. Knowledge of species specific pharmacology can be advantageous for drug discovery, where rats are frequently used as a model system. For human paralogs, we demonstrate a global correlation between sequence identity and the binding of small molecules with equivalent affinity. Our findings provide an initial general model relating small molecule binding and sequence divergence, containing the foundations for a general model to anticipate and predict within-target-family selectivity.
Warwick, C. N.; Venkateshvaran, D.; Sirringhaus, H.
2015-09-01
We present measurements of the Seebeck coefficient in two high mobility organic small molecules, 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) and 2,9-didecyl-dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (C10-DNTT). The measurements are performed in a field effect transistor structure with high field effect mobilities of approximately 3 cm2/V s. This allows us to observe both the charge concentration and temperature dependence of the Seebeck coefficient. We find a strong logarithmic dependence upon charge concentration and a temperature dependence within the measurement uncertainty. Despite performing the measurements on highly polycrystalline evaporated films, we see an agreement in the Seebeck coefficient with modelled values from Shi et al. [Chem. Mater. 26, 2669 (2014)] at high charge concentrations. We attribute deviations from the model at lower charge concentrations to charge trapping.
Small-Molecule Compounds Exhibiting Target-Mediated Drug Disposition (TMDD): A Minireview.
An, Guohua
2017-02-01
Nonlinearities are commonplace in pharmacokinetics, and 1 special source is the saturable binding of the drug to a high-affinity, low-capacity target, a phenomenon known as target-mediated drug disposition (TMDD). Compared with large-molecule compounds undergoing TMDD, which has been well recognized due to its high prevalence, TMDD in small-molecule compounds is more counterintuitive and has not been well appreciated. With more and more potent small-molecule drugs acting on highly specific targets being developed as well as increasingly sensitive analytical techniques becoming available, many small-molecule compounds have recently been reported to have nonlinear pharmacokinetics imparted by TMDD. To expand our current knowledge of TMDD in small-molecule compounds and increase the awareness of this clinically important phenomenon, this minireview provides an overview of the small-molecule compounds that demonstrate nonlinear pharmacokinetics imparted by TMDD. The present review also summarizes the general features of TMDD in small-molecule compounds and highlights the differences between TMDD in small-molecule compounds and large-molecule compounds. © 2016, The American College of Clinical Pharmacology.
The effect of the charge density on the dipole moment of diatomic molecules
International Nuclear Information System (INIS)
Rosato, A.; Germano, J.S.E.
1986-01-01
The results of the calculation, using the Variational Cellular Method (VCM), of the electric dipole moment of several diatomic molecules are improved. In previous calculations, the electronic charge density was treated like a spherically symmetric function in the inscribed sphere within each cell and as being the same constant value for all intercellular regions. Since the results obtained with such an approximation have not been satisfactory, an improved approximation for the charge density in the intercellular regions is needed. It is considered that the charge density is still constant outside the inscribed sphere but with different values in each intercellular region. A new expression for the dipole moment is obtained, and applied to the diatomic molecules HF, CO, BF and CS. In addition, the corresponding dipole moment curves, potential energy curves and spectroscopic constants are calculated taking into consideration our approximation and the traditional approximation for the charge density. The results of the two models are compared with each other and with experimental results for all the molecules considered. (Author) [pt
Directory of Open Access Journals (Sweden)
C. N. Warwick
2015-09-01
Full Text Available We present measurements of the Seebeck coefficient in two high mobility organic small molecules, 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT and 2,9-didecyl-dinaphtho[2,3-b:2′,3′-f]thieno[3,2-b]thiophene (C10-DNTT. The measurements are performed in a field effect transistor structure with high field effect mobilities of approximately 3 cm2/V s. This allows us to observe both the charge concentration and temperature dependence of the Seebeck coefficient. We find a strong logarithmic dependence upon charge concentration and a temperature dependence within the measurement uncertainty. Despite performing the measurements on highly polycrystalline evaporated films, we see an agreement in the Seebeck coefficient with modelled values from Shi et al. [Chem. Mater. 26, 2669 (2014] at high charge concentrations. We attribute deviations from the model at lower charge concentrations to charge trapping.
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.
Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou
2017-08-02
The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.
International Nuclear Information System (INIS)
Usenko, A.S.
1995-01-01
The equilibrium space-inhomogeneous distributions of free and pair bound charged particles are calculated in the dipole approximation for the plasma-molecular cylinder and sphere. It is shown that the space and orientational distributions of charged particles and molecules in these systems are similar to those in the cases of plasma-molecular system restricted by one or two parallel planes. The influence of the parameters of outer medium and a plasma-molecular system on the space and orientational distributions of charged particles and molecules is studied in detail
Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications
Directory of Open Access Journals (Sweden)
Annamaria eRuscito
2016-05-01
Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed
Small molecules: the missing link in the central dogma.
Schreiber, Stuart L
2005-07-01
Small molecules have critical roles at all levels of biological complexity and yet remain orphans of the central dogma. Chemical biologists, working with small molecules, expand our understanding of these central elements of life.
International Nuclear Information System (INIS)
Freire-Nordi, Cristina S.; Nascimento, Otaciro R.; Vieira, Armando A.H.; Nakaie, Clovis R.
2006-01-01
The existence of a mucilaginous envelope, sheath or capsule is usual in many desmids, but few data concerning its function are available. Previous studies of the transport function and permeation of molecules through the algae capsules were done using the algae Spondylosium panduriforme and Nephrocytium lunatum, the Electron Paramagnetic Resonance (EPR) technique, and different spin labels. The results suggested that the capsule functions as a selective diffusion medium. In the present work charged and uncharged molecules (spin labels group A) and Staurastrum iversenii var. americanum (Desmids),whose alga presents a great mucilaginous capsule, were used. Charged nitroxide molecules similar to amino acids (spin labels group B) were also used allowing a better understanding of the electrostatic effect in the permeation process across the capsule. The role of the cell capsule in the solute diffusion was evaluated by determining the capsulated and decapsulated cell permeation times. The permeation times for all spin labels tested in the cells lacking capsules were always shorter than those containing this physical barrier. The decay times of spin labels group A observed for S. iversenii were compared to other studied algae. The results regarding the diffusion of charged spin labels group B suggested that the interaction of cell capsule occurs more strongly with negatively charged molecules than with positively charged ones. The results obtained in this work with spin labels group A confirm that the capsule is an essential structure for the cell, and that due to the polar interactions with the spin labels, it plays an important role in the selection of small molecules. Several parameters, mainly those of electrostatic nature, seem to control the permeation across the algal capsules of spin labels group B, showing that structures which are similar to amino acids could diffuse across the interior of the algal cell. (author)
Design of small-molecule epigenetic modulators
Pachaiyappan, Boobalan
2013-01-01
The field of epigenetics has expanded rapidly to reveal multiple new targets for drug discovery. The functional elements of the epigenomic machinery can be catagorized as writers, erasers and readers, and together these elements control cellular gene expression and homeostasis. It is increasingly clear that aberrations in the epigenome can underly a variety of diseases, and thus discovery of small molecules that modulate the epigenome in a specific manner is a viable approach to the discovery of new therapeutic agents. In this Digest, the components of epigenetic control of gene expression will be briefly summarized, and efforts to identify small molecules that modulate epigenetic processes will be described. PMID:24300735
Application of a small molecule radiopharmaceutical concept to improve kinetics
International Nuclear Information System (INIS)
Jeong, Jae Min
2016-01-01
Recently, large molecules or nanoparticles are actively studied as radiopharmaceuticals. However, their kinetics is problematic because of a slow penetration through the capillaries and slow distribution to the target. To improve the kinetics, a two-step targeting method can be applied by using small molecules and very rapid copper-free click reaction. Although this method might have limitations such as internalization of the first targeted conjugate, it will provide high target-to-non-target ratio imaging of radiopharmaceuticals. The majority of radiopharmaceuticals belong to small molecules of which the molecular weight is less than 2000 Da, and the molecular size is smaller than 2 nm generally. The outstanding feature of the small molecule radiopharmaceuticals compared to large molecules is with their kinetics. Their distribution to target and clearance from non-target tissues are very rapid, which is the essential requirement of radiopharmaceuticals. In conclusion, the small molecule radiopharmaceuticals generally show excellent biodistribution properties; however, they show poor efficiency of radioisotope delivery. Large molecule or nanoparticle radiopharmaceuticals have advantages of multimodal and efficient delivery, but lower target-to-non-target ratio. Two-step targeting using a bio-orthogonal copper-free click reaction can be a solution of the problem of large molecule or nanoparticle radiopharmaceuticals. The majority of radiopharmaceuticals belong to small molecules of which the molecular weight is less than 2000 Da, and the molecular size is smaller than 2 nm generally. The outstanding feature of the small molecule radiopharmaceuticals compared to large molecules is with their kinetics. Their distribution to target and clearance from non-target tissues are very rapid, which is the essential requirement of radiopharmaceuticals
Application of a small molecule radiopharmaceutical concept to improve kinetics
Energy Technology Data Exchange (ETDEWEB)
Jeong, Jae Min [Dept. of Nuclear Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of)
2016-06-15
Recently, large molecules or nanoparticles are actively studied as radiopharmaceuticals. However, their kinetics is problematic because of a slow penetration through the capillaries and slow distribution to the target. To improve the kinetics, a two-step targeting method can be applied by using small molecules and very rapid copper-free click reaction. Although this method might have limitations such as internalization of the first targeted conjugate, it will provide high target-to-non-target ratio imaging of radiopharmaceuticals. The majority of radiopharmaceuticals belong to small molecules of which the molecular weight is less than 2000 Da, and the molecular size is smaller than 2 nm generally. The outstanding feature of the small molecule radiopharmaceuticals compared to large molecules is with their kinetics. Their distribution to target and clearance from non-target tissues are very rapid, which is the essential requirement of radiopharmaceuticals. In conclusion, the small molecule radiopharmaceuticals generally show excellent biodistribution properties; however, they show poor efficiency of radioisotope delivery. Large molecule or nanoparticle radiopharmaceuticals have advantages of multimodal and efficient delivery, but lower target-to-non-target ratio. Two-step targeting using a bio-orthogonal copper-free click reaction can be a solution of the problem of large molecule or nanoparticle radiopharmaceuticals. The majority of radiopharmaceuticals belong to small molecules of which the molecular weight is less than 2000 Da, and the molecular size is smaller than 2 nm generally. The outstanding feature of the small molecule radiopharmaceuticals compared to large molecules is with their kinetics. Their distribution to target and clearance from non-target tissues are very rapid, which is the essential requirement of radiopharmaceuticals.
Deng, Wanyuan; Gao, Ke; Yan, Jun; Liang, Quanbin; Xie, Yuan; He, Zhicai; Wu, Hongbin; Peng, Xiaobin; Cao, Yong
2018-03-07
In this study, we demonstrate that remarkably reduced open-circuit voltage in highly efficient organic solar cells (OSCs) from a blend of phenyl-C 61 -butyric acid methyl ester and a recently developed conjugated small molecule (DPPEZnP-THD) upon solvent vapor annealing (SVA) is due to two independent sources: increased radiative recombination and increased nonradiative recombination. Through the measurements of electroluminescence due to the emission of the charge-transfer state and photovoltaic external quantum efficiency measurement, we can quantify that the open-circuit voltage losses in a device with SVA due to the radiative recombination and nonradiative recombination are 0.23 and 0.31 V, respectively, which are 0.04 and 0.07 V higher than those of the as-cast device. Despite of the reduced open-circuit voltage, the device with SVA exhibited enhanced dissociation of charge-transfer excitons, leading to an improved short-circuit current density and a remarkable power conversion efficiency (PCE) of 9.41%, one of the best for solution-processed OSCs based on small-molecule donor materials. Our study also clearly shows that removing the nonradiative recombination pathways and/or suppressing energetic disorder in the active layer would result in more long-lived charge carriers and enhanced open-circuit voltage, which are prerequisites for further improving the PCE.
Peng, Yifeng; Tellier, Liane E; Temenoff, Johnna S
2016-08-16
Sustained release of anti-inflammatory agents remains challenging for small molecule drugs due to their low molecular weight and hydrophobicity. Therefore, the goal of this study was to control the release of a small molecule anti-inflammatory agent, crystal violet (CV), from hydrogels fabricated with heparin, a highly sulfated glycosaminoglycan capable of binding positively-charged molecules such as CV. In this system, both electrostatic interactions between heparin and CV and hydrogel degradation were tuned simultaneously by varying the level of heparin sulfation and varying the amount of dithiothreitol within hydrogels, respectively. It was found that heparin sulfation significantly affected CV release, whereby more sulfated heparin hydrogels (Hep and Hep(-N)) released CV with near zero-order release kinetics (R-squared values between 0.96-0.99). Furthermore, CV was released more quickly from fast-degrading hydrogels than slow-degrading hydrogels, providing a method to tune total CV release between 5-15 days while maintaining linear release kinetics. In particular, N-desulfated heparin hydrogels exhibited efficient CV loading (∼90% of originally included CV), near zero-order CV release kinetics, and maintenance of CV bioactivity after release, making this hydrogel formulation a promising CV delivery vehicle for a wide range of inflammatory diseases.
Hierarchical virtual screening approaches in small molecule drug discovery.
Kumar, Ashutosh; Zhang, Kam Y J
2015-01-01
Virtual screening has played a significant role in the discovery of small molecule inhibitors of therapeutic targets in last two decades. Various ligand and structure-based virtual screening approaches are employed to identify small molecule ligands for proteins of interest. These approaches are often combined in either hierarchical or parallel manner to take advantage of the strength and avoid the limitations associated with individual methods. Hierarchical combination of ligand and structure-based virtual screening approaches has received noteworthy success in numerous drug discovery campaigns. In hierarchical virtual screening, several filters using ligand and structure-based approaches are sequentially applied to reduce a large screening library to a number small enough for experimental testing. In this review, we focus on different hierarchical virtual screening strategies and their application in the discovery of small molecule modulators of important drug targets. Several virtual screening studies are discussed to demonstrate the successful application of hierarchical virtual screening in small molecule drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
About the correlation between atomic charge fluctuations in a molecule
International Nuclear Information System (INIS)
Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.
1987-01-01
In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt
Crystal growth of new charge-transfer salts based on π-conjugated donor molecules
Energy Technology Data Exchange (ETDEWEB)
Morherr, Antonia, E-mail: morherr@stud.uni-frankfurt.de [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Witt, Sebastian [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Chernenkaya, Alisa [Graduate School Materials Science in Mainz, 55128 Mainz (Germany); Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bäcker, Jan-Peter [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Schönhense, Gerd [Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bolte, Michael [Institut für anorganische Chemie, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Krellner, Cornelius [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany)
2016-09-01
New charge transfer crystals of π-conjugated, aromatic molecules (phenanthrene and picene) as donors were obtained by physical vapor transport. The melting behavior, optimization of crystal growth and the crystal structure are reported for charge transfer salts with (fluorinated) tetracyanoquinodimethane (TCNQ-F{sub x}, x=0, 2, 4), which was used as acceptor material. The crystal structures were determined by single-crystal X-ray diffraction. Growth conditions for different vapor pressures in closed ampules were applied and the effect of these starting conditions for crystal size and quality is reported. The process of charge transfer was investigated by geometrical analysis of the crystal structure and by infrared spectroscopy on single crystals. With these three different acceptor strengths and the two sets of donor materials, it is possible to investigate the distribution of the charge transfer systematically. This helps to understand the charge transfer process in this class of materials with π-conjugated donor molecules.
Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule
Directory of Open Access Journals (Sweden)
Satoshi Ohmura
2016-01-01
Full Text Available Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC-triethylene glycol (TEG–C60 molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D+ and A- in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.
Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule
Energy Technology Data Exchange (ETDEWEB)
Ohmura, Satoshi, E-mail: s.ohmura.m4@cc.it-hiroshima.ac.jp [Research Center for Condensed Matter Physics, Department of Civil Engineering and Urban Design, Hiroshima Institute of Technology, Hiroshima 731-5193 (Japan); Tsuruta, Kenji [Department of Electrical and Electronic Engineering, Okayama University, Okayama 700-8530 (Japan); Shimojo, Fuyuki [Department of Physics, Kumamoto University, Kumamoto 860-8555 Japan (Japan); Nakano, Aiichiro [Collaboratory for Advanced Computing and Simulations, Department of Computer Science, Department of Physics & Astronomy, Department of Chemical Engineering & Materials Science, Department of Biological Sciences, University of Southern California, CA90089-024 (United States)
2016-01-15
Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC)-triethylene glycol (TEG)–C{sub 60} molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D{sup +} and A{sup -}) in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.
Komsa, Darya N; Staroverov, Viktor N
2016-11-08
Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.
International Nuclear Information System (INIS)
Janev, R.K.; Kato, T.; Wang, J.G.
2001-05-01
The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C x H y charge exchange reactions from thermal energies up to several hundreds keV for all C x H y molecules with x=1, 2, 3 and 1 ≤ y ≤ 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)
Small molecule fluoride toxicity agonists.
Nelson, James W; Plummer, Mark S; Blount, Kenneth F; Ames, Tyler D; Breaker, Ronald R
2015-04-23
Fluoride is a ubiquitous anion that inhibits a wide variety of metabolic processes. Here, we report the identification of a series of compounds that enhance fluoride toxicity in Escherichia coli and Streptococcus mutans. These molecules were isolated by using a high-throughput screen (HTS) for compounds that increase intracellular fluoride levels as determined via a fluoride riboswitch reporter fusion construct. A series of derivatives were synthesized to examine structure-activity relationships, leading to the identification of compounds with improved activity. Thus, we demonstrate that small molecule fluoride toxicity agonists can be identified by HTS from existing chemical libraries by exploiting a natural fluoride riboswitch. In addition, our findings suggest that some molecules might be further optimized to function as binary antibacterial agents when combined with fluoride. Copyright © 2015 Elsevier Ltd. All rights reserved.
Design of small molecule epigenetic modulators.
Pachaiyappan, Boobalan; Woster, Patrick M
2014-01-01
The field of epigenetics has expanded rapidly to reveal multiple new targets for drug discovery. The functional elements of the epigenomic machinery can be categorized as writers, erasers and readers, and together these elements control cellular gene expression and homeostasis. It is increasingly clear that aberrations in the epigenome can underly a variety of diseases, and thus discovery of small molecules that modulate the epigenome in a specific manner is a viable approach to the discovery of new therapeutic agents. In this Digest, the components of epigenetic control of gene expression will be briefly summarized, and efforts to identify small molecules that modulate epigenetic processes will be described. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
International Nuclear Information System (INIS)
Jean, Y.C.; Yu, C.; Wang, Y.Y.; Yeh, Y.Y.
1984-01-01
Rate constants for positronium atoms reacting chemically with charge-transfer molecules such as p-benzoquinone, nitrobenzene, and coenzyme Q-10 in a model bilayer membrane, dipalmitoylphosphatidylcholine (DPPC), have been measured at temperatures between 23 and 65 0 C. A strong variation of the positronium chemical reactivities, k/sub Ps/ was observed in these systems: k/sub Ps/ increases with increasing temperature until the pretransition temperature of the membrane reaches a maximum value near the main transition temperature and decreases at temperatures higher than the main transition temperature. This variation is interpreted in terms of fluidity and permeability changes associated with the phase transitions of membranes and in terms of charge-transfer-complex formation between the solubilized molecules and the polar head of the membrane. These results demonstrate that positronium and its annihilation characteristics can be employed to investigate charge transport phenomena and microstructural changes of real biological membranes
Energy Technology Data Exchange (ETDEWEB)
Janev, R.K.; Kato, T. [National Inst. for Fusion Science, Toki, Gifu (Japan); Wang, J.G. [Department of Physics and Astronomy, University of Georgia, Athens (United States)
2001-05-01
The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C{sub x}H{sub y} charge exchange reactions from thermal energies up to several hundreds keV for all C{sub x}H{sub y} molecules with x=1, 2, 3 and 1 {<=} y {<=} 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)
Duan, Yu-Ai; Geng, Yun; Li, Hai-Bin; Jin, Jun-Ling; Wu, Yong; Su, Zhong-Min
2013-07-15
To seek for high-performance small molecule donor materials used in heterojunction solar cell, six acceptor-donor-acceptor small molecules based on naphtho[2,3-b:6,7-b']dithiophene (NDT) units with different acceptor units were designed and characterized using density functional theory and time-dependent density functional theory. Their geometries, electronic structures, photophysical, and charge transport properties have been scrutinized comparing with the reported donor material NDT(TDPP)2 (TDPP = thiophene-capped diketopyrrolopyrrole). The open circuit voltage (V(oc)), energetic driving force(ΔE(L-L)), and exciton binding energy (E(b)) were also provided to give an elementary understanding on their cell performance. The results reveal that the frontier molecular orbitals of 3-7 match well with the acceptor material PC61 BM, and compounds 3-5 were found to exhibit the comparable performances to 1 and show promising potential in organic solar cells. In particular, comparing with 1, system 7 with naphthobisthiadiazole acceptor unit displays broader absorption spectrum, higher V(oc), lower E(b), and similar carrier mobility. An in-depth insight into the nature of the involved excited states based on transition density matrix and charge density difference indicates that all S1 states are mainly intramolecular charge transfer states with the charge transfer from central NDT unit to bilateral acceptor units, and also imply that the exciton of 7 can be dissociated easily due to its large extent of the charge transfer. In a word, 7 maybe superior to 1 and may act as a promising donor candidate for organic solar cell. Copyright © 2013 Wiley Periodicals, Inc.
Small molecule screening identifies targetable zebrafish pigmentation pathways
DEFF Research Database (Denmark)
Colanesi, Sarah; Taylor, Kerrie L; Temperley, Nicholas D
2012-01-01
Small molecules complement genetic mutants and can be used to probe pigment cell biology by inhibiting specific proteins or pathways. Here, we present the results of a screen of active compounds for those that affect the processes of melanocyte and iridophore development in zebrafish and investig......Small molecules complement genetic mutants and can be used to probe pigment cell biology by inhibiting specific proteins or pathways. Here, we present the results of a screen of active compounds for those that affect the processes of melanocyte and iridophore development in zebrafish...... and investigate the effects of a few of these compounds in further detail. We identified and confirmed 57 compounds that altered pigment cell patterning, number, survival, or differentiation. Additional tissue targets and toxicity of small molecules are also discussed. Given that the majority of cell types...
Small molecule-guided thermoresponsive supramolecular assemblies
Rancatore, Benjamin J.
2012-10-23
Small organic molecules with strong intermolecular interactions have a wide range of desirable optical and electronic properties and rich phase behaviors. Incorporating them into block copolymer (BCP)-based supramolecules opens new routes to generate functional responsive materials. Using oligothiophene- containing supramolecules, we present systematic studies of critical thermodynamic parameters and kinetic pathway that govern the coassemblies of BCP and strongly interacting small molecules. A number of potentially useful morphologies for optoelectronic materials, including a nanoscopic network of oligothiophene and nanoscopic crystalline lamellae, were obtained by varying the assembly pathway. Hierarchical coassemblies of oligothiophene and BCP, rather than macrophase separation, can be obtained. Crystallization of the oligothiophene not only induces chain stretching of the BCP block the oligothiophene is hydrogen bonded to but also changes the conformation of the other BCP coil block. This leads to an over 70% change in the BCP periodicity (e.g., from 31 to 53 nm) as the oligothiophene changes from a melt to a crystalline state, which provides access to a large BCP periodicity using fairly low molecular weight BCP. The present studies have demonstrated the experimental feasibility of generating thermoresponsive materials that convert heat into mechanical energy. Incorporating strongly interacting small molecules into BCP supramolecules effectively increases the BCP periodicity and may also open new opportunities to tailor their optical properties without the need for high molecular weight BCP. © 2012 American Chemical Society.
Small molecule-guided thermoresponsive supramolecular assemblies
Rancatore, Benjamin J.; Mauldin, Clayton E.; Frechet, Jean; Xu, Ting
2012-01-01
Small organic molecules with strong intermolecular interactions have a wide range of desirable optical and electronic properties and rich phase behaviors. Incorporating them into block copolymer (BCP)-based supramolecules opens new routes to generate functional responsive materials. Using oligothiophene- containing supramolecules, we present systematic studies of critical thermodynamic parameters and kinetic pathway that govern the coassemblies of BCP and strongly interacting small molecules. A number of potentially useful morphologies for optoelectronic materials, including a nanoscopic network of oligothiophene and nanoscopic crystalline lamellae, were obtained by varying the assembly pathway. Hierarchical coassemblies of oligothiophene and BCP, rather than macrophase separation, can be obtained. Crystallization of the oligothiophene not only induces chain stretching of the BCP block the oligothiophene is hydrogen bonded to but also changes the conformation of the other BCP coil block. This leads to an over 70% change in the BCP periodicity (e.g., from 31 to 53 nm) as the oligothiophene changes from a melt to a crystalline state, which provides access to a large BCP periodicity using fairly low molecular weight BCP. The present studies have demonstrated the experimental feasibility of generating thermoresponsive materials that convert heat into mechanical energy. Incorporating strongly interacting small molecules into BCP supramolecules effectively increases the BCP periodicity and may also open new opportunities to tailor their optical properties without the need for high molecular weight BCP. © 2012 American Chemical Society.
Role of molecular charge in nucleocytoplasmic transport.
Directory of Open Access Journals (Sweden)
Alexander Goryaynov
Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.
Small-molecule pheromones and hormones controlling nematode development.
Butcher, Rebecca A
2017-05-17
The existence of small-molecule signals that influence development in Caenorhabditis elegans has been known for several decades, but only in recent years have the chemical structures of several of these signals been established. The identification of these signals has enabled connections to be made between these small molecules and fundamental signaling pathways in C. elegans that influence not only development but also metabolism, fertility, and lifespan. Spurred by these important discoveries and aided by recent advances in comparative metabolomics and NMR spectroscopy, the field of nematode chemistry has the potential to expand dramatically in the coming years. This Perspective will focus on small-molecule pheromones and hormones that influence developmental events in the nematode life cycle (ascarosides, dafachronic acids, and nemamides), will cover more recent work regarding the biosynthesis of these signals, and will explore how the discovery of these signals is transforming our understanding of nematode development and physiology.
Surface-confined electroactive molecules for multistate charge storage information.
Mas-Torrent, M; Rovira, C; Veciana, J
2013-01-18
Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.
X-ray characterization of solid small molecule organic materials
Billinge, Simon; Shankland, Kenneth; Shankland, Norman; Florence, Alastair
2014-06-10
The present invention provides, inter alia, methods of characterizing a small molecule organic material, e.g., a drug or a drug product. This method includes subjecting the solid small molecule organic material to x-ray total scattering analysis at a short wavelength, collecting data generated thereby, and mathematically transforming the data to provide a refined set of data.
Medium-Bandgap Small-Molecule Donors Compatible with Both Fullerene and Nonfullerene Acceptors.
Huo, Yong; Yan, Cenqi; Kan, Bin; Liu, Xiao-Fei; Chen, Li-Chuan; Hu, Chen-Xia; Lau, Tsz-Ki; Lu, Xinhui; Sun, Chun-Lin; Shao, Xiangfeng; Chen, Yongsheng; Zhan, Xiaowei; Zhang, Hao-Li
2018-03-21
Much effort has been devoted to the development of new donor materials for small-molecule organic solar cells due to their inherent advantages of well-defined molecular weight, easy purification, and good reproducibility in photovoltaic performance. Herein, we report two small-molecule donors that are compatible with both fullerene and nonfullerene acceptors. Both molecules consist of an (E)-1,2-di(thiophen-2-yl)ethane-substituted (TVT-substituted) benzo[1,2-b:4,5-b']dithiophene (BDT) as the central unit, and two rhodanine units as the terminal electron-withdrawing groups. The central units are modified with either alkyl side chains (DRBDT-TVT) or alkylthio side chains (DRBDT-STVT). Both molecules exhibit a medium bandgap with complementary absorption and proper energy level offset with typical acceptors like PC 71 BM and IDIC. The optimized devices show a decent power conversion efficiency (PCE) of 6.87% for small-molecule organic solar cells and 6.63% for nonfullerene all small-molecule organic solar cells. Our results reveal that rationally designed medium-bandgap small-molecule donors can be applied in high-performance small-molecule organic solar cells with different types of acceptors.
Electrostatic field and charge distribution in small charged dielectric droplets
Storozhev, V. B.
2004-08-01
The charge distribution in small dielectric droplets is calculated on the basis of continuum medium approximation. There are considered charged liquid spherical droplets of methanol in the range of nanometer sizes. The problem is solved by the following way. We find the free energy of some ion in dielectric droplet, which is a function of distribution of other ions in the droplet. The probability of location of the ion in some element of volume in the droplet is a function of its free energy in this element of volume. The same approach can be applied to other ions in the droplet. The obtained charge distribution differs considerably from the surface distribution. The curve of the charge distribution in the droplet as a function of radius has maximum near the surface. Relative concentration of charges in the vicinity of the center of the droplet does not equal to zero, and it is the higher, the less is the total charge of the droplet. According to the estimates the model is applicable if the droplet radius is larger than 10 nm.
Electrostatic field and charge distribution in small charged dielectric droplets
International Nuclear Information System (INIS)
Storozhev, V.B.
2004-01-01
The charge distribution in small dielectric droplets is calculated on the basis of continuum medium approximation. There are considered charged liquid spherical droplets of methanol in the range of nanometer sizes. The problem is solved by the following way. We find the free energy of some ion in dielectric droplet, which is a function of distribution of other ions in the droplet. The probability of location of the ion in some element of volume in the droplet is a function of its free energy in this element of volume. The same approach can be applied to other ions in the droplet. The obtained charge distribution differs considerably from the surface distribution. The curve of the charge distribution in the droplet as a function of radius has maximum near the surface. Relative concentration of charges in the vicinity of the center of the droplet does not equal to zero, and it is the higher, the less is the total charge of the droplet. According to the estimates the model is applicable if the droplet radius is larger than 10 nm
Huang, Jing; Mei, Ye; König, Gerhard; Simmonett, Andrew C; Pickard, Frank C; Wu, Qin; Wang, Lee-Ping; MacKerell, Alexander D; Brooks, Bernard R; Shao, Yihan
2017-02-14
In this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PAD energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other 11 solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. This suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.
Small molecule inhibitors of anthrax edema factor.
Jiao, Guan-Sheng; Kim, Seongjin; Moayeri, Mahtab; Thai, April; Cregar-Hernandez, Lynne; McKasson, Linda; O'Malley, Sean; Leppla, Stephen H; Johnson, Alan T
2018-01-15
Anthrax is a highly lethal disease caused by the Gram-(+) bacteria Bacillus anthracis. Edema toxin (ET) is a major contributor to the pathogenesis of disease in humans exposed to B. anthracis. ET is a bipartite toxin composed of two proteins secreted by the vegetative bacteria, edema factor (EF) and protective antigen (PA). Our work towards identifying a small molecule inhibitor of anthrax edema factor is the subject of this letter. First we demonstrate that the small molecule probe 5'-Fluorosulfonylbenzoyl 5'-adenosine (FSBA) reacts irreversibly with EF and blocks enzymatic activity. We then show that the adenosine portion of FSBA can be replaced to provide more drug-like molecules which are up to 1000-fold more potent against EF relative to FSBA, display low cross reactivity when tested against a panel of kinases, and are nanomolar inhibitors of EF in a cell-based assay of cAMP production. Copyright © 2017 Elsevier Ltd. All rights reserved.
Small Molecule Modifiers of the microRNA and RNA Interference Pathway
Deiters, Alexander
2009-01-01
Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...
Small molecules enhance CRISPR genome editing in pluripotent stem cells.
Yu, Chen; Liu, Yanxia; Ma, Tianhua; Liu, Kai; Xu, Shaohua; Zhang, Yu; Liu, Honglei; La Russa, Marie; Xie, Min; Ding, Sheng; Qi, Lei S
2015-02-05
The bacterial CRISPR-Cas9 system has emerged as an effective tool for sequence-specific gene knockout through non-homologous end joining (NHEJ), but it remains inefficient for precise editing of genome sequences. Here we develop a reporter-based screening approach for high-throughput identification of chemical compounds that can modulate precise genome editing through homology-directed repair (HDR). Using our screening method, we have identified small molecules that can enhance CRISPR-mediated HDR efficiency, 3-fold for large fragment insertions and 9-fold for point mutations. Interestingly, we have also observed that a small molecule that inhibits HDR can enhance frame shift insertion and deletion (indel) mutations mediated by NHEJ. The identified small molecules function robustly in diverse cell types with minimal toxicity. The use of small molecules provides a simple and effective strategy to enhance precise genome engineering applications and facilitates the study of DNA repair mechanisms in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Charge migration and charge transfer in molecular systems
Directory of Open Access Journals (Sweden)
Hans Jakob Wörner
2017-11-01
Full Text Available The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review.
Methods to enable the design of bioactive small molecules targeting RNA.
Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L
2014-02-21
RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome.
Augmented-plane-wave calculations on small molecules
International Nuclear Information System (INIS)
Serena, P.A.; Baratoff, A.; Soler, J.M.
1993-01-01
We have performed ab initio calculations on a wide range of small molecules, demonstrating the accuracy and flexibility of an alternative method for calculating the electronic structure of molecules, solids, and surfaces. It is based on the local-density approximation (LDA) for exchange and correlation and the nonlinear augmented-plane-wave method. Very accurate atomic forces are obtained directly. This allows for implementation of Car-Parrinello-like techniques to determine simultaneously the self-consistent electron wave functions and the equilibrium atomic positions within an iterative scheme. We find excellent agreement with the best existing LDA-based calculations and remarkable agreement with experiment for the equilibrium geometries, vibrational frequencies, and dipole moments of a wide variety of molecules, including strongly bound homopolar and polar molecules, hydrogen-bound and electron-deficient molecules, and weakly bound alkali and noble-metal dimers, although binding energies are overestimated
Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia
2017-08-01
A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.
Landry, James P; Fei, Yiyan; Zhu, X D
2011-12-01
Small-molecule compounds remain the major source of therapeutic and preventative drugs. Developing new drugs against a protein target often requires screening large collections of compounds with diverse structures for ligands or ligand fragments that exhibit sufficiently affinity and desirable inhibition effect on the target before further optimization and development. Since the number of small molecule compounds is large, high-throughput screening (HTS) methods are needed. Small-molecule microarrays (SMM) on a solid support in combination with a suitable binding assay form a viable HTS platform. We demonstrate that by combining an oblique-incidence reflectivity difference optical scanner with SMM we can screen 10,000 small-molecule compounds on a single glass slide for protein ligands without fluorescence labeling. Furthermore using such a label-free assay platform we can simultaneously acquire binding curves of a solution-phase protein to over 10,000 immobilized compounds, thus enabling full characterization of protein-ligand interactions over a wide range of affinity constants.
Organic small molecule semiconducting chromophores for use in organic electronic devices
Energy Technology Data Exchange (ETDEWEB)
Welch, Gregory C.; Hoven, Corey V.; Nguyen, Thuc-Quyen
2018-02-13
Small organic molecule semi-conducting chromophores containing a pyridalthiadiazole, pyridaloxadiazole, or pyridaltriazole core structure are disclosed. Such compounds can be used in organic heterojunction devices, such as organic small molecule solar cells and transistors.
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
The effects of electric fields on charged molecules and particles in individual microenvironments
Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.
Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.
Control Strategy for Small Molecule Impurities in Antibody-Drug Conjugates.
Gong, Hai H; Ihle, Nathan; Jones, Michael T; Kelly, Kathleen; Kott, Laila; Raglione, Thomas; Whitlock, Scott; Zhang, Qunying; Zheng, Jie
2018-04-01
Antibody-drug conjugates (ADCs) are an emerging class of biopharmaceuticals. As such, there are no specific guidelines addressing impurity limits and qualification requirements. The current ICH guidelines on impurities, Q3A (Impurities in New Drug Substances), Q3B (Impurities in New Drug Products), and Q6B (Specifications: Test Procedures and Acceptance Criteria for Biotechnological/Biological Products) do not adequately address how to assess small molecule impurities in ADCs. The International Consortium for Innovation and Quality in Pharmaceutical Development (IQ) formed an impurities working group (IWG) to discuss this issue. This white paper presents a strategy for evaluating the impact of small molecule impurities in ADCs. This strategy suggests a science-based approach that can be applied to the design of control systems for ADC therapeutics. The key principles that form the basis for this strategy include the significant difference in molecular weights between small molecule impurities and the ADC, the conjugation potential of the small molecule impurities, and the typical dosing concentrations and dosing schedule. The result is that exposure to small impurities in ADCs is so low as to often pose little or no significant safety risk.
Theory of Charged Quantum Dot Molecules
Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.
Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy
International Nuclear Information System (INIS)
Lee, Min Hyung; Song, Hyunwook
2013-01-01
We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects
Designing small molecule polyaromatic p- and n-type semiconductor materials for organic electronics
Collis, Gavin E.
2015-12-22
By combining computational aided design with synthetic chemistry, we are able to identify core 2D polyaromatic small molecule templates with the necessary optoelectronic properties for p- and n-type materials. By judicious selection of the functional groups, we can tune the physical properties of the material making them amenable to solution and vacuum deposition. In addition to solubility, we observe that the functional group can influence the thin film molecular packing. By developing structure-property relationships (SPRs) for these families of compounds we observe that some compounds are better suited for use in organic solar cells, while others, varying only slightly in structure, are favoured in organic field effect transistor devices. We also find that the processing conditions can have a dramatic impact on molecular packing (i.e. 1D vs 2D polymorphism) and charge mobility; this has implications for material and device long term stability. We have developed small molecule p- and n-type materials for organic solar cells with efficiencies exceeding 2%. Subtle variations in the functional groups of these materials produces p- and ntype materials with mobilities higher than 0.3 cm2/Vs. We are also interested in using our SPR approach to develop materials for sensor and bioelectronic applications.
Computational mass spectrometry for small molecules
2013-01-01
The identification of small molecules from mass spectrometry (MS) data remains a major challenge in the interpretation of MS data. This review covers the computational aspects of identifying small molecules, from the identification of a compound searching a reference spectral library, to the structural elucidation of unknowns. In detail, we describe the basic principles and pitfalls of searching mass spectral reference libraries. Determining the molecular formula of the compound can serve as a basis for subsequent structural elucidation; consequently, we cover different methods for molecular formula identification, focussing on isotope pattern analysis. We then discuss automated methods to deal with mass spectra of compounds that are not present in spectral libraries, and provide an insight into de novo analysis of fragmentation spectra using fragmentation trees. In addition, this review shortly covers the reconstruction of metabolic networks using MS data. Finally, we list available software for different steps of the analysis pipeline. PMID:23453222
Theory and simulation of charge transport in disordered organic semiconductors
Bobbert, P.A.; Kondov, I.; Sutman, G.
2013-01-01
Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Anisotropic charge transport in large single crystals of π-conjugated organic molecules.
Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent
2014-05-07
The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.
Targeting p53 by small molecules in hematological malignancies
Saha, Manujendra N; Qiu, Lugui; Chang, Hong
2013-01-01
p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...
Synthesis of molecular complexes for small molecule activation
International Nuclear Information System (INIS)
Andrez, Julie
2016-01-01
enhancement of the reducing power of the 'classical' divalent lanthanide ions was studied using two different ligand systems. The coordination of siloxid ligands to divalent Eu, Yb and Sm metal centres led to highly reactive compounds featuring unique reactivity with small molecules such as azobenzene, CS_2 and CO_2. Finally, syntheses and electrochemistry analyses of a family of homoleptic lanthanide complexes supported by related tripodal amino-phenolate ligands allowed us to quantify the influence of the ligand donor-character and charge on the reduction potential of the lanthanide centre. The reactivity of an Eu(II) system with CS_2 was also investigated. (author) [fr
Development of novel small molecules for imaging and drug release
Cao, Yanting
Small organic molecules, including small molecule based fluorescent probes, small molecule based drugs or prodrugs, and smart multifunctional fluorescent drug delivery systems play important roles in biological research, drug discovery, and clinical practices. Despite the significant progress made in these fields, the development of novel and diverse small molecules is needed to meet various demands for research and clinical applications. My Ph.D study focuses on the development of novel functional molecules for recognition, imaging and drug release. In the first part, a turn-on fluorescent probe is developed for the detection of intracellular adenosine-5'-triphosphate (ATP) levels based on multiplexing recognitions. Considering the unique and complicated structure of ATP molecules, a fluorescent probe has been implemented with improved sensitivity and selectivity due to two synergistic binding recognitions by incorporating of 2, 2'-dipicolylamine (Dpa)-Zn(II) for targeting of phospho anions and phenylboronic acid group for cis-diol moiety. The novel probe is able to detect intracellular ATP levels in SH-SY5Y cells. Meanwhile, the advantages of multiplexing recognition design concept have been demonstrated using two control molecules. In the second part, a prodrug system is developed to deliver multiple drugs within one small molecule entity. The prodrug is designed by using 1-(2-nitrophenyl)ethyl (NPE) as phototrigger, and biphenol biquaternary ammonium as the prodrug. With controlled photo activation, both DNA cross-linking agents mechlorethamine and o-quinone methide are delivered and released at the preferred site, leading to efficient DNA cross-links formation and cell death. The prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, but displays potent activity towards cancer cells (HeLa cells) upon UV activation. The multiple drug release system may hold a great potential for practical application. In the
International Nuclear Information System (INIS)
Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.
2007-01-01
The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed
Small-molecule compounds exhibiting target-mediated drug disposition - A case example of ABT-384.
An, Guohua; Liu, Wei; Dutta, Sandeep
2015-10-01
Nonlinearities are frequently encountered in pharmacokinetics, and they can occur when 1 or more processes of absorption, distribution, metabolism, and excretion are saturable. One special source of nonlinearity that has been noticed recently is the saturable binding of the drug to a high-affinity-low-capacity target, a phenomenon known as target-mediated drug disposition (TMDD). Although TMDD can occur in both small-molecule compounds and large-molecule compounds, the latter has received much more attention because of its high prevalence. With the development of more potent small-molecule drugs acting on highly specific targets and the availability of increasingly sensitive analytical techniques, small-molecule compounds exhibiting TMDD have been increasingly reported in the past several years. ABT-384 is a small-molecule drug candidate that exhibited significant nonlinear pharmacokinetics, potentially imparted by TMDD, in a first-in-human clinical trial conducted in healthy volunteers. Compared with published small-molecule compounds exhibiting TMDD, ABT-384 pharmacokinetic characteristics are more consistent with TMDD. To expand current knowledge of TMDD of small-molecule compounds and increase awareness of this interesting and clinically important phenomenon, in this review the general features of small-molecule compounds exhibiting TMDD are highlighted, with ABT-384 provided as an example. © 2015, The American College of Clinical Pharmacology.
Kümmel, Stephan
Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.
Acoustical communications by means of small explosive charges
International Nuclear Information System (INIS)
Edrington, T.S.
1984-03-01
An acoustical communication system that conveys information by modulating the time intervals between detonations of small (subgram) explosive charges has been designed and field-tested. In addition to an information capacity of about 20 bits per charge, the system provides a means for making inferences about sound speed and attenuation in the propagation medium
Bifunctional Pt-Si Alloys for Small Organic Molecule Electro-oxidation
DEFF Research Database (Denmark)
Permyakova, Anastasia Aleksandrovna; Suntivich, Jin; Han, Binghong
Designing highly active catalysts for electro-oxidation of small organic molecules can help to reduce the anodic overpotential for more efficient utilization of hydrocarbon fuels. The challenge in developing more active electrocatalysts for electro-oxidation reactions is to satisfy the stringent...... adsorption site. We will discuss the enhanced activity of Pt-Si alloys for small organic molecule oxidation, which can be attributed to the improved CO electro-oxidation kinetics on Pt-Si....
Recent progress in the development of small-molecule glucagon receptor antagonists.
Sammons, Matthew F; Lee, Esther C Y
2015-10-01
The endocrine hormone glucagon stimulates hepatic glucose output via its action at the glucagon receptor (GCGr) in the liver. In the diabetic state, dysregulation of glucagon secretion contributes to abnormally elevated hepatic glucose output. The inhibition of glucagon-induced hepatic glucose output via antagonism of the GCGr using small-molecule ligands is a promising mechanism for improving glycemic control in the diabetic state. Clinical data evaluating the therapeutic potential of small-molecule GCGr antagonists is currently emerging. Recently disclosed clinical data demonstrates the potential efficacy and possible therapeutic limitations of small-molecule GCGr antagonists. Recent pre-clinical work on the development of GCGr antagonists is also summarized. Copyright © 2015 Elsevier Ltd. All rights reserved.
Szarko, Jodi M.; Guo, Jianchang; Rolczynski, Brian S.; Chen, Lin X.
2011-01-01
Photovoltaic functions in organic materials are intimately connected to interfacial morphologies of molecular packing in films on the nanometer scale and molecular levels. This review will focus on current studies on correlations of nanoscale morphologies in organic photovoltaic (OPV) materials with fundamental processes relevant to photovoltaic functions, such as light harvesting, exciton splitting, exciton diffusion, and charge separation (CS) and diffusion. Small molecule photovoltaic materials will be discussed here. The donor and acceptor materials in small molecule OPV devices can be fabricated in vacuum-deposited, multilayer, crystalline thin films, or spin-coated together to form blended bulk heterojunction (BHJ) films. These two methods result in very different morphologies of the solar cell active layers. There is still a formidable debate regarding which morphology is favored for OPV optimization. The morphology of the conducting films has been systematically altered; using variations of the techniques above, the whole spectrum of film qualities can be fabricated. It is possible to form a highly crystalline material, one which is completely amorphous, or an intermediate morphology. In this review, we will summarize the past key findings that have driven organic solar cell research and the current state-of-the-art of small molecule and conducting oligomer materials. We will also discuss the merits and drawbacks of these devices. Finally, we will highlight some works that directly compare the spectra and morphology of systematically elongated oligothiophene derivatives and compare these oligomers to their polymer counterparts. We hope this review will shed some new light on the morphology differences of these two systems. PMID:22110870
A Prospective Method to Guide Small Molecule Drug Design
Johnson, Alan T.
2015-01-01
At present, small molecule drug design follows a retrospective path when considering what analogs are to be made around a current hit or lead molecule with the focus often on identifying a compound with higher intrinsic potency. What this approach overlooks is the simultaneous need to also improve the physicochemical (PC) and pharmacokinetic (PK)…
Directory of Open Access Journals (Sweden)
Raúl García
2015-06-01
Full Text Available We describe the synthesis and single-molecule electrical transport properties of a molecular wire containing a π-extended tetrathiafulvalene (exTTF group and its charge-transfer complex with F4TCNQ. We form single-molecule junctions using the in situ break junction technique using a homebuilt scanning tunneling microscope with a range of conductance between 10 G0 down to 10−7 G0. Within this range we do not observe a clear conductance signature of the neutral parent molecule, suggesting either that its conductance is too low or that it does not form a stable junction. Conversely, we do find a clear conductance signature in the experiments carried out on the charge-transfer complex. Due to the fact we expected this species to have a higher conductance than the neutral molecule, we believe this supports the idea that the conductance of the neutral molecule is very low, below our measurement sensitivity. This idea is further supported by theoretical calculations. To the best of our knowledge, these are the first reported single-molecule conductance measurements on a molecular charge-transfer species.
Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo
2012-10-01
In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.
Mapping small molecule binding data to structural domains.
Kruger, Felix A; Rostom, Raghd; Overington, John P
2012-01-01
Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a grouping of activity classes
Fragmentation of small molecules induced by 46 keV/amu N+ and N2+ projectiles
International Nuclear Information System (INIS)
Kovacs, S.T.S.; Juhasz, Z.; Herczku, P.; Sulik, B.
2012-01-01
Complete text of publication follows. Collisional molecule fragmentation experiments has gain increasing attention in several research and applied fields. In order to understand the fundamental processes of molecule fragmentation one has to start with collisions of small few-atomic molecules. Moreover, fragments of small molecules such as water can cause damages of large molecules (DNA) very effectively in living tissues. In the last few years a new experimental setup was developed at Atomki. It was designed especially for molecule fragmentation experiments. Now the measurements using this system are running routinely. In 2012 the studied targets were water vapor, methane and nitrogen gases, injected into the collision area by an effusive molecular gas jet system. 650 keV N + and 1,3 MeV N 2 + ions were used as projectiles produced by the VdG-5 electrostatic accelerator. The velocity of the two types of projectiles was the same. Energy and angular distribution of the produced fragments was measured by an energy dispersive electrostatic spectrometer. For atomic ionization a symmetric, diatomic molecular projectile (e.g. N 2 + ) yields about twice more electrons compared to those of singly charged ion projectiles of the same atom (N + ) at the same velocity. In such cases the two atomic centers in the molecular ion can be considered as two individual atomic centers. For the fragmentation of molecular targets the picture is not so simple because in this case close collision of two extended systems is investigated. As figure 1 and 2 show, the measured yields for molecular projectile is not simply twice of the ones for atomic projectile. The shape of the energy spectra are different. The measured data are under evaluation. Acknowledgements. This work was supported by the Hungarian National Science Foundation OTKA (Grant: K73703) and by the TAMOP-4.2.2/B-10/1-2010-0024 project. The project is cofinanced by the European Union and the European Social Fund.
Small Molecule Agonists of Cell Adhesion Molecule L1 Mimic L1 Functions In Vivo.
Kataria, Hardeep; Lutz, David; Chaudhary, Harshita; Schachner, Melitta; Loers, Gabriele
2016-09-01
Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery after injury, leading to severe disabilities in motor functions and pain. Peripheral nerve injury impairs motor, sensory, and autonomic functions, particularly in cases where nerve gaps are large and chronic nerve injury ensues. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration after acute injury. We screened libraries of known drugs for small molecule agonists of L1 and evaluated the effect of hit compounds in cell-based assays in vitro and in mice after femoral nerve and spinal cord injuries in vivo. We identified eight small molecule L1 agonists and showed in cell-based assays that they stimulate neuronal survival, neuronal migration, and neurite outgrowth and enhance Schwann cell proliferation and migration and myelination of neurons in an L1-dependent manner. In a femoral nerve injury mouse model, enhanced functional regeneration and remyelination after application of the L1 agonists were observed. In a spinal cord injury mouse model, L1 agonists improved recovery of motor functions, being paralleled by enhanced remyelination, neuronal survival, and monoaminergic innervation, reduced astrogliosis, and activation of microglia. Together, these findings suggest that application of small organic compounds that bind to L1 and stimulate the beneficial homophilic L1 functions may prove to be a valuable addition to treatments of nervous system injuries.
Directory of Open Access Journals (Sweden)
Rebecca Boll
2016-07-01
Full Text Available Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse.
Reciprocal carbonyl-carbonyl interactions in small molecules and proteins.
Rahim, Abdur; Saha, Pinaki; Jha, Kunal Kumar; Sukumar, Nagamani; Sarma, Bani Kanta
2017-07-19
Carbonyl-carbonyl n→π* interactions where a lone pair (n) of the oxygen atom of a carbonyl group is delocalized over the π* orbital of a nearby carbonyl group have attracted a lot of attention in recent years due to their ability to affect the 3D structure of small molecules, polyesters, peptides, and proteins. In this paper, we report the discovery of a "reciprocal" carbonyl-carbonyl interaction with substantial back and forth n→π* and π→π* electron delocalization between neighboring carbonyl groups. We have carried out experimental studies, analyses of crystallographic databases and theoretical calculations to show the presence of this interaction in both small molecules and proteins. In proteins, these interactions are primarily found in polyproline II (PPII) helices. As PPII are the most abundant secondary structures in unfolded proteins, we propose that these local interactions may have implications in protein folding.Carbonyl-carbonyl π* non covalent interactions affect the structure and stability of small molecules and proteins. Here, the authors carry out experimental studies, analyses of crystallographic databases and theoretical calculations to describe an additional type of carbonyl-carbonyl interaction.
Reprogramming with Small Molecules instead of Exogenous Transcription Factors
Directory of Open Access Journals (Sweden)
Tongxiang Lin
2015-01-01
Full Text Available Induced pluripotent stem cells (iPSCs could be employed in the creation of patient-specific stem cells, which could subsequently be used in various basic and clinical applications. However, current iPSC methodologies present significant hidden risks with respect to genetic mutations and abnormal expression which are a barrier in realizing the full potential of iPSCs. A chemical approach is thought to be a promising strategy for safety and efficiency of iPSC generation. Many small molecules have been identified that can be used in place of exogenous transcription factors and significantly improve iPSC reprogramming efficiency and quality. Recent studies have shown that the use of small molecules results in the generation of chemically induced pluripotent stem cells from mouse embryonic fibroblast cells. These studies might lead to new areas of stem cell research and medical applications, not only human iPSC by chemicals alone, but also safe generation of somatic stem cells for cell based clinical trials and other researches. In this paper, we have reviewed the recent advances in small molecule approaches for the generation of iPSCs.
Enhanced Light Absorption in Fluorinated Ternary Small-Molecule Photovoltaics
Energy Technology Data Exchange (ETDEWEB)
Eastham, Nicholas D. [Department; Dudnik, Alexander S. [Department; Harutyunyan, Boris [Department; Aldrich, Thomas J. [Department; Leonardi, Matthew J. [Department; Manley, Eric F. [Department; Chemical; Butler, Melanie R. [Department; Harschneck, Tobias [Department; Ratner, Mark A. [Department; Chen, Lin X. [Department; Chemical; Bedzyk, Michael J. [Department; Department; Melkonyan, Ferdinand S. [Department; Facchetti, Antonio [Department; Chang, Robert P. H. [Department; Marks, Tobin J. [Department; Department
2017-06-14
Using small-molecule donor (SMD) semiconductors in organic photovoltaics (OPVs) has historically afforded lower power conversion efficiencies (PCEs) than their polymeric counterparts. The PCE difference is attributed to shorter conjugated backbones, resulting in reduced intermolecular interactions. Here, a new pair of SMDs is synthesized based on the diketopyrrolopyrrole-benzodithiophene-diketopyrrolopyrrole (BDT-DPP2) skeleton but having fluorinated and fluorinefree aromatic side-chain substituents. Ternary OPVs having varied ratios of the two SMDs with PC61BM as the acceptor exhibit tunable open-circuit voltages (Vocs) between 0.833 and 0.944 V due to a fluorination-induced shift in energy levels and the electronic “alloy” formed from the miscibility of the two SMDs. A 15% increase in PCE is observed at the optimal ternary SMD ratio, with the short-circuit current density (Jsc) significantly increased to 9.18 mA/cm2. The origin of Jsc enhancement is analyzed via charge generation, transport, and diffuse reflectance measurements, and is attributed to increased optical absorption arising from a maximum in film crystallinity at this SMD ratio, observed by grazing incidence wide-angle X-ray scattering.
Small molecule alteration of RNA sequence in cells and animals.
Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D
2017-10-18
RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.
Small-Molecule-Directed Hepatocyte-Like Cell Differentiation of Human Pluripotent Stem Cells.
Mathapati, Santosh; Siller, Richard; Impellizzeri, Agata A R; Lycke, Max; Vegheim, Karianne; Almaas, Runar; Sullivan, Gareth J
2016-08-17
Hepatocyte-like cells (HLCs) generated in vitro from human pluripotent stem cells (hPSCs) provide an invaluable resource for basic research, regenerative medicine, drug screening, toxicology, and modeling of liver disease and development. This unit describes a small-molecule-driven protocol for in vitro differentiation of hPSCs into HLCs without the use of growth factors. hPSCs are coaxed through a developmentally relevant route via the primitive streak to definitive endoderm (DE) using the small molecule CHIR99021 (a Wnt agonist), replacing the conventional growth factors Wnt3A and activin A. The small-molecule-derived DE is then differentiated to hepatoblast-like cells in the presence of dimethyl sulfoxide. The resulting hepatoblasts are then differentiated to HLCs with N-hexanoic-Tyr, Ile-6 aminohexanoic amide (Dihexa, a hepatocyte growth factor agonist) and dexamethasone. The protocol provides an efficient and reproducible procedure for differentiation of hPSCs into HLCs utilizing small molecules. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
Adhikari, Tham; Solanke, Parmeshwar; Pathak, Dinesh; Wagner, Tomas; Bureš, Filip; Reed, Tyler; Nunzi, Jean-Michel
2017-07-01
We report on the photovoltaic performance of novel T-Shaped Indan-1,3-dione derivatives as donors in a solution processed bulk heterojunction solar cells. Small molecule bulk heterojunction solar cells of these molecules with [6,6]-phenyl-C61-butyric acid methyl ester (PC61BM) were fabricated and characterized. The preliminary characterization of these devices yielded a PCE of 0.24% and 0.33% for two separate derivatives. These low power conversion efficiencies were attributed to a high surface roughness with a large number of dewetting spots. Doping with 10% Polystyrene in the Indan-1,3-dione derivatives decreases surface roughness and dewetting spots thereby improving the efficiency of the devices. Efficiency of the devices was found as 0.39% and 0.51% for two derivatives after doping with polystyrene. The charge transfer mechanism was studied with photoluminescence quenching. The morphology and packing behavior of molecules were further studied using Atomic Force Microscopy (AFM) and X-ray diffraction (XRD).
Charge neutralization of small ion beam clumps
Energy Technology Data Exchange (ETDEWEB)
Welch, D R [Mission Research Corp., Albuquerque, NM (United States); Olson, C L; Hanson, D L [Sandia National Labs., Albuquerque, NM (United States)
1997-12-31
The mega-ampere currents associated with light ion fusion (LIF) require excellent charge neutralization to prevent divergence growth. As the size and space-charge potential of a beam clump or `beamlet` become small (submillimeter size and kilovolt potentials), the neutralization becomes increasingly difficult. Linear theory predicts that plasma electrons cannot neutralize potentials < {phi}{sub crit} = (1/2)m{sub e}v{sub i}{sup 2}/e, where m{sub e} is the electron mass and v{sub i} is the ion beam velocity. A non-uniform beam would, therefore, have regions with potentials sufficient to add divergence to beam clumps. The neutralization of small beamlets produced on the SABLE accelerator and in numerical simulation has supported the theory, showing a plateau in divergence growths as the potential in the beamlet exceeds {phi}{sub crit}. (author). 1 tab., 2 figs., 4 refs.
Fluorescent scattering by molecules embedded in small particles
International Nuclear Information System (INIS)
1982-01-01
Studies are reported in these areas: double resonance in fluorescent and Raman scattering; surface enhanced Raman scattering; fluorescence by molecules embedded in small particles; fluorescence by a liquid droplet; and fluorescence by conical pits in surfaces
UP-scaling of inverted small molecule based organic solar cells
DEFF Research Database (Denmark)
Patil, Bhushan Ramesh; Madsen, Morten
Organic solar cells (OSC), in spite of being a promising technology, still face challenges regarding large-scale fabrication. Although efficiencies of up to 12 % has been reached for small molecule OSC, their performance, both in terms of device efficiency and stability, is significantly reduced...... during up-scaling processes. The work presented here is focused on an approach towards up-scaling of small molecule based OSC with inverted device configuration. Bilayer OSC from Tetraphenyldibenzoperiflanthene (DBP) and Fullerenes (C70), as electron donor and acceptor respectively, with cell area...
Blu-ray based optomagnetic aptasensor for detection of small molecules
DEFF Research Database (Denmark)
Yang, Jaeyoung; Donolato, Marco; Pinto, Alessandro
2016-01-01
This paper describes an aptamer-based optomagnetic biosensor for detection of a small molecule based on target binding-induced inhibition of magnetic nanoparticle (MNP) clustering. For the detection of a target small molecule, two mutually exclusive binding reactions (aptamer-target binding...... the hydrodynamic size distribution of MNPs and their clusters. A commercial Blu-ray optical pickup unit is used for optical signal acquisition, which enables the establishment of a low-cost and miniaturized biosensing platform. Experimental results show that the degree of MNP clustering correlates well...
Small-molecule kinase inhibitors: an analysis of FDA-approved drugs
DEFF Research Database (Denmark)
Wu, Peng; Nielsen, Thomas Eiland; Clausen, Mads Hartvig
2016-01-01
Small-molecule kinase inhibitors (SMKIs), 28 of which are approved by the US Food and Drug Administration (FDA), have been actively pursued as promising targeted therapeutics. Here, we assess the key structural and physicochemical properties, target selectivity and mechanism of function, and ther......Small-molecule kinase inhibitors (SMKIs), 28 of which are approved by the US Food and Drug Administration (FDA), have been actively pursued as promising targeted therapeutics. Here, we assess the key structural and physicochemical properties, target selectivity and mechanism of function...
RNA targeting by small molecules: Binding of protoberberine ...
Indian Academy of Sciences (India)
2012-06-25
Jun 25, 2012 ... Studies on RNA targeting by small molecules to specifically control certain cellular functions is an .... form secondary structures such as stem-loop, hairpin, etc. ..... paired third strand of the triplex without affecting the stability.
Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard
2018-05-01
Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.
TSH Receptor Signaling Abrogation by a Novel Small Molecule.
Latif, Rauf; Realubit, Ronald B; Karan, Charles; Mezei, Mihaly; Davies, Terry F
2016-01-01
Pathological activation of the thyroid-stimulating hormone receptor (TSHR) is caused by thyroid-stimulating antibodies in patients with Graves' disease (GD) or by somatic and rare genomic mutations that enhance constitutive activation of the receptor influencing both G protein and non-G protein signaling. Potential selective small molecule antagonists represent novel therapeutic compounds for abrogation of such abnormal TSHR signaling. In this study, we describe the identification and in vitro characterization of a novel small molecule antagonist by high-throughput screening (HTS). The identification of the TSHR antagonist was performed using a transcription-based TSH-inhibition bioassay. TSHR-expressing CHO cells, which also expressed a luciferase-tagged CRE response element, were optimized using bovine TSH as the activator, in a 384 well plate format, which had a Z score of 0.3-0.6. Using this HTS assay, we screened a diverse library of ~80,000 compounds at a final concentration of 16.7 μM. The selection criteria for a positive hit were based on a mean signal threshold of ≥50% inhibition of control TSH stimulation. The screening resulted in 450 positive hits giving a hit ratio of 0.56%. A secondary confirmation screen against TSH and forskolin - a post receptor activator of adenylyl cyclase - confirmed one TSHR-specific candidate antagonist molecule (named VA-K-14). This lead molecule had an IC 50 of 12.3 μM and a unique chemical structure. A parallel analysis for cell viability indicated that the lead inhibitor was non-cytotoxic at its effective concentrations. In silico docking studies performed using a TSHR transmembrane model showed the hydrophobic contact locations and the possible mode of inhibition of TSHR signaling. Furthermore, this molecule was capable of inhibiting TSHR stimulation by GD patient sera and monoclonal-stimulating TSHR antibodies. In conclusion, we report the identification of a novel small molecule TSHR inhibitor, which has the
[Innovative application of small molecules to influence -pathogenicity of dental plaque].
Janus, M M; Volgenant, C M C; Krom, B P
2018-05-01
Current preventive measures against infectious oral diseases are mainly focussed on plaque removal and promoting a healthy lifestyle. This in vitro study investigated a third preventive method: maintaining healthy dental plaque with the use of small molecules. As a model of dental plaque, in vitro biofilms were cultivated under conditions that induce pathogenic characteristics. The effect of erythritol and other small molecules on the pathogenic characteristics and bacterial composition of the biofilm was evaluated. The artificial sweetener erythritol and the molecule 3-Oxo-N-(2-oxycyclohexyl)dodecanamide (3-Oxo-N) had no clinically relevant effect on total biofilm formation. Erythritol did, however, lower the gingivitis related protease activity of the biofilm, while 3-Oxo-N blocked the caries related lactic acid accumulation. Furthermore, both substances ensured the biofilm maintained a young, non-pathogenic microbial composition. This shows it is possible to influence the dental plaque in a positive manner in vitro with the help of small molecules. Further research is necessary before this manipulation of dental plaque can be applied.
Charge-transport simulations in organic semiconductors
Energy Technology Data Exchange (ETDEWEB)
May, Falk
2012-07-06
In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that
A semantic web ontology for small molecules and their biological targets.
Choi, Jooyoung; Davis, Melissa J; Newman, Andrew F; Ragan, Mark A
2010-05-24
A wide range of data on sequences, structures, pathways, and networks of genes and gene products is available for hypothesis testing and discovery in biological and biomedical research. However, data describing the physical, chemical, and biological properties of small molecules have not been well-integrated with these resources. Semantically rich representations of chemical data, combined with Semantic Web technologies, have the potential to enable the integration of small molecule and biomolecular data resources, expanding the scope and power of biomedical and pharmacological research. We employed the Semantic Web technologies Resource Description Framework (RDF) and Web Ontology Language (OWL) to generate a Small Molecule Ontology (SMO) that represents concepts and provides unique identifiers for biologically relevant properties of small molecules and their interactions with biomolecules, such as proteins. We instanced SMO using data from three public data sources, i.e., DrugBank, PubChem and UniProt, and converted to RDF triples. Evaluation of SMO by use of predetermined competency questions implemented as SPARQL queries demonstrated that data from chemical and biomolecular data sources were effectively represented and that useful knowledge can be extracted. These results illustrate the potential of Semantic Web technologies in chemical, biological, and pharmacological research and in drug discovery.
Biomedical application of MALDI mass spectrometry for small-molecule analysis.
van Kampen, Jeroen J A; Burgers, Peter C; de Groot, Ronald; Gruters, Rob A; Luider, Theo M
2011-01-01
Matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) is an emerging analytical tool for the analysis of molecules with molar masses below 1,000 Da; that is, small molecules. This technique offers rapid analysis, high sensitivity, low sample consumption, a relative high tolerance towards salts and buffers, and the possibility to store sample on the target plate. The successful application of the technique is, however, hampered by low molecular weight (LMW) matrix-derived interference signals and by poor reproducibility of signal intensities during quantitative analyses. In this review, we focus on the biomedical application of MALDI-MS for the analysis of small molecules and discuss its favorable properties and its challenges as well as strategies to improve the performance of the technique. Furthermore, practical aspects and applications are presented. © 2010 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Gordon, R.J.
1990-01-01
An explanation is proposed for the qualitatively different types of behavior that have been reported for the vibrational relaxation of highly excited diatomic and polyatomic molecules. It is argued that all of the diatomic molecules that have been studied in bulk relax adiabatically at room temperature. In contrast, large polyatomic molecules have low frequency modes which act at ''doorway'' modes for the rest of the molecules, producing an impulsive relaxation mechanism. The theoretical work of Nesbitt and Hynes showed that impulsive collisions result in an exponential decay of the average vibrational energy of a Morse oscillator, whereas adiabatic collisions produce nonexponential power law behavior. We propose that this result explains a large body of data for the vibrational relaxation of small and large molecules
Urea transporter proteins as targets for small-molecule diuretics.
Esteva-Font, Cristina; Anderson, Marc O; Verkman, Alan S
2015-02-01
Conventional diuretics such as furosemide and thiazides target salt transporters in kidney tubules, but urea transporters (UTs) have emerged as alternative targets. UTs are a family of transmembrane channels expressed in a variety of mammalian tissues, in particular the kidney. UT knockout mice and humans with UT mutations exhibit reduced maximal urinary osmolality, demonstrating that UTs are necessary for the concentration of urine. Small-molecule screening has identified potent and selective inhibitors of UT-A, the UT protein expressed in renal tubule epithelial cells, and UT-B, the UT protein expressed in vasa recta endothelial cells. Data from UT knockout mice and from rodents administered UT inhibitors support the diuretic action of UT inhibition. The kidney-specific expression of UT-A1, together with high selectivity of the small-molecule inhibitors, means that off-target effects of such small-molecule drugs should be minimal. This Review summarizes the structure, expression and function of UTs, and looks at the evidence supporting the validity of UTs as targets for the development of salt-sparing diuretics with a unique mechanism of action. UT-targeted inhibitors may be useful alone or in combination with conventional diuretics for therapy of various oedemas and hyponatraemias, potentially including those refractory to treatment with current diuretics.
Enhancing SERS by Means of Supramolecular Charge Transfer
Wong, Eric; Flood, Amar; Morales, Alfredo
2009-01-01
In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.
Directory of Open Access Journals (Sweden)
Diogo de Jesus Medeiros
2013-01-01
Full Text Available The suitable computation of accurate atomic charges for the GROMACS topology *.itp files of small molecules, generated in the PRODRG server, has been a tricky task nowadays because it does not calculate atomic charges using an ab initio method. Usually additional steps of structure optimization and charges calculation, followed by a tedious manual replacement of atomic charges in the *.itp file, are needed. In order to assist this task, we report here the ITP Adjuster 1.0, a utility program developed to perform the replacement of the PRODRG charges in the *.itp files of small molecules by ab initio charges.
Zou, Xiaojing; Qu, Mingyi; Fang, Fang; Fan, Zeng; Chen, Lin; Yue, Wen; Xie, Xiaoyan; Pei, Xuetao
2017-01-01
Platelets (PLTs) are produced by megakaryocytes (MKs) that completed differentiation and endomitosis. Endomitosis is an important process in which the cell replicates its DNA without cytokinesis and develops highly polyploid MK. In this study, to gain a better PLTs production, four small molecules (Rho-Rock inhibitor (RRI), nicotinamide (NIC), Src inhibitor (SI), and Aurora B inhibitor (ABI)) and their combinations were surveyed as MK culture supplements for promoting polyploidization. Three leukemia cell lines as well as primary mononuclear cells were chosen in the function and mechanism studies of the small molecules. In an optimal culture method, cells were treated with different small molecules and their combinations. The impact of the small molecules on megakaryocytic surface marker expression, polyploidy, proliferation, and apoptosis was examined for the best MK polyploidization supplement. The elaborate analysis confirmed that the combination of SI and RRI together with our MK induction system might result in efficient ploidy promotion. Our experiments demonstrated that, besides direct downregulation on the expression of cytoskeleton protein actin, SI and RRI could significantly enhance the level of cyclins through the suppression of p53 and p21. The verified small molecule combination might be further used in the in vitro PLT manufacture and clinical applications.
Directory of Open Access Journals (Sweden)
Xiaojing Zou
2017-01-01
Full Text Available Platelets (PLTs are produced by megakaryocytes (MKs that completed differentiation and endomitosis. Endomitosis is an important process in which the cell replicates its DNA without cytokinesis and develops highly polyploid MK. In this study, to gain a better PLTs production, four small molecules (Rho-Rock inhibitor (RRI, nicotinamide (NIC, Src inhibitor (SI, and Aurora B inhibitor (ABI and their combinations were surveyed as MK culture supplements for promoting polyploidization. Three leukemia cell lines as well as primary mononuclear cells were chosen in the function and mechanism studies of the small molecules. In an optimal culture method, cells were treated with different small molecules and their combinations. The impact of the small molecules on megakaryocytic surface marker expression, polyploidy, proliferation, and apoptosis was examined for the best MK polyploidization supplement. The elaborate analysis confirmed that the combination of SI and RRI together with our MK induction system might result in efficient ploidy promotion. Our experiments demonstrated that, besides direct downregulation on the expression of cytoskeleton protein actin, SI and RRI could significantly enhance the level of cyclins through the suppression of p53 and p21. The verified small molecule combination might be further used in the in vitro PLT manufacture and clinical applications.
Advanced SPARQL querying in small molecule databases
Czech Academy of Sciences Publication Activity Database
Galgonek, Jakub; Hurt, T.; Michlíková, V.; Onderka, P.; Schwarz, J.; Vondrášek, Jiří
2016-01-01
Roč. 8, Jun 6 (2016), č. článku 31. ISSN 1758-2946 R&D Projects: GA MŠk(CZ) LM2015047 Institutional support: RVO:61388963 Keywords : Resource Description Framework * SPARQL query language * Database of small molecules Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.220, year: 2016 http://jcheminf.springeropen.com/articles/10.1186/s13321-016-0144-4
Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung
2016-11-01
We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .
International Nuclear Information System (INIS)
Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito
2012-01-01
Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)
Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi
2012-01-01
Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.
Gowda, Srivardhan Shivappa
Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was
Rancatore, Benjamin J.
2016-01-21
© 2016 American Chemical Society. Small molecules (SMs) with unique optical or electronic properties provide an opportunity to incorporate functionality into block copolymer (BCP)-based supramolecules. However, the assembly of supramolecules based on these highly crystalline molecules differs from their less crystalline counterparts. Here, two families of organic semiconductor SMs are investigated, where the composition of the crystalline core, the location (side- vs end-functionalization) of the alkyl solubilizing groups, and the constitution (branched vs linear) of the alkyl groups are varied. With these SMs, we present a systematic study of how the phase behavior of the SMs affects the overall assembly of these organic semiconductor-based supramolecules. The incorporation of SMs has a large effect on the interfacial curvature, the supramolecular periodicity, and the overall supramolecular morphology. The crystal packing of the SM within the supramolecule does not necessarily lead to the assembly of the comb block within the BCP microdomains, as is normally observed for alkyl-containing supramolecules. An unusual lamellar morphology with a wavy interface between the microdomains is observed due to changes in the packing structure of the small molecule within BCP microdomains. Since the supramolecular approach is modular and small molecules can be readily switched out, present studies provide useful guidance toward access supramolecular assemblies over several length scales using optically active and semiconducting small molecules.
Identifying genetic alterations that prime a cancer cell to respond to a particular therapeutic agent can facilitate the development of precision cancer medicines. Cancer cell-line (CCL) profiling of small-molecule sensitivity has emerged as an unbiased method to assess the relationships between genetic or cellular features of CCLs and small-molecule response. Here, we developed annotated cluster multidimensional enrichment analysis to explore the associations between groups of small molecules and groups of CCLs in a new, quantitative sensitivity dataset.
Terminal moiety-driven electrical performance of asymmetric small-molecule-based organic solar cells
DEFF Research Database (Denmark)
Huang, Jianhua; Zhang, Shanlin; jiang, Bo
2016-01-01
With respect to the successes from symmetric small molecules, asymmetric ones have recently emerged as an alternative choice. In this paper, we present the synthesis and photovoltaic properties of four asymmetric small molecule donors. The benzo[1,2-b:4,5-b']dithiophene (BDT) end in the asymmetri...
Energy Technology Data Exchange (ETDEWEB)
Secker, Daniel
2008-06-03
The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)
Contributions of charge-density research to medicinal chemistry
Directory of Open Access Journals (Sweden)
Birger Dittrich
2014-11-01
Full Text Available This article reviews efforts in accurate experimental charge-density studies with relevance to medicinal chemistry. Initially, classical charge-density studies that measure electron density distribution via least-squares refinement of aspherical-atom population parameters are summarized. Next, interaction density is discussed as an idealized situation resembling drug–receptor interactions. Scattering-factor databases play an increasing role in charge-density research, and they can be applied both to small-molecule and macromolecular structures in refinement and analysis; software development facilitates their use. Therefore combining both of these complementary branches of X-ray crystallography is recommended, and examples are given where such a combination already proved useful. On the side of the experiment, new pixel detectors are allowing rapid measurements, thereby enabling both high-throughput small-molecule studies and macromolecular structure determination to higher resolutions. Currently, the most ambitious studies compute intermolecular interaction energies of drug–receptor complexes, and it is recommended that future studies benefit from recent method developments. Selected new developments in theoretical charge-density studies are discussed with emphasis on its symbiotic relation to crystallography.
Simulation of diffusion time of small molecules in protein crystals.
Geremia, Silvano; Campagnolo, Mara; Demitri, Nicola; Johnson, Louise N
2006-03-01
A simple model for evaluation of diffusion times of small molecule into protein crystals has been developed, which takes into account the physical and chemical properties both of protein crystal and the diffusing molecules. The model also includes consideration of binding and the binding affinity of a ligand to the protein. The model has been validated by simulation of experimental set-ups of several examples found in the literature. These experiments cover a wide range of situations: from small to relatively large diffusing molecules, crystals having low, medium, or high protein density, and different size. The reproduced experiments include ligand exchange in protein crystals by soaking techniques. Despite the simplifying assumptions of the model, theoretical and experimental data are in agreement with available data, with experimental diffusion times ranging from a few seconds to several hours. The method has been used successfully for planning intermediate cryotrapping experiments in maltodextrin phosphorylase crystals.
In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.
Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C
2017-12-14
Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Small molecule probes for plant cell wall polysaccharide imaging
Directory of Open Access Journals (Sweden)
Ian eWallace
2012-05-01
Full Text Available Plant cell walls are composed of interlinked polymer networks consisting of cellulose, hemicelluloses, pectins, proteins, and lignin. The ordered deposition of these components is a dynamic process that critically affects the development and differentiation of plant cells. However, our understanding of cell wall synthesis and remodeling, as well as the diverse cell wall architectures that result from these processes, has been limited by a lack of suitable chemical probes that are compatible with live-cell imaging. In this review, we summarize the currently available molecular toolbox of probes for cell wall polysaccharide imaging in plants, with particular emphasis on recent advances in small molecule-based fluorescent probes. We also discuss the potential for further development of small molecule probes for the analysis of cell wall architecture and dynamics.
Small Molecules, Diversity and Great Expectations
Indian Academy of Sciences (India)
Small Molecules, Diversity and Great Expectations · PowerPoint Presentation · Slide 3 · Slide 4 · Slide 5 · Slide 6 · Slide 7 · Slide 8 · Slide 9 · Slide 10 · Slide 11 · Slide 12 · Slide 13 · Slide 14 · Slide 15 · Slide 16 · Slide 17 · Slide 18 · Slide 19 · Slide 20 · Slide 21 · Slide 22 · Slide 23 · Slide 24 · Slide 25 · Slide 26 · Slide 27.
Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways
Al-Habib, Mey; Yu, Zongdong
2013-01-01
One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877
Fully synthetic phage-like system for screening mixtures of small molecules in live cells.
Byk, Gerardo; Partouche, Shirly; Weiss, Aryeh; Margel, Shlomo; Khandadash, Raz
2010-05-10
A synthetic "phage-like" system was designed for screening mixtures of small molecules in live cells. The core of the system consists of 2 mum diameter cross-linked monodispersed microspheres bearing a panel of fluorescent tags and peptides or small molecules either directly synthesized or covalently conjugated to the microspheres. The microsphere mixtures were screened for affinity to cell line PC-3 (prostate cancer model) by incubation with live cells, and as was with phage-display peptide methods, unbound microspheres were removed by repeated washings followed by total lysis of cells and analysis of the bound microspheres by flow-cytometry. Similar to phage-display peptide screening, this method can be applied even in the absence of prior information about the cellular targets of the candidate ligands, which makes the system especially interesting for selection of molecules with high affinity for desired cells, tissues, or tumors. The advantage of the proposed system is the possibility of screening synthetic non-natural peptides or small molecules that cannot be expressed and screened using phage display libraries. A library composed of small molecules synthesized by the Ugi reaction was screened, and a small molecule, Rak-2, which strongly binds to PC-3 cells was found. Rak-2 was then individually synthesized and validated in a complementary whole cell-based binding assay, as well as by live cell microscopy. This new system demonstrates that a mixture of molecules bound to subcellular sized microspheres can be screened on plated cells. Together with other methods using subcellular sized particles for cellular multiplexing, this method represents an important milestone toward high throughput screening of mixtures of small molecules in live cells and in vivo with potential applications in the fields of drug delivery and diagnostic imaging.
Along the Central Dogma-Controlling Gene Expression with Small Molecules.
Schneider-Poetsch, Tilman; Yoshida, Minoru
2018-05-04
The central dogma of molecular biology, that DNA is transcribed into RNA and RNA translated into protein, was coined in the early days of modern biology. Back in the 1950s and 1960s, bacterial genetics first opened the way toward understanding life as the genetically encoded interaction of macromolecules. As molecular biology progressed and our knowledge of gene control deepened, it became increasingly clear that expression relied on many more levels of regulation. In the process of dissecting mechanisms of gene expression, specific small-molecule inhibitors played an important role and became valuable tools of investigation. Small molecules offer significant advantages over genetic tools, as they allow inhibiting a process at any desired time point, whereas mutating or altering the gene of an important regulator would likely result in a dead organism. With the advent of modern sequencing technology, it has become possible to monitor global cellular effects of small-molecule treatment and thereby overcome the limitations of classical biochemistry, which usually looks at a biological system in isolation. This review focuses on several molecules, especially natural products, that have played an important role in dissecting gene expression and have opened up new fields of investigation as well as clinical venues for disease treatment. Expected final online publication date for the Annual Review of Biochemistry Volume 87 is June 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung
2005-03-17
Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.
Li, Yilin; Li, Zhipeng; Ablekim, Tursunjan; Ren, Tianhui; Dong, Wen-Ji
2014-12-21
A rational design strategy of novel fluorophores for luminescent down-shifting (LDS) application was proposed and tested in this paper. Three new fluorophores (1a-c) with specific intramolecular charge transfer (ICT) and aggregation-induced emission (AIE) characteristics were synthesized as LDS molecules for increasing the output short circuit current density (Jsc) of a CdTe solar cell. Photophysical studies of their solution and solid states, and photovoltaic measurements of their PMMA solid films applied on a CdTe solar cell suggested that the specific spectroscopic properties and Jsc enhancement effects of these molecules were highly related to their chemical structures. The Jsc enhancement effects of these fluorophores were measured on both a CdTe small cell and a large panel. An increase in the output Jsc by as high as 5.69% for a small cell and 8.88% for a large panel was observed. Compared to a traditional LDS molecule, Y083, these fluorophores exhibited more superior capabilities of LDS.
Long, Guankui; Wu, Bo; Yang, Xuan; Kan, Bin; Zhou, Ye-Cheng; Chen, Li-Chuan; Wan, Xiangjian; Zhang, Hao-Li; Sum, Tze Chien; Chen, Yongsheng
2015-09-30
Both solution-processed polymers and small molecule based solar cells have achieved PCEs over 9% with the conventional device structure. However, for the practical applications of photovoltaic technology, further enhancement of both device performance and stability are urgently required, particularly for the inverted structure devices, since this architecture will probably be most promising for the possible coming commercialization. In this work, we have fabricated both conventional and inverted structure devices using the same small molecular donor/acceptor materials and compared the performance of both device structures, and found that the inverted structure based device gave significantly improved performance, the highest PCE so far for inverted structure based device using small molecules as the donor. Furthermore, the inverted device shows a remarkable stability with almost no obvious degradation after three months. Systematic device physics and charge generation dynamics studies, including optical simulation, light-intensity-dependent current-voltage experiments, photocurrent density-effective voltage analyses, transient absorption measurements, and electrical simulations, indicate that the significantly enhanced performance using inverted device is ascribed to the increasing of Jsc compared to the conventional device, which in turn is mainly attributed to the increased absorption of photons in the active layers, rather than the reduced nongeminate recombination.
Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S
2017-09-01
VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Adsorption of small gas molecules on B36 nanocluster
Indian Academy of Sciences (India)
Supplementary Information. Journal of Chemical Sciences. Adsorption of small gas molecules on B36 nanocluster. YOUNES VALADBEIGI. *. , HOSSEIN FARROKHPOUR and MAHMOUD TABRIZCHI. Department of chemistry, Isfahan University of Technology, Isfahan, 84156-83111, Iran. *. Corresponding Author: Younes ...
Small organic molecule based flow battery
Huskinson, Brian; Marshak, Michael; Aziz, Michael J.; Gordon, Roy G.; Betley, Theodore A.; Aspuru-Guzik, Alan; Er, Suleyman; Suh, Changwon
2018-05-08
The invention provides an electrochemical cell based on a new chemistry for a flow battery for large scale, e.g., gridscale, electrical energy storage. Electrical energy is stored chemically at an electrochemical electrode by the protonation of small organic molecules called quinones to hydroquinones. The proton is provided by a complementary electrochemical reaction at the other electrode. These reactions are reversed to deliver electrical energy. A flow battery based on this concept can operate as a closed system. The flow battery architecture has scaling advantages over solid electrode batteries for large scale energy storage.
International Nuclear Information System (INIS)
Aleksanyan, V.T.; Samvelyan, S.Kh.
1984-01-01
General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated
Structural Ordering of Semiconducting Polymers and Small-Molecules for Organic Electronics
O'Hara, Kathryn Allison
Semiconducting polymers and small-molecules can be readily incorporated into electronic devices such as organic photovoltaics (OPVs), thermoelectrics (OTEs), organic light emitting diodes (OLEDs), and organic thin film transistors (OTFTs). Organic materials offer the advantage of being processable from solution to form flexible and lightweight thin films. The molecular design, processing, and resulting thin film morphology of semiconducting polymers drastically affect the optical and electronic properties. Charge transport within films of semiconducting polymers relies on the nanoscale organization to ensure electronic coupling through overlap of molecular orbitals and to provide continuous transport pathways. While the angstrom-scale packing details can be studied using X-ray scattering methods, an understanding of the mesoscale, or the length scale over which smaller ordered regions connect, is much harder to achieve. Grain boundaries play an important role in semiconducting polymer thin films where the average grain size is much smaller than the total distance which charges must traverse in order to reach the electrodes in a device. The majority of semiconducting polymers adopt a lamellar packing structure in which the conjugated backbones align in parallel pi-stacks separated by the alkyl side-chains. Only two directions of transport are possible--along the conjugated backbone and in the pi-stacking direction. Currently, the discussion of transport between crystallites is centered around the idea of tie-chains, or "bridging" polymer chains connecting two ordered regions. However, as molecular structures become increasingly complex with the development of new donor-acceptor copolymers, additional forms of connectivity between ordered domains should be considered. High resolution transmission electron microscopy (HRTEM) is a powerful tool for directly imaging the crystalline grain boundaries in polymer and small-molecule thin films. Recently, structures
Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda
2006-08-24
The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.
Energy Technology Data Exchange (ETDEWEB)
Inal, Sahika; Castellani, Mauro; Neher, Dieter [Universitaet Potsdam, Institut fuer Physik und Astronomie, Potsdam-Golm (Germany); Sellinger, Alan [Institute of Materials Research and Engineering, Singapore (Singapore)
2009-07-01
Recent experimental investigations revealed that the photovoltaic properties of our devices are related to the balance between recombination and field-induced dissociation of interfacial excited states such as exciplexes or geminate polaron pairs. This balance was shown to be affected by the nanomorphology at the heterojunction. We have analyzed the photophysical properties of a new materials couple comprising an electron-donating PPV copolymer and a vinazene-based small molecule acceptor. Steady state and time-resolved photoluminescence (PL) spectroscopy in solution and in the solid state showed the formation of excimers within the acceptor. The associated long-range diffusion promise efficient energy harvesting at the heterojunction. On the other hand, blends of the PPV-derivative and the small molecule revealed strong exciplex formation. Therefore, bilayered hybrid small-molecular/polymeric solar cells have been fabricated by consequently spin-coating the macromolecular donor and the small molecule acceptor from two different solvents. The bilayer architecture limits recombination processes enabling high FFs of around 44% and a technologically important open circuit voltage of 1Volt.
A small-molecule switch for Golgi sulfotransferases.
de Graffenried, Christopher L; Laughlin, Scott T; Kohler, Jennifer J; Bertozzi, Carolyn R
2004-11-30
The study of glycan function is a major frontier in biology that could benefit from small molecules capable of perturbing carbohydrate structures on cells. The widespread role of sulfotransferases in modulating glycan function makes them prime targets for small-molecule modulators. Here, we report a system for conditional activation of Golgi-resident sulfotransferases using a chemical inducer of dimerization. Our approach capitalizes on two features shared by these enzymes: their requirement of Golgi localization for activity on cellular substrates and the modularity of their catalytic and localization domains. Fusion of these domains to the proteins FRB and FKBP enabled their induced assembly by the natural product rapamycin. We applied this strategy to the GlcNAc-6-sulfotransferases GlcNAc6ST-1 and GlcNAc6ST-2, which collaborate in the sulfation of L-selectin ligands. Both the activity and specificity of the inducible enzymes were indistinguishable from their WT counterparts. We further generated rapamycin-inducible chimeric enzymes comprising the localization domain of a sulfotransferase and the catalytic domain of a glycosyltransferase, demonstrating the generality of the system among other Golgi enzymes. The approach provides a means for studying sulfate-dependent processes in cellular systems and, potentially, in vivo.
Small molecule inhibitors target the tissue transglutaminase and fibronectin interaction.
Directory of Open Access Journals (Sweden)
Bakhtiyor Yakubov
Full Text Available Tissue transglutaminase (TG2 mediates protein crosslinking through generation of ε-(γ-glutamyl lysine isopeptide bonds and promotes cell adhesion through interaction with fibronectin (FN and integrins. Cell adhesion to the peritoneal matrix regulated by TG2 facilitates ovarian cancer dissemination. Therefore, disruption of the TG2-FN complex by small molecules may inhibit cell adhesion and metastasis. A novel high throughput screening (HTS assay based on AlphaLISA™ technology was developed to measure the formation of a complex between His-TG2 and the biotinylated FN fragment that binds TG2 and to discover small molecules that inhibit this protein-protein interaction. Several hits were identified from 10,000 compounds screened. The top candidates selected based on >70% inhibition of the TG2/FN complex formation were confirmed by using ELISA and bioassays measuring cell adhesion, migration, invasion, and proliferation. In conclusion, the AlphaLISA bead format assay measuring the TG2-FN interaction is robust and suitable for HTS of small molecules. One compound identified from the screen (TG53 potently inhibited ovarian cancer cell adhesion to FN, cell migration, and invasion and could be further developed as a potential inhibitor for ovarian cancer dissemination.
Novel dual small-molecule HIV inhibitors: scaffolds and discovery strategies.
Song, Anran; Yu, Haiqing; Wang, Changyuan; Zhu, Xingqi; Liu, Kexin; Ma, Xiaodong
2015-01-01
Searching for safe and effective treatments for HIV infection is still a great challenge worldwide in spite of the 27 marketed anti-HIV drugs and the powerful highly active antiretroviral therapy (HAART). As a promising prospect for generation of new HIV therapy drugs, multiple ligands (MDLs) were greatly focused on recently due to their lower toxicity, simplified dosing and patient adherence than single-target drugs. Till now, by disrupting two active sites or steps of HIV replications, a number of HIV dual inhibitors, such as CD4-gssucap120 inhibitors, CXCR4-gp20 inhibitors, RT-CXCR4 inhibitors, RT-protease inhibitors, RT-integrase inhibitors, and RTassociated functions inhibitors have been identified. Generally, these dual inhibitors were discovered mainly through screening approaches and design strategies. Of these compounds, the molecules bearing small skeletons exhibited strong anti-HIV activity and aroused great attention recently. Reviewing the progress of the dual small-molecule HIV inhibitors from the point of view of their scaffolds and discovery strategies will provide valuable information for producing more effective anti-HIV drugs. In this regard, novel dual small-molecule HIV inhibitors were illustrated, and their discovery paradigms as the major contents were also summarized in this manuscript.
Kanoh, Naoki; Asami, Aya; Kawatani, Makoto; Honda, Kaori; Kumashiro, Saori; Takayama, Hiroshi; Simizu, Siro; Amemiya, Tomoyuki; Kondoh, Yasumitsu; Hatakeyama, Satoru; Tsuganezawa, Keiko; Utata, Rei; Tanaka, Akiko; Yokoyama, Shigeyuki; Tashiro, Hideo; Osada, Hiroyuki
2006-12-18
We have developed a unique photo-cross-linking approach for immobilizing a variety of small molecules in a functional-group-independent manner. Our approach depends on the reactivity of the carbene species generated from trifluoromethylaryldiazirine upon UV irradiation. It was demonstrated in model experiments that the photogenerated carbenes were able to react with every small molecule tested, and they produced multiple conjugates in most cases. It was also found in on-array immobilization experiments that various small molecules were immobilized, and the immobilized small molecules retained their ability to interact with their binding proteins. With this approach, photo-cross-linked microarrays of about 2000 natural products and drugs were constructed. This photo-cross-linked microarray format was found to be useful not merely for ligand screening but also to study the structure-activity relationship, that is, the relationship between the structural motif (or pharmacophore) found in small molecules and its binding affinity toward a protein, by taking advantage of the nonselective nature of the photo-cross-linking process.
Small Molecules Facilitate Single Factor-Mediated Hepatic Reprogramming
Directory of Open Access Journals (Sweden)
Kyung Tae Lim
2016-04-01
Full Text Available Recent studies have shown that defined factors could lead to the direct conversion of fibroblasts into induced hepatocyte-like cells (iHeps. However, reported conversion efficiencies are very low, and the underlying mechanism of the direct hepatic reprogramming is largely unknown. Here, we report that direct conversion into iHeps is a stepwise transition involving the erasure of somatic memory, mesenchymal-to-epithelial transition, and induction of hepatic cell fate in a sequential manner. Through screening for additional factors that could potentially enhance the conversion kinetics, we have found that c-Myc and Klf4 (CK dramatically accelerate conversion kinetics, resulting in remarkably improved iHep generation. Furthermore, we identified small molecules that could lead to the robust generation of iHeps without CK. Finally, we show that Hnf1α supported by small molecules is sufficient to efficiently induce direct hepatic reprogramming. This approach might help to fully elucidate the direct conversion process and also facilitate the translation of iHep into the clinic.
Multi-small molecule conjugations as new targeted delivery carriers for tumor therapy
Directory of Open Access Journals (Sweden)
Shan L
2015-09-01
Full Text Available Lingling Shan,1 Ming Liu,2 Chao Wu,1 Liang Zhao,1 Siwen Li,3 Lisheng Xu,1 Wengen Cao,1 Guizhen Gao,1 Yueqing Gu3 1Institute of Pharmaceutical Biotechnology, School of Biology and Food Engineering, Suzhou University, Suzhou, People’s Republic of China; 2Department of Biology, University of South Dakota, Vermillion, SD, USA; 3Department of Biomedical Engineering, School of Life Science and Technology, China Pharmaceutical University, Nanjing, People’s Republic of China Abstract: In response to the challenges of cancer chemotherapeutics, including poor physicochemical properties, low tumor targeting ability, and harmful side effects, we developed a new tumor-targeted multi-small molecule drug delivery platform. Using paclitaxel (PTX as a model therapeutic, we prepared two prodrugs, ie, folic acid-fluorescein-5(6-isothiocyanate-arginine-paclitaxel (FA-FITC-Arg-PTX and folic acid-5-aminofluorescein-glutamic-paclitaxel (FA-5AF-Glu-PTX, composed of folic acid (FA, target, amino acids (Arg or Glu, linker, and fluorescent dye (fluorescein in vitro or near-infrared fluorescent dye in vivo in order to better understand the mechanism of PTX prodrug targeting. In vitro and acute toxicity studies demonstrated the low toxicity of the prodrug formulations compared with the free drug. In vitro and in vivo studies indicated that folate receptor-mediated uptake of PTX-conjugated multi-small molecule carriers induced high antitumor activity. Notably, compared with free PTX and with PTX-loaded macromolecular carriers from our previous study, this multi-small molecule-conjugated strategy improved the water solubility, loading rate, targeting ability, antitumor activity, and toxicity profile of PTX. These results support the use of multi-small molecules as tumor-targeting drug delivery systems. Keywords: multi-small molecules, paclitaxel, prodrugs, targeting, tumor therapy
AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists
Terry W. Moody; Nicole Tashakkori; Samuel A. Mantey; Paola Moreno; Irene Ramos-Alvarez; Marcello Leopoldo; Robert T. Jensen
2017-01-01
While peptide antagonists for the gastrin-releasing peptide receptor (BB2R), neuromedin B receptor (BB1R), and bombesin (BB) receptor subtype-3 (BRS-3) exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA)1 binds with high affinity to the BB1R, BB2R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB1R, BB2R, and BRS-3 with similar ...
Small molecule antagonists of integrin receptors.
Perdih, A; Dolenc, M Sollner
2010-01-01
The complex and widespread family of integrin receptors is involved in numerous physiological processes, such as tissue remodeling, angiogenesis, development of the immune response and homeostasis. In addition, their key role has been elucidated in important pathological disorders such as cancer, cardiovascular diseases, osteoporosis, autoimmune and inflammatory diseases and in the pathogenesis of infectious diseases, making them highly important targets for modern drug design campaigns. In this review we seek to present a concise overview of the small molecule antagonists of this diverse and highly complex receptor family. Integrin antagonists are classified according to the targeted integrin receptor and are discussed in four sections. First we present the fibrinogen alpha(IIb)beta3 and the vitronectin alpha (V)beta(3) receptor antagonists. The remaining selective integrin antagonists are examined in the third section. The final section is dedicated to molecules with dual or multiple integrin activity. In addition, the use of antibodies and peptidomimetic approaches to modulate the integrin receptors are discussed, as well providing the reader with an overall appreciation of the field.
Small Business Administration — Reflects total post-charge off recovery rates, as a percent of the amounts charged off by charge off year, for the major loan programs and aggregate totals by charge...
Small electrostatic storage rings; also for highly charged ions?
International Nuclear Information System (INIS)
Moeller, S.P.; Pedersen, U.V.
2001-01-01
Two years ago, a small electrostatic storage ring ELISA (electrostatic ion storage ring, Aarhus) was put into operation. The design of this small 7 m circumference ring was based on electrostatic deflection plates and quadrupoles. This is in contrast to the larger ion storage rings, which are based on magnetic focusing and deflection. The result is a small, relatively inexpensive, storage ring being able to store ions of any mass and any charge at low energy ( -11 mbar resulting in storage times of several tens of seconds for singly charged ions. The maximum number of singly charged ions that can be stored is a few 10 7 . Several experiments have already been performed in ELISA. These include lifetime studies of metastable ions and studies of fullerenes and metal-cluster ions. Lasers are also used for excitation of the circulating ions. Heating/cooling of the ring is possible. Cooling of the ring leads to significantly lower pressures, and correspondingly longer lifetimes. A change of the temperature of the vacuum chambers surrounding the ion beam also leads to a change of the spectrum of the black-body radiation, which has a significant influence on weakly bound negative ions. At the time of writing, at least two other electrostatic storage rings are being built, and more are planned. In the following, the electrostatic storage ring ELISA will be described, and results from some of the initial experiments demonstrating the performance will be shown. The relative merits of such a ring, as opposed to the larger magnetic rings and the smaller ion traps will be discussed. The potential for highly charged ions will be briefly mentioned. (orig.)
Directory of Open Access Journals (Sweden)
Rajani Thanissery
2018-06-01
Full Text Available Antibiotics are considered to be the first line of treatment for mild to moderately severe Clostridium difficile infection (CDI in humans. However, antibiotics are also risk factors for CDI as they decrease colonization resistance against C. difficile by altering the gut microbiota and metabolome. Finding compounds that selectively inhibit different stages of the C. difficile life cycle, while sparing the indigenous gut microbiota is important for the development of alternatives to standard antibiotic treatment. 2-aminoimidazole (2-AI molecules are known to disrupt bacterial protection mechanisms in antibiotic resistant bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii, and Staphylococcus aureus, but are yet to be evaluated against C. difficile. A comprehensive small molecule-screening pipeline was developed to investigate how novel small molecules affect different stages of the C. difficile life cycle (growth, toxin, and sporulation in vitro, and a library of commensal bacteria that are associated with colonization resistance against C. difficile. The initial screening tested the efficacy of eleven 2-AI molecules (compound 1 through 11 against C. difficile R20291 compared to a vancomycin (2 μg/ml control. Molecules were selected for their ability to inhibit C. difficile growth, toxin activity, and sporulation. Further testing included growth inhibition of other C. difficile strains (CD196, M68, CF5, 630, BI9, M120 belonging to distinct PCR ribotypes, and a commensal panel (Bacteroides fragilis, B. thetaiotaomicron, C. scindens, C. hylemonae, Lactobacillus acidophilus, L. gasseri, Escherichia coli, B. longum subsp. infantis. Three molecules compound 1 and 2, and 3 were microbicidal, whereas compounds 4, 7, 9, and 11 inhibited toxin activity without affecting the growth of C. difficile strains and the commensal microbiota. The antimicrobial and anti-toxin effects of 2-AI molecules need to be further characterized for mode of
Zhang, Qianchun; Luo, Xialin; Li, Gongke; Xiao, Xiaohua
2015-09-01
Small polar molecules such as nucleosides, amines, amino acids are important analytes in biological, food, environmental, and other fields. It is necessary to develop efficient sample preparation and sensitive analytical methods for rapid analysis of these polar small molecules in complex matrices. Some typical materials in sample preparation, including silica, polymer, carbon, boric acid and so on, are introduced in this paper. Meanwhile, the applications and developments of analytical methods of polar small molecules, such as reversed-phase liquid chromatography, hydrophilic interaction chromatography, etc., are also reviewed.
Small Molecules that Enhance the Catalytic Efficiency of HLA-DM
International Nuclear Information System (INIS)
Nicholson, M.; Moradi, B.; Seth, N.; Xing, X.; Cuny, G.; Stein, R.; Wucherpfenning, K.
2006-01-01
HLA-DM (DM) plays a critical role in Ag presentation to CD4 T cells by catalyzing the exchange of peptides bound to MHC class II molecules. Large lateral surfaces involved in the DM:HLA-DR (DR) interaction have been defined, but the mechanism of catalysis is not understood. In this study, we describe four small molecules that accelerate DM-catalyzed peptide exchange. Mechanistic studies demonstrate that these small molecules substantially enhance the catalytic efficiency of DM, indicating that they make the transition state of the DM:DR/peptide complex energetically more favorable. These compounds fall into two functional classes: two compounds are active only in the presence of DM, and binding data for one show a direct interaction with DM. The remaining two compounds have partial activity in the absence of DM, suggesting that they may act at the interface between DM and DR/peptide. A hydrophobic ridge in the DMβ1 domain was implicated in the catalysis of peptide exchange because the activity of three of these enhancers was substantially reduced by point mutations in this area
Small molecules targeting LapB protein prevent Listeria attachment to catfish muscle.
Directory of Open Access Journals (Sweden)
Ali Akgul
Full Text Available Listeria monocytogenes is a Gram-positive foodborne pathogen and the causative agent of listeriosis. L. monocytogenes lapB gene encodes a cell wall surface anchor protein, and mutation of this gene causes Listeria attenuation in mice. In this work, the potential role of Listeria LapB protein in catfish fillet attachment was investigated. To achieve this, boron-based small molecules designed to interfere with the active site of the L. monocytogenes LapB protein were developed, and their ability to prevent L. monocytogenes attachment to fish fillet was tested. Results indicated that seven out of nine different small molecules were effective in reducing the Listeria attachment to catfish fillets. Of these, three small molecules (SM3, SM5, and SM7 were highly effective in blocking Listeria attachment to catfish fillets. This study suggests an alternative strategy for reduction of L. monocytogenes contamination in fresh and frozen fish products.
Small amplitude variable charge dust Bernstein-Greene-Kruskal double layers
Energy Technology Data Exchange (ETDEWEB)
Amour, Rabia [Plasma Physics Group, Theoretical Physics Laboratory, Faculty of Sciences - Physics, U.S.T.H.B, Bab-Ezzouar, B.P. 32, El Alia, Algiers 16111 (Algeria); Tribeche, Mouloud [Plasma Physics Group, Theoretical Physics Laboratory, Faculty of Sciences - Physics, U.S.T.H.B, Bab-Ezzouar, B.P. 32, El Alia, Algiers 16111 (Algeria)], E-mail: mouloud-tribeche@lycos.com
2009-05-11
A first theoretical attempt is made to investigate small amplitude, variable charge dust Bernstein-Greene-Kruskal (BGK) double layers (DLs). The nature of the dust BGK-DLs (compressive or rarefactive), their strength and thickness depend sensitively on the net negative charge residing on the grain surface, the dust grain dynamics and, more interestingly, on the ion-to-electron temperatures ratio.
Small amplitude variable charge dust Bernstein-Greene-Kruskal double layers
International Nuclear Information System (INIS)
Amour, Rabia; Tribeche, Mouloud
2009-01-01
A first theoretical attempt is made to investigate small amplitude, variable charge dust Bernstein-Greene-Kruskal (BGK) double layers (DLs). The nature of the dust BGK-DLs (compressive or rarefactive), their strength and thickness depend sensitively on the net negative charge residing on the grain surface, the dust grain dynamics and, more interestingly, on the ion-to-electron temperatures ratio.
New small molecules targeting apoptosis and cell viability in osteosarcoma.
Directory of Open Access Journals (Sweden)
Doris Maugg
Full Text Available Despite the option of multimodal therapy in the treatment strategies of osteosarcoma (OS, the most common primary malignant bone tumor, the standard therapy has not changed over the last decades and still involves multidrug chemotherapy and radical surgery. Although successfully applied in many patients a large number of patients eventually develop recurrent or metastatic disease in which current therapeutic regimens often lack efficacy. Thus, new therapeutic strategies are urgently needed. In this study, we performed a phenotypic high-throughput screening campaign using a 25,000 small-molecule diversity library to identify new small molecules selectively targeting osteosarcoma cells. We could identify two new small molecules that specifically reduced cell viability in OS cell lines U2OS and HOS, but affected neither hepatocellular carcinoma cell line (HepG2 nor primary human osteoblasts (hOB. In addition, the two compounds induced caspase 3 and 7 activity in the U2OS cell line. Compared to conventional drugs generally used in OS treatment such as doxorubicin, we indeed observed a greater sensitivity of OS cell viability to the newly identified compounds compared to doxorubicin and staurosporine. The p53-negative OS cell line Saos-2 almost completely lacked sensitivity to compound treatment that could indicate a role of p53 in the drug response. Taken together, our data show potential implications for designing more efficient therapies in OS.
Small Molecule Drug Discovery at the Glucagon-Like Peptide-1 Receptor
Directory of Open Access Journals (Sweden)
Francis S. Willard
2012-01-01
Full Text Available The therapeutic success of peptide glucagon-like peptide-1 (GLP-1 receptor agonists for the treatment of type 2 diabetes mellitus has inspired discovery efforts aimed at developing orally available small molecule GLP-1 receptor agonists. Although the GLP-1 receptor is a member of the structurally complex class B1 family of GPCRs, in recent years, a diverse array of orthosteric and allosteric nonpeptide ligands has been reported. These compounds include antagonists, agonists, and positive allosteric modulators with intrinsic efficacy. In this paper, a comprehensive review of currently disclosed small molecule GLP-1 receptor ligands is presented. In addition, examples of “ligand bias” and “probe dependency” for the GLP-1 receptor are discussed; these emerging concepts may influence further optimization of known molecules or persuade designs of expanded screening strategies to identify novel chemical starting points for GLP-1 receptor drug discovery.
Advances in treating psoriasis in the elderly with small molecule inhibitors.
Cline, Abigail; Cardwell, Leah A; Feldman, Steven R
2017-12-01
Due to the chronic nature of psoriasis, the population of elderly psoriasis patients is increasing. However, many elderly psoriatic patients are not adequately treated because management is challenging as a result of comorbidities, polypharmacy, and progressive impairment of organ systems. Physicians may hesitate to use systemic or biologic agents in elderly psoriasis patients because of an increased risk of adverse events in this patient population. Small molecule medications are emerging as promising options for elderly patients with psoriasis and other inflammatory conditions. Areas covered: Here we review the efficacy, safety and tolerability of small molecule inhibitors apremilast, tofacitinib, ruxolitinib, baricitinib, and peficitinib in the treatment of psoriasis, with focus on their use in the elderly population. Expert opinion: Although small molecule inhibitors demonstrate efficacy in elderly patients with psoriasis, they will require larger head-to-head studies and post-marketing registries to evaluate their effectiveness and safety in specific patient populations. Apremilast, ruxolitinib, and peficitinib are effective agents with favorable side effect profiles; however, physicians should exercise caution when prescribing tofacitinib or baricitinib in elderly populations due to adverse events. The high cost of these drugs in the U.S. is likely to limit their use.
Efficient charge generation by relaxed charge-transfer states at organic interfaces
Vandewal, Koen
2013-11-17
Interfaces between organic electron-donating (D) and electron-accepting (A) materials have the ability to generate charge carriers on illumination. Efficient organic solar cells require a high yield for this process, combined with a minimum of energy losses. Here, we investigate the role of the lowest energy emissive interfacial charge-transfer state (CT1) in the charge generation process. We measure the quantum yield and the electric field dependence of charge generation on excitation of the charge-transfer (CT) state manifold via weakly allowed, low-energy optical transitions. For a wide range of photovoltaic devices based on polymer:fullerene, small-molecule:C60 and polymer:polymer blends, our study reveals that the internal quantum efficiency (IQE) is essentially independent of whether or not D, A or CT states with an energy higher than that of CT1 are excited. The best materials systems show an IQE higher than 90% without the need for excess electronic or vibrational energy. © 2014 Macmillan Publishers Limited.
Efficient charge generation by relaxed charge-transfer states at organic interfaces
Vandewal, Koen; Albrecht, Steve N.; Hoke, Eric T.; Graham, Kenneth; Widmer, Johannes; Douglas, Jessica D.; Schubert, Marcel; Mateker, William R.; Bloking, Jason T.; Burkhard, George F.; Sellinger, Alan; Frechet, Jean; Amassian, Aram; Riede, Moritz Kilian; McGehee, Michael D.; Neher, Dieter; Salleo, Alberto
2013-01-01
Interfaces between organic electron-donating (D) and electron-accepting (A) materials have the ability to generate charge carriers on illumination. Efficient organic solar cells require a high yield for this process, combined with a minimum of energy losses. Here, we investigate the role of the lowest energy emissive interfacial charge-transfer state (CT1) in the charge generation process. We measure the quantum yield and the electric field dependence of charge generation on excitation of the charge-transfer (CT) state manifold via weakly allowed, low-energy optical transitions. For a wide range of photovoltaic devices based on polymer:fullerene, small-molecule:C60 and polymer:polymer blends, our study reveals that the internal quantum efficiency (IQE) is essentially independent of whether or not D, A or CT states with an energy higher than that of CT1 are excited. The best materials systems show an IQE higher than 90% without the need for excess electronic or vibrational energy. © 2014 Macmillan Publishers Limited.
UPAR targeted molecular imaging of cancers with small molecule-based probes.
Ding, Feng; Chen, Seng; Zhang, Wanshu; Tu, Yufeng; Sun, Yao
2017-10-15
Molecular imaging can allow the non-invasive characterization and measurement of biological and biochemical processes at the molecular and cellular levels in living subjects. The imaging of specific molecular targets that are associated with cancers could allow for the earlier diagnosis and better treatment of diseases. Small molecule-based probes play prominent roles in biomedical research and have high clinical translation ability. Here, with an emphasis on small molecule-based probes, we review some recent developments in biomarkers, imaging techniques and multimodal imaging in molecular imaging and highlight the successful applications for molecular imaging of cancers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cui, Liang; Zou, Yuan; Lin, Ninghang; Zhu, Zhi; Jenkins, Gareth; Yang, Chaoyong James
2012-07-03
Fluorescence anisotropy (FA) is a reliable and excellent choice for fluorescence sensing. One of the key factors influencing the FA value for any molecule is the molar mass of the molecule being measured. As a result, the FA method with functional nucleic acid aptamers has been limited to macromolecules such as proteins and is generally not applicable for the analysis of small molecules because their molecular masses are relatively too small to produce observable FA value changes. We report here a molecular mass amplifying strategy to construct anisotropy aptamer probes for small molecules. The probe is designed in such a way that only when a target molecule binds to the probe does it activate its binding ability to an anisotropy amplifier (a high molecular mass molecule such as protein), thus significantly increasing the molecular mass and FA value of the probe/target complex. Specifically, a mass amplifying probe (MAP) consists of a targeting aptamer domain against a target molecule and molecular mass amplifying aptamer domain for the amplifier protein. The probe is initially rendered inactive by a small blocking strand partially complementary to both target aptamer and amplifier protein aptamer so that the mass amplifying aptamer domain would not bind to the amplifier protein unless the probe has been activated by the target. In this way, we prepared two probes that constitute a target (ATP and cocaine respectively) aptamer, a thrombin (as the mass amplifier) aptamer, and a fluorophore. Both probes worked well against their corresponding small molecule targets, and the detection limits for ATP and cocaine were 0.5 μM and 0.8 μM, respectively. More importantly, because FA is less affected by environmental interferences, ATP in cell media and cocaine in urine were directly detected without any tedious sample pretreatment. Our results established that our molecular mass amplifying strategy can be used to design aptamer probes for rapid, sensitive, and selective
International Nuclear Information System (INIS)
Wells, E.; Ben-Itzhak, I.; Carnes, K.D.; Krishnamurthi, V.
1996-01-01
The ratio of double- to single-ionization (DI/SI) as well as the ratio of ionization-excitation to single-ionization (IE/SI) in hydrogen molecules was studied by examining the effect of the projectile charge on these processes. The DI/SI and IE/SI ratios were measured using the coincidence time of flight technique at a fixed velocity (1 MeV/amu) over a range of projectile charge states (q = 1-9,14,20). Preliminary results indicate that for a highly charged F 9+ projectile the DI/SI and IE/SI ratios are 6.8% and 24.7%, respectively, a large increase from the ratios of 0.13% and 1.95%, respectively, for H + projectiles. For low charge states, the DI/SI is negligible relative to the IE/SI ratio, while for more highly charged projectiles the DI/SI ratio becomes comparable to the IE/SI ratio. This indicates that double-ionization increases much more rapidly with projectile charge than ionization-excitation
Psmir: a database of potential associations between small molecules and miRNAs.
Meng, Fanlin; Wang, Jing; Dai, Enyu; Yang, Feng; Chen, Xiaowen; Wang, Shuyuan; Yu, Xuexin; Liu, Dianming; Jiang, Wei
2016-01-13
miRNAs are key post-transcriptional regulators of many essential biological processes, and their dysregulation has been validated in almost all human cancers. Restoring aberrantly expressed miRNAs might be a novel therapeutics. Recently, many studies have demonstrated that small molecular compounds can affect miRNA expression. Thus, prediction of associations between small molecules and miRNAs is important for investigation of miRNA-targeted drugs. Here, we analyzed 39 miRNA-perturbed gene expression profiles, and then calculated the similarity of transcription responses between miRNA perturbation and drug treatment to predict drug-miRNA associations. At the significance level of 0.05, we obtained 6501 candidate associations between 1295 small molecules and 25 miRNAs, which included 624 FDA approved drugs. Finally, we constructed the Psmir database to store all potential associations and the related materials. In a word, Psmir served as a valuable resource for dissecting the biological significance in small molecules' effects on miRNA expression, which will facilitate developing novel potential therapeutic targets or treatments for human cancers. Psmir is supported by all major browsers, and is freely available at http://www.bio-bigdata.com/Psmir/.
X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule
Directory of Open Access Journals (Sweden)
Li Fang
2017-05-01
Full Text Available Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. We present our investigation of photoionization and nuclear dynamics in methyl iodine (CH3I molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up to 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.
Light incoupling in small molecule organic solar cells
Energy Technology Data Exchange (ETDEWEB)
Allinger, Nikola; Meiss, Jan; Riede, Moritz; Leo, Karl [Institut fuer Angewandte Photophysik, Technische Universitaet Dresden, 01069 Dresden (Germany); Gnehr, Wolf-Michael [Heliatek GmbH, Liebigstrasse 26, 01187 Dresden (Germany)
2008-07-01
Light incoupling is an essential topic for optimization of organic solar cells. In our group, we examine light incoupling of different kinds of transparent contacting materials as well as external dielectric coatings, using optical simulation of thin film systems and experimental methods. Thin films of small molecules are prepared by thermal evaporation in a multi-chamber UHV system. Complex refraction indices of various materials are calculated from reflection and transmission measurements of monolayers. For modelling of optical properties of thin film systems, we developed a numerical simulation program based on the transfer matrix method. The cell structures investigated consist of nanolayers of small molecules, using ZnPc/C60 as an acceptor-donor heterojunction. As contact materials, we compare the expensive standard material indium tin oxide (ITO) with more cost-efficient alternatives like thin Ag layers or spin-coated layers of the polymer PEDOT:PSS, and discuss the resulting cell properties. Additional dielectric layers of varying materials, like tris(8-hydroxy-quinolinate)-aluminum (Alq3) or N,N'-tetrakis(4-methoxyphenyl)-benzidine (MeO-TPD), are deposited on top of the stack and their influence on cell efficiencies is investigated.
Directory of Open Access Journals (Sweden)
Laura Pandolfi
2016-01-01
Full Text Available Current tissue engineering strategies focus on restoring damaged tissue architectures using biologically active scaffolds. The ideal scaffold would mimic the extracellular matrix of any tissue of interest, promoting cell proliferation and de novo extracellular matrix deposition. A plethora of techniques have been evaluated to engineer scaffolds for the controlled and targeted release of bioactive molecules to provide a functional structure for tissue growth and remodeling, as well as enhance recruitment and proliferation of autologous cells within the implant. Recently, novel approaches using small molecules, instead of growth factors, have been exploited to regulate tissue regeneration. The use of small synthetic molecules could be very advantageous because of their stability, tunability, and low cost. Herein, we propose a chitosan–gelatin scaffold functionalized with composite microspheres consisting of mesoporous silicon microparticles and poly(dl-lactic-co-glycolic acid for the controlled release of sphingosine-1-phospate, a small molecule of interest. We characterized the platform with scanning electron microscopy, Fourier transform infrared spectroscopy, and confocal microscopy. Finally, the biocompatibility of this multiscale system was analyzed by culturing human mesenchymal stem cells onto the scaffold. The presented strategy establishes the basis of a versatile scaffold for the controlled release of small molecules and for culturing mesenchymal stem cells for regenerative medicine applications.
Directory of Open Access Journals (Sweden)
S. Suresh Kumar
2014-12-01
Full Text Available Human pluripotent stem cells, including human embryonic stem cells (hESCs and human induced pluripotent stem cells (hiPSCs, hold promise as novel therapeutic tools for diabetes treatment because of their self-renewal capacity and ability to differentiate into beta (β-cells. Small and large molecules play important roles in each stage of β-cell differentiation from both hESCs and hiPSCs. The small and large molecules that are described in this review have significantly advanced efforts to cure diabetic disease. Lately, effective protocols have been implemented to induce hESCs and human mesenchymal stem cells (hMSCs to differentiate into functional β-cells. Several small molecules, proteins, and growth factors promote pancreatic differentiation from hESCs and hMSCs. These small molecules (e.g., cyclopamine, wortmannin, retinoic acid, and sodium butyrate and large molecules (e.g. activin A, betacellulin, bone morphogentic protein (BMP4, epidermal growth factor (EGF, fibroblast growth factor (FGF, keratinocyte growth factor (KGF, hepatocyte growth factor (HGF, noggin, transforming growth factor (TGF-α, and WNT3A are thought to contribute from the initial stages of definitive endoderm formation to the final stages of maturation of functional endocrine cells. We discuss the importance of such small and large molecules in uniquely optimized protocols of β-cell differentiation from stem cells. A global understanding of various small and large molecules and their functions will help to establish an efficient protocol for β-cell differentiation.
Kumar, S. Suresh; Alarfaj, Abdullah A.; Munusamy, Murugan A.; Singh, A. J. A. Ranjith; Peng, I-Chia; Priya, Sivan Padma; Hamat, Rukman Awang; Higuchi, Akon
2014-01-01
Human pluripotent stem cells, including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), hold promise as novel therapeutic tools for diabetes treatment because of their self-renewal capacity and ability to differentiate into beta (β)-cells. Small and large molecules play important roles in each stage of β-cell differentiation from both hESCs and hiPSCs. The small and large molecules that are described in this review have significantly advanced efforts to cure diabetic disease. Lately, effective protocols have been implemented to induce hESCs and human mesenchymal stem cells (hMSCs) to differentiate into functional β-cells. Several small molecules, proteins, and growth factors promote pancreatic differentiation from hESCs and hMSCs. These small molecules (e.g., cyclopamine, wortmannin, retinoic acid, and sodium butyrate) and large molecules (e.g. activin A, betacellulin, bone morphogentic protein (BMP4), epidermal growth factor (EGF), fibroblast growth factor (FGF), keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), noggin, transforming growth factor (TGF-α), and WNT3A) are thought to contribute from the initial stages of definitive endoderm formation to the final stages of maturation of functional endocrine cells. We discuss the importance of such small and large molecules in uniquely optimized protocols of β-cell differentiation from stem cells. A global understanding of various small and large molecules and their functions will help to establish an efficient protocol for β-cell differentiation. PMID:25526563
Energy Technology Data Exchange (ETDEWEB)
Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.
2016-07-15
We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.
Excitation of atoms and molecules in collisions with highly charged ions
International Nuclear Information System (INIS)
Watson, R.L.
1991-01-01
Much of the work this year has been directed toward studies of charge exchange and ionization in single collisions of heavy ions with gaseous atoms and molecules. A study of the double ionization of He by high energy N 7+ ions, which began last year, was extended up in energy to 40 MeV/amu. These measurements verified the deviations from the predictions of theory observed in our previous work and indicated that the energy required to reach the limiting value of the ratio of double-to-single ionization cross sections may be as high as 70 MeV/amu
Nanoelectropulse-driven membrane perturbation and small molecule permeabilization
Directory of Open Access Journals (Sweden)
Sun Yinghua
2006-10-01
Full Text Available Abstract Background Nanosecond, megavolt-per-meter pulsed electric fields scramble membrane phospholipids, release intracellular calcium, and induce apoptosis. Flow cytometric and fluorescence microscopy evidence has associated phospholipid rearrangement directly with nanoelectropulse exposure and supports the hypothesis that the potential that develops across the lipid bilayer during an electric pulse drives phosphatidylserine (PS externalization. Results In this work we extend observations of cells exposed to electric pulses with 30 ns and 7 ns durations to still narrower pulse widths, and we find that even 3 ns pulses are sufficient to produce responses similar to those reported previously. We show here that in contrast to unipolar pulses, which perturb membrane phospholipid order, tracked with FM1-43 fluorescence, only at the anode side of the cell, bipolar pulses redistribute phospholipids at both the anode and cathode poles, consistent with migration of the anionic PS head group in the transmembrane field. In addition, we demonstrate that, as predicted by the membrane charging hypothesis, a train of shorter pulses requires higher fields to produce phospholipid scrambling comparable to that produced by a time-equivalent train of longer pulses (for a given applied field, 30, 4 ns pulses produce a weaker response than 4, 30 ns pulses. Finally, we show that influx of YO-PRO-1, a fluorescent dye used to detect early apoptosis and activation of the purinergic P2X7 receptor channels, is observed after exposure of Jurkat T lymphoblasts to sufficiently large numbers of pulses, suggesting that membrane poration occurs even with nanosecond pulses when the electric field is high enough. Propidium iodide entry, a traditional indicator of electroporation, occurs with even higher pulse counts. Conclusion Megavolt-per-meter electric pulses as short as 3 ns alter the structure of the plasma membrane and permeabilize the cell to small molecules. The dose
Simulations of charge transport in organic compounds
Energy Technology Data Exchange (ETDEWEB)
Vehoff, Thorsten
2010-05-05
We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main
Dissociation in small molecules
International Nuclear Information System (INIS)
Dehmer, P.M.
1982-01-01
The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Identification and characterization of small molecule inhibitors of a PHD finger§
Wagner, Elise K.; Nath, Nidhi; Flemming, Rod; Feltenberger, John B.; Denu, John M.
2012-01-01
A number of histone-binding domains are implicated in cancer through improper binding of chromatin. In a clinically reported case of acute myeloid leukemia (AML), a genetic fusion protein between nucleoporin 98 and the third plant homeodomain (PHD) finger of JARID1A drives an oncogenic transcriptional program that is dependent on histone binding by the PHD finger. By exploiting the requirement for chromatin binding in oncogenesis, therapeutics targeting histone readers may represent a new paradigm in drug development. In this study, we developed a novel small molecule screening strategy that utilizes HaloTag technology to identify several small molecules that disrupt binding of the JARID1A PHD finger to histone peptides. Small molecule inhibitors were validated biochemically through affinity pull downs, fluorescence polarization, and histone reader specificity studies. One compound was modified through medicinal chemistry to improve its potency while retaining histone reader selectivity. Molecular modeling and site-directed mutagenesis of JARID1A PHD3 provided insights into the biochemical basis of competitive inhibition. PMID:22994852
Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S
2016-01-15
The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small
Panidi, Julianna; Paterson, Alexandra F.; Khim, Dongyoon; Fei, Zhuping; Han, Yang; Tsetseris, Leonidas; Vourlias, George; Patsalas, Panos A.; Heeney, Martin; Anthopoulos, Thomas D.
2017-01-01
Improving the charge carrier mobility of solution-processable organic semiconductors is critical for the development of advanced organic thin-film transistors and their application in the emerging sector of printed electronics. Here, a simple method is reported for enhancing the hole mobility in a wide range of organic semiconductors, including small-molecules, polymers, and small-molecule:polymer blends, with the latter systems exhibiting the highest mobility. The method is simple and relies on admixing of the molecular Lewis acid B(C6F5)(3) in the semiconductor formulation prior to solution deposition. Two prototypical semiconductors where B(C6F5)(3) is shown to have a remarkable impact are the blends of 2,8-difluoro-5,11-bis(triethylsilylethynyl)anthradithiophene:poly(triarylamine) (diF-TESADT:PTAA) and 2,7-dioctyl[1]-benzothieno[3,2-b][1]benzothiophene:poly(indacenodithiophene-co-benzothiadiazole) (C8-BTBT:C16-IDTBT), for which hole mobilities of 8 and 11 cm(2) V-1 s(-1), respectively, are obtained. Doping of the 6,13-bis(triisopropylsilylethynyl)pentacene:PTAA blend with B(C6F5)(3) is also shown to increase the maximum hole mobility to 3.7 cm(2) V-1 s(-1). Analysis of the single and multicomponent materials reveals that B(C6F5)(3) plays a dual role, first acting as an efficient p-dopant, and secondly as a microstructure modifier. Semiconductors that undergo simultaneous p-doping and dopant-induced long-range crystallization are found to consistently outperform transistors based on the pristine materials. Our work underscores Lewis acid doping as a generic strategy towards high performance printed organic microelectronics.
Panidi, Julianna; Paterson, Alexandra F; Khim, Dongyoon; Fei, Zhuping; Han, Yang; Tsetseris, Leonidas; Vourlias, George; Patsalas, Panos A; Heeney, Martin; Anthopoulos, Thomas D
2018-01-01
Improving the charge carrier mobility of solution-processable organic semiconductors is critical for the development of advanced organic thin-film transistors and their application in the emerging sector of printed electronics. Here, a simple method is reported for enhancing the hole mobility in a wide range of organic semiconductors, including small-molecules, polymers, and small-molecule:polymer blends, with the latter systems exhibiting the highest mobility. The method is simple and relies on admixing of the molecular Lewis acid B(C 6 F 5 ) 3 in the semiconductor formulation prior to solution deposition. Two prototypical semiconductors where B(C 6 F 5 ) 3 is shown to have a remarkable impact are the blends of 2,8-difluoro-5,11-bis(triethylsilylethynyl)anthradithiophene:poly(triarylamine) (diF-TESADT:PTAA) and 2,7-dioctyl[1]-benzothieno[3,2-b][1]benzothiophene:poly(indacenodithiophene-co-benzothiadiazole) (C8-BTBT:C16-IDTBT), for which hole mobilities of 8 and 11 cm 2 V -1 s -1 , respectively, are obtained. Doping of the 6,13-bis(triisopropylsilylethynyl)pentacene:PTAA blend with B(C 6 F 5 ) 3 is also shown to increase the maximum hole mobility to 3.7 cm 2 V -1 s -1 . Analysis of the single and multicomponent materials reveals that B(C 6 F 5 ) 3 plays a dual role, first acting as an efficient p-dopant, and secondly as a microstructure modifier. Semiconductors that undergo simultaneous p-doping and dopant-induced long-range crystallization are found to consistently outperform transistors based on the pristine materials. Our work underscores Lewis acid doping as a generic strategy towards high performance printed organic microelectronics.
Panidi, Julianna
2017-10-05
Improving the charge carrier mobility of solution-processable organic semiconductors is critical for the development of advanced organic thin-film transistors and their application in the emerging sector of printed electronics. Here, a simple method is reported for enhancing the hole mobility in a wide range of organic semiconductors, including small-molecules, polymers, and small-molecule:polymer blends, with the latter systems exhibiting the highest mobility. The method is simple and relies on admixing of the molecular Lewis acid B(C6F5)(3) in the semiconductor formulation prior to solution deposition. Two prototypical semiconductors where B(C6F5)(3) is shown to have a remarkable impact are the blends of 2,8-difluoro-5,11-bis(triethylsilylethynyl)anthradithiophene:poly(triarylamine) (diF-TESADT:PTAA) and 2,7-dioctyl[1]-benzothieno[3,2-b][1]benzothiophene:poly(indacenodithiophene-co-benzothiadiazole) (C8-BTBT:C16-IDTBT), for which hole mobilities of 8 and 11 cm(2) V-1 s(-1), respectively, are obtained. Doping of the 6,13-bis(triisopropylsilylethynyl)pentacene:PTAA blend with B(C6F5)(3) is also shown to increase the maximum hole mobility to 3.7 cm(2) V-1 s(-1). Analysis of the single and multicomponent materials reveals that B(C6F5)(3) plays a dual role, first acting as an efficient p-dopant, and secondly as a microstructure modifier. Semiconductors that undergo simultaneous p-doping and dopant-induced long-range crystallization are found to consistently outperform transistors based on the pristine materials. Our work underscores Lewis acid doping as a generic strategy towards high performance printed organic microelectronics.
AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists.
Moody, Terry W; Tashakkori, Nicole; Mantey, Samuel A; Moreno, Paola; Ramos-Alvarez, Irene; Leopoldo, Marcello; Jensen, Robert T
2017-01-01
While peptide antagonists for the gastrin-releasing peptide receptor (BB 2 R), neuromedin B receptor (BB 1 R), and bombesin (BB) receptor subtype-3 (BRS-3) exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA)1 binds with high affinity to the BB 1 R, BB 2 R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB 1 R, BB 2 R, and BRS-3 with similar affinity ( K i = 1.4-10.8 µM). AM-13 and AM-14 were approximately an order of magnitude less potent than AM-37 and ST-36. The ability of BA1 to elevate cytosolic Ca 2+ in human lung cancer cells transfected with BB 1 R, BB 2 R, and BRS-3 was antagonized by AM-37 and ST-36. BA1 increased tyrosine phosphorylation of the EGFR and ERK in lung cancer cells, which was blocked by AM-37 and ST-36. AM-37 and ST-36 reduced the growth of lung cancer cells that have BBR. The results indicate that AM-37 and ST-36 function as small molecule BB receptor antagonists.
Zhu, Chenggang; Zhu, Xiangdong; Landry, James P; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan
2016-03-16
Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%.
Biased small-molecule ligands for selective inhibition of HIV-1 cell entry via CCR5
DEFF Research Database (Denmark)
Berg, Christian; Spiess, Katja; von Lüttichau, Hans Rudolf
2016-01-01
Since the discovery of HIV's use of CCR5 as the primary coreceptor in fusion, the focus on developing small-molecule receptor antagonists for inhibition hereof has only resulted in one single drug, Maraviroc. We therefore investigated the possibility of using small-molecule CCR5 agonists as HIV-1...
Small molecules as therapy for uveitis: a selected perspective of new and developing agents.
Pleyer, Uwe; Algharably, Engi Abdel-Hady; Feist, Eugen; Kreutz, Reinhold
2017-09-01
Intraocular inflammation (uveitis) remains a significant burden of legal blindness. Because of its immune mediated and chronic recurrent nature, common therapy includes corticosteroids, disease-modifying anti-rheumatic drugs and more recently biologics as immune modulatory agents. The purpose of this article is to identify the role of new treatment approaches focusing on small molecules as therapeutic option in uveitis. Areas covered: A MEDLINE database search was conducted through February 2017 using the terms 'uveitis' and 'small molecule'. To provide ongoing and future perspectives in treatment options, also clinical trials as registered at ClinicalTrials.gov were included. Both, results from experimental as well as clinical research in this field were included. Since this field is rapidly evolving, a selection of promising agents had to be made. Expert opinion: Small molecules may interfere at different steps of the inflammatory cascade and appear as an interesting option in the treatment algorithm of uveitis. Because of their highly targeted molecular effects and their favorable bioavailability with the potential of topical application small molecules hold great promise. Nevertheless, a careful evaluation of these agents has to be made, since current experience is almost exclusively based on experimental uveitis models and few registered trials.
Immobilization of small molecules and proteins by radio-derivatized polystyrene
International Nuclear Information System (INIS)
Varga, J.M.; Fritsch, P.
1990-01-01
When molded polystyrene (PS) products (e.g., microtiter plates) or latex particles are irradiated with high-energy (1-10 Mrads) gamma rays in the presence of nonpolymerizable small molecules such as aromatic amines, some of these molecules incorporate into PS, which leads to the formation of radio-derivatized PS (RDPS). Two classes of RDPS can be identified regarding their ability for immobilization of biologically important molecules: (1) reactive RDPS that are able to form covalent bonds with molecules such as proteins without the help of cross-linkers, and (2) functionalized RDPS that can be used for the immobilization of molecules with activators (e.g., carbodiimides) or cross-linkers. The method can be used for the production of low-noise supports for binding assays. Most of the RDPS can be produced without impairment of the optical quality of PS, making derivatized microtiter plates suitable for colorimetric assays. The principle can be applied for the preparation of affinity sorbents, e.g., for high-performance affinity chromatography and for the immobilization of enzymes using latex PS particles
Small-molecule azomethines : Organic photovoltaics via Schiff base condensation chemistry
Petrus, M.L.; Bouwer, R.K.M.; Lafont, U.; Athanasopoulos, S.; Greenham, N.C.; Dingemans, T.J.
2014-01-01
Conjugated small-molecule azomethines for photovoltaic applications were prepared via Schiff base condensation chemistry. Bulk heterojunction (BHJ) devices exhibit efficiencies of 1.2% with MoOx as the hole-transporting layer. The versatility and simplicity of the chemistry is illustrated by
A-π-D-π-A Electron-Donating Small Molecules for Solution-Processed Organic Solar Cells: A Review.
Wang, Zhen; Zhu, Lingyun; Shuai, Zhigang; Wei, Zhixiang
2017-11-01
Organic solar cells based on semiconducting polymers and small molecules have attracted considerable attention in the last two decades. Moreover, the power conversion efficiencies for solution-processed solar cells containing A-π-D-π-A-type small molecules and fullerenes have reached 11%. However, the method for designing high-performance, photovoltaic small molecules still remains unclear. In this review, recent studies on A-π-D-π-A electron-donating small molecules for organic solar cells are introduced. Moreover, the relationships between molecular properties and device performances are summarized, from which inspiration for the future design of high performance organic solar cells may be obtained. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Vladimir I. Volchikhin
2017-06-01
Full Text Available Introduction: The study promotes to decrease a number of errors of calculating the correlation coefficient in small test samples. Materials and Methods: We used simulation tool for the distribution functions of the density values of the correlation coefficient in small samples. A method for quantization of the data, allows obtaining a discrete spectrum states of one of the varieties of correlation functional. This allows us to consider the proposed structure as a mathematical correlation molecule, described by some analogue continuous-quantum Schrödinger equation. Results: The chi-squared Pearson’s molecule on small samples allows enhancing power of classical chi-squared test to 20 times. A mathematical correlation molecule described in the article has similar properties. It allows in the future reducing calculation errors of the classical correlation coefficients in small samples. Discussion and Conclusions: The authors suggest that there are infinitely many mathematical molecules are similar in their properties to the actual physical molecules. Schrödinger equations are not unique, their analogues can be constructed for each mathematical molecule. You can expect a mathematical synthesis of molecules for a large number of known statistical tests and statistical moments. All this should make it possible to reduce calculation errors due to quantum effects that occur in small test samples.
Evaluation of EML4-ALK Fusion Proteins in Non–Small Cell Lung Cancer Using Small Molecule Inhibitors
Directory of Open Access Journals (Sweden)
Yongjun Li
2011-01-01
Full Text Available The echinoderm microtubule–associated protein-like 4–anaplastic lymphoma kinase (EML4-ALK fusion gene resulting from an inversion within chromosome 2p occurs in approximately 5% of non–small cell lung cancer and is mu-tually exclusive with Ras and EGFR mutations. In this study, we have used a potent and selective ALK small molecule inhibitor, NPV-TAE684, to assess the oncogenic role of EML4-ALK in non–small cell lung cancer (NSCLC. We show here that TAE684 inhibits proliferation and induces cell cycle arrest, apoptosis, and tumor regression in two NSCLC models that harbor EML4-ALK fusions. TAE684 inhibits EML4-ALK activation and its downstream signaling including ERK, AKT, and STAT3. We used microarray analysis to carry out targeted pathway studies of gene expression changes in H2228 NSCLC xenograft model after TAE684 treatment and identified a gene signature of EML4-ALK inhibition. The gene signature represents 1210 known human genes, and the top biologic processes represented by these genes are cell cycle, DNA synthesis, cell proliferation, and cell death. We also compared the effect of TAE684 with PF2341066, a c-Met and ALK small molecule inhibitor currently in clinical trial in cancers harboring ALK fusions, and demonstrated that TAE684 is a much more potent inhibitor of EML4-ALK. Our data demonstrate that EML4-ALK plays an important role in the pathogenesis of a subset of NSCLC and provides insight into the mech-anism of EML4-ALK inhibition by a small molecule inhibitor.
Maiti, Prabal K.; Bagchi, Biman
2009-12-01
In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.
International Nuclear Information System (INIS)
Chen, Wei-Ren
2009-01-01
Our previous study of the structure change of poly(amidoamine) starburst dendrimers (PAMAM) dendrimer of generation 5 (G5) have demonstrated that although the overall molecular size is practically unaffected by increasing DCl concentration, a configurational transformation, from a diffusive density profile to a more uniform density distribution, is clearly observed. In the current paper, the focus is placed on understanding the effect of counterion identity on the inter-molecular structure and the conformational properties by studying the effect due to DBr using small angle neutron scattering (SANS) and integral equation theory. While the overall molecular size is found to be essentially unaffected by the change in the pD of solutions, it is surprising that the intra-molecular configurational transformation is not observed when DBr is used. The overall effective charge of a dendrimer is nearly the same for 1, the effect of counterion identity becomes significant, the effective charge carried by a charged G5 PAPAM protonated by DBr becomes smaller than that of solutions with DCl. As a consequence, a counterion identity dependence of counterion association is revealed: Under the same level of molecular protonation, the specific counterion association, which is defined as the ratio of bound chloride anions to positively charged amines per molecule, is larger for the G5 PAMAM dendrimer charged by DBr than the one by DCl.
Bulashevska, Alla; Stein, Martin; Jackson, David; Eils, Roland
2009-12-01
Accurate computational methods that can help to predict biological function of a protein from its sequence are of great interest to research biologists and pharmaceutical companies. One approach to assume the function of proteins is to predict the interactions between proteins and other molecules. In this work, we propose a machine learning method that uses a primary sequence of a domain to predict its propensity for interaction with small molecules. By curating the Pfam database with respect to the small molecule binding ability of its component domains, we have constructed a dataset of small molecule binding and non-binding domains. This dataset was then used as training set to learn a Bayesian classifier, which should distinguish members of each class. The domain sequences of both classes are modelled with Markov chains. In a Jack-knife test, our classification procedure achieved the predictive accuracies of 77.2% and 66.7% for binding and non-binding classes respectively. We demonstrate the applicability of our classifier by using it to identify previously unknown small molecule binding domains. Our predictions are available as supplementary material and can provide very useful information to drug discovery specialists. Given the ubiquitous and essential role small molecules play in biological processes, our method is important for identifying pharmaceutically relevant components of complete proteomes. The software is available from the author upon request.
Polymer and small molecule based hybrid light source
Choong, Vi-En; Choulis, Stelios; Krummacher, Benjamin Claus; Mathai, Mathew; So, Franky
2010-03-16
An organic electroluminescent device, includes: a substrate; a hole-injecting electrode (anode) coated over the substrate; a hole injection layer coated over the anode; a hole transporting layer coated over the hole injection layer; a polymer based light emitting layer, coated over the hole transporting layer; a small molecule based light emitting layer, thermally evaporated over the polymer based light emitting layer; and an electron-injecting electrode (cathode) deposited over the electroluminescent polymer layer.
Recent advances in the discovery of small molecule c-Met Kinase inhibitors.
Parikh, Palak K; Ghate, Manjunath D
2018-01-01
c-Met is a prototype member of a subfamily of heterodimeric receptor tyrosine kinases (RTKs) and is the receptor for hepatocyte growth factor (HGF). Binding of HGF to its receptor c-Met, initiates a wide range of cellular signalling, including those involved in proliferation, motility, migration and invasion. Importantly, dysregulated HGF/c-Met signalling is a driving factor for numerous malignancies and promotes tumour growth, invasion, dissemination and/or angiogenesis. Dysregulated HGF/c-Met signalling has also been associated with poor clinical outcomes and resistance acquisition to some approved targeted therapies. Thus, c-Met kinase has emerged as a promising target for cancer drug development. Different therapeutic approaches targeting the HGF/c-Met signalling pathway are under development for targeted cancer therapy, among which small molecule inhibitors of c-Met kinase constitute the largest effort within the pharmaceutical industry. The review is an effort to summarize recent advancements in medicinal chemistry development of small molecule c-Met kinase inhibitors as potential anti-cancer agents which would certainly help future researchers to bring further developments in the discovery of small molecule c-Met kinase inhibitors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Hamidi-Asl, Ezat; Daems, Devin; De Wael, Karolien; Van Camp, Guy; Nagels, Luc J
2014-12-16
In the present paper, the utility of a special potentiometric titration approach for recognition and calculation of biomolecule/small-molecule interactions is reported. This approach is fast, sensitive, reproducible, and inexpensive in comparison to the other methods for the determination of the association constant values (Ka) and the interaction energies (ΔG). The potentiometric titration measurement is based on the use of a classical polymeric membrane indicator electrode in a solution of the small-molecule ligand. The biomolecule is used as a titrant. The potential is measured versus a reference electrode and transformed into a concentration-related signal over the entire concentration interval, also at low concentrations, where the millivolt (y-axis) versus log canalyte (x-axis) potentiometric calibration curve is not linear. In the procedure, Ka is calculated for the interaction of cocaine with a cocaine binding aptamer and with an anticocaine antibody. To study the selectivity and cross-reactivity, other oligonucleotides and aptamers are tested, as well as other small ligand molecules such as tetrakis(4-chlorophenyl)borate, metergoline, lidocaine, and bromhexine. The calculated Ka compared favorably to the value reported in the literature using surface plasmon resonance. The potentiometric titration approach called "concentration-related response potentiometry" is used to study molecular interaction for seven macromolecular target molecules and four small-molecule ligands.
Interaction of small molecule inhibitors of HIV-1 entry with CCR5
International Nuclear Information System (INIS)
Seibert, Christoph; Ying Weiwen; Gavrilov, Svetlana; Tsamis, Fotini; Kuhmann, Shawn E.; Palani, Anandan; Tagat, Jayaram R.; Clader, John W.; McCombie, Stuart W.; Baroudy, Bahige M.; Smith, Steven O.; Dragic, Tatjana; Moore, John P.; Sakmar, Thomas P.
2006-01-01
The CC-chemokine receptor 5 (CCR5) is the major coreceptor for macrophage-tropic (R5) HIV-1 strains. Several small molecule inhibitors of CCR5 that block chemokine binding and HIV-1 entry are being evaluated as drug candidates. Here we define how CCR5 antagonists TAK-779, AD101 (SCH-350581) and SCH-C (SCH-351125), which inhibit HIV-1 entry, interact with CCR5. Using a mutagenesis approach in combination with a viral entry assay to provide a direct functional read out, we tested predictions based on a homology model of CCR5 and analyzed the functions of more than 30 amino acid residues. We find that a key set of aromatic and aliphatic residues serves as a hydrophobic core for the ligand binding pocket, while E283 is critical for high affinity interaction, most likely by acting as the counterion for a positively charged nitrogen atom common to all three inhibitors. These results provide a structural basis for understanding how specific antagonists interact with CCR5, and may be useful for the rational design of new, improved CCR5 ligands
Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A
2014-10-01
Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the
AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists
Directory of Open Access Journals (Sweden)
Terry W. Moody
2017-07-01
Full Text Available While peptide antagonists for the gastrin-releasing peptide receptor (BB2R, neuromedin B receptor (BB1R, and bombesin (BB receptor subtype-3 (BRS-3 exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA1 binds with high affinity to the BB1R, BB2R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB1R, BB2R, and BRS-3 with similar affinity (Ki = 1.4–10.8 µM. AM-13 and AM-14 were approximately an order of magnitude less potent than AM-37 and ST-36. The ability of BA1 to elevate cytosolic Ca2+ in human lung cancer cells transfected with BB1R, BB2R, and BRS-3 was antagonized by AM-37 and ST-36. BA1 increased tyrosine phosphorylation of the EGFR and ERK in lung cancer cells, which was blocked by AM-37 and ST-36. AM-37 and ST-36 reduced the growth of lung cancer cells that have BBR. The results indicate that AM-37 and ST-36 function as small molecule BB receptor antagonists.
AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists
Moody, Terry W.; Tashakkori, Nicole; Mantey, Samuel A.; Moreno, Paola; Ramos-Alvarez, Irene; Leopoldo, Marcello; Jensen, Robert T.
2017-01-01
While peptide antagonists for the gastrin-releasing peptide receptor (BB2R), neuromedin B receptor (BB1R), and bombesin (BB) receptor subtype-3 (BRS-3) exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA)1 binds with high affinity to the BB1R, BB2R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB1R, BB2R, and BRS-3 with similar affinity (Ki = 1.4–10.8 µM). AM-13 and AM-14 were approximately an order of magnitude less potent than AM-37 and ST-36. The ability of BA1 to elevate cytosolic Ca2+ in human lung cancer cells transfected with BB1R, BB2R, and BRS-3 was antagonized by AM-37 and ST-36. BA1 increased tyrosine phosphorylation of the EGFR and ERK in lung cancer cells, which was blocked by AM-37 and ST-36. AM-37 and ST-36 reduced the growth of lung cancer cells that have BBR. The results indicate that AM-37 and ST-36 function as small molecule BB receptor antagonists. PMID:28785244
Approaches to Validate and Manipulate RNA Targets with Small Molecules in Cells.
Childs-Disney, Jessica L; Disney, Matthew D
2016-01-01
RNA has become an increasingly important target for therapeutic interventions and for chemical probes that dissect and manipulate its cellular function. Emerging targets include human RNAs that have been shown to directly cause cancer, metabolic disorders, and genetic disease. In this review, we describe various routes to obtain bioactive compounds that target RNA, with a particular emphasis on the development of small molecules. We use these cases to describe approaches that are being developed for target validation, which include target-directed cleavage, classic pull-down experiments, and covalent cross-linking. Thus, tools are available to design small molecules to target RNA and to identify the cellular RNAs that are their targets.
Small Molecule Library Synthesis Using Segmented Flow
Directory of Open Access Journals (Sweden)
Christina M. Thompson
2011-11-01
Full Text Available Flow chemistry has gained considerable recognition as a simple, efficient, and safe technology for the synthesis of many types of organic and inorganic molecules ranging in scope from large complex natural products to silicon nanoparticles. In this paper we describe a method that adapts flow chemistry to the synthesis of libraries of compounds using a fluorous immiscible solvent as a spacer between reactions. The methodology was validated in the synthesis of two small heterocycle containing libraries. The reactions were performed on a 0.2 mmol scale, enabling tens of milligrams of material to be generated in a single 200 mL reaction plug. The methodology allowed library synthesis in half the time of conventional microwave synthesis while maintaining similar yields. The ability to perform multiple, potentially unrelated reactions in a single run is ideal for making small quantities of many different compounds quickly and efficiently.
Yamamoto, Takaki; Hatano, Junichi; Nakagawa, Takafumi; Yamaguchi, Shigeru; Matsuo, Yutaka
2013-01-01
Utilizing tetraethynyl porphyrin derivative (TE-Por) as a small molecule donor material, we fabricated a small molecule solution-processed bulk heterojunction (BHJ) solar cell with inverted structure, which exhibited 1.6% power conversion efficiency (JSC (short-circuit current) = 4.6 mA/cm2, VOC (open-circuit voltage) = 0.90 V, and FF (fill factor) = 0.39) in the device configuration indium tin oxide/TiOx (titanium sub-oxide)/[6,6]-phenyl-C61-butyric acid methyl ester:TE-Por (5:1)/MoOx (molybdenum sub-oxide)/Au under AM1.5 G illumination at 100 mW/cm2. Without encapsulation, the small molecule solution-processed inverted BHJ solar cell also showed remarkable durability to air, where it kept over 73% of its initial power conversion efficiency after storage for 28 days under ambient atmosphere in the dark.
Anti-chemokine small molecule drugs: a promising future?
Proudfoot, Amanda E I; Power, Christine A; Schwarz, Matthias K
2010-03-01
Chemokines have principally been associated with inflammation due to their role in the control of leukocyte migration, but just over a decade ago chemokine receptors were also identified as playing a pivotal role in the entry of the HIV virus into cells. Chemokines activate seven transmembrane G protein-coupled receptors, making them extremely attractive therapeutic targets for the pharmaceutical industry. Although there are now a large number of molecules targeting chemokines and chemokine receptors including neutralizing antibodies in clinical trials for inflammatory diseases, the results to date have not always been positive, which has been disappointing for the field. These failures have often been attributed to redundancy in the chemokine system. However, other difficulties have been encountered in drug discovery processes targeting the chemokine system, and these will be addressed in this review. In this review, the reader will get an insight into the hurdles that have to be overcome, learn about some of the pitfalls that may explain the lack of success, and get a glimpse of the outlook for the future. In 2007, the FDA approved maraviroc, an inhibitor of CCR5 for the prevention of HIV infection, the first triumph for a small-molecule drug acting on the chemokine system. The time to market, 11 years from discovery of CCR5, was fast by industry standards. A second small-molecule drug, a CXCR4 antagonist for hematopoietic stem cell mobilization, was approved by the FDA at the end of 2008. The results of a Phase III trial with a CCR9 inhibitor for Crohn's disease are also promising. This could herald the first success for a chemokine receptor antagonist as an anti-inflammatory therapeutic and confirms the importance of chemokine receptors as a target class for anti-inflammatory and autoimmune diseases.
Gal, Maayan; Bloch, Itai; Shechter, Nelia; Romanenko, Olga; Shir, Ofer M
2016-01-01
Protein-protein interactions (PPI) play a critical role in regulating many cellular processes. Finding novel PPI inhibitors that interfere with specific binding of two proteins is considered a great challenge, mainly due to the complexity involved in characterizing multi-molecular systems and limited understanding of the physical principles governing PPIs. Here we show that the combination of virtual screening techniques, which are capable of filtering a large library of potential small molecule inhibitors, and a unique secondary screening by isothermal titration calorimetry, a label-free method capable of observing direct interactions, is an efficient tool for finding such an inhibitor. In this study we applied this strategy in a search for a small molecule capable of interfering with the interaction of the tumor-suppressor p53 and the E3-ligase MDM2. We virtually screened a library of 15 million small molecules that were filtered to a final set of 80 virtual hits. Our in vitro experimental assay, designed to validate the activity of mixtures of compounds by isothermal titration calorimetry, was used to identify an active molecule against MDM2. At the end of the process the small molecule (4S,7R)-4-(4-chlorophenyl)-5-hydroxy-2,7-dimethyl-N-(6-methylpyridin-2-yl)-4,6,7,8 tetrahydrIoquinoline-3-carboxamide was found to bind MDM2 with a dissociation constant of ~2 µM. Following the identification of this single bioactive compound, spectroscopic measurements were used to further characterize the interaction of the small molecule with the target protein. 2D NMR spectroscopy was used to map the binding region of the small molecule, and fluorescence polarization measurement confirmed that it indeed competes with p53.
Chen, Tao; Su, Dian; Gruenhagen, Jason; Gu, Christine; Li, Yi; Yehl, Peter; Chetwyn, Nik P; Medley, Colin D
2016-01-05
Antibody-drug conjugates (ADCs) offer new therapeutic options for advanced cancer patients through precision killing with fewer side effects. The stability and efficacy of ADCs are closely related, emphasizing the urgency and importance of gaining a comprehensive understanding of ADC stability. In this work, a chemical de-conjugation approach was developed to investigate the in-situ stability of the small molecule drug while it is conjugated to the antibody. This method involves chemical-mediated release of the small molecule drug from the ADC and subsequent characterization of the released small molecule drug by HPLC. The feasibility of this technique was demonstrated utilizing a model ADC containing a disulfide linker that is sensitive to the reducing environment within cancer cells. Five reducing agents were screened for use in de-conjugation; tris(2-carboxyethyl) phosphine (TCEP) was selected for further optimization due to its high efficiency and clean impurity profile. The optimized de-conjugation assay was shown to have excellent specificity and precision. More importantly, it was shown to be stability indicating, enabling the identification and quantification of the small molecule drug and its degradation products under different formulation pHs and storage temperatures. In summary, the chemical de-conjugation strategy demonstrated here offers a powerful tool to assess the in-situ stability of small molecule drugs on ADCs and the resulting information will shed light on ADC formulation/process development and storage condition selection. Copyright © 2015 Elsevier B.V. All rights reserved.
Design and synthesis of small molecule agonists of EphA2 receptor.
Petty, Aaron; Idippily, Nethrie; Bobba, Viharika; Geldenhuys, Werner J; Zhong, Bo; Su, Bin; Wang, Bingcheng
2018-01-01
Ligand-independent activation of EphA2 receptor kinase promotes cancer metastasis and invasion. Activating EphA2 receptor tyrosine kinase with small molecule agonist is a novel strategy to treat EphA2 overexpressing cancer. In this study, we performed a lead optimization of a small molecule Doxazosin that was identified as an EphA2 receptor agonist. 33 new analogs were developed and evaluated; a structure-activity relationship was summarized based on the EphA2 activation of these derivatives. Two new derivative compounds 24 and 27 showed much improved activity compared to Doxazosin. Compound 24 possesses a bulky amide moiety, and compound 27 has a dimeric structure that is very different to the parental compound. Compound 27 with a twelve-carbon linker of the dimer activated the kinase and induced receptor internalization and cell death with the best potency. Another dimer with a six-carbon linker has significantly reduced potency compared to the dimer with a longer linker, suggesting that the length of the linker is critical for the activity of the dimeric agonist. To explore the receptor binding characteristics of the new molecules, we applied a docking study to examine how the small molecule binds to the EphA2 receptor. The results reveal that compounds 24 and 27 form more hydrogen bonds to EphA2 than Doxazosin, suggesting that they may have higher binding affinity to the receptor. Published by Elsevier Masson SAS.
Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.
Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W
2014-03-04
Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.
Wambaugh, Morgan A; Shakya, Viplendra P S; Lewis, Adam J; Mulvey, Matthew A; Brown, Jessica C S
2017-06-01
Antibiotic-resistant infections kill approximately 23,000 people and cost $20,000,000,000 each year in the United States alone despite the widespread use of small-molecule antimicrobial combination therapy. Antibiotic combinations typically have an additive effect: the efficacy of the combination matches the sum of the efficacies of each antibiotic when used alone. Small molecules can also act synergistically when the efficacy of the combination is greater than the additive efficacy. However, synergistic combinations are rare and have been historically difficult to identify. High-throughput identification of synergistic pairs is limited by the scale of potential combinations: a modest collection of 1,000 small molecules involves 1 million pairwise combinations. Here, we describe a high-throughput method for rapid identification of synergistic small-molecule pairs, the overlap2 method (O2M). O2M extracts patterns from chemical-genetic datasets, which are created when a collection of mutants is grown in the presence of hundreds of different small molecules, producing a precise set of phenotypes induced by each small molecule across the mutant set. The identification of mutants that show the same phenotype when treated with known synergistic molecules allows us to pinpoint additional molecule combinations that also act synergistically. As a proof of concept, we focus on combinations with the antibiotics trimethoprim and sulfamethizole, which had been standard treatment against urinary tract infections until widespread resistance decreased efficacy. Using O2M, we screened a library of 2,000 small molecules and identified several that synergize with the antibiotic trimethoprim and/or sulfamethizole. The most potent of these synergistic interactions is with the antiviral drug azidothymidine (AZT). We then demonstrate that understanding the molecular mechanism underlying small-molecule synergistic interactions allows the rational design of additional combinations that
Directory of Open Access Journals (Sweden)
Morgan A Wambaugh
2017-06-01
Full Text Available Antibiotic-resistant infections kill approximately 23,000 people and cost $20,000,000,000 each year in the United States alone despite the widespread use of small-molecule antimicrobial combination therapy. Antibiotic combinations typically have an additive effect: the efficacy of the combination matches the sum of the efficacies of each antibiotic when used alone. Small molecules can also act synergistically when the efficacy of the combination is greater than the additive efficacy. However, synergistic combinations are rare and have been historically difficult to identify. High-throughput identification of synergistic pairs is limited by the scale of potential combinations: a modest collection of 1,000 small molecules involves 1 million pairwise combinations. Here, we describe a high-throughput method for rapid identification of synergistic small-molecule pairs, the overlap2 method (O2M. O2M extracts patterns from chemical-genetic datasets, which are created when a collection of mutants is grown in the presence of hundreds of different small molecules, producing a precise set of phenotypes induced by each small molecule across the mutant set. The identification of mutants that show the same phenotype when treated with known synergistic molecules allows us to pinpoint additional molecule combinations that also act synergistically. As a proof of concept, we focus on combinations with the antibiotics trimethoprim and sulfamethizole, which had been standard treatment against urinary tract infections until widespread resistance decreased efficacy. Using O2M, we screened a library of 2,000 small molecules and identified several that synergize with the antibiotic trimethoprim and/or sulfamethizole. The most potent of these synergistic interactions is with the antiviral drug azidothymidine (AZT. We then demonstrate that understanding the molecular mechanism underlying small-molecule synergistic interactions allows the rational design of additional
Design, Optimization and Application of Small Molecule Biosensor in Metabolic Engineering.
Liu, Yang; Liu, Ye; Wang, Meng
2017-01-01
The development of synthetic biology and metabolic engineering has painted a great future for the bio-based economy, including fuels, chemicals, and drugs produced from renewable feedstocks. With the rapid advance of genome-scale modeling, pathway assembling and genome engineering/editing, our ability to design and generate microbial cell factories with various phenotype becomes almost limitless. However, our lack of ability to measure and exert precise control over metabolite concentration related phenotypes becomes a bottleneck in metabolic engineering. Genetically encoded small molecule biosensors, which provide the means to couple metabolite concentration to measurable or actionable outputs, are highly promising solutions to the bottleneck. Here we review recent advances in the design, optimization and application of small molecule biosensor in metabolic engineering, with particular focus on optimization strategies for transcription factor (TF) based biosensors.
Small-Molecule Inhibitors of the Type III Secretion System
Directory of Open Access Journals (Sweden)
Lingling Gu
2015-09-01
Full Text Available Drug-resistant pathogens have presented increasing challenges to the discovery and development of new antibacterial agents. The type III secretion system (T3SS, existing in bacterial chromosomes or plasmids, is one of the most complicated protein secretion systems. T3SSs of animal and plant pathogens possess many highly conserved main structural components comprised of about 20 proteins. Many Gram-negative bacteria carry T3SS as a major virulence determinant, and using the T3SS, the bacteria secrete and inject effector proteins into target host cells, triggering disease symptoms. Therefore, T3SS has emerged as an attractive target for antimicrobial therapeutics. In recent years, many T3SS-targeting small-molecule inhibitors have been discovered; these inhibitors prevent the bacteria from injecting effector proteins and from causing pathophysiology in host cells. Targeting the virulence of Gram-negative pathogens, rather than their survival, is an innovative and promising approach that may greatly reduce selection pressures on pathogens to develop drug-resistant mutations. This article summarizes recent progress in the search for promising small-molecule T3SS inhibitors that target the secretion and translocation of bacterial effector proteins.
Organic Optoelectronic Devices Employing Small Molecules
Fleetham, Tyler Blain
Organic optoelectronic devices have remained a research topic of great interest over the past two decades, particularly in the development of efficient organic photovoltaics (OPV) and organic light emitting diodes (OLED). In order to improve the efficiency, stability, and materials variety for organic optoelectronic devices a number of emitting materials, absorbing materials, and charge transport materials were developed and employed in a device setting. Optical, electrical, and photophysical studies of the organic materials and their corresponding devices were thoroughly carried out. Two major approaches were taken to enhance the efficiency of small molecule based OPVs: developing material with higher open circuit voltages or improved device structures which increased short circuit current. To explore the factors affecting the open circuit voltage (VOC) in OPVs, molecular structures were modified to bring VOC closer to the effective bandgap, DeltaE DA, which allowed the achievement of 1V VOC for a heterojunction of a select Ir complex with estimated exciton energy of only 1.55eV. Furthermore, the development of anode interfacial layer for exciton blocking and molecular templating provide a general approach for enhancing the short circuit current. Ultimately, a 5.8% PCE was achieved in a single heterojunction of C60 and a ZnPc material prepared in a simple, one step, solvent free, synthesis. OLEDs employing newly developed deep blue emitters based on cyclometalated complexes were demonstrated. Ultimately, a peak EQE of 24.8% and nearly perfect blue emission of (0.148,0.079) was achieved from PtON7dtb, which approaches the maximum attainable performance from a blue OLED. Furthermore, utilizing the excimer formation properties of square-planar Pt complexes, highly efficient and stable white devices employing a single emissive material were demonstrated. A peak EQE of over 20% for pure white color (0.33,0.33) and 80 CRI was achieved with the tridentate Pt complex, Pt
Li, Yi; Gu, Christine; Gruenhagen, Jason; Yehl, Peter; Chetwyn, Nik P; Medley, Colin D
2016-01-01
Antibody-drug conjugates (ADCs) are complex therapeutic agents that use the specific targeting properties of antibodies and the highly potent cytotoxicity of small molecule drugs to selectively eliminate tumor cells while limiting the toxicity to normal healthy tissues. Two critical quality attributes of ADCs are the purity and stability of the active small molecule drug linked to the ADC, but these are difficult to assess once the drug is conjugated to the antibody. In this study, we report a enzyme deconjugation approach to cleave small molecule drugs from ADCs, which allows the drugs to be subsequently characterized by reversed-phase high performance liquid chromatography. The model ADC we used in this study utilizes a valine-citrulline linker that is designed to be sensitive to endoproteases after internalization by tumor cells. We screened several proteases to determine the most effective enzyme. Among the 3 cysteine proteases evaluated, papain had the best efficiency in cleaving the small molecule drug from the model ADC. The deconjugation conditions were further optimized to achieve complete cleavage of the small molecule drug. This papain deconjugation approach demonstrated excellent specificity and precision. The purity and stability of the active drug on an ADC drug product was evaluated and the major degradation products of the active drug were identified. The papain deconjugation method was also applied to several other ADCs, with the results suggesting it could be applied generally to ADCs containing a valine-citrulline linker. Our results indicate that the papain deconjugation method is a powerful tool for characterizing the active small molecule drug conjugated to an ADC, and may be useful in ensuring the product quality, efficacy and the safety of ADCs.
Ganesamoorthy, Ramasamy; Vijayaraghavan, Rajagopalan; Sakthivel, Pachagounder
2017-12-01
Development of nonfullerene acceptors plays an important role in the commercial availability of plastic solar cells. We report herein synthesis of bay-substituted donor-acceptor-donor (D-A-D)-type perylene diimide (PDI)-based small molecules (SM-1 to SM-4) by Suzuki coupling method and their use as acceptors in bulk heterojunction organic solar cells (BHJ-OSCs) with poly(3-hexylthiophene) (P3HT) polymer donor. We varied the number of electron-rich thiophene units and the solubilizing side chains and also evaluated the optical and electrochemical properties of the small molecules. The synthesized small molecules were confirmed by Fourier-transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy, and high-resolution mass spectroscopy (HR-MS). The small molecules showed extensive and strong absorption in the ultraviolet-visible (UV-Vis) region up to 750 nm, with bandgap (E_{{g}}^{{opt}} ) reduced below use as electron-accepting materials. The small molecules showed good thermal stability up to 300°C. BHJ-OSCs with SM-1 and P3HT polymer donor showed maximum power conversion efficiency (PCE) of 0.19% with V oc of 0.30 V, J sc of 1.72 mA cm-2, and fill factor (FF) of 37%. The PCE decreased with the number of thiophene units. The PCE of SM-2 was lower than that of SM-1. This difference in PCE can be explained by the higher aggregation tendency of the bithiophene compared with the thiophene unit. Introduction of the solubilizing group in the bay position increased the aggregation property, leading to much lower PCE than for the small molecules without solubilizing group.
Validation and extraction of molecular-geometry information from small-molecule databases.
Long, Fei; Nicholls, Robert A; Emsley, Paul; Graǽulis, Saulius; Merkys, Andrius; Vaitkus, Antanas; Murshudov, Garib N
2017-02-01
A freely available small-molecule structure database, the Crystallography Open Database (COD), is used for the extraction of molecular-geometry information on small-molecule compounds. The results are used for the generation of new ligand descriptions, which are subsequently used by macromolecular model-building and structure-refinement software. To increase the reliability of the derived data, and therefore the new ligand descriptions, the entries from this database were subjected to very strict validation. The selection criteria made sure that the crystal structures used to derive atom types, bond and angle classes are of sufficiently high quality. Any suspicious entries at a crystal or molecular level were removed from further consideration. The selection criteria included (i) the resolution of the data used for refinement (entries solved at 0.84 Å resolution or higher) and (ii) the structure-solution method (structures must be from a single-crystal experiment and all atoms of generated molecules must have full occupancies), as well as basic sanity checks such as (iii) consistency between the valences and the number of connections between atoms, (iv) acceptable bond-length deviations from the expected values and (v) detection of atomic collisions. The derived atom types and bond classes were then validated using high-order moment-based statistical techniques. The results of the statistical analyses were fed back to fine-tune the atom typing. The developed procedure was repeated four times, resulting in fine-grained atom typing, bond and angle classes. The procedure will be repeated in the future as and when new entries are deposited in the COD. The whole procedure can also be applied to any source of small-molecule structures, including the Cambridge Structural Database and the ZINC database.
Two-color studies of autoionizing states of small molecules
International Nuclear Information System (INIS)
Pratt, S.T.; Dehmer, P.M.; Dehmer, J.L.; Tomkins, F.S.; O'Halloran, M.A.
1989-01-01
Two-color, resonantly enhanced multiphoton ionization is proving to be a valuable technique for the study of autoionizing states of small molecules. In this talk, results obtained by combining REMPI, photoelectron spectroscopy, and mass spectrometry will be discussed and will be illustrated by examples from our recent studies of rotational and vibrational autoionization in molecular hydrogen and rotational autoionization in nitric oxide. 2 refs., 1 fig
Nanoparticle assisted laser desorption/ionization mass spectrometry for small molecule analytes.
Abdelhamid, Hani Nasser
2018-03-01
Nanoparticle assisted laser desorption/ionization mass spectrometry (NPs-ALDI-MS) shows remarkable characteristics and has a promising future in terms of real sample analysis. The incorporation of NPs can advance several methods including surface assisted LDI-MS, and surface enhanced LDI-MS. These methods have advanced the detection of many thermally labile and nonvolatile biomolecules. Nanoparticles circumvent the drawbacks of conventional organic matrices for the analysis of small molecules. In most cases, NPs offer a clear background without interfering peaks, absence of fragmentation of thermally labile molecules, and allow the ionization of species with weak noncovalent interactions. Furthermore, an enhancement in sensitivity and selectivity can be achieved. NPs enable straightforward analysis of target species in a complex sample. This review (with 239 refs.) covers the progress made in laser-based mass spectrometry in combination with the use of metallic NPs (such as AuNPs, AgNPs, PtNPs, and PdNPs), NPs consisting of oxides and chalcogenides, silicon-based NPs, carbon-based nanomaterials, quantum dots, and metal-organic frameworks. Graphical abstract An overview is given on nanomaterials for use in surface-assisted laser desorption/ionization mass spectrometry of small molecules.
International Nuclear Information System (INIS)
Wells, E.; Carnes, K.D.; Tawara, H.; Ali, R.; Sidky, Emil Y.; Illescas, Clara; Ben-Itzhak, I.
2005-01-01
A coincidence time-of-flight technique coupled with projectile charge state analysis was used to study electron capture in collisions between slow highly charged ions and hydrogen molecules. We found single electron capture with no target excitation to be the dominant process for both C 6+ projectiles at a velocity of 0.8 atomic units and Ar 11+ projectiles at v 0.63 a.u. Double electron capture and transfer excitation, however, were found to be comparable and occur about 30% of the time relative to single capture. Most projectiles (96%) auto-ionize quickly following double capture into doubly excited states. The data are compared to classical and quantum mechanical model calculations
Small molecules, big players: the National Cancer Institute's Initiative for Chemical Genetics.
Tolliday, Nicola; Clemons, Paul A; Ferraiolo, Paul; Koehler, Angela N; Lewis, Timothy A; Li, Xiaohua; Schreiber, Stuart L; Gerhard, Daniela S; Eliasof, Scott
2006-09-15
In 2002, the National Cancer Institute created the Initiative for Chemical Genetics (ICG), to enable public research using small molecules to accelerate the discovery of cancer-relevant small-molecule probes. The ICG is a public-access research facility consisting of a tightly integrated team of synthetic and analytical chemists, assay developers, high-throughput screening and automation engineers, computational scientists, and software developers. The ICG seeks to facilitate the cross-fertilization of synthetic chemistry and cancer biology by creating a research environment in which new scientific collaborations are possible. To date, the ICG has interacted with 76 biology laboratories from 39 institutions and more than a dozen organic synthetic chemistry laboratories around the country and in Canada. All chemistry and screening data are deposited into the ChemBank web site (http://chembank.broad.harvard.edu/) and are available to the entire research community within a year of generation. ChemBank is both a data repository and a data analysis environment, facilitating the exploration of chemical and biological information across many different assays and small molecules. This report outlines how the ICG functions, how researchers can take advantage of its screening, chemistry and informatic capabilities, and provides a brief summary of some of the many important research findings.
Solution-processed white organic light-emitting devices based on small-molecule materials
International Nuclear Information System (INIS)
Wang Dongdong; Wu Zhaoxin; Zhang Xinwen; Wang Dawei; Hou Xun
2010-01-01
We investigated solution-processed films of 4,4'-bis(2,2-diphenylvinyl)-1,1'-bibenyl (DPVBi) and its blends with N,N'-bis(3-methylphenyl)-(1,1'-biphenyl)-4,4'-diamine (TPD) by atomic force microscopy (AFM). The AFM result shows that the solution-processed films are pin-free and their morphology is smooth enough to be used in OLEDs. We have developed a solution-processed white organic light-emitting device (WOLEDs) based on small-molecules, in which the light-emitting layer (EML) was formed by spin-coating the solution of small-molecules on top of the solution-processed hole-transporting layer. This WOLEDs, in which the EML consists of co-host (DPVBi and TPD), the blue dopant (4,4'-bis[2-(4-(N,N-diphenylamino)phenyl)vinyl]biphenyl) and the yellow dye (5,6,11,12-tetraphenylnaphtacene), has a current efficiency of 6.0 cd/A at a practical luminance of 1000 cd/m 2 , a maximum luminance of 22500 cd/m 2 , and its color coordinates are quite stable. Our research shows a possible approach to achieve efficient and low-cost small-molecule-based WOLEDs, which avoids the complexities of the co-evaporation process of multiple dopants and host materials in vacuum depositions.
Bond charges and electronic charge transfer in ternary semiconductors
International Nuclear Information System (INIS)
Pietsch, U.
1986-01-01
By means of a simple molecule-theoretic model of 'linear superposition of two-electron molecules' the bond charges between nearest neighbours and the effective charges of ions are calculated for ternary zinc-blende structure alloys as well as chalcopyrite semiconductors. Taking into account both, the charge transfer among the ions caused by the differences of electronegativities of atoms used and between the bonds created by the internal stress of the lattice a nearly unvaried averaged bond charge amount of the alloy is found, but rather dramatically changed local bond charge parameters in comparison with the respective values of binary compounds used. This fact should influence the noncentral force interaction in such semiconductors. (author)
Small molecule inhibitors block Gas6-inducible TAM activation and tumorigenicity.
Kimani, Stanley G; Kumar, Sushil; Bansal, Nitu; Singh, Kamalendra; Kholodovych, Vladyslav; Comollo, Thomas; Peng, Youyi; Kotenko, Sergei V; Sarafianos, Stefan G; Bertino, Joseph R; Welsh, William J; Birge, Raymond B
2017-03-08
TAM receptors (Tyro-3, Axl, and Mertk) are a family of three homologous type I receptor tyrosine kinases that are implicated in several human malignancies. Overexpression of TAMs and their major ligand Growth arrest-specific factor 6 (Gas6) is associated with more aggressive staging of cancers, poorer predicted patient survival, acquired drug resistance and metastasis. Here we describe small molecule inhibitors (RU-301 and RU-302) that target the extracellular domain of Axl at the interface of the Ig-1 ectodomain of Axl and the Lg-1 of Gas6. These inhibitors effectively block Gas6-inducible Axl receptor activation with low micromolar IC 50s in cell-based reporter assays, inhibit Gas6-inducible motility in Axl-expressing cell lines, and suppress H1299 lung cancer tumor growth in a mouse xenograft NOD-SCIDγ model. Furthermore, using homology models and biochemical verifications, we show that RU301 and 302 also inhibit Gas6 inducible activation of Mertk and Tyro3 suggesting they can act as pan-TAM inhibitors that block the interface between the TAM Ig1 ectodomain and the Gas6 Lg domain. Together, these observations establish that small molecules that bind to the interface between TAM Ig1 domain and Gas6 Lg1 domain can inhibit TAM activation, and support the further development of small molecule Gas6-TAM interaction inhibitors as a novel class of cancer therapeutics.
Activation of TRPM7 channels by small molecules under physiological conditions.
Hofmann, T; Schäfer, S; Linseisen, M; Sytik, L; Gudermann, T; Chubanov, V
2014-12-01
Transient receptor potential cation channel, subfamily M, member 7 (TRPM7) is a cation channel covalently linked to a protein kinase domain. TRPM7 is ubiquitously expressed and regulates key cellular processes such as Mg(2+) homeostasis, motility, and proliferation. TRPM7 is involved in anoxic neuronal death, cardiac fibrosis, and tumor growth. The goal of this work was to identify small molecule activators of the TRPM7 channel and investigate their mechanism of action. We used an aequorin bioluminescence-based assay to screen for activators of the TRPM7 channel. Valid candidates were further characterized using patch clamp electrophysiology. We identified 20 drug-like compounds with various structural backbones that can activate the TRPM7 channel. Among them, the δ opioid antagonist naltriben was studied in greater detail. Naltriben's action was selective among the TRP channels tested. Naltriben activates TRPM7 currents without prior depletion of intracellular Mg(2+) even under conditions of low PIP2. Moreover, naltriben interfered with the effect of the TRPM7 inhibitor NS8593. Finally, our experiments with TRPM7 variants carrying mutations in the pore, TRP, and kinase domains indicate that the site of TRPM7 activation by this small-molecule ligand is most likely located in or near the TRP domain. In conclusion, we identified the first organic small-molecule activators of TRPM7 channels, thus providing new experimental tools to study TRPM7 function in native cellular environments.
Lee, Olivia P.; Yiu, Alan T.; Beaujuge, Pierre; Woo, Claire; Holcombe, Thomas W.; Millstone, Jill E.; Douglas, Jessica D.; Chen, Mark S.; Frechet, Jean
2011-01-01
Efficient organic photovoltaic (OPV) materials are constructed by attaching completely planar, symmetric end-groups to donor-acceptor electroactive small molecules. Appending C2-pyrene as the small molecule end-group to a diketopyrrolopyrrole core leads to materials with a tight, aligned crystal packing and favorable morphology dictated by π-π interactions, resulting in high power conversion efficiencies and high fill factors. The use of end-groups to direct molecular self-assembly is an effective strategy for designing high-performance small molecule OPV devices. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lee, Olivia P.
2011-10-21
Efficient organic photovoltaic (OPV) materials are constructed by attaching completely planar, symmetric end-groups to donor-acceptor electroactive small molecules. Appending C2-pyrene as the small molecule end-group to a diketopyrrolopyrrole core leads to materials with a tight, aligned crystal packing and favorable morphology dictated by π-π interactions, resulting in high power conversion efficiencies and high fill factors. The use of end-groups to direct molecular self-assembly is an effective strategy for designing high-performance small molecule OPV devices. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook
2009-01-01
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference
Energy Technology Data Exchange (ETDEWEB)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2009-05-15
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.
Charge Transport Processes in Molecular Junctions
Smith, Christopher Eugene
Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.
Plate, Lars; Cooley, Christina B; Chen, John J; Paxman, Ryan J; Gallagher, Ciara M; Madoux, Franck; Genereux, Joseph C; Dobbs, Wesley; Garza, Dan; Spicer, Timothy P; Scampavia, Louis; Brown, Steven J; Rosen, Hugh; Powers, Evan T; Walter, Peter; Hodder, Peter; Wiseman, R Luke; Kelly, Jeffery W
2016-01-01
Imbalances in endoplasmic reticulum (ER) proteostasis are associated with etiologically-diverse degenerative diseases linked to excessive extracellular protein misfolding and aggregation. Reprogramming of the ER proteostasis environment through genetic activation of the Unfolded Protein Response (UPR)-associated transcription factor ATF6 attenuates secretion and extracellular aggregation of amyloidogenic proteins. Here, we employed a screening approach that included complementary arm-specific UPR reporters and medium-throughput transcriptional profiling to identify non-toxic small molecules that phenocopy the ATF6-mediated reprogramming of the ER proteostasis environment. The ER reprogramming afforded by our molecules requires activation of endogenous ATF6 and occurs independent of global ER stress. Furthermore, our molecules phenocopy the ability of genetic ATF6 activation to selectively reduce secretion and extracellular aggregation of amyloidogenic proteins. These results show that small molecule-dependent ER reprogramming, achieved through preferential activation of the ATF6 transcriptional program, is a promising strategy to ameliorate imbalances in ER function associated with degenerative protein aggregation diseases. DOI: http://dx.doi.org/10.7554/eLife.15550.001 PMID:27435961
Li, Jie; Zheng, Yifan; Zheng, Ding; Yu, Junsheng
2016-07-01
In this study, the influence of small-molecule organic hole injection materials on the performance of organic solar cells (OSCs) as the hole transport layer (HTL) with an architecture of ITO/ZnO/P3HT:PC71BM/HTL/Ag has been investigated. A significant enhancement on the performance of OSCs from 1.06% to 2.63% is obtained by using N, N‧-bis(1-naphthalenyl)-N, N‧-bis-phenyl-(1, 1‧-biphenyl)-4, 4‧-diamine (NPB) HTL. Through the resistance simulation and space-charge limited current analysis, we found that NPB HTL cannot merely improve the hole mobility of the device but also form the Ohmic contact between the active layer and anode. Besides, when we apply mix HTL by depositing the NPB on the surface of molybdenum oxide, the power conversion efficiency of OSC are able to be further improved to 2.96%.
Ma, Jie; Wang, Lin-Wang
2015-03-01
Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.
Intercalation of small hydrophobic molecules in lipid bilayers containing cholesterol
Energy Technology Data Exchange (ETDEWEB)
Worcester, D.L.; Hamacher, K.; Kaiser, H.; Kulasekere, R.; Torbet, J. [Univ. of Missouri, Columbia, MO (United States)
1994-12-31
Partitioning of small hydrophobic molecules into lipid bilayers containing cholesterol has been studied using the 2XC diffractometer at the University of Missouri Research Reactor. Locations of the compounds were determined by Fourier difference methods with data from both deuterated and undeuterated compounds introduced into the bilayers from the vapor phase. Data fitting procedures were developed for determining how well the compounds were localized. The compounds were found to be localized in a narrow region at the center of the hydrophobic layer, between the two halves of the bilayer. The structures are therefore intercalated structures with the long axis of the molecules in the plane of the bilayer.
Intercalation of small hydrophobic molecules in lipid bilayers containing cholesterol
International Nuclear Information System (INIS)
Worcester, D.L.; Hamacher, K.; Kaiser, H.; Kulasekere, R.; Torbet, J.
1994-01-01
Partitioning of small hydrophobic molecules into lipid bilayers containing cholesterol has been studied using the 2XC diffractometer at the University of Missouri Research Reactor. Locations of the compounds were determined by Fourier difference methods with data from both deuterated and undeuterated compounds introduced into the bilayers from the vapor phase. Data fitting procedures were developed for determining how well the compounds were localized. The compounds were found to be localized in a narrow region at the center of the hydrophobic layer, between the two halves of the bilayer. The structures are therefore intercalated structures with the long axis of the molecules in the plane of the bilayer
Small molecule inhibitors of bromodomain-acetyl-lysine interactions.
Brand, Michael; Measures, Angelina R; Measures, Angelina M; Wilson, Brian G; Cortopassi, Wilian A; Alexander, Rikki; Höss, Matthias; Hewings, David S; Rooney, Timothy P C; Paton, Robert S; Conway, Stuart J
2015-01-16
Bromodomains are protein modules that bind to acetylated lysine residues. Their interaction with histone proteins suggests that they function as "readers" of histone lysine acetylation, a component of the proposed "histone code". Bromodomain-containing proteins are often found as components of larger protein complexes with roles in fundamental cellular process including transcription. The publication of two potent ligands for the BET bromodomains in 2010 demonstrated that small molecules can inhibit the bromodomain-acetyl-lysine protein-protein interaction. These molecules display strong phenotypic effects in a number of cell lines and affect a range of cancers in vivo. This work stimulated intense interest in developing further ligands for the BET bromodomains and the design of ligands for non-BET bromodomains. Here we review the recent progress in the field with particular attention paid to ligand design, the assays employed in early ligand discovery, and the use of computational approaches to inform ligand design.
Lü, Rui
2017-09-01
Dynamic detection of transient redox changes in living cells and animals has broad implications for human health and disease diagnosis, because intracellular redox homeostasis regulated by reactive oxygen species (ROS) plays important role in cell functions, normal physiological functions and some serious human diseases (e.g., cancer, Alzheimer's disease, diabetes, etc.) usually have close relationship with the intracellular redox status. Small-molecule ROS-responsive fluorescent probes can act as powerful tools for dynamic detection of ROS and redox changes in living cells and animals through fluorescence imaging techniques; and great advances have been achieved recently in the design and synthesis of small-molecule ROS-responsive fluorescent probes. This article highlights up-to-date achievements in designing and using the reaction-based small-molecule fluorescent probes (with high sensitivity and selectivity to ROS and redox cycles) in the dynamic detection of ROS and transient redox changes in living cells and animals through fluorescence imaging. Copyright © 2017. Published by Elsevier Ltd.
Excipients used in lyophilization of small molecules
Directory of Open Access Journals (Sweden)
Ankit Baheti
2010-03-01
Full Text Available This review deals with the excipients used in various lyophilized formulations of small molecules. The role of excipients such as bulking agents, buffering agents, tonicity modifiers, antimicrobial agents, surfactants and co-solvents has been discussed. Additionally, a decision making process for their incorporation into the formulation matrix has been proposed. A list of ingredients used in lyophilized formulations marketed in USA has been created based on a survey of the Physician Desk Reference (PDR and the Handbook on Injectable Drugs. Information on the recommended quantities of various excipients has also been provided, based on the details given in the Inactive Ingredient Guide (IIG.
Spectrally resolved single-molecule electrometry
Ruggeri, F.; Krishnan, M.
2018-03-01
Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.
A general strategy to construct small molecule biosensors in eukaryotes.
Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David
2015-12-29
Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.
Habchi, Johnny; Chia, Sean; Limbocker, Ryan; Mannini, Benedetta; Ahn, Minkoo; Perni, Michele; Hansson, Oskar; Arosio, Paolo; Kumita, Janet R; Challa, Pavan Kumar; Cohen, Samuel I A; Linse, Sara; Dobson, Christopher M; Knowles, Tuomas P J; Vendruscolo, Michele
2017-01-10
The aggregation of the 42-residue form of the amyloid-β peptide (Aβ42) is a pivotal event in Alzheimer's disease (AD). The use of chemical kinetics has recently enabled highly accurate quantifications of the effects of small molecules on specific microscopic steps in Aβ42 aggregation. Here, we exploit this approach to develop a rational drug discovery strategy against Aβ42 aggregation that uses as a read-out the changes in the nucleation and elongation rate constants caused by candidate small molecules. We thus identify a pool of compounds that target specific microscopic steps in Aβ42 aggregation. We then test further these small molecules in human cerebrospinal fluid and in a Caenorhabditis elegans model of AD. Our results show that this strategy represents a powerful approach to identify systematically small molecule lead compounds, thus offering an appealing opportunity to reduce the attrition problem in drug discovery.
Ye, Deju; Shuhendler, Adam J.; Cui, Lina; Tong, Ling; Tee, Sui Seng; Tikhomirov, Grigory; Felsher, Dean W.; Rao, Jianghong
2014-06-01
Directed self-assembly of small molecules in living systems could enable a myriad of applications in biology and medicine, and already this has been used widely to synthesize supramolecules and nano/microstructures in solution and in living cells. However, controlling the self-assembly of synthetic small molecules in living animals is challenging because of the complex and dynamic in vivo physiological environment. Here we employ an optimized first-order bioorthogonal cyclization reaction to control the self-assembly of a fluorescent small molecule, and demonstrate its in vivo applicability by imaging caspase-3/7 activity in human tumour xenograft mouse models of chemotherapy. The fluorescent nanoparticles assembled in situ were imaged successfully in both apoptotic cells and tumour tissues using three-dimensional structured illumination microscopy. This strategy combines the advantages offered by small molecules with those of nanomaterials and should find widespread use for non-invasive imaging of enzyme activity in vivo.
Choi, Hyeju; Ko, Haye Min; Cho, Nara; Song, Kihyung; Lee, Jae Kwan; Ko, Jaejung
2012-10-01
New electron-rich anthracene derivatives containing triarylamine hole stabilizers, 2,6-bis[5,5'-bis(N,N'-diphenylaniline)-2,2'-bithiophen-5-yl]-9,10-bis-[(triisopropylsilyl)ethynyl]anthracene (TIPSAntBT-TPA) and 2,6-bis(5,5'-bis{4-[bis(9,9-dimethyl-9H-fluoren-2-yl)amino]phenyl}-2,2'-bithiophen-5-yl)-9,10-bis-[(triisopropylsilyl)ethynyl]anthracene (TIPSAntBT-bisDMFA), linked with π-conjugated bithiophene bridges, were synthesized and their photovoltaic characteristics were investigated in solution-processed small-molecule organic solar cells (SMOSCs). These new materials exhibited superior intramolecular charge transfer from triarylamine to anthracene, leading to a more electron-rich anthracene core that facilitated electron transfer into phenyl-C(61)-butyric acid methyl ester. Compared with TIPSAntBT and triarylamine, these materials show a threefold improvement in hole-transporting properties and better photovoltaic performance in solution-processed SMOSCs, with the best power conversion efficiency being 2.96 % at a high open-circuit voltage of 0.85 V. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Small-molecule azomethines: Organic photovoltaics via Schiff base condensation chemistry
Petrus, M.L.; Bouwer, R.K.M.; Lafont, U.; Athanasopoulos, S.; Greenham, N.C.; Dingemans, T.J.
2014-01-01
Conjugated small-molecule azomethines for photovoltaic applications were prepared via Schiff base condensation chemistry. Bulk heterojunction (BHJ) devices exhibit efficiencies of 1.2% with MoOx as the hole-transporting layer. The versatility and simplicity of the chemistry is illustrated by preparing a photovoltaic device directly from the reaction mixture without any form of workup.
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Molecular locks and keys: the role of small molecules in phytohormone research
Directory of Open Access Journals (Sweden)
Sandra eFonseca
2014-12-01
Full Text Available Plant adaptation, growth and development rely on the integration of many environmental and endogenous signals that collectively determine the overall plant phenotypic plasticity. Plant signalling molecules, also known as phytohormones, are fundamental to this process. These molecules act at low concentrations and regulate multiple aspects of plant fitness and development via complex signalling networks. By its nature, phytohormone research lies at the interface between chemistry and biology. Classically, the scientific community has always used synthetic phytohormones and analogs to study hormone functions and responses. However, recent advances in synthetic and combinational chemistry, have allowed a new field, plant chemical biology, to emerge and this has provided a powerful tool with which to study phytohormone function.Plant chemical biology is helping to address some of the most enduring questions in phytohormone research such as: Are there still undiscovered plant hormones? How can we identify novel signalling molecules? How can plants activate specific hormone responses in a tissue-specific manner? How can we modulate hormone responses in one developmental context without inducing detrimental effects on other processes? The chemical genomics approaches rely on the identification of small molecules modulating different biological processes and have recently identified active forms of plant hormones and molecules regulating many aspects of hormone synthesis, transport and response. We envision that the field of chemical genomics will continue to provide novel molecules able to elucidate specific aspects of hormone-mediated responses. In addition, compounds blocking specific responses could uncover how complex biological responses are regulated. As we gain information about such compounds we can design small alterations to the chemical structure to further alter specificity, enhance affinity or modulate the activity of these compounds.
Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M
2016-04-01
The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.
Pirim, C.; Gann, R. D.; McLain, J. L.; Orlando, T. M.
2015-09-01
Electron-induced polymerization processes and charging events that can occur within Titan's atmosphere or on its surface were simulated using electron irradiation and dissociative electron attachment (DEA) studies of nitrogen-containing organic condensates. The DEA studies probe the desorption of H- from hydrogen cyanide (HCN), acetonitrile (CH3CN), and aminoacetonitrile (NH2CH2CN) ices, as well as from synthesized tholin materials condensed or deposited onto a graphite substrate maintained at low temperature (90-130 K). The peak cross sections for H- desorption during low-energy (3-15 eV) electron irradiation were measured and range from 3 × 10-21 to 2 × 10-18 cm2. Chemical and structural transformations of HCN ice upon 2 keV electron irradiation were investigated using X-ray photoelectron and Fourier-transform infrared spectroscopy techniques. The electron-beam processed materials displayed optical properties very similar to tholins produced by conventional discharge methods. Electron and negative ion trapping lead to 1011 charges cm-2 on a flat surface which, assuming a radius of 0.05 μm for Titan aerosols, is ∼628 charges/radius (in μm). The facile charge trapping indicates that electron interactions with nitriles and complex tholin-like molecules could affect the conductivity of Titan's atmosphere due to the formation of large negative ion complexes. These negatively charged complexes can also precipitate onto Titan's surface and possibly contribute to surface reactions and the formation of dunes.
Strategies for Discovery of Small Molecule Radiation Protectors and Radiation Mitigators
Directory of Open Access Journals (Sweden)
Joel S Greenberger
2012-01-01
Full Text Available Mitochondrial targeted radiation damage protectors (delivered prior to irradiation and mitigators (delivered after irradiation, but before the appearance of symptoms associated with radiation syndrome have been a recent focus in drug discovery for 1 normal tissue radiation protection during fractionated radiotherapy, and 2 radiation terrorism counter measures. Several categories of such molecules have been discovered: nitroxide-linked hybrid molecules, including GS-nitroxide, GS-nitric oxide synthase inhibitors, p53/mdm2/mdm4 inhibitors, and pharmaceutical agents including inhibitors of the phosphoinositide-3-kinase pathway and the anti-seizure medicine, carbamazepine. Evaluation of potential new irradiation dose modifying molecules to protect normal tissue includes: clonagenic radiation survival curves; assays for apoptosis and DNA repair, and irradiation-induced depletion of antioxidant stores. Studies of organ specific radioprotection and in total body irradiation-induced hematopoietic syndrome in the mouse model for protection/mitigation facilitate rational means by which to move candidate small molecule drugs along the drug discovery pipeline into clinical development.
Strategies for Discovery of Small Molecule Radiation Protectors and Radiation Mitigators
Energy Technology Data Exchange (ETDEWEB)
Greenberger, Joel S.; Clump, David [Radiation Oncology Department, University of Pittsburgh Cancer Institute, Pittsburgh, PA (United States); Kagan, Valerian [Environmental and Occupational Health Department, University of Pittsburgh, Pittsburgh, PA (United States); Bayir, Hülya [Critical Care Medicine Department, University of Pittsburgh Medical Center, Pittsburgh, PA (United States); Lazo, John S. [Pharmacology Department, University of Virginia, Charlottesville, VA (United States); Wipf, Peter [Department of Chemistry, Accelerated Chemical Discovery Center, University of Pittsburgh, Pittsburgh, PA (United States); Li, Song; Gao, Xiang [Pharmaceutical Science Department, University of Pittsburgh, Pittsburgh, PA (United States); Epperly, Michael W., E-mail: greenbergerjs@upmc.edu [Radiation Oncology Department, University of Pittsburgh Cancer Institute, Pittsburgh, PA (United States)
2012-01-13
Mitochondrial targeted radiation damage protectors (delivered prior to irradiation) and mitigators (delivered after irradiation, but before the appearance of symptoms associated with radiation syndrome) have been a recent focus in drug discovery for (1) normal tissue radiation protection during fractionated radiotherapy, and (2) radiation terrorism counter measures. Several categories of such molecules have been discovered: nitroxide-linked hybrid molecules, including GS-nitroxide, GS-nitric oxide synthase inhibitors, p53/mdm2/mdm4 inhibitors, and pharmaceutical agents including inhibitors of the phosphoinositide-3-kinase pathway and the anti-seizure medicine, carbamazepine. Evaluation of potential new radiation dose modifying molecules to protect normal tissue includes: clonogenic radiation survival curves, assays for apoptosis and DNA repair, and irradiation-induced depletion of antioxidant stores. Studies of organ specific radioprotection and in total body irradiation-induced hematopoietic syndrome in the mouse model for protection/mitigation facilitate rational means by which to move candidate small molecule drugs along the drug discovery pipeline into clinical development.
Small Molecule Inhibitors in Acute Myeloid Leukemia: From the Bench to the Clinic
Al-Hussaini, Muneera; DiPersio, John F.
2014-01-01
Many patients with acute myeloid leukemia (AML) will eventually develop refractory or relapsed disease. In the absence of standard therapy for this population, there is currently an urgent unmet need for novel therapeutic agents. Targeted therapy with small molecule inhibitors (SMIs) represents a new therapeutic intervention that has been successful for the treatment of multiple tumors (e.g., gastrointestinal stromal tumors, chronic myelogenous leukemia). Hence, there has been great interest in generating selective small molecule inhibitors targeting critical pathways of proliferation and survival in AML. This review highlights a selective group of intriguing therapeutic agents and their presumed targets in both preclinical models and in early human clinical trials. PMID:25025370
Joshi, Priyanka; Chia, Sean; Habchi, Johnny; Knowles, Tuomas P J; Dobson, Christopher M; Vendruscolo, Michele
2016-03-14
The aggregation process of intrinsically disordered proteins (IDPs) has been associated with a wide range of neurodegenerative disorders, including Alzheimer's and Parkinson's diseases. Currently, however, no drug in clinical use targets IDP aggregation. To facilitate drug discovery programs in this important and challenging area, we describe a fragment-based approach of generating small-molecule libraries that target specific IDPs. The method is based on the use of molecular fragments extracted from compounds reported in the literature to inhibit of the aggregation of IDPs. These fragments are used to screen existing large generic libraries of small molecules to form smaller libraries specific for given IDPs. We illustrate this approach by describing three distinct small-molecule libraries to target, Aβ, tau, and α-synuclein, which are three IDPs implicated in Alzheimer's and Parkinson's diseases. The strategy described here offers novel opportunities for the identification of effective molecular scaffolds for drug discovery for neurodegenerative disorders and to provide insights into the mechanism of small-molecule binding to IDPs.
Dey, Supratim; Anbanandam, Asokan; Mumford, Ben E.; De Guzman, Roberto N.
2017-01-01
Many pathogens such as Shigella and other bacteria assemble the type III secretion system (T3SS) nanoinjector to inject virulence proteins into their target cells to cause infectious diseases in humans. The rise of drug resistance among pathogens that rely on the T3SS for infectivity, plus the dearth of new antibiotics require alternative strategies in developing new antibiotics. The Shigella T3SS tip protein IpaD is an attractive target for developing anti-infectives because of its essential role in virulence and its exposure on the bacterial surface. Currently, the only known small molecules that bind to IpaD are bile salts sterols. Here, we identified four new small molecule scaffolds that bind to IpaD based on the methylquinoline, pyrrolidin-aniline, hydroxyindole, and morpholinoaniline scaffolds. NMR mapping revealed potential hotspots in IpaD for binding small molecules. These scaffolds can be used as building blocks in developing small molecule inhibitors of IpaD that could lead to new anti-infectives. PMID:28750143
Meisel, Jayda E; Chang, Mayland
2017-11-01
The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.
Segmental Interactions between Polymers and Small Molecules in Batteries and Biofuel Purification
Balsara, Nitash
2015-03-01
Polymers such as poly(ethylene oxide) (PEO) and poly(dimethyl siloxane) (PDMS) have the potential to play an important role in the emerging clean energy landscape. Mixtures of PEO and lithium salts are the most widely studied non-flammable electrolyte for rechargeable lithium batteries. PDMS membranes are ideally suited for purifying bioethanol and biobutanol from fermentation broths. The ability of PEO and PDMS to function in these applications depends on segmental interactions between the polymeric host and small molecule guests. One experimental approach for studying these interactions is X-ray absorption spectroscopy (XAS). Models for interpreting XAS spectra of amorphous mixtures and charged species such as salts must quantify the effect of segmental interactions on the electronic structure of the atoms of interest (e.g. sulfur). This combination of experiment and theory is used to determine the species formed in during charging and discharging lithium-sulfur batteries; the theoretical specific energy of lithium-sulfur batteries is a factor of four larger than that of current lithium-ion batteries. Selective transport of alcohols in PDMS-containing membranes is controlled by the size, shape, and connectivity of sub-nanometer cavities or free volume that form and disappear spontaneously as the chain segments undergo Brownian motion. We demonstrate that self-assembly of PDMS-containing block copolymers can be used to control segmental relaxation, which, in turn, affects free volume. Positron annihilation was used to determine the size distribution of free volume cavities in the PDMS-containing block copolymers. The effect of this artificial free volume on selective permeation of alcohols formed by fermentation of sugars derived from lignocellulosic biomass is studied. Molecular dynamics simulations are needed to understand the relationship between self-assembly, free volume, and transport in block copolymers.
Niu, Xin; Brahmbhatt, Hetal; Mergenthaler, Philipp; Zhang, Zhi; Sang, Jing; Daude, Michael; Ehlert, Fabian G R; Diederich, Wibke E; Wong, Eve; Zhu, Weijia; Pogmore, Justin; Nandy, Jyoti P; Satyanarayana, Maragani; Jimmidi, Ravi K; Arya, Prabhat; Leber, Brian; Lin, Jialing; Culmsee, Carsten; Yi, Jing; Andrews, David W
2017-04-20
Aberrant apoptosis can lead to acute or chronic degenerative diseases. Mitochondrial outer membrane permeabilization (MOMP) triggered by the oligomerization of the Bcl-2 family proteins Bax/Bak is an irreversible step leading to execution of apoptosis. Here, we describe the discovery of small-molecule inhibitors of Bax/Bak oligomerization that prevent MOMP. We demonstrate that these molecules disrupt multiple, but not all, interactions between Bax dimer interfaces thereby interfering with the formation of higher-order oligomers in the MOM, but not recruitment of Bax to the MOM. Small-molecule inhibition of Bax/Bak oligomerization allowed cells to evade apoptotic stimuli and rescued neurons from death after excitotoxicity, demonstrating that oligomerization of Bax is essential for MOMP. Our discovery of small-molecule Bax/Bak inhibitors provides novel tools for the investigation of the mechanisms leading to MOMP and will ultimately facilitate development of compounds inhibiting Bax/Bak in acute and chronic degenerative diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Library design practices for success in lead generation with small molecule libraries.
Goodnow, R A; Guba, W; Haap, W
2003-11-01
The generation of novel structures amenable to rapid and efficient lead optimization comprises an emerging strategy for success in modern drug discovery. Small molecule libraries of sufficient size and diversity to increase the chances of discovery of novel structures make the high throughput synthesis approach the method of choice for lead generation. Despite an industry trend for smaller, more focused libraries, the need to generate novel lead structures makes larger libraries a necessary strategy. For libraries of a several thousand or more members, solid phase synthesis approaches are the most suitable. While the technology and chemistry necessary for small molecule library synthesis continue to advance, success in lead generation requires rigorous consideration in the library design process to ensure the synthesis of molecules possessing the proper characteristics for subsequent lead optimization. Without proper selection of library templates and building blocks, solid phase synthesis methods often generate molecules which are too heavy, too lipophilic and too complex to be useful for lead optimization. The appropriate filtering of virtual library designs with multiple computational tools allows the generation of information-rich libraries within a drug-like molecular property space. An understanding of the hit-to-lead process provides a practical guide to molecular design characteristics. Examples of leads generated from library approaches also provide a benchmarking of successes as well as aspects for continued development of library design practices.
Small Molecule-Photoactive Yellow Protein Labeling Technology in Live Cell Imaging
Directory of Open Access Journals (Sweden)
Feng Gao
2016-08-01
Full Text Available Characterization of the chemical environment, movement, trafficking and interactions of proteins in live cells is essential to understanding their functions. Labeling protein with functional molecules is a widely used approach in protein research to elucidate the protein location and functions both in vitro and in live cells or in vivo. A peptide or a protein tag fused to the protein of interest and provides the opportunities for an attachment of small molecule probes or other fluorophore to image the dynamics of protein localization. Here we reviewed the recent development of no-wash small molecular probes for photoactive yellow protein (PYP-tag, by the means of utilizing a quenching mechanism based on the intramolecular interactions, or an environmental-sensitive fluorophore. Several fluorogenic probes have been developed, with fast labeling kinetics and cell permeability. This technology allows quick live-cell imaging of cell-surface and intracellular proteins without a wash-out procedure.
Spectroscopy of Charged Quantum Dot Molecules
Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.
2006-03-01
Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.
Directory of Open Access Journals (Sweden)
Yuan-Ping Pang
2011-03-01
Full Text Available Ribosome-inactivating proteins (RIPs are toxic because they bind to 28S rRNA and depurinate a specific adenine residue from the α-sarcin/ricin loop (SRL, thereby inhibiting protein synthesis. Shiga-like toxins (Stx1 and Stx2, produced by Escherichia coli, are RIPs that cause outbreaks of foodborne diseases with significant morbidity and mortality. Ricin, produced by the castor bean plant, is another RIP lethal to mammals. Currently, no US Food and Drug Administration-approved vaccines nor therapeutics exist to protect against ricin, Shiga-like toxins, or other RIPs. Development of effective small-molecule RIP inhibitors as therapeutics is challenging because strong electrostatic interactions at the RIP•SRL interface make drug-like molecules ineffective in competing with the rRNA for binding to RIPs. Herein, we report small molecules that show up to 20% cell protection against ricin or Stx2 at a drug concentration of 300 nM. These molecules were discovered using the doorstop approach, a new approach to protein•polynucleotide inhibitors that identifies small molecules as doorstops to prevent an active-site residue of an RIP (e.g., Tyr80 of ricin or Tyr77 of Stx2 from adopting an active conformation thereby blocking the function of the protein rather than contenders in the competition for binding to the RIP. This work offers promising leads for developing RIP therapeutics. The results suggest that the doorstop approach might also be applicable in the development of other protein•polynucleotide inhibitors as antiviral agents such as inhibitors of the Z-DNA binding proteins in poxviruses. This work also calls for careful chemical and biological characterization of drug leads obtained from chemical screens to avoid the identification of irrelevant chemical structures and to avoid the interference caused by direct interactions between the chemicals being screened and the luciferase reporter used in screening assays.
International Nuclear Information System (INIS)
Jiang Xue-Dong; Xu He; Wang Xin
2014-01-01
The charge quantity of small particulates such as PM2.5 plays a key role in the collection efficiency of an electrostatic precipitator (ESP). Under a single electrostatic voltage, it is difficult to charge and absorb small particulates. A new method of superimposing an alternative voltage on the electrostatic voltage is provided in this paper. Characteristics of small particulates are analyzed under alternative and electrostatic voltages. It is demonstrated that an alternative voltage can significantly improve the collection efficiency in three aspects: preventing anti-corona, increasing the charge quantity of small particulates, and increasing the median particulate size by electric agglomeration. In addition, practical usage with the superposition of alternative voltage is provided, and the results are in agreement with the theoretical analysis. (physics of gases, plasmas, and electric discharges)
Experimental validation of calculated atomic charges in ionic liquids
Fogarty, Richard M.; Matthews, Richard P.; Ashworth, Claire R.; Brandt-Talbot, Agnieszka; Palgrave, Robert G.; Bourne, Richard A.; Vander Hoogerstraete, Tom; Hunt, Patricia A.; Lovelock, Kevin R. J.
2018-05-01
A combination of X-ray photoelectron spectroscopy and near edge X-ray absorption fine structure spectroscopy has been used to provide an experimental measure of nitrogen atomic charges in nine ionic liquids (ILs). These experimental results are used to validate charges calculated with three computational methods: charges from electrostatic potentials using a grid-based method (ChelpG), natural bond orbital population analysis, and the atoms in molecules approach. By combining these results with those from a previous study on sulfur, we find that ChelpG charges provide the best description of the charge distribution in ILs. However, we find that ChelpG charges can lead to significant conformational dependence and therefore advise that small differences in ChelpG charges (<0.3 e) should be interpreted with care. We use these validated charges to provide physical insight into nitrogen atomic charges for the ILs probed.
Considerable improvement in the stability of solution processed small molecule OLED by annealing
Energy Technology Data Exchange (ETDEWEB)
Mao Guilin [Key Laboratory of Photonics Technology for Information, Key Laboratory for Physical Electronics and Devices of the Ministry of Education, School of Electronic and Information Engineering, Xi' an Jiaotong University, Xi' an, 710049 (China); Wu Zhaoxin, E-mail: zhaoxinwu@mail.xjtu.edu.cn [Key Laboratory of Photonics Technology for Information, Key Laboratory for Physical Electronics and Devices of the Ministry of Education, School of Electronic and Information Engineering, Xi' an Jiaotong University, Xi' an, 710049 (China); He Qiang [Key Laboratory of Photonics Technology for Information, Key Laboratory for Physical Electronics and Devices of the Ministry of Education, School of Electronic and Information Engineering, Xi' an Jiaotong University, Xi' an, 710049 (China); Department of UAV, Wuhan Ordnance Noncommissioned Officers Academy, Wuhan, 430075 (China); Jiao Bo; Xu Guojin; Hou Xun [Key Laboratory of Photonics Technology for Information, Key Laboratory for Physical Electronics and Devices of the Ministry of Education, School of Electronic and Information Engineering, Xi' an Jiaotong University, Xi' an, 710049 (China); Chen Zhijian; Gong Qihuang [State Key Laboratory for Mesoscopic Physics and Department of Physics, Peking University, Beijing, 100871 (China)
2011-06-15
We investigated the annealing effect on solution processed small organic molecule organic films, which were annealed with various conditions. It was found that the densities of the spin-coated (SC) films increased and the surface roughness decreased as the annealing temperature rose. We fabricated corresponding organic light emitting diodes (OLEDs) by spin coating on the same annealing conditions. The solution processed OLEDs show the considerable efficiency and stability, which were prior or equivalent to the vacuum-deposited (VD) counterparts. Our research shows that annealing process plays a key role in prolonging the lifetime of solution processed small molecule OLEDs, and the mechanism for the improvement of the device performance upon annealing was also discussed.
Cross-sections for inelastic collisions of fast charged particles with atoms and molecules
International Nuclear Information System (INIS)
Inokuti, M.
1987-01-01
Despite the long history of research, the current experimental data of the cross-sections, required for solving problems of radiological physics and dosimetry, are far from being complete or even satisfactory for tentative applications. Calculations are, in general, difficult and only in exceptional situations lead to reliable results. Thus, one practical approach to the cross-section determination is to test experimental data with general criteria. This is possible because cross-sections for various processes are related among themselves and with many other properties of atoms and molecules. For example, the Bethe theory indicates a close connection between photoabsorption and energy absorption by glancing collisions and puts many other useful constraints on the cross-section data. Development and use of these data constraints, first advanced by Platzman, can now be demonstrated in many examples. More recent studies concern the determination of the analytic expression most suitable for fitting the data on the oscillator strength distribution or the energy distribution of secondary electrons from ionizing collisions of charged particles. There are three areas to which major efforts should be directed: (1) Methods of absolute cross-section measurements, both for electron and ionic collisions, must be thoroughly reviewed so that sources of systematic errors may be identified and corrected. (2) Efforts should be devoted to the understanding of the data systematics, viz. the trends of cross-sections for a series of molecules. This is especially important because the variety of molecules relevant to radiological physics and radiation biology is so enormous that even the data presentation for each molecule will be impractical. (3) Electron and ionic collisions with molecules in condensed phases will be an important topic of study for years to come. Initial reports on efforts in this direction are encouraging. 49 refs
Dey, Supratim; Anbanandam, Asokan; Mumford, Ben E; De Guzman, Roberto N
2017-09-21
Many pathogens such as Shigella and other bacteria assemble the type III secretion system (T3SS) nanoinjector to inject virulence proteins into their target cells to cause infectious diseases in humans. The rise of drug resistance among pathogens that rely on the T3SS for infectivity, plus the dearth of new antibiotics require alternative strategies in developing new antibiotics. The Shigella T3SS tip protein IpaD is an attractive target for developing anti-infectives because of its essential role in virulence and its exposure on the bacterial surface. Currently, the only known small molecules that bind to IpaD are bile salt sterols. In this study we identified four new small-molecule scaffolds that bind to IpaD, based on the methylquinoline, pyrrolidine-aniline, hydroxyindole, and morpholinoaniline scaffolds. NMR mapping revealed potential hotspots in IpaD for binding small molecules. These scaffolds can be used as building blocks in developing small-molecule inhibitors of IpaD that could lead to new anti-infectives. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Process Intensification Tools in the Small‐Scale Pharmaceutical Manufacturing of Small Molecules
DEFF Research Database (Denmark)
Mitic, Aleksandar; Gernaey, Krist V.
2015-01-01
of processes are in a state of change. However, it is important to note that not all processes can be intensified easily, such as slow chemical reactions, processes with solids, slurries, and on the like. This review summarizes applications of promising tools for achieving process intensification in the small......‐scale pharmaceutical manufacturing of so‐called small molecules. The focus is on microwave radiation, microreactors, ultrasounds, and meso‐scale tubular reactors....
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lorenz, Daniel A; Song, James M; Garner, Amanda L
2015-01-21
MicroRNAs (miRNA) play critical roles in human development and disease. As such, the targeting of miRNAs is considered attractive as a novel therapeutic strategy. A major bottleneck toward this goal, however, has been the identification of small molecule probes that are specific for select RNAs and methods that will facilitate such discovery efforts. Using pre-microRNAs as proof-of-concept, herein we report a conceptually new and innovative approach for assaying RNA-small molecule interactions. Through this platform assay technology, which we term catalytic enzyme-linked click chemistry assay or cat-ELCCA, we have designed a method that can be implemented in high throughput, is virtually free of false readouts, and is general for all nucleic acids. Through cat-ELCCA, we envision the discovery of selective small molecule ligands for disease-relevant miRNAs to promote the field of RNA-targeted drug discovery and further our understanding of the role of miRNAs in cellular biology.
Current practices in generation of small molecule new leads.
Goodnow, R A
2001-01-01
The current drug discovery processes in many pharmaceutical companies require large and growing collections of high quality lead structures for use in high throughput screening assays. Collections of small molecules with diverse structures and "drug-like" properties have, in the past, been acquired by several means: by archive of previous internal lead optimization efforts, by purchase from compound vendors, and by union of separate collections following company mergers. More recently, many drug discovery companies have established dedicated efforts to effect synthesis by internal and/or outsourcing efforts of targeted compound libraries for new lead generation. Although high throughput/combinatorial chemistry is an important component in the process of new lead generation, the selection of library designs for synthesis and the subsequent design of library members has evolved to a new level of challenge and importance. The potential benefits of screening multiple small molecule compound library designs against multiple biological targets offers substantial opportunity to discover new lead structures. Subsequent optimization of such compounds is often accelerated because of the structure-activity relationship (SAR) information encoded in these lead generation libraries. Lead optimization is often facilitated due to the ready applicability of high-throughput chemistry (HTC) methods for follow-up synthesis. Some of the strategies, trends, and critical issues central to the success of lead generation processes are discussed below. Copyright 2002 Wiley-Liss, Inc.
Post-transcriptional bursting in genes regulated by small RNA molecules
Rodrigo, Guillermo
2018-03-01
Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.
A new class of pluripotent stem cell cytotoxic small molecules.
Directory of Open Access Journals (Sweden)
Mark Richards
Full Text Available A major concern in Pluripotent Stem Cell (PSC-derived cell replacement therapy is the risk of teratoma formation from contaminating undifferentiated cells. Removal of undifferentiated cells from differentiated cultures is an essential step before PSC-based cell therapies can be safely deployed in a clinical setting. We report a group of novel small molecules that are cytotoxic to PSCs. Our data indicates that these molecules are specific and potent in their activity allowing rapid eradication of undifferentiated cells. Experiments utilizing mixed PSC and primary human neuronal and cardiomyocyte cultures demonstrate that up to a 6-fold enrichment for specialized cells can be obtained without adversely affecting cell viability and function. Several structural variants were synthesized to identify key functional groups and to improve specificity and efficacy. Comparative microarray analysis and ensuing RNA knockdown studies revealed involvement of the PERK/ATF4/DDIT3 ER stress pathway. Surprisingly, cell death following ER stress induction was associated with a concomitant decrease in endogenous ROS levels in PSCs. Undifferentiated cells treated with these molecules preceding transplantation fail to form teratomas in SCID mice. Furthermore, these molecules remain non-toxic and non-teratogenic to zebrafish embryos suggesting that they may be safely used in vivo.
Small-scale gradients of charged particles in the heliospheric magnetic field
International Nuclear Information System (INIS)
Guo, Fan; Giacalone, Joe
2014-01-01
Using numerical simulations of charged-particles propagating in the heliospheric magnetic field, we study small-scale gradients, or 'dropouts,' in the intensity of solar energetic particles seen at 1 AU. We use two turbulence models, the foot-point random motion model and the two-component model, to generate fluctuating magnetic fields similar to spacecraft observations at 1 AU. The turbulence models include a Kolmogorov-like magnetic field power spectrum containing a broad range of spatial scales from those that lead to large-scale field-line random walk to small scales leading to resonant pitch-angle scattering of energetic particles. We release energetic protons (20 keV-10 MeV) from a spatially compact and instantaneous source. The trajectories of energetic charged particles in turbulent magnetic fields are numerically integrated. Spacecraft observations are mimicked by collecting particles in small windows when they pass the windows at a distance of 1 AU. We show that small-scale gradients in the intensity of energetic particles and velocity dispersions observed by spacecraft can be reproduced using the foot-point random motion model. However, no dropouts are seen in simulations using the two-component magnetic turbulence model. We also show that particle scattering in the solar wind magnetic field needs to be infrequent for intensity dropouts to form.
A new component of the interstellar matter - Small grains and large aromatic molecules
International Nuclear Information System (INIS)
Puget, J.L.
1989-01-01
Predictions from dust models constructed to account for the interstellar extinction curve are in conflict with emission data. This paper shows that the introduction of small grains and large aromatic molecules as a new component of the interstellar matter can resolve this conflict. Observational evidence for the existence of very small grains is also reviewed, along with the physics of IR emission by thermal fluctuations and its relation to very small particles. 99 refs
Photoionization of atoms and small molecules using synchrotron radiation
International Nuclear Information System (INIS)
Ferrett, T.A.
1986-11-01
The combination of synchrotron radiation and time-of-flight electron spectroscopy has been used to study the photoionization dynamics of atoms (Li) and small molecules (SF 6 , SiF 4 , and SO 2 ). Partial cross sections and angular distribution asymmetry parameters have been measured for Auger electrons and photoelectrons as functions of photon energy. Emphasis is on the basic understanding of electron correlation and resonant effects as manifested in the photoemission spectra for these systems. 254 refs., 46 figs., 10 tabs
Guo, Min; Gamby, Sonja; Zheng, Yue; Sintim, Herman O.
2013-01-01
Bacteria respond to different small molecules that are produced by other neighboring bacteria. These molecules, called autoinducers, are classified as intraspecies (i.e., molecules produced and perceived by the same bacterial species) or interspecies (molecules that are produced and sensed between different bacterial species). AI-2 has been proposed as an interspecies autoinducer and has been shown to regulate different bacterial physiology as well as affect virulence factor production and biofilm formation in some bacteria, including bacteria of clinical relevance. Several groups have embarked on the development of small molecules that could be used to perturb AI-2 signaling in bacteria, with the ultimate goal that these molecules could be used to inhibit bacterial virulence and biofilm formation. Additionally, these molecules have the potential to be used in synthetic biology applications whereby these small molecules are used as inputs to switch on and off AI-2 receptors. In this review, we highlight the state-of-the-art in the development of small molecules that perturb AI-2 signaling in bacteria and offer our perspective on the future development and applications of these classes of molecules. PMID:23994835
Yin, Ming; Zhang, Xin-Ping; Liu, Hong-Mei
2012-11-01
The crystallization properties of the perylene (EPPTC) molecules doped in the solid film of the derivative of polyfluorene (F8BT) at different annealing temperatures, as well as the consequently induced spectroscopic response of the exciplex emission in the heterojunction structures, were studied in the present paper. Experimental results showed that the phase separation between the small and the polymer molecules in the blend film is enhanced with increasing the annealing temperature, which leads to the crystallization of the EPPTC molecules due to the strong pi-pi stacking. The size of the crystal phase increases with increasing the annealing temperature. However, this process weakens the mechanisms of the heterojunction configuration, thus, the total interfacial area between the small and the polymer molecules and the amount of exciplex are reduced significantly in the blend film. Meanwhile, the energy transfer from the polymer to the small molecules is also reduced. As a result, the emission from the exciplex becomes weaker with increasing the annealing temperature, whereas the stronger emission from the polymer molecules and from the crystal phase of the small molecules can be observed. These experimental results are very important for understanding and tailoring the organic heterojunction structures. Furthermore, this provides photophysics for improving the performance of photovoltaic or solar cell devices.
Determining the optimal size of small molecule mixtures for high throughput NMR screening
International Nuclear Information System (INIS)
Mercier, Kelly A.; Powers, Robert
2005-01-01
High-throughput screening (HTS) using NMR spectroscopy has become a common component of the drug discovery effort and is widely used throughout the pharmaceutical industry. NMR provides additional information about the nature of small molecule-protein interactions compared to traditional HTS methods. In order to achieve comparable efficiency, small molecules are often screened as mixtures in NMR-based assays. Nevertheless, an analysis of the efficiency of mixtures and a corresponding determination of the optimum mixture size (OMS) that minimizes the amount of material and instrumentation time required for an NMR screen has been lacking. A model for calculating OMS based on the application of the hypergeometric distribution function to determine the probability of a 'hit' for various mixture sizes and hit rates is presented. An alternative method for the deconvolution of large screening mixtures is also discussed. These methods have been applied in a high-throughput NMR screening assay using a small, directed library
Electrons from fixed in space molecules and clusters
International Nuclear Information System (INIS)
Doerner, R.; Jahnke, T.; Czasch, A.; Jagutzki, O.; Schmidt-Boecking; Kreidi, K.; Knapp, A.; Schmidt, L.; Schoeffler, M.; Foucar, L.; Cocke, C.L.; Osipov, T.; Alnaser, A.
2004-01-01
Full text: We use modern multi particle momentum imaging techniques (COLTRIMS) to measure the vector momenta of all charged fragments, ions, photoelectrons and Auger electrons for small molecules excited by synchrotron radiation. These complete images of the fragmentation give an umprecedented detailed insight in the molecular photoionization and Auger process. Also latest results on molecular double ionisation and on cluster fragmentation unveiling interatomic coulomb decay will be presented
PD-1/PD-L1 Inhibitors for Immuno-oncology: From Antibodies to Small Molecules.
Geng, Qiaohong; Jiao, Peifu; Jin, Peng; Su, Gaoxing; Dong, Jinlong; Yan, Bing
2018-02-12
The recent regulatory approvals of immune checkpoint protein inhibitors, such as ipilimumab, pembrolizumab, nivolumab, atezolizumab, durvalumab, and avelumab ushered a new era in cancer therapy. These inhibitors do not attack tumor cells directly but instead mobilize the immune system to re-recognize and eradicate tumors, which endows them with unique advantages including durable clinical responses and substantial clinical benefits. PD-1/PD-L1 inhibitors, a pillar of immune checkpoint protein inhibitors, have demonstrated unprecedented clinical efficacy in more than 20 cancer types. Besides monoclonal antibodies, diverse PD- 1/PD-L1 inhibiting candidates, such as peptides, small molecules have formed a powerful collection of weapons to fight cancer. The goal of this review is to summarize and discuss the current PD-1/PD-L1 inhibitors including candidates under clinical development, their molecular interactions with PD-1 or PD-L1, the disclosed structureactivity relationships of peptides and small molecules as inhibitors. Current PD-1/PD-L1 inhibitors under clinical development are exclusively dominated by antibodies. The molecular interactions of therapeutic antibodies with PD-1 or PD-L1 have been gradually elucidated for the design of novel inhibitors. Various peptides and traditional small molecules have been investigated in preclinical model to discover novel PD-1/PD-L1 inhibitors. Peptides and small molecules may play an important role in immuno-oncology because they may bind to multiple immune checkpoint proteins via rational design, opening opportunity for a new generation of novel PD-1/PD-L1 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Meng Zhang; Peh, Jessie; Hergenrother, Paul J; Cunningham, Brian T
2014-01-01
High throughput screening of protein-small molecule binding interactions using label-free optical biosensors is challenging, as the detected signals are often similar in magnitude to experimental noise. Here, we describe a novel self-referencing external cavity laser (ECL) biosensor approach that achieves high resolution and high sensitivity, while eliminating thermal noise with sub-picometer wavelength accuracy. Using the self-referencing ECL biosensor, we demonstrate detection of binding between small molecules and a variety of immobilized protein targets with binding affinities or inhibition constants in the sub-nanomolar to low micromolar range. The demonstrated ability to perform detection in the presence of several interfering compounds opens the potential for increasing the throughput of the approach. As an example application, we performed a "needle-in-the-haystack" screen for inhibitors against carbonic anhydrase isozyme II (CA II), in which known inhibitors are clearly differentiated from inactive molecules within a compound library.
DEFF Research Database (Denmark)
Gessier, Francois; Preuss, Inga; Yin, Hong
2014-01-01
immune response and has been genetically linked to autoimmune diseases such as type I diabetes ( Nature 2010 , 467 , 460 ). Here we describe the isolation of a potent small molecule antagonist for the EBI2 receptor. First, we identified a small molecule agonist NIBR51 (1), which enabled identification...
Energy Technology Data Exchange (ETDEWEB)
Sokolova, Viktoriya; Rotan, Olga; Klesing, Jan [University of Duisburg-Essen, Inorganic Chemistry and Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany); Nalbant, Perihan [University of Duisburg-Essen, Faculty of Biology, Institute of Molecular Cell Biology (Germany); Buer, Jan; Knuschke, Torben; Westendorf, Astrid M. [University Hospital Essen, University of Duisburg-Essen, Institute of Medical Microbiology (Germany); Epple, Matthias, E-mail: matthias.epple@uni-due.de [University of Duisburg-Essen, Inorganic Chemistry and Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany)
2012-06-15
The successful transport of molecules across the cell membrane is a key point in biology and medicine. In most cases, molecules alone cannot penetrate the cell membrane, therefore an efficient carrier is needed. Calcium phosphate nanoparticles (diameter: 100-250 nm, depending on the functionalization) were loaded with fluorescent oligonucleotides, peptide, proteins, antibodies, polymers or porphyrins and characterized by dynamic light scattering, nanoparticle tracking analysis and scanning electron microscopy. Any excess of molecules was removed by ultracentrifugation, and the dissolved molecules at the same concentration were used as control. The uptake of such fluorescence-labeled nanoparticles into HeLa cells was monitored by fluorescence microscopy and confocal laser scanning microscopy. Calcium phosphate nanoparticles were able to transport all molecules across the cell membrane, whereas the dissolved molecules alone were taken up only to a very small extent or even not at all.
Sokolova, Viktoriya; Rotan, Olga; Klesing, Jan; Nalbant, Perihan; Buer, Jan; Knuschke, Torben; Westendorf, Astrid M.; Epple, Matthias
2012-06-01
The successful transport of molecules across the cell membrane is a key point in biology and medicine. In most cases, molecules alone cannot penetrate the cell membrane, therefore an efficient carrier is needed. Calcium phosphate nanoparticles (diameter: 100-250 nm, depending on the functionalization) were loaded with fluorescent oligonucleotides, peptide, proteins, antibodies, polymers or porphyrins and characterized by dynamic light scattering, nanoparticle tracking analysis and scanning electron microscopy. Any excess of molecules was removed by ultracentrifugation, and the dissolved molecules at the same concentration were used as control. The uptake of such fluorescence-labeled nanoparticles into HeLa cells was monitored by fluorescence microscopy and confocal laser scanning microscopy. Calcium phosphate nanoparticles were able to transport all molecules across the cell membrane, whereas the dissolved molecules alone were taken up only to a very small extent or even not at all.
International Nuclear Information System (INIS)
Sokolova, Viktoriya; Rotan, Olga; Klesing, Jan; Nalbant, Perihan; Buer, Jan; Knuschke, Torben; Westendorf, Astrid M.; Epple, Matthias
2012-01-01
The successful transport of molecules across the cell membrane is a key point in biology and medicine. In most cases, molecules alone cannot penetrate the cell membrane, therefore an efficient carrier is needed. Calcium phosphate nanoparticles (diameter: 100–250 nm, depending on the functionalization) were loaded with fluorescent oligonucleotides, peptide, proteins, antibodies, polymers or porphyrins and characterized by dynamic light scattering, nanoparticle tracking analysis and scanning electron microscopy. Any excess of molecules was removed by ultracentrifugation, and the dissolved molecules at the same concentration were used as control. The uptake of such fluorescence-labeled nanoparticles into HeLa cells was monitored by fluorescence microscopy and confocal laser scanning microscopy. Calcium phosphate nanoparticles were able to transport all molecules across the cell membrane, whereas the dissolved molecules alone were taken up only to a very small extent or even not at all.
Small-molecule AT2 receptor agonists
DEFF Research Database (Denmark)
Hallberg, Mathias; Sumners, Colin; Steckelings, U Muscha
2018-01-01
The discovery of the first selective, small-molecule ATR receptor (AT2R) agonist compound 21 (C21) (8) that is now extensively studied in a large variety of in vitro and in vivo models is described. The sulfonylcarbamate derivative 8, encompassing a phenylthiofen scaffold is the drug-like agonist...... with the highest affinity for the AT2R reported to date (Ki = 0.4 nM). Structure-activity relationships (SAR), regarding different biaryl scaffolds and functional groups attached to these scaffolds and with a particular focus on the impact of various para substituents displacing the methylene imidazole group of 8......, are discussed. Furthermore, the consequences of migration of the methylene imidazole group and presumed structural requirements for ligands that are aimed as AT2R agonists (e.g. 8) or AT2R antagonists (e.g. 9), respectively, are briefly addressed. A summary of the pharmacological actions of C21 (8) is also...
Fei, Yiyan; Landry, James P; Sun, Yungshin; Zhu, Xiangdong; Wang, Xiaobing; Luo, Juntao; Wu, Chun-Yi; Lam, Kit S
2010-01-01
We describe a high-throughput scanning optical microscope for detecting small-molecule compound microarrays on functionalized glass slides. It is based on measurements of oblique-incidence reflectivity difference and employs a combination of a y-scan galvometer mirror and an x-scan translation stage with an effective field of view of 2 cm x 4 cm. Such a field of view can accommodate a printed small-molecule compound microarray with as many as 10,000 to 20,000 targets. The scanning microscope is capable of measuring kinetics as well as endpoints of protein-ligand reactions simultaneously. We present the experimental results on solution-phase protein reactions with small-molecule compound microarrays synthesized from one-bead, one-compound combinatorial chemistry and immobilized on a streptavidin-functionalized glass slide.
Directory of Open Access Journals (Sweden)
Ioan Bâldea
2016-03-01
Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.
The Molecular Industrial Revolution: Automated Synthesis of Small Molecules.
Trobe, Melanie; Burke, Martin D
2018-04-09
Today we are poised for a transition from the highly customized crafting of specific molecular targets by hand to the increasingly general and automated assembly of different types of molecules with the push of a button. Creating machines that are capable of making many different types of small molecules on demand, akin to that which has been achieved on the macroscale with 3D printers, is challenging. Yet important progress is being made toward this objective with two complementary approaches: 1) Automation of customized synthesis routes to different targets by machines that enable the use of many reactions and starting materials, and 2) automation of generalized platforms that make many different targets using common coupling chemistry and building blocks. Continued progress in these directions has the potential to shift the bottleneck in molecular innovation from synthesis to imagination, and thereby help drive a new industrial revolution on the molecular scale. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Isonitrile ligand effects on small-molecule-sequestering in bimetalladodecaborane clusters
Czech Academy of Sciences Publication Activity Database
Bould, Jonathan; Londesborough, Michael Geoffrey Stephen; Kennedy, JD.; Macias, R.; Winter, REK.; Císařová, I.; Kubát, Pavel; Lang, Kamil
2013-01-01
Roč. 747, december (2013), s. 76-84 ISSN 0022-328X R&D Projects: GA ČR GAP207/11/1577; GA ČR GAP208/10/1678; GA ČR GAP207/11/0705 Institutional support: RVO:61388980 ; RVO:61388955 Keywords : Metallaboranes * Small molecule * Sequestration * DFT * Isonitrile * Carbon monoxide Subject RIV: CA - Inorganic Chemistry; CF - Physical ; Theoretical Chemistry (UFCH-W) Impact factor: 2.302, year: 2013
Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.
Directory of Open Access Journals (Sweden)
Scott S Walker
Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.
International Nuclear Information System (INIS)
Zhou, Liping; Zhu, Anna; Lou, Xuening; Song, Dan; Yang, Rong; Shi, Hanchang; Long, Feng
2016-01-01
A universal sandwich-like immunoassay strategy based on quantum-dots immunoprobe (QD-labeled anti-mouse IgG antibody) was developed for rapid and ultrasensitive detection of small molecules. A portable and reusable optofluidic nano-biosensing platform was applied to investigate the sandwich-like immunoassay mechanism and format of small molecules, as well as the binding kinetics between QD immunoprobe and anti-small molecule antibody. A two-step immunoassay method that involves pre-incubation mixture of different concentration of small molecule and anti-small molecule antibody, and subsequent introduction of QD immunoprobe into the optofluidic cell was conducted for small molecule determination. Compared with the one-step immunoassay method, the two-step immunoassay method can obtain higher fluorescence signal and higher sensitivity index, thus improving the nano-biosensing performance. Based on the proposed strategy, two mode targets, namely, microcystin-LR (MC-LR) and Bisphenol A (BPA) were tested with high sensitivity, rapidity, and ease of use. A higher concentration of small molecules in the sample led to less anti-small molecule antibody bound with antigen-carrier protein conjugate immobilized onto the sensor surface, and less QD immunoprobes bound with anti-small molecule antibody. This phenomenon lowered the fluorescence signal detected by nano-biosensing platform. Under optimal operating conditions, MC-LR and BPA exhibited a limit of detection of 0.003 and 0.04 μg/L, respectively. The LODs were better than those of the indirect competitive immunoassay method for small molecules via Cy5.5-labeled anti-small molecule antibody. The proposed QD-based sandwich-like immunoassay strategy was evaluated in spiked water samples, and showed good recovery, precision and accuracy without complicated sample pretreatments. All these results demonstrate that the new detection strategy could be readily applied to the other trace small molecules in real water samples
Energy Technology Data Exchange (ETDEWEB)
Zhou, Liping; Zhu, Anna; Lou, Xuening; Song, Dan; Yang, Rong [School of Environment and Natural Resources, Renmin University of China, Beijing (China); Shi, Hanchang [School of Environment, Tsinghua University, Beijing (China); Long, Feng, E-mail: longf04@ruc.edu.cn [School of Environment and Natural Resources, Renmin University of China, Beijing (China)
2016-01-28
A universal sandwich-like immunoassay strategy based on quantum-dots immunoprobe (QD-labeled anti-mouse IgG antibody) was developed for rapid and ultrasensitive detection of small molecules. A portable and reusable optofluidic nano-biosensing platform was applied to investigate the sandwich-like immunoassay mechanism and format of small molecules, as well as the binding kinetics between QD immunoprobe and anti-small molecule antibody. A two-step immunoassay method that involves pre-incubation mixture of different concentration of small molecule and anti-small molecule antibody, and subsequent introduction of QD immunoprobe into the optofluidic cell was conducted for small molecule determination. Compared with the one-step immunoassay method, the two-step immunoassay method can obtain higher fluorescence signal and higher sensitivity index, thus improving the nano-biosensing performance. Based on the proposed strategy, two mode targets, namely, microcystin-LR (MC-LR) and Bisphenol A (BPA) were tested with high sensitivity, rapidity, and ease of use. A higher concentration of small molecules in the sample led to less anti-small molecule antibody bound with antigen-carrier protein conjugate immobilized onto the sensor surface, and less QD immunoprobes bound with anti-small molecule antibody. This phenomenon lowered the fluorescence signal detected by nano-biosensing platform. Under optimal operating conditions, MC-LR and BPA exhibited a limit of detection of 0.003 and 0.04 μg/L, respectively. The LODs were better than those of the indirect competitive immunoassay method for small molecules via Cy5.5-labeled anti-small molecule antibody. The proposed QD-based sandwich-like immunoassay strategy was evaluated in spiked water samples, and showed good recovery, precision and accuracy without complicated sample pretreatments. All these results demonstrate that the new detection strategy could be readily applied to the other trace small molecules in real water samples
Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework
Energy Technology Data Exchange (ETDEWEB)
Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)
2014-09-01
The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.
International Nuclear Information System (INIS)
Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I.; Barik, Tapan Kumar
2012-01-01
COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)
Energy Technology Data Exchange (ETDEWEB)
Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I., E-mail: prem_indra@yahoo.co.in [Radiation Biosciences Division, Institute of Nuclear Medicine and Allied Sciences, Delhi (India); Barik, Tapan Kumar [P.G. Department of Zoology, Berhampur University, Berhampur (India)
2012-07-01
COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)
Small-molecule modulators of PXR and CAR
Chai, Sergio C.; Cherian, Milu T.; Wang, Yue-Ming; Chen, Taosheng
2016-01-01
Two nuclear receptors, the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR), participate in the xenobiotic detoxification system by regulating the expression of drug-metabolizing enzymes and transporters in order to degrade and excrete foreign chemicals or endogenous metabolites. This review aims to expand the perceived relevance of PXR and CAR beyond their established role as master xenosensors to disease-oriented areas, emphasizing their modulation by small molecules. Structural studies of these receptors have provided much-needed insight into the nature of their binding promiscuity and the important elements that lead to ligand binding. Reports of species- and isoform-selective activation highlight the need for further scrutiny when extrapolating from animal data to humans, as animal models are at the forefront of early drug discovery. PMID:26921498
Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond
Directory of Open Access Journals (Sweden)
David eDavidson
2013-01-01
Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA
Shaw-Stewart, J. R. H.; Mattle, T.; Lippert, T. K.; Nagel, M.; Nüesch, F. A.; Wokaun, A.
2013-01-01
Laser-induced forward transfer (LIFT) is a versatile organic light-emitting diode (OLED) pixel deposition process, but has hitherto been applied exclusively to polymeric materials. Here, a modified LIFT process has been used to fabricate small molecule Alq3 organic light-emitting diodes (SMOLEDs). Small molecule thin films are considerably more mechanically brittle than polymeric thin films, which posed significant challenges for LIFT of these materials. The LIFT process presented here uses a polymeric dynamic release layer, a reduced environmental pressure, and a well-defined receiver-donor gap. The Alq3 pixels demonstrate good morphology and functionality, even when compared to conventionally fabricated OLEDs. The Alq3 SMOLED pixel performances show a significant amount of fluence dependence, not observed with polymerical OLED pixels made in previous studies. A layer of tetrabutyl ammonium hydroxide has been deposited on top of the aluminium cathode, as part of the donor substrate, to improve electron injection to the Alq3, by over 600%. These results demonstrate that this variant of LIFT is applicable for the deposition of functional small molecule OLEDs as well as polymeric OLEDs.
Rapid parameterization of small molecules using the Force Field Toolkit.
Mayne, Christopher G; Saam, Jan; Schulten, Klaus; Tajkhorshid, Emad; Gumbart, James C
2013-12-15
The inability to rapidly generate accurate and robust parameters for novel chemical matter continues to severely limit the application of molecular dynamics simulations to many biological systems of interest, especially in fields such as drug discovery. Although the release of generalized versions of common classical force fields, for example, General Amber Force Field and CHARMM General Force Field, have posited guidelines for parameterization of small molecules, many technical challenges remain that have hampered their wide-scale extension. The Force Field Toolkit (ffTK), described herein, minimizes common barriers to ligand parameterization through algorithm and method development, automation of tedious and error-prone tasks, and graphical user interface design. Distributed as a VMD plugin, ffTK facilitates the traversal of a clear and organized workflow resulting in a complete set of CHARMM-compatible parameters. A variety of tools are provided to generate quantum mechanical target data, setup multidimensional optimization routines, and analyze parameter performance. Parameters developed for a small test set of molecules using ffTK were comparable to existing CGenFF parameters in their ability to reproduce experimentally measured values for pure-solvent properties (<15% error from experiment) and free energy of solvation (±0.5 kcal/mol from experiment). Copyright © 2013 Wiley Periodicals, Inc.
Kozlov, Oleg V.; Luponosov, Yuriy N.; Ponomarenko, Sergei A.; Kausch-Busies, Nina; Paraschuk, Dmitry Yu; Olivier, Yoann; Beljonne, David; Cornil, Jerome; Pshenichnikov, Maxim S.
2015-01-01
The quest for new materials is one of the main factors propelling recent advances in organic photovoltaics. Star-shaped small molecules (SSMs) have been proven promising candidates as perspective donor material due to the increase in numbers of excitation pathways caused by the degeneracy of the
Pan, Jinhong
The receptor of advanced glycation end product (RAGE) is a multiligand receptor of the immunoglobulin superfamily of cell surface molecules, which plays an important role in immune responses. Full-length RAGE includes three extracellular immunoglobulin domains, a transmembrane domain and an intracellular domain. It is a pattern recognition receptor that can bind diverse ligands. NMR spectroscopy and x-ray crystallization studies of the extracellular domains of RAGE indicate that RAGE ligands bind by distinct charge- and hydrophobicity-dependent mechanisms. It is found that calgranulin binding to the C1C2 domain or AGEs binding to the V domain activates extracellular signaling, which triggers interactions of the RAGE cytoplasmic tail (ctRAGE) with intracellular effector, such as diaphanous 1 (DIAPH1), to initiate signal transduction cascades. ctRAGE is essential for RAGE-ligand-mediated signal transduction and consequent modulation of gene expression and cellular properties. RAGE is over-expressed in diseased tissues of most RAGE-associated pathogenic conditions, such as complications of Alzheimer's diseases, diabetes, vascular diseases, inflammation, cancers and neurodegeneration. They are the major diseases affecting a large population worldwide. RAGE can function as a biomarker or drug target for these diseases. The cytoplasmic tail of RAGE can be used as a drug target to inhibit RAGE-induced intracellular signaling by small molecule inhibitors to treat RAGE-associated diseases. We developed a high throughput screening assay with which we probed a small molecule library of 58,000 compounds to find that 777 small molecules displayed 50% inhibition and 97 compounds demonstrated dose-dependent inhibition of the binding of ctRAGE-DIAPH1. Eventually, there were 13 compounds which displayed dose-dependent inhibition of ctRAGE binding to DIAPH1 and direct binding to ctRAGE analyzed by 15N HSQC-NMR and native tryptophan fluorescence titration experiments; thus, they were
Zhou, Lu; Yang, Lei; Yu, Mengjie; Jiang, Yi; Liu, Cheng-Fang; Lai, Wen-Yong; Huang, Wei
2017-11-22
Manufacturing small-molecule organic light-emitting diodes (OLEDs) via inkjet printing is rather attractive for realizing high-efficiency and long-life-span devices, yet it is challenging. In this paper, we present our efforts on systematical investigation and optimization of the ink properties and the printing process to enable facile inkjet printing of conjugated light-emitting small molecules. Various factors on influencing the inkjet-printed film quality during the droplet generation, the ink spreading on the substrates, and its solidification processes have been systematically investigated and optimized. Consequently, halogen-free inks have been developed and large-area patterning inkjet printing on flexible substrates with efficient blue emission has been successfully demonstrated. Moreover, OLEDs manufactured by inkjet printing the light-emitting small molecules manifested superior performance as compared with their corresponding spin-cast counterparts.
Li, Yi; Gu, Christine; Gruenhagen, Jason; Zhang, Kelly; Yehl, Peter; Chetwyn, Nik P; Medley, Colin D
2015-05-08
Antibody drug conjugates (ADCs) are complex therapeutic agents combining the specific targeting properties of antibodies and highly potent cytotoxic small molecule drugs to selectively eliminate tumor cells while limiting the toxicity to normal healthy tissues. One unique critical quality attribute of ADCs is the content of unconjugated small molecule drug present from either incomplete conjugation or degradation of the ADC. In this work, size exclusion chromatography (SEC) was coupled with reversed-phase (RP) HPLC in an online 2-dimensional chromatography format for identification and quantitation of unconjugated small molecule drugs and related small molecule impurities in ADC samples directly without sample preparation. The SEC method in the 1st dimension not only separated the small molecule impurities from the intact ADC, but also provided information about the size variants (monomer, dimer, aggregates, etc.) of the ADC. The small molecule peak from the SEC was trapped and sent to a RP-HPLC in the 2nd dimension to further separate and quantify the different small molecule impurities present in the ADC sample. This SEC-RP 2D-LC method demonstrated excellent precision (%RSDmolecule degradation products and aggregation of the conjugate were observed in the stability samples and the degradation pathways of the ADC were investigated. This 2D-LC method offers a powerful tool for ADC characterization and provides valuable information for conjugation and formulation development. Copyright © 2015 Elsevier B.V. All rights reserved.
Can radiation damage to protein crystals be reduced using small-molecule compounds?
Energy Technology Data Exchange (ETDEWEB)
Kmetko, Jan [Kenyon College, Gambier, OH 43022 (United States); Warkentin, Matthew; Englich, Ulrich; Thorne, Robert E., E-mail: ret6@cornell.edu [Cornell University, Ithaca, NY 14853 (United States); Kenyon College, Gambier, OH 43022 (United States)
2011-10-01
Free-radical scavengers that are known to be effective protectors of proteins in solution are found to increase global radiation damage to protein crystals. Protective mechanisms may become deleterious in the protein-dense environment of a crystal. Recent studies have defined a data-collection protocol and a metric that provide a robust measure of global radiation damage to protein crystals. Using this protocol and metric, 19 small-molecule compounds (introduced either by cocrystallization or soaking) were evaluated for their ability to protect lysozyme crystals from radiation damage. The compounds were selected based upon their ability to interact with radiolytic products (e.g. hydrated electrons, hydrogen, hydroxyl and perhydroxyl radicals) and/or their efficacy in protecting biological molecules from radiation damage in dilute aqueous solutions. At room temperature, 12 compounds had no effect and six had a sensitizing effect on global damage. Only one compound, sodium nitrate, appeared to extend crystal lifetimes, but not in all proteins and only by a factor of two or less. No compound provided protection at T = 100 K. Scavengers are ineffective in protecting protein crystals from global damage because a large fraction of primary X-ray-induced excitations are generated in and/or directly attack the protein and because the ratio of scavenger molecules to protein molecules is too small to provide appreciable competitive protection. The same reactivity that makes some scavengers effective radioprotectors in protein solutions may explain their sensitizing effect in the protein-dense environment of a crystal. A more productive focus for future efforts may be to identify and eliminate sensitizing compounds from crystallization solutions.
Can radiation damage to protein crystals be reduced using small-molecule compounds?
International Nuclear Information System (INIS)
Kmetko, Jan; Warkentin, Matthew; Englich, Ulrich; Thorne, Robert E.
2011-01-01
Free-radical scavengers that are known to be effective protectors of proteins in solution are found to increase global radiation damage to protein crystals. Protective mechanisms may become deleterious in the protein-dense environment of a crystal. Recent studies have defined a data-collection protocol and a metric that provide a robust measure of global radiation damage to protein crystals. Using this protocol and metric, 19 small-molecule compounds (introduced either by cocrystallization or soaking) were evaluated for their ability to protect lysozyme crystals from radiation damage. The compounds were selected based upon their ability to interact with radiolytic products (e.g. hydrated electrons, hydrogen, hydroxyl and perhydroxyl radicals) and/or their efficacy in protecting biological molecules from radiation damage in dilute aqueous solutions. At room temperature, 12 compounds had no effect and six had a sensitizing effect on global damage. Only one compound, sodium nitrate, appeared to extend crystal lifetimes, but not in all proteins and only by a factor of two or less. No compound provided protection at T = 100 K. Scavengers are ineffective in protecting protein crystals from global damage because a large fraction of primary X-ray-induced excitations are generated in and/or directly attack the protein and because the ratio of scavenger molecules to protein molecules is too small to provide appreciable competitive protection. The same reactivity that makes some scavengers effective radioprotectors in protein solutions may explain their sensitizing effect in the protein-dense environment of a crystal. A more productive focus for future efforts may be to identify and eliminate sensitizing compounds from crystallization solutions
Femtosecond response of polyatomic molecules to ultra-intense hard X-rays.
Rudenko, A; Inhester, L; Hanasaki, K; Li, X; Robatjazi, S J; Erk, B; Boll, R; Toyota, K; Hao, Y; Vendrell, O; Bomme, C; Savelyev, E; Rudek, B; Foucar, L; Southworth, S H; Lehmann, C S; Kraessig, B; Marchenko, T; Simon, M; Ueda, K; Ferguson, K R; Bucher, M; Gorkhover, T; Carron, S; Alonso-Mori, R; Koglin, J E; Correa, J; Williams, G J; Boutet, S; Young, L; Bostedt, C; Son, S-K; Santra, R; Rolles, D
2017-06-01
X-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecular system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects-an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure-the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is
Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing
2017-08-01
The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Khandelia, Himanshu
2008-01-01
, comparable to the affinities for the binding of small molecule ligands to proteins, was measured for phosphatidic acid (PA, mole fraction of XPA ) 0.2 in phosphatidylcholine vesicles), yielding a molecular partition coefficient of 240 ( 80 × 106. An MD simulation on the siramesine:PA interaction...
Chen, Yangwu; Huang, Jiayun; Tang, Chenqi; Chen, Xiao; Yin, Zi; Heng, Boon Chin; Chen, Weishan; Shen, Weiliang
2017-10-01
Inflammation-associated chronic musculoskeletal degenerative diseases (ICMDDs) like osteoarthritis and tendinopathy often results in morbidity and disability, with consequent heavy socio-economic burden. Current available therapies such as NSAIDs and glucocorticoid are palliative rather than disease-modifying. Insufficient systematic research data on disease molecular mechanism also makes it difficult to exploit valid therapeutic targets. Small molecules are designed to act on specific signaling pathways and/or mechanisms of cellular physiology and function, and have gradually shown potential for treating ICMDDs. In this review, we would examine and analyze recent developments in small molecule drugs for ICMDDs, suggest possible feasible improvements in treatment modalities, and discuss future research directions. Copyright © 2017. Published by Elsevier Inc.
Effect of small-molecule modification on single-cell pharmacokinetics of PARP inhibitors.
Thurber, Greg M; Reiner, Thomas; Yang, Katherine S; Kohler, Rainer H; Weissleder, Ralph
2014-04-01
The heterogeneous delivery of drugs in tumors is an established process contributing to variability in treatment outcome. Despite the general acceptance of variable delivery, the study of the underlying causes is challenging, given the complex tumor microenvironment including intra- and intertumor heterogeneity. The difficulty in studying this distribution is even more significant for small-molecule drugs where radiolabeled compounds or mass spectrometry detection lack the spatial and temporal resolution required to quantify the kinetics of drug distribution in vivo. In this work, we take advantage of the synthesis of fluorescent drug conjugates that retain their target binding but are designed with different physiochemical and thus pharmacokinetic properties. Using these probes, we followed the drug distribution in cell culture and tumor xenografts with temporal resolution of seconds and subcellular spatial resolution. These measurements, including in vivo permeability of small-molecule drugs, can be used directly in predictive pharmacokinetic models for the design of therapeutics and companion imaging agents as demonstrated by a finite element model.
Effect of Small Molecule Modification on Single Cell Pharmacokinetics of PARP Inhibitors
Thurber, Greg M.; Reiner, Thomas; Yang, Katherine S; Kohler, Rainer; Weissleder, Ralph
2014-01-01
The heterogeneous delivery of drugs in tumors is an established process contributing to variability in treatment outcome. Despite the general acceptance of variable delivery, the study of the underlying causes is challenging given the complex tumor microenvironment including intra- and inter-tumor heterogeneity. The difficulty in studying this distribution is even more significant for small molecule drugs where radiolabeled compounds or mass spectrometry detection lack the spatial and temporal resolution required to quantify the kinetics of drug distribution in vivo. In this work, we take advantage of the synthesis of fluorescent drug conjugates that retain their target binding but are designed with different physiochemical and thus pharmacokinetic properties. Using these probes, we followed the drug distribution in cell culture and tumor xenografts with temporal resolution of seconds and subcellular spatial resolution. These measurements, including in vivo permeability of small molecule drugs, can be used directly in predictive pharmacokinetic models for the design of therapeutics and companion imaging agents as demonstrated by a finite element model. PMID:24552776
Intact Four-atom Organic Tetracation Stabilized by Charge Localization in the Gas Phase.
Yatsuhashi, Tomoyuki; Toyota, Kazuo; Mitsubayashi, Naoya; Kozaki, Masatoshi; Okada, Keiji; Nakashima, Nobuaki
2016-10-05
Several features distinguish intact multiply charged molecular cations (MMCs) from other species such as monocations and polycations: high potential energy, high electron affinity, a high density of electronic states with various spin multiplicities, and charge-dependent reactions. However, repulsive Coulombic interactions make MMCs quite unstable, and hence small organic MMCs are currently not readily available. Herein, we report that the isolated four-atom molecule diiodoacetylene survives after the removal of four electrons via tunneling. We show that the tetracation remains metastable towards dissociation because of the localization (91-95 %) of the positive charges on the terminal iodine atoms, ensuring minimum Coulomb repulsion between adjacent atoms as well as maximum charge-induced attractive dipole interactions between iodine and carbon. Our approach making use of iodines as the positively charged sites enables small organic MMCs to remain intact. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Can, Mustafa [Izmir Katip Celebi University, Faculty of Engineering, Department of Engineering Sciences, Çiğli, Izmir (Turkey); Havare, Ali Kemal [Toros University, Faculty of Engineering, Electric and Electronic Department, Mersin (Turkey); Aydın, Hasan; Yagmurcukardes, Nesli [Izmir Institute of Technology, Material Science and Engineering, Izmir (Turkey); Demic, Serafettin [Izmir Katip Celebi University, Faculty of Engineering, Department of Material Science and Engineering, Çiğli, Izmir (Turkey); Icli, Sıddık [Ege University, Solar Energy Institute, Izmir (Turkey); Okur, Salih, E-mail: salih.okur@ikc.edu.tr [Izmir Katip Celebi University, Faculty of Engineering, Department of Material Science and Engineering, Çiğli, Izmir (Turkey)
2014-09-30
Graphical abstract: - Highlights: • We report that the performance of OLED consist of aromatic small molecules with double bond carboxylic acid groups on ITO surface. • The OLED devices were tested in terms of electrical and optical characteristics. • The I–V results show that OLEDs with SAM-modified ITO surface have lower turn on voltages than OLED configurations without SAMs. - Abstract: 5-[(3-Methylphenyl)(phenyl)amino]isophthalic acid (5-MePIFA) and 5-(diphenyl)amino]isophthalic acid (5-DPIFA) organic molecules were synthesized to form self-assembled monolayer on indium tin oxide (ITO) anode to enhance hole transport from ITO to organic hole transport layers such as TPD. The modified surface was characterized by scanning tunneling microscopy (STM). The change in the surface potential was measured by Kelvin probe force microscopy (KPFM). Our Kelvin probe force microscopy (KPFM) measurements showed that the surface potentials increased more than 100 mV with reference to bare indium tin-oxide. The results show that the threshold voltage on OLEDs with modified ITO is lowered significantly compared to OLEDs with unmodified ITO. The hole mobility of TPD has been estimated using space–charge-limited current measurements (SCLC)
International Nuclear Information System (INIS)
Can, Mustafa; Havare, Ali Kemal; Aydın, Hasan; Yagmurcukardes, Nesli; Demic, Serafettin; Icli, Sıddık; Okur, Salih
2014-01-01
Graphical abstract: - Highlights: • We report that the performance of OLED consist of aromatic small molecules with double bond carboxylic acid groups on ITO surface. • The OLED devices were tested in terms of electrical and optical characteristics. • The I–V results show that OLEDs with SAM-modified ITO surface have lower turn on voltages than OLED configurations without SAMs. - Abstract: 5-[(3-Methylphenyl)(phenyl)amino]isophthalic acid (5-MePIFA) and 5-(diphenyl)amino]isophthalic acid (5-DPIFA) organic molecules were synthesized to form self-assembled monolayer on indium tin oxide (ITO) anode to enhance hole transport from ITO to organic hole transport layers such as TPD. The modified surface was characterized by scanning tunneling microscopy (STM). The change in the surface potential was measured by Kelvin probe force microscopy (KPFM). Our Kelvin probe force microscopy (KPFM) measurements showed that the surface potentials increased more than 100 mV with reference to bare indium tin-oxide. The results show that the threshold voltage on OLEDs with modified ITO is lowered significantly compared to OLEDs with unmodified ITO. The hole mobility of TPD has been estimated using space–charge-limited current measurements (SCLC)
Wang, Lei; Huang, Wei; Li, Run; Gehrig, Dominik; Blom, Paul W M; Landfester, Katharina; Zhang, Kai A I
2016-08-08
Herein, we report on the structural design principle of small-molecule organic semiconductors as metal-free, pure organic and visible light-active photocatalysts. Two series of electron-donor and acceptor-type organic semiconductor molecules were synthesized to meet crucial requirements, such as 1) absorption range in the visible region, 2) sufficient photoredox potential, and 3) long lifetime of photogenerated excitons. The photocatalytic activity was demonstrated in the intermolecular C-H functionalization of electron-rich heteroaromates with malonate derivatives. A mechanistic study of the light-induced electron transport between the organic photocatalyst, substrate, and the sacrificial agent are described. With their tunable absorption range and defined energy-band structure, the small-molecule organic semiconductors could offer a new class of metal-free and visible light-active photocatalysts for chemical reactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
International Nuclear Information System (INIS)
Jing, Yu; Tang, Qing; He, Peng; Zhou, Zhen; Shen, Panwen
2015-01-01
Systematical computations on the density functional theory were performed to investigate the adsorption of three typical organic molecules, tetracyanoquinodimethane (TCNQ), tetracyanoethylene (TCNE) and tetrathiafulvalene (TTF), on the surface of phosphorene monolayers and thicker layers. There exist considerable charge transfer and strong non-covalent interaction between these molecules and phosphorene. In particular, the band gap of phosphorene decreases dramatically due to the molecular modification and can be further tuned by applying an external electric field. Meanwhile, surface molecular modification has proven to be an effective way to enhance the light harvesting of phosphorene in different directions. Our results predict a flexible method toward modulating the electronic and optical properties of phosphorene and shed light on its experimental applications. (paper)
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules
Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken
Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.
Small-molecule inhibitors of toxT expression in Vibrio cholerae.
Anthouard, Rebecca; DiRita, Victor J
2013-08-06
Vibrio cholerae, a Gram-negative bacterium, infects humans and causes cholera, a severe disease characterized by vomiting and diarrhea. These symptoms are primarily caused by cholera toxin (CT), whose production by V. cholerae is tightly regulated by the virulence cascade. In this study, we designed and carried out a high-throughput chemical genetic screen to identify inhibitors of the virulence cascade. We identified three compounds, which we named toxtazin A and toxtazin B and B', representing two novel classes of toxT transcription inhibitors. All three compounds reduce production of both CT and the toxin-coregulated pilus (TCP), an important colonization factor. We present evidence that toxtazin A works at the level of the toxT promoter and that toxtazins B and B' work at the level of the tcpP promoter. Treatment with toxtazin B results in a 100-fold reduction in colonization in an infant mouse model of infection, though toxtazin A did not reduce colonization at the concentrations tested. These results add to the growing body of literature indicating that small-molecule inhibitors of virulence genes could be developed to treat infections, as alternatives to antibiotics become increasingly needed. V. cholerae caused more than 580,000 infections worldwide in 2011 alone (WHO, Wkly. Epidemiol. Rec. 87:289-304, 2012). Cholera is treated with an oral rehydration therapy consisting of water, glucose, and electrolytes. However, as V. cholerae is transmitted via contaminated water, treatment can be difficult for communities whose water source is contaminated. In this study, we address the need for new therapeutic approaches by targeting the production of the main virulence factor, cholera toxin (CT). The high-throughput screen presented here led to the identification of two novel classes of inhibitors of the virulence cascade in V. cholerae, toxtazin A and toxtazins B and B'. We demonstrate that (i) small-molecule inhibitors of virulence gene production can be
In situ click chemistry: from small molecule discovery to synthetic antibodies
Agnew, Heather D.; Lai, Bert; Lee, Su Seong; Lim, Jaehong; Nag, Arundhati; Pitram, Suresh; Rohde, Rosemary; Heath, James R.
2013-01-01
Advances in the fields of proteomics, molecular imaging, and therapeutics are closely linked to the availability of affinity reagents that selectively recognize their biological targets. Here we present a review of Iterative Peptide In Situ Click Chemistry (IPISC), a novel screening technology for designing peptide multiligands with high affinity and specificity. This technology builds upon in situ click chemistry, a kinetic target-guided synthesis approach where the protein target catalyzes the conjugation of two small molecules, typically through the azide–alkyne Huisgen cycloaddition. Integrating this methodology with solid phase peptide libraries enables the assembly of linear and branched peptide multiligands we refer to as Protein Catalyzed Capture Agents (PCC Agents). The resulting structures can be thought of as analogous to the antigen recognition site of antibodies and serve as antibody replacements in biochemical and cell-based applications. In this review, we discuss the recent progress in ligand design through IPISC and related approaches, focusing on the improvements in affinity and specificity as multiligands are assembled by target-catalyzed peptide conjugation. We compare the IPISC process to small molecule in situ click chemistry with particular emphasis on the advantages and technical challenges of constructing antibody-like PCC Agents. PMID:22836343
Thyroid Hormone Receptor Antagonists: From Environmental Pollution to Novel Small Molecules.
Mackenzie, Louise S
2018-01-01
Thyroid hormone receptors (TRs) are nuclear receptors which control transcription, and thereby have effects in all cells within the body. TRs are an important regulator in many basic physiological processes including development, growth, metabolism, and cardiac function. The hyperthyroid condition results from an over production of thyroid hormones resulting in a continual stimulation of thyroid receptors which is detrimental for the patient. Therapies for hyperthyroidism are available, but there is a need for new small molecules that act as TR antagonists to treat hyperthyroidism. Many compounds exhibit TR antagonism and are considered detrimental to health. Some drugs in the clinic (most importantly, amiodarone) and environmental pollution exhibit TR antagonist properties and thus have the potential to induce hypothyroidism in some people. This chapter provides an overview of novel small molecules that have been specifically designed or screened for their TR antagonist activity as novel treatments for hyperthyroidism. While novel compounds have been identified, to date none have been developed sufficiently to enter clinical trials. Furthermore, a discussion on other sources of TR antagonists is discussed in terms of side effects of current drugs in the clinic as well as environmental pollution. © 2018 Elsevier Inc. All rights reserved.
Evans, M. L.; Hangarter, R. P.
1993-01-01
Positively charged nylon blotting membranes were used as an anion binding medium to trap [14C]indoleactic acid (IAA) as it exited cells at the basal ends of Coleus blumei L. stem and Zea mays L. coleoptile segments. Autoradiography was used to visualize where the [14C] that moved out of the cut ends was localized on the nylon membrane. Diffusion of [14C]IAA from the initial point of contact with the nylon membrane was minimal. Comparison of the autoradiograms with anatomical tissue prints of the cut ends of the segments was used to determine what tissues participate in IAA movement. The results of these initial studies were consistent with other reports suggesting that [14C]IAA movement was primarily associated with vascular tissues in both C. blumei stems and corn coleoptiles, but the resolution was not sufficient to identify which vascular tissues were involved in IAA transport. With further refinements, this technique could also be used for studying the movement of other small charged molecules through plant tissues.
Sherman, Sean P; Pyle, April D
2013-01-01
Differentiated cells from human embryonic stem cells (hESCs) provide an unlimited source of cells for use in regenerative medicine. The recent derivation of human induced pluripotent cells (hiPSCs) provides a potential supply of pluripotent cells that avoid immune rejection and could provide patient-tailored therapy. In addition, the use of pluripotent cells for drug screening could enable routine toxicity testing and evaluation of underlying disease mechanisms. However, prior to establishment of patient specific cells for cell therapy it is important to understand the basic regulation of cell fate decisions in hESCs. One critical issue that hinders the use of these cells is the fact that hESCs survive poorly upon dissociation, which limits genetic manipulation because of poor cloning efficiency of individual hESCs, and hampers production of large-scale culture of hESCs. To address the problems associated with poor growth in culture and our lack of understanding of what regulates hESC signaling, we successfully developed a screening platform that allows for large scale screening for small molecules that regulate survival. In this work we developed the first large scale platform for hESC screening using laser scanning cytometry and were able to validate this platform by identifying the pro-survival molecule HA-1077. These small molecules provide targets for both improving our basic understanding of hESC survival as well as a tool to improve our ability to expand and genetically manipulate hESCs for use in regenerative applications.
Wang, Lan; Guan, Xin; Wang, Huihui; Shen, Bin; Zhang, Yu; Ren, Zhihua; Ma, Yupo; Ding, Xinxin; Jiang, Yongping
2017-07-18
Accumulated evidence supports the potent stimulating effects of multiple small molecules on the expansion of hematopoietic stem cells (HSCs) which are important for the therapy of various hematological disorders. Here, we report a novel, optimized formula, named the SC cocktail, which contains a combination of three such small molecules and four cytokines. Small-molecule candidates were individually screened and then combined at their optimal concentration with the presence of cytokines to achieve maximum capacity for stimulating the human CD34 + cell expansion ex vivo. The extent of cell expansion and the immunophenotype of expanded cells were assessed through flow cytometry. The functional preservation of HSC stemness was confirmed by additional cell and molecular assays in vitro. Subsequently, the expanded cells were transplanted into sublethally irradiated NOD/SCID mice for the assessment of human cell viability and engraftment potential in vivo. Furthermore, the expression of several genes in the cell proliferation and differentiation pathways was analyzed through quantitative polymerase chain reaction (qPCR) during the process of CD34 + cell expansion. The SC cocktail supported the retention of the immunophenotype of hematopoietic stem/progenitor cells remarkably well, by yielding purities of 86.6 ± 11.2% for CD34 + cells and 76.2 ± 10.5% for CD34 + CD38 - cells, respectively, for a 7-day culture. On day 7, the enhancement of expansion of CD34 + cells and CD34 + CD38 - cells reached a maxima of 28.0 ± 5.5-fold and 27.9 ± 4.3-fold, respectively. The SC cocktail-expanded CD34 + cells preserved the characteristics of HSCs by effectively inhibiting their differentiation in vitro and retained the multilineage differentiation potential in primary and secondary in vivo murine xenotransplantation trials. Further gene expression analysis suggested that the small-molecule combination strengthened the ability of the cytokines to enhance the Notch
Inhibition of DNA glycosylases via small molecule purine analogs.
Directory of Open Access Journals (Sweden)
Aaron C Jacobs
Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.
A small molecule fusion inhibitor of dengue virus.
Poh, Mee Kian; Yip, Andy; Zhang, Summer; Priestle, John P; Ma, Ngai Ling; Smit, Jolanda M; Wilschut, Jan; Shi, Pei-Yong; Wenk, Markus R; Schul, Wouter
2009-12-01
The dengue virus envelope protein plays an essential role in viral entry by mediating fusion between the viral and host membranes. The crystal structure of the envelope protein shows a pocket (located at a "hinge" between Domains I and II) that can be occupied by ligand n-octyl-beta-D-glucoside (betaOG). Compounds blocking the betaOG pocket are thought to interfere with conformational changes in the envelope protein that are essential for fusion. Two fusion assays were developed to examine the anti-fusion activities of compounds. The first assay measures the cellular internalization of propidium iodide upon membrane fusion. The second assay measures the protease activity of trypsin upon fusion between dengue virions and trypsin-containing liposomes. We performed an in silico virtual screening for small molecules that can potentially bind to the betaOG pocket and tested these candidate molecules in the two fusion assays. We identified one compound that inhibits dengue fusion in both assays with an IC(50) of 6.8 microM and reduces viral titers with an EC(50) of 9.8 microM. Time-of-addition experiments showed that the compound was only active when present during viral infection but not when added 1h later, in agreement with a mechanism of action through fusion inhibition.
Small molecule inhibitors of HCV replication from Pomegranate
Reddy, B. Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra
2014-06-01
Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and`no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications.
A geometry-based simulation of the hydration of ions and small molecules
International Nuclear Information System (INIS)
Plumridge, T.H.
2001-01-01
The behaviour of solutes in water is of universal significance, but still not fully understood. This thesis provides details of a new computer simulation technique used to investigate the hydration of ions and small molecules. In contrast to conventional techniques such as molecular dynamics, this is a purely geometric method involving no forcefield or energy terms. Molecules of interest are modelled using crystallographic data to ensure that the structures are accurate. Water molecules are added randomly at any hydrogen bonding site in chains. At each addition the chain is rotated through all available space testing for the possibility of ring formation. The constraints used by the program to decide whether a ring should be conserved, i.e. whether the ring-forming hydrogen bond is viable were derived from a survey of (i) all available ice and clathrate hydrate structures and (ii) the hydrates of small biological molecules from the Cambridge Crystallographic Data Centre. If a ring forms, it is conserved and the process restarted with the addition of another random water. If the chain reaches a certain length and no hydrogen bonding opportunities are detected, the water chain is dissolved, and the process restarted. Using these techniques structure makers such as sulfate will readily allow structured water to form around them leading to large networks, whereas structure breakers such as urea will not allow any water chains to bridge the hydrogen bonding groups. The software has been tested with a set of twenty widely varying solutes and has produced results which generally agree with experimental data for structure makers and breakers, and also agrees well with traditional techniques such as molecular dynamics and Monte Carlo techniques. (author)
Small-molecule quinolinol inhibitor identified provides protection against BoNT/A in mice.
Directory of Open Access Journals (Sweden)
Padma Singh
Full Text Available Botulinum neurotoxins (BoNTs, etiological agents of the life threatening neuroparalytic disease botulism, are the most toxic substances currently known. The potential for the use as bioweapon makes the development of small-molecule inhibitor against these deadly toxins is a top priority. Currently, there are no approved pharmacological treatments for BoNT intoxication. Although an effective vaccine/immunotherapy is available for immuno-prophylaxis but this cannot reverse the effects of toxin inside neurons. A small-molecule pharmacological intervention, especially one that would be effective against the light chain protease, would be highly desirable. Similarity search was carried out from ChemBridge and NSC libraries to the hit (7-(phenyl(8-quinolinylaminomethyl-8-quinolinol; NSC 84096 to mine its analogs. Several hits obtained were screened for in silico inhibition using AutoDock 4.1 and 19 new molecules selected based on binding energy and Ki. Among these, eleven quinolinol derivatives potently inhibited in vitro endopeptidase activity of botulinum neurotoxin type A light chain (rBoNT/A-LC on synaptosomes isolated from rat brain which simulate the in vivo system. Five of these inhibitor molecules exhibited IC(50 values ranging from 3.0 nM to 10.0 µM. NSC 84087 is the most potent inhibitor reported so far, found to be a promising lead for therapeutic development, as it exhibits no toxicity, and is able to protect animals from pre and post challenge of botulinum neurotoxin type A (BoNT/A.
Identifying a Small Molecule Blocking Antigen Presentation in Autoimmune Thyroiditis.
Li, Cheuk Wun; Menconi, Francesca; Osman, Roman; Mezei, Mihaly; Jacobson, Eric M; Concepcion, Erlinda; David, Chella S; Kastrinsky, David B; Ohlmeyer, Michael; Tomer, Yaron
2016-02-19
We previously showed that an HLA-DR variant containing arginine at position 74 of the DRβ1 chain (DRβ1-Arg74) is the specific HLA class II variant conferring risk for autoimmune thyroid diseases (AITD). We also identified 5 thyroglobulin (Tg) peptides that bound to DRβ1-Arg74. We hypothesized that blocking the binding of these peptides to DRβ1-Arg74 could block the continuous T-cell activation in thyroiditis needed to maintain the autoimmune response to the thyroid. The aim of the current study was to identify small molecules that can block T-cell activation by Tg peptides presented within DRβ1-Arg74 pockets. We screened a large and diverse library of compounds and identified one compound, cepharanthine that was able to block peptide binding to DRβ1-Arg74. We then showed that Tg.2098 is the dominant peptide when inducing experimental autoimmune thyroiditis (EAT) in NOD mice expressing human DRβ1-Arg74. Furthermore, cepharanthine blocked T-cell activation by thyroglobulin peptides, in particular Tg.2098 in mice that were induced with EAT. For the first time we identified a small molecule that can block Tg peptide binding and presentation to T-cells in autoimmune thyroiditis. If confirmed cepharanthine could potentially have a role in treating human AITD. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Kuen, I.; Howorka, F.
1983-01-01
Absolute cross sections for the excitation of optically emitting states in collisions of He + , Ne + , Ar + , Kr + , B + , He ++ , Ne ++ and Ar ++ with oxygen molecules are measured, the energy range of the ion being1 - 1800 eV Lab for the singly charged and 1 - 3600 eV for the doubly charged ions. Seven important processes can be distinguished: charge exchange excitation of O 2 + band, O I, O II, X I and X II lines (X + , X ++ being the primary ion), direct excitation of X II and double charge exchange excitations. The energy dependences of the excitation cross sections are remarkably different for different processes but similar for one process with different ions. The sum total of all cross sections together for excitations which lead to light emission is on the order of a few square angstroms at 1000 eV c.m. energy. The results are of interest for surface investigations, plasma diagnostics and laser work. (Author)
International Nuclear Information System (INIS)
Chang, Yung-Ting; Liu, Shun-Wei; Yuan, Chih-Hsien; Lee, Chih-Chien; Ho, Yu-Hsuan; Wei, Pei-Kuen; Chen, Kuan-Yu; Lee, Yi-Ting; Wu, Min-Fei; Chen, Chin-Ti; Wu, Chih-I
2013-01-01
Single-layer blue phosphorescence organic light emitting diodes (OLEDs) with either small-molecule or polymer hosts are fabricated using solution process and the performances of devices with different hosts are investigated. The small-molecule device exhibits luminous efficiency of 14.7 cd/A and maximum power efficiency of 8.39 lm/W, which is the highest among blue phosphorescence OLEDs with single-layer solution process and small molecular hosts. Using the same solution process for all devices, comparison of light out-coupling enhancement, with brightness enhancement film (BEF), between small-molecule and polymer based OLEDs is realized. Due to different dipole orientation and anisotropic refractive index, polymer-based OLEDs would trap less light than small molecule-based OLEDs internally, about 37% better based simulation results. In spite of better electrical and spectroscopic characteristics, including ambipolar characteristics, higher carrier mobility, higher photoluminescence quantum yield, and larger triplet state energy, the overall light out-coupling efficiency of small molecule-based devices is worse than that of polymer-based devices without BEF. However, with BEF for light out-coupling enhancement, the improved ratio in luminous flux and luminous efficiency for small molecule based device is 1.64 and 1.57, respectively, which are significantly better than those of PVK (poly-9-vinylcarbazole) devices. In addition to the theoretical optical simulation, the experimental data also confirm the origins of differential light-outcoupling enhancement. The maximum luminous efficiency and power efficiency are enhanced from 14.7 cd/A and 8.39 lm/W to 23 cd/A and 13.2 lm/W, respectively, with laminated BEF, which are both the highest so far for single-layer solution-process blue phosphorescence OLEDs with small molecule hosts
Energy Technology Data Exchange (ETDEWEB)
Chang, Yung-Ting [Institute of Chemistry, Academia Sinica, Taipei, Taiwan 11529, Taiwan (China); Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei, Taiwan 10617, Taiwan (China); Liu, Shun-Wei [Department of Electronic Engineering, Mingchi University of Technology, New Taipei, Taiwan 24301, Taiwan (China); Yuan, Chih-Hsien; Lee, Chih-Chien [Department of Electronic Engineering, National Taiwan University of Science and Technology, Taipei, Taiwan 10607, Taiwan (China); Ho, Yu-Hsuan; Wei, Pei-Kuen [Research Center for Applied Science Academia Sinica, Taipei, Taiwan 11527, Taiwan (China); Chen, Kuan-Yu [Chilin Technology Co., LTD, Tainan City, Taiwan 71758, Taiwan (China); Lee, Yi-Ting; Wu, Min-Fei; Chen, Chin-Ti, E-mail: cchen@chem.sinica.edu.tw, E-mail: chihiwu@cc.ee.ntu.edu.tw [Institute of Chemistry, Academia Sinica, Taipei, Taiwan 11529, Taiwan (China); Wu, Chih-I, E-mail: cchen@chem.sinica.edu.tw, E-mail: chihiwu@cc.ee.ntu.edu.tw [Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei, Taiwan 10617, Taiwan (China)
2013-11-07
Single-layer blue phosphorescence organic light emitting diodes (OLEDs) with either small-molecule or polymer hosts are fabricated using solution process and the performances of devices with different hosts are investigated. The small-molecule device exhibits luminous efficiency of 14.7 cd/A and maximum power efficiency of 8.39 lm/W, which is the highest among blue phosphorescence OLEDs with single-layer solution process and small molecular hosts. Using the same solution process for all devices, comparison of light out-coupling enhancement, with brightness enhancement film (BEF), between small-molecule and polymer based OLEDs is realized. Due to different dipole orientation and anisotropic refractive index, polymer-based OLEDs would trap less light than small molecule-based OLEDs internally, about 37% better based simulation results. In spite of better electrical and spectroscopic characteristics, including ambipolar characteristics, higher carrier mobility, higher photoluminescence quantum yield, and larger triplet state energy, the overall light out-coupling efficiency of small molecule-based devices is worse than that of polymer-based devices without BEF. However, with BEF for light out-coupling enhancement, the improved ratio in luminous flux and luminous efficiency for small molecule based device is 1.64 and 1.57, respectively, which are significantly better than those of PVK (poly-9-vinylcarbazole) devices. In addition to the theoretical optical simulation, the experimental data also confirm the origins of differential light-outcoupling enhancement. The maximum luminous efficiency and power efficiency are enhanced from 14.7 cd/A and 8.39 lm/W to 23 cd/A and 13.2 lm/W, respectively, with laminated BEF, which are both the highest so far for single-layer solution-process blue phosphorescence OLEDs with small molecule hosts.
DEFF Research Database (Denmark)
Liu, Wenqing; Liu, Shiyong; Zawacka, Natalia Klaudia
2014-01-01
All solution-processed flexible large area small molecule bulk heterojunction solar cells were fabricated via roll-coating technology. Our devices were produced from slot-die coating on a lab-scale mini roll-coater under ambient conditions without the use of spin-coating or vacuum evaporation.......01%, combined with an open circuit voltage of 0.73 V, a short-circuit current density of 3.13 mA cm (2) and a fill factor of 44% were obtained for the device with SM1, which was the first example reported for efficient roll-coating fabrication of flexible large area small molecule solar cells with PCE exceeding...... methods. Four diketopyrrolopyrrole based small molecules (SMs 1-4) were utilized as electron donors with (6,6)phenyl- C61-butyric acid methyl ester as an acceptor and their photovoltaic performances based on roll-coated devices were investigated. The best power conversion efficiency (PCE) of 1...
Small molecule pinocytosis and clathrin-dependent endocytosis at the intestinal brush border
DEFF Research Database (Denmark)
Danielsen, Erik Michael; Hansen, Gert H
2016-01-01
Pinocytosis at the small intestinal brush border was studied in postweaned porcine cultured mucosal explants, using the fluorescent polar probes Alexa hydrazide (AH, MW 570), Texas red dextran (TRD, MW ~ 3000), and Cascade blue dextran (CBD, MW ~ 10,000). Within 1 h, AH appeared in a string...... of subapical punctae in enterocytes, indicative of an ongoing constitutive pinocytosis. By comparison, TRD was taken up less efficiently into the same compartment, and no intracellular labeling of CBD was detectable, indicating that only small molecules are pinocytosed from the postweaned gut lumen. AH...
Rwigema, Jean-Claude M.; Beck, Barbara; Wang, Wei; Doemling, Alexander; Epperly, Michael W.; Shields, Donna; Goff, Julie P.; Franicola, Darcy; Dixon, Tracy; Frantz, Marie-Céline; Wipf, Peter; Tyurina, Yulia; Kagan, Valerian E.; Wang, Hong; Greenberger, Joel S.
2011-01-01
Purpose: To evaluate the effectiveness of mitigation of acute ionizing radiation damage by mitochondrion-targeted small molecules. Methods and Materials: We evaluated the ability of nitroxide-linked alkene peptide isostere JP4-039, the nitric oxide synthase inhibitor-linked alkene peptide esostere
Remote control of therapeutic T cells through a small molecule-gated chimeric receptor
Wu, Chia-Yung; Roybal, Kole T.; Puchner, Elias M.; Onuffer, James; Lim, Wendell A.
2016-01-01
There is growing promise in using engineered cells as therapeutic agents. For example, synthetic Chimeric Antigen Receptors (CARs) can redirect T cells to recognize and eliminate tumor cells expressing specific antigens. Despite promising clinical results, excessive activity and poor control over such engineered T cells can cause severe toxicities. We present the design of “ON-switch” CARs that enable small molecule-control over T cell therapeutic functions, while still retaining antigen specificity. In these split receptors, antigen binding and intracellular signaling components only assemble in the presence of a heterodimerizing small molecule. This titratable pharmacologic regulation could allow physicians to precisely control the timing, location, and dosage of T cell activity, thereby mitigating toxicity. This work illustrates the potential of combining cellular engineering with orthogonal chemical tools to yield safer therapeutic cells that tightly integrate both cell autonomous recognition and user control. PMID:26405231
Energy Technology Data Exchange (ETDEWEB)
Kera, Satoshi, E-mail: kera@ims.ac.jp [Institute for Molecular Science, Myodaiji, Okazaki 444-8585 (Japan); Department of Nanomaterial Science, Graduate School of Advanced Integration Science, Chiba University, Inage-ku, Chiba 263-8522 (Japan); Ueno, Nobuo [Department of Nanomaterial Science, Graduate School of Advanced Integration Science, Chiba University, Inage-ku, Chiba 263-8522 (Japan)
2015-10-01
Understanding of electron-phonon coupling as well as intermolecular interaction is required to discuss the mobility of charge carrier in functional molecular solids. This article summarizes recent progress in direct measurements of valence hole-vibration coupling in ultrathin films of organic semiconductors by using ultraviolet photoelectron spectroscopy (UPS). The experimental study of hole-vibration coupling of the highest occupied molecular orbital (HOMO) state in ordered monolayer film by UPS is essential to comprehend hole-hopping transport and small-polaron related transport in organic semiconductors. Only careful measurements can attain the high-resolution spectra and provide key parameters in hole-transport dynamics, namely the charge reorganization energy and small polaron binding energy. Analyses methods of the UPS HOMO fine feature and resulting charge reorganization energy and small polaron binding energy are described for pentacene and perfluoropentacene films. Difference between thin-film and gas-phase results is discussed by using newly measured high-quality gas-phase spectra of pentacene. Methodology for achieving high-resolution UPS measurements for molecular films is also described.
Point charges optimally placed to represent the multipole expansion of charge distributions.
Directory of Open Access Journals (Sweden)
Ramu Anandakrishnan
Full Text Available We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance 2x the extent of the charge distribution--the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom, is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å is half that of the point multipole expansion up to the octupole
Energy Technology Data Exchange (ETDEWEB)
Cha, Sangwon [Iowa State Univ., Ames, IA (United States)
2008-01-01
Matrix-assisted laser desorption/ionization(MALDI) mass spectrometry(MS) has been widely used for analysis of biological molecules, especially macromolecules such as proteins. However, MALDI MS has a problem in small molecule (less than 1 kDa) analysis because of the signal saturation by organic matrixes in the low mass region. In imaging MS (IMS), inhomogeneous surface formation due to the co-crystallization process by organic MALDI matrixes limits the spatial resolution of the mass spectral image. Therefore, to make laser desorption/ionization (LDI) MS more suitable for mass spectral profiling and imaging of small molecules directly from raw biological tissues, LDI MS protocols with various alternative assisting materials were developed and applied to many biological systems of interest. Colloidal graphite was used as a matrix for IMS of small molecules for the first time and methodologies for analyses of small metabolites in rat brain tissues, fruits, and plant tissues were developed. With rat brain tissues, the signal enhancement for cerebroside species by colloidal graphite was observed and images of cerebrosides were successfully generated by IMS. In addition, separation of isobaric lipid ions was performed by imaging tandem MS. Directly from Arabidopsis flowers, flavonoids were successfully profiled and heterogeneous distribution of flavonoids in petals was observed for the first time by graphite-assisted LDI(GALDI) IMS.
Infrared intensities and charge mobility in hydrogen bonded complexes
Energy Technology Data Exchange (ETDEWEB)
Galimberti, Daria; Milani, Alberto; Castiglioni, Chiara [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta,” Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)
2013-08-21
The analytical model for the study of charge mobility in the molecules presented by Galimberti et al.[J. Chem. Phys. 138, 164115 (2013)] is applied to hydrogen bonded planar dimers. Atomic charges and charge fluxes are obtained from density functional theory computed atomic polar tensors and related first derivatives, thus providing an interpretation of the IR intensity enhancement of the X–H stretching band observed upon aggregation. Our results show that both principal and non-principal charge fluxes have an important role for the rationalization of the spectral behavior; moreover, they demonstrate that the modulation of the charge distribution during vibrational motions of the –XH⋯Y– fragment is not localized exclusively on the atoms directly involved in hydrogen bonding. With these premises we made some correlations between IR intensities, interaction energies, and charge fluxes. The model was tested on small dimers and subsequently to the bigger one cytosine-guanine. Thus, the model can be applied to complex systems.
Patel, Mahesh J; Batch, Bryan C; Svetkey, Laura P; Bain, James R; Turer, Christy Boling; Haynes, Carol; Muehlbauer, Michael J; Stevens, Robert D; Newgard, Christopher B; Shah, Svati H
2013-12-01
In overweight/obese individuals, cardiometabolic risk factors differ by race and sex categories. Small-molecule metabolites and metabolic hormone levels might also differ across these categories and contribute to risk factor heterogeneity. To explore this possibility, we performed a cross-sectional analysis of fasting plasma levels of 69 small-molecule metabolites and 13 metabolic hormones in 500 overweight/obese adults who participated in the Weight Loss Maintenance trial. Principal-components analysis (PCA) was used for reduction of metabolite data. Race and sex-stratified comparisons of metabolite factors and metabolic hormones were performed. African Americans represented 37.4% of the study participants, and females 63.0%. Of thirteen metabolite factors identified, three differed by race and sex: levels of factor 3 (branched-chain amino acids and related metabolites, phormones regulating body weight homeostasis. Among overweight/obese adults, there are significant race and sex differences in small-molecule metabolites and metabolic hormones; these differences may contribute to risk factor heterogeneity across race and sex subgroups and should be considered in future investigations with circulating metabolites and metabolic hormones.
DEFF Research Database (Denmark)
Biskup, Edyta; Naym, David Gram; Gniadecki, Robert
2016-01-01
inhibited by small molecule antagonists VE-821, VE-822 or Chir-124, or by small interfering RNAs (siRNAs). Cell cycle and viability were assessed by flow cytometry. RESULTS: Small molecule inhibitors of ATR and Chk1 potently sensitized all cell lines to PUVA and, importantly, also to UVA, which by itself...... did not cause apoptotic response. VE-821/2 blocked ATR pathway activation and released the cells from the G2/M block caused by UVA and PUVA, but did not affect apoptosis caused by other chemotherapeutics (etoposide, gemcitabine, doxorubicine) or by hydrogen peroxide. Knockdown of ATR and Chk1 with si......RNA also blocked the ATR pathway and released the cells from G2/M block but did not sensitize the cells to UVA as observed with the small molecule inhibitors. The latter suggested that the synergism between VE-821/2 or Chir-124 and UVA was not solely caused by specific blocking of ATR kinase but also ATR...
Label-free electrochemical biosensing of small-molecule inhibition on O-GlcNAc glycosylation.
Yang, Yu; Gu, Yuxin; Wan, Bin; Ren, Xiaomin; Guo, Liang-Hong
2017-09-15
O-linked N-acetylglucosamine (O-GlcNAc) transferase (OGT) plays a critical role in modulating protein function in many cellular processes and human diseases such as Alzheimer's disease and type II diabetes, and has emerged as a promising new target. Specific inhibitors of OGT could be valuable tools to probe the biological functions of O-GlcNAcylation, but a lack of robust nonradiometric assay strategies to detect glycosylation, has impeded efforts to identify such compounds. Here we have developed a novel label-free electrochemical biosensor for the detection of peptide O-GlcNAcylation using protease-protection strategy and electrocatalytic oxidation of tyrosine mediated by osmium bipyridine as a signal reporter. There is a large difference in the abilities of proteolysis of the glycosylated and the unglycosylated peptides by protease, thus providing a sensing mechanism for OGT activity. When the O-GlcNAcylation is achieved, the glycosylated peptides cannot be cleaved by proteinase K and result in a high current response on indium tin oxide (ITO) electrode. However, when the O-GlcNAcylation is successfully inhibited using a small molecule, the unglycosylated peptides can be cleaved easily and lead to low current signal. Peptide O-GlcNAcylation reaction was performed in the presence of a well-defined small-molecule OGT inhibitor. The results indicated that the biosensor could be used to screen the OGT inhibitors effectively. Our label-free electrochemical method is a promising candidate for protein glycosylation pathway research in screening small-molecule inhibitors of OGT. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Uchikata, Nami; Yoshida, Shijun
2011-01-01
We investigate quasinormal modes of a massless charged scalar field on a small Reissner-Nordstroem-anti-de Sitter (RN-AdS) black hole both with analytical and numerical approaches. In the analytical approach, by using the small black hole approximation (r + + /L→0, where r + and L stand for the black hole event horizon radius and the AdS scale, respectively. We then show that the small RN-AdS black hole is unstable if its quasinormal modes satisfy the superradiance condition and that the instability condition of the RN-AdS black hole in the limit of r + /L→0 is given by Q>(3/eL)Q c , where Q, Q c , and e are the charge of the black hole, the critical (maximum) charge of the black hole, and the charge of the scalar field, respectively. In the numerical approach, we calculate the quasinormal modes for the small RN-AdS black holes with r + + =0.2L, 0.1L, and 0.01L become unstable against scalar perturbations with eL=4 when the charge of the black hole satisfies Q > or approx. 0.8Q c , 0.78Q c , and 0.76Q c , respectively.
Fei, Yiyan; Landry, James P.; Sun, Yungshin; Zhu, Xiangdong; Wang, Xiaobing; Luo, Juntao; Wu, Chun-Yi; Lam, Kit S.
2010-01-01
We describe a high-throughput scanning optical microscope for detecting small-molecule compound microarrays on functionalized glass slides. It is based on measurements of oblique-incidence reflectivity difference and employs a combination of a y-scan galvometer mirror and an x-scan translation stage with an effective field of view of 2 cm×4 cm. Such a field of view can accommodate a printed small-molecule compound microarray with as many as 10,000 to 20,000 targets. The scanning microscope is...
Small-Molecule Sigma1 Modulator Induces Autophagic Degradation of PD-L1.
Maher, Christina M; Thomas, Jeffrey D; Haas, Derick A; Longen, Charles G; Oyer, Halley M; Tong, Jane Y; Kim, Felix J
2018-02-01
Emerging evidence suggests that Sigma1 ( SIGMAR1 , also known as sigma-1 receptor) is a unique ligand-regulated integral membrane scaffolding protein that contributes to cellular protein and lipid homeostasis. Previously, we demonstrated that some small-molecule modulators of Sigma1 alter endoplasmic reticulum (ER)-associated protein homeostasis pathways in cancer cells, including the unfolded protein response and autophagy. Programmed death-ligand 1 (PD-L1) is a type I integral membrane glycoprotein that is cotranslationally inserted into the ER and is processed and transported through the secretory pathway. Once at the surface of cancer cells, PD-L1 acts as a T-cell inhibitory checkpoint molecule and suppresses antitumor immunity. Here, we demonstrate that in Sigma1-expressing triple-negative breast and androgen-independent prostate cancer cells, PD-L1 protein levels were suppressed by RNAi knockdown of Sigma1 and by small-molecule inhibition of Sigma1. Sigma1-mediated action was confirmed by pharmacologic competition between Sigma1-selective inhibitor and activator ligands. When administered alone, the Sigma1 inhibitor decreased cell surface PD-L1 expression and suppressed functional interaction of PD-1 and PD-L1 in a coculture of T cells and cancer cells. Conversely, the Sigma1 activator increased PD-L1 cell surface expression, demonstrating the ability to positively and negatively modulate Sigma1 associated PD-L1 processing. We discovered that the Sigma1 inhibitor induced degradation of PD-L1 via autophagy, by a mechanism distinct from bulk macroautophagy or general ER stress-associated autophagy. Finally, the Sigma1 inhibitor suppressed IFNγ-induced PD-L1. Our data demonstrate that small-molecule Sigma1 modulators can be used to regulate PD-L1 in cancer cells and trigger its degradation by selective autophagy. Implications: Sigma1 modulators sequester and eliminate PD-L1 by autophagy, thus preventing functional PD-L1 expression at the cell surface. This
CRISPR Approaches to Small Molecule Target Identification. | Office of Cancer Genomics
A long-standing challenge in drug development is the identification of the mechanisms of action of small molecules with therapeutic potential. A number of methods have been developed to address this challenge, each with inherent strengths and limitations. We here provide a brief review of these methods with a focus on chemical-genetic methods that are based on systematically profiling the effects of genetic perturbations on drug sensitivity.
Spectroscopic and dynamical studies of highly energized small polyatomic molecules
Energy Technology Data Exchange (ETDEWEB)
Field, R.W.; Silbey, R.J. [Massachusetts Institute of Technology, Cambridge (United States)
1993-12-01
The authors have initiated a program to perform spectroscopic and dynamic studies of small molecules. Large amplitude motions in excited acetylene were discussed along with plans to record the dispersed fluorescence (DF) and the stimulated emission pumping (SEP) spectra. SEP spectra were reported for the formyl radical. A Fourier transform spectrometer was discussed with respect to its ability to probe the structure of radicals. This instrument is capable of performing studies using various techniques such as magnetic rotation spectroscopy and sub-Doppler sideband-OODR Zeman (SOODRZ) spectroscopy.
Electrochemically-gated single-molecule electrical devices
International Nuclear Information System (INIS)
Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael
2013-01-01
In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour
Passing Current through Touching Molecules
DEFF Research Database (Denmark)
Schull, G.; Frederiksen, Thomas; Brandbyge, Mads
2009-01-01
The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...
Directory of Open Access Journals (Sweden)
Sean P Sherman
Full Text Available Differentiated cells from human embryonic stem cells (hESCs provide an unlimited source of cells for use in regenerative medicine. The recent derivation of human induced pluripotent cells (hiPSCs provides a potential supply of pluripotent cells that avoid immune rejection and could provide patient-tailored therapy. In addition, the use of pluripotent cells for drug screening could enable routine toxicity testing and evaluation of underlying disease mechanisms. However, prior to establishment of patient specific cells for cell therapy it is important to understand the basic regulation of cell fate decisions in hESCs. One critical issue that hinders the use of these cells is the fact that hESCs survive poorly upon dissociation, which limits genetic manipulation because of poor cloning efficiency of individual hESCs, and hampers production of large-scale culture of hESCs. To address the problems associated with poor growth in culture and our lack of understanding of what regulates hESC signaling, we successfully developed a screening platform that allows for large scale screening for small molecules that regulate survival. In this work we developed the first large scale platform for hESC screening using laser scanning cytometry and were able to validate this platform by identifying the pro-survival molecule HA-1077. These small molecules provide targets for both improving our basic understanding of hESC survival as well as a tool to improve our ability to expand and genetically manipulate hESCs for use in regenerative applications.
A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules
DEFF Research Database (Denmark)
Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.
2018-01-01
-SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...
Regulation of metabolic networks by small molecule metabolites
Directory of Open Access Journals (Sweden)
Kanehisa Minoru
2007-03-01
Full Text Available Abstract Background The ability to regulate metabolism is a fundamental process in living systems. We present an analysis of one of the mechanisms by which metabolic regulation occurs: enzyme inhibition and activation by small molecules. We look at the network properties of this regulatory system and the relationship between the chemical properties of regulatory molecules. Results We find that many features of the regulatory network, such as the degree and clustering coefficient, closely match those of the underlying metabolic network. While these global features are conserved across several organisms, we do find local differences between regulation in E. coli and H. sapiens which reflect their different lifestyles. Chemical structure appears to play an important role in determining a compounds suitability for use in regulation. Chemical structure also often determines how groups of similar compounds can regulate sets of enzymes. These groups of compounds and the enzymes they regulate form modules that mirror the modules and pathways of the underlying metabolic network. We also show how knowledge of chemical structure and regulation could be used to predict regulatory interactions for drugs. Conclusion The metabolic regulatory network shares many of the global properties of the metabolic network, but often varies at the level of individual compounds. Chemical structure is a key determinant in deciding how a compound is used in regulation and for defining modules within the regulatory system.
Remote control of therapeutic T cells through a small molecule-gated chimeric receptor.
Wu, Chia-Yung; Roybal, Kole T; Puchner, Elias M; Onuffer, James; Lim, Wendell A
2015-10-16
There is growing interest in using engineered cells as therapeutic agents. For example, synthetic chimeric antigen receptors (CARs) can redirect T cells to recognize and eliminate tumor cells expressing specific antigens. Despite promising clinical results, these engineered T cells can exhibit excessive activity that is difficult to control and can cause severe toxicity. We designed "ON-switch" CARs that enable small-molecule control over T cell therapeutic functions while still retaining antigen specificity. In these split receptors, antigen-binding and intracellular signaling components assemble only in the presence of a heterodimerizing small molecule. This titratable pharmacologic regulation could allow physicians to precisely control the timing, location, and dosage of T cell activity, thereby mitigating toxicity. This work illustrates the potential of combining cellular engineering with orthogonal chemical tools to yield safer therapeutic cells that tightly integrate cell-autonomous recognition and user control. Copyright © 2015, American Association for the Advancement of Science.
Database of Small Molecule Thermochemistry for Combustion
Goldsmith, C. Franklin; Magoon, Gregory R.; Green, William H.
2012-01-01
High-accuracy ab initio thermochemistry is presented for 219 small molecules relevant in combustion chemistry, including many radical, biradical, and triplet species. These values are critical for accurate kinetic modeling. The RQCISD(T)/cc-PV∞QZ//B3LYP/6-311++G(d,p) method was used to compute the electronic energies. A bond additivity correction for this method has been developed to remove systematic errors in the enthalpy calculations, using the Active Thermochemical Tables as reference values. On the basis of comparison with the benchmark data, the 3σ uncertainty in the standard-state heat of formation is 0.9 kcal/mol, or within chemical accuracy. An uncertainty analysis is presented for the entropy and heat capacity. In many cases, the present values are the most accurate and comprehensive numbers available. The present work is compared to several published databases. In some cases, there are large discrepancies and errors in published databases; the present work helps to resolve these problems. © 2012 American Chemical Society.
Database of Small Molecule Thermochemistry for Combustion
Goldsmith, C. Franklin
2012-09-13
High-accuracy ab initio thermochemistry is presented for 219 small molecules relevant in combustion chemistry, including many radical, biradical, and triplet species. These values are critical for accurate kinetic modeling. The RQCISD(T)/cc-PV∞QZ//B3LYP/6-311++G(d,p) method was used to compute the electronic energies. A bond additivity correction for this method has been developed to remove systematic errors in the enthalpy calculations, using the Active Thermochemical Tables as reference values. On the basis of comparison with the benchmark data, the 3σ uncertainty in the standard-state heat of formation is 0.9 kcal/mol, or within chemical accuracy. An uncertainty analysis is presented for the entropy and heat capacity. In many cases, the present values are the most accurate and comprehensive numbers available. The present work is compared to several published databases. In some cases, there are large discrepancies and errors in published databases; the present work helps to resolve these problems. © 2012 American Chemical Society.
Lattice diffusion of a single molecule in solution
Ruggeri, Francesca; Krishnan, Madhavi
2017-12-01
The ability to trap a single molecule in an electrostatic potential well in solution has opened up new possibilities for the use of molecular electrical charge to study macromolecular conformation and dynamics at the level of the single entity. Here we study the diffusion of a single macromolecule in a two-dimensional lattice of electrostatic traps in solution. We report the ability to measure both the size and effective electrical charge of a macromolecule by observing single-molecule transport trajectories, typically a few seconds in length, using fluorescence microscopy. While, as shown previously, the time spent by the molecule in a trap is a strong function of its effective charge, we demonstrate here that the average travel time between traps in the landscape yields its hydrodynamic radius. Tailoring the pitch of the lattice thus yields two different experimentally measurable time scales that together uniquely determine both the size and charge of the molecule. Since no information is required on the location of the molecule between consecutive departure and arrival events at lattice sites, the technique is ideally suited to measurements on weakly emitting entities such as single molecules.
Periwal, Vinita; Scaria, Vinod
2017-01-01
The ubiquitous role of microRNAs (miRNAs) in a number of pathological processes has suggested that they could act as potential drug targets. RNA-binding small molecules offer an attractive means for modulating miRNA function. The availability of bioassay data sets for a variety of biological assays and molecules in public domain provides a new opportunity toward utilizing them to create models and further utilize them for in silico virtual screening approaches to prioritize or assign potential functions for small molecules. Here, we describe a computational strategy based on machine learning for creation of predictive models from high-throughput biological screens for virtual screening of small molecules with the potential to inhibit microRNAs. Such models could be potentially used for computational prioritization of small molecules before performing high-throughput biological assay.
DEFF Research Database (Denmark)
Dalskov, Erik K.; Sauer, Stephan P. A.
1998-01-01
Molecular static and dynamic polarizabilities for thirteen small molecules have been calculated using four "black box" ab initio methods, the random phase approximation, RPA, the second-order polarization propagator approximation, SOPPA, the second-order polarization propagator approximation...
Directory of Open Access Journals (Sweden)
Mary C. Hames
2013-11-01
Full Text Available Bacterial Pth1 is essential for viability. Pth1 cleaves the ester bond between the peptide and nucleotide of peptidyl-tRNA generated from aborted translation, expression of mini-genes, and short ORFs. We have determined the shape of the Pth1:peptidyl-tRNA complex using small angle neutron scattering. Binding of piperonylpiperazine, a small molecule constituent of a combinatorial synthetic library common to most compounds with inhibitory activity, was mapped to Pth1 via NMR spectroscopy. We also report computational docking results, modeling piperonylpiperazine binding based on chemical shift perturbation mapping. Overall these studies promote Pth1 as a novel antibiotic target, contribute to understanding how Pth1 interacts with its substrate, advance the current model for cleavage, and demonstrate feasibility of small molecule inhibition.
International Nuclear Information System (INIS)
Hatta, Ichiro; Ohta, Noboru; Yagi, Naoto; Nakazawa, Hiromitsu; Obata, Yasuko; Inoue, Katsuaki
2011-01-01
We studied effects of functional molecules on corneocytes in stratum corneum using time-resolved small- and wide-angle x-ray diffraction after applying a functional molecule. From these results it was revealed that in the stratum corneum a typical hydrophilic molecule, ethanol, penetrates via the transcellular route and on the other hand a typical hydrophobic molecule, d-limonene, penetrates via the intercellular route.
International Nuclear Information System (INIS)
Yoetz-Kopelman, Tal; Ram, Yaron; Freeman, Amihay; Shacham-Diamand, Yosi
2015-01-01
The changes in the Faradaic impedance of gold/biomolecules system due to specific binding of small molecule to a significantly larger binding protein molecule were investigated. The biotin (244.31 Da) - avidin (66000 Da) couple was used as a model for small ligand - binding protein biorecognition. The study was carried out under open circuit potential in the presence of [Fe(CN) 6 ] −3/−4 redox couple. An equivalent electrical circuit was proposed and used for the interpretation of the recorded impedance spectra. Adsorption of thiolated avidin increased the electron transfer resistance, R ct , by a factor of about 7.5 while subsequent addition of biotin within the concentration range of 4.1-40.9 nM reduced the value of R ct by amount proportional to the biotin concentration. The addition of biotin did not affect, however, the equivalent double layer capacitance or other equivalent circuit parameters. A simple model based on effective surface coverage by the avidin molecules and the effect of the added biotin on electron transfer through the coated surface is proposed. A model for the minimum detection limit based on the random distribution of the binding protein and its dimensions is proposed
Sharenko, Alexander; Treat, Neil D.; Love, John A.; Toney, Michael F.; Stingelin, Natalie; Nguyen, Thuc-Quyen
2014-01-01
© the Partner Organisations 2014. The nucleating agent DMDBS is used to modulate the crystallization of solution-processed small molecule donor molecules in bulk heterojunction organic photovoltaic (BHJ OPV) devices. This control over donor molecule crystallization leads to a reduction in optimized thermal annealing times as well as smaller donor molecule crystallites, and therefore more efficient devices, when using an excessive amount of solvent additive. We therefore demonstrate the use of nucleating agents as a powerful and versatile processing strategy for solution-processed, small molecule BHJ OPVs. This journal is
Sharenko, Alexander
2014-08-12
© the Partner Organisations 2014. The nucleating agent DMDBS is used to modulate the crystallization of solution-processed small molecule donor molecules in bulk heterojunction organic photovoltaic (BHJ OPV) devices. This control over donor molecule crystallization leads to a reduction in optimized thermal annealing times as well as smaller donor molecule crystallites, and therefore more efficient devices, when using an excessive amount of solvent additive. We therefore demonstrate the use of nucleating agents as a powerful and versatile processing strategy for solution-processed, small molecule BHJ OPVs. This journal is
Nossa, Javier; Islam, Fhokrul; Canali, Carlo; Pederson, Mark
2012-02-01
For device applications of single molecule magnets (SMMs) in high-density information storage and quantum-state control it is essential that the magnetic properties of the molecules remain stable under the influence of metallic contacts or surface environment. Recent tunneling experiments [1, 2] on N@C60 and Fe4 SMM have shown that these molecules preserve their magnetic characteristics when they are used as the central island of single-electron transistors. Although quantum spin models have been used extensively to study theoretically tunneling spectroscopy of SMMs, it has been shown recently that the orbital degrees of freedom, which is absent in spin models, can significantly affect the tunneling conductance [3]. In this work we present first-principles calculations of the neutral and charged states of N@C60 and Fe4 SMMs, and discuss a strategy to include their properties into a theory of quantum transport. We also present results of the magnetic anisotropy for the different charge states of Fe4 and discuss their relevance for experiments [2] in the sequential tunneling and cotunnelling regimes. [4pt] [1]. N. Roch et al., Phys. Rev. B 83, 081407 (2011). [0pt] [2]. A.S. Zyazin et al., Nano Lett. 10, 3307 (2010). [0pt] [3]. L. Michalak et al., Phys. Rev. Lett. 104, 017202 (2010).
Single Molecule Conductance of Oligothiophene Derivatives
Dell, Emma J.
to sample similar conformers. This work demonstrates that the conductance of bithiophene displays a strong dependence on the conformational fluctuations accessible within a given junction configuration, and that the symmetry of such small molecules can significantly influence their conductance behavior. Next, the single-molecule conductance of a family of oligothiophenes comprising one to six thiophene units was measured. An anomalous behavior was found: the peak of the conductance histogram distribution did not follow a clear exponential decay with increasing number of thiophene units in the chain. The electronic properties of the materials were characterized by optical spectroscopy and electrochemistry to gain an understanding of the factors affecting the conductance of these molecules. Different conformers in the junction were postulated to be a contributing factor to the anomalous trend in the observed conductance as a function of molecule length. Then, the electronic properties of the thiophene-1,1-dioxide unit were investigated. These motifs have become synthetically accessible in the last decade, due to Rozen's unprecedentedly potent oxidizing reagent - HOF˙CH 3CN - which has been shown to be powerful yet selective enough to oxidize thiophenes in various environments. The resulting thiophene-1,1-dioxides show great promise for electronic devices. The oxidation chemistry of thiophenes was expanded and tuning of the frontier energy levels was demonstrated through combining electron poor and electron rich units. Finally, charge carriers in single-molecule junctions were shown to be tunable within a family of molecules containing these thiophene-1,1-dioxide (TDO) building blocks. Oligomers of TDO were designed in order to increase electron affinity, maintain delocalized frontier orbitals, while significantly decreasing the transport gap. Through thermopower measurements, the dominant charge carriers were shown to change from holes to electrons as the number of
Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J
2015-09-16
Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.
Um, JungIn; Lee, Ji-Hyung; Jung, Da-Woon; Williams, Darren R
2018-04-01
Degenerative diseases, such as Alzheimer's disease, heart disease and arthritis cause great suffering and are major socioeconomic burdens. An attractive treatment approach is stem cell transplantation to regenerate damaged or destroyed tissues. However, this can be problematic. For example, donor cells may not functionally integrate into the host tissue. An alternative methodology is to deliver bioactive agents, such as small molecules, directly into the diseased tissue to enhance the regenerative potential of endogenous stem cells. Areas covered: In this review, the authors discuss the necessity of developing these small molecules to treat degenerative diseases and survey progress in their application as therapeutics. They describe both the successes and caveats of developing small molecules that target endogenous stem cells to induce tissue regeneration. This article is based on literature searches which encompass databases for biomedical research and clinical trials. These small molecules are also categorized per their target disease and mechanism of action. Expert opinion: The development of small molecules targeting endogenous stem cells is a high-profile research area. Some compounds have made the successful transition to the clinic. Novel approaches, such as modulating the stem cell niche or targeted delivery to disease sites, should increase the likelihood of future successes in this field.
A magnetic nanoparticle-clustering biosensor for blu-ray based optical detection of small-molecules
DEFF Research Database (Denmark)
Yang, Jaeyoung; Donolato, Marco; Antunes, Paula Soares Martins
2014-01-01
MNP-clustering facilitates high-resolution small-molecule assays. For experiments, aptamer-functionalized MNPs (Apt-MNPs) were first incubated with adenosine-5'-triphosphate (ATP) followed by adding MNPs with linker strands (linker-MNPs). The linker hybridizes with a region of aptamer sequences...
Kang, Minji; Hwang, Hansu; Park, Won-Tae; Khim, Dongyoon; Yeo, Jun-Seok; Kim, Yunseul; Kim, Yeon-Ju; Noh, Yong-Young; Kim, Dong-Yu
2017-01-25
We report on the fabrication of an organic thin-film semiconductor formed using a blend solution of soluble ambipolar small molecules and an insulating polymer binder that exhibits vertical phase separation and uniform film formation. The semiconductor thin films are produced in a single step from a mixture containing a small molecular semiconductor, namely, quinoidal biselenophene (QBS), and a binder polymer, namely, poly(2-vinylnaphthalene) (PVN). Organic field-effect transistors (OFETs) based on QBS/PVN blend semiconductor are then assembled using top-gate/bottom-contact device configuration, which achieve almost four times higher mobility than the neat QBS semiconductor. Depth profile via secondary ion mass spectrometry and atomic force microscopy images indicate that the QBS domains in the films made from the blend are evenly distributed with a smooth morphology at the bottom of the PVN layer. Bias stress test and variable-temperature measurements on QBS-based OFETs reveal that the QBS/PVN blend semiconductor remarkably reduces the number of trap sites at the gate dielectric/semiconductor interface and the activation energy in the transistor channel. This work provides a one-step solution processing technique, which makes use of soluble ambipolar small molecules to form a thin-film semiconductor for application in high-performance OFETs.
Medeiros, Diogo de Jesus; Cortopassi, Wilian Augusto; Costa França, Tanos Celmar; Pimentel, André Silva
2013-01-01
The suitable computation of accurate atomic charges for the GROMACS topology *.itp files of small molecules, generated in the PRODRG server, has been a tricky task nowadays because it does not calculate atomic charges using an ab initio method. Usually additional steps of structure optimization and charges calculation, followed by a tedious manual replacement of atomic charges in the *.itp file, are needed. In order to assist this task, we report here the ITP Adjuster 1.0, a utility program d...
Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.
The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.
Electronic structure of molecular Rydberg states of some small molecules and molecular ion
International Nuclear Information System (INIS)
Sun Biao; Li Jiaming
1993-01-01
Based on an independent-particle-approximation (i.e. the multiple scattering self-consistent-field theory), the electronic structures of Rydberg states of the small diatomic molecules H 2 , He 2 and the He 2 + molecular ion were studied. The principal quantum number of the first state of the Rydberg series is determined from a convention of the limit of the molecular electronic configuration. The dynamics of the excited molecules and molecular ion has been elucidated. The theoretical results are in fair agreement with the existing experimental measurements, thus they can serve as a reliable basis for future refined treatment such as the configuration interaction calculation
Nonlinear Transport in Organic Thin Film Transistors with Soluble Small Molecule Semiconductor.
Kim, Hyeok; Song, Dong-Seok; Kwon, Jin-Hyuk; Jung, Ji-Hoon; Kim, Do-Kyung; Kim, SeonMin; Kang, In Man; Park, Jonghoo; Tae, Heung-Sik; Battaglini, Nicolas; Lang, Philippe; Horowitz, Gilles; Bae, Jin-Hyuk
2016-03-01
Nonlinear transport is intensively explained through Poole-Frenkel (PF) transport mechanism in organic thin film transistors with solution-processed small molecules, which is, 6,13-bis(triisopropylsilylethynyl) (TIPS) pentacene. We outline a detailed electrical study that identifies the source to drain field dependent mobility. Devices with diverse channel lengths enable the extensive exhibition of field dependent mobility due to thermal activation of carriers among traps.
Support for Natural Small-Molecule Phenols as Anxiolytics
Directory of Open Access Journals (Sweden)
Xiaohong Wang
2017-12-01
Full Text Available Natural small-molecule phenols (NSMPs share some bioactivities. The anxiolytic activity of NSMPs is attracting attention in the scientific community. This paper provides data supporting the hypothesis that NSMPs are generally anxiolytic. The anxiolytic activities of seven simple phenols, including phloroglucinol, eugenol, protocatechuic aldehyde, vanillin, thymol, ferulic acid, and caffeic acid, were assayed with the elevated plus maze (EPM test in mice. The oral doses were 5, 10 and 20 mg/kg, except for phloroglucinol for which the doses were 2.5, 5 and 10 mg/kg. All tested phenols had anxiolytic activity in mice. The phenolic hydroxyl group in 4-hydroxycinnamic acid (4-OH CA was essential for the anxiolytic activity in the EPM test in mice and rats compared to 4-chlorocinnamic acid (4-Cl CA. The in vivo spike recording of rats’ hippocampal neurons also showed significant differences between 4-OH CA and 4-Cl CA. Behavioral and neuronal spike recording results converged to indicate the hippocampal CA1 region might be a part of the anxiolytic pathways of 4-OH CA. Therefore, our study provides further experimental data supporting NSMPs sharing anxiolytic activity, which may have general implications for phytotherapy because small phenols occur extensively in herbal medicines.
International Nuclear Information System (INIS)
Panov, M.N.; Afrosimov, V.V.; Basalaev, A.A.; Guschina, N.A.; Nikulin, V.K.
2006-01-01
The interactions of protons and alpha-particles with hydrocarbons are investigated. A quantum-mechanical computation of the electronic structure of all hydrocarbons from methane to butane and its fragment ions was performed in the Hartree-Fock RHF/UHF approximation using a GAMESS program (General Atomic Molecular Electron Structure System). The correlation energy was taken into account within the framework of MP2 perturbation theory. The structural parameters of the hydrocarbon molecules and their charged and neutral fragments were calculated in two cases: in the geometry of the parent molecule or of the relaxation states. The difference of the full energy of the same fragments in and out of brackets gives us the vibration excitation energies of the fragments at the moment of creation. Additional Mulliken effective charges (in electron charge units) of atoms in the fragments have been calculated. The calculations show that removing one electron from the ethane molecule without electronic excitation produced a single charged molecular ion in vibration state with binding energy of hydrogen atoms, some decimal eV. As results we obtain C 2 H 6 + and C 2 H 5 + . Additional fragmentation of hydrocarbon needs electronic excitation of produced single charged ions. Cross sections for electron capture and excitation processes in collisions between the hydrogen-like He + , B 4+ and O 7+ ions have been evaluated. The purpose of the theory within this project during the period under review was to get for the first time new data on Single-Electron Capture (SEC) and Excitation Processes (EP) in collisions of He + (1s) ions with hydrogen-like impurity ions B 4+ (1s) and O 7+ (1s) in the energy range for He + ions from 0.2 MeV to 3.0 MeV. The calculations were carried out by using the method of close-coupling equations with basis sets of eleven and ten quasimolecular two-electron states for reactions (1, 2) and (3, 4), respectively (entrance channel, seven charge transfer channels
Directory of Open Access Journals (Sweden)
Arnout Voet
Full Text Available One of the underlying principles in drug discovery is that a biologically active compound is complimentary in shape and molecular recognition features to its receptor. This principle infers that molecules binding to the same receptor may share some common features. Here, we have investigated whether the electrostatic similarity can be used for the discovery of small molecule protein-protein interaction inhibitors (SMPPIIs. We have developed a method that can be used to evaluate the similarity of electrostatic potentials between small molecules and known protein ligands. This method was implemented in a software called EleKit. Analyses of all available (at the time of research SMPPII structures indicate that SMPPIIs bear some similarities of electrostatic potential with the ligand proteins of the same receptor. This is especially true for the more polar SMPPIIs. Retrospective analysis of several successful SMPPIIs has shown the applicability of EleKit in the design of new SMPPIIs.
Small stress molecules inhibit aggregation and neurotoxicity of prion peptide 106-126
International Nuclear Information System (INIS)
Kanapathipillai, Mathumai; Ku, Sook Hee; Girigoswami, Koyeli; Park, Chan Beum
2008-01-01
In prion diseases, the posttranslational modification of host-encoded prion protein PrP c yields a high β-sheet content modified protein PrP sc , which further polymerizes into amyloid fibrils. PrP106-126 initiates the conformational changes leading to the conversion of PrP c to PrP sc . Molecules that can defunctionalize such peptides can serve as a potential tool in combating prion diseases. In microorganisms during stressed conditions, small stress molecules (SSMs) are formed to prevent protein denaturation and maintain protein stability and function. The effect of such SSMs on PrP106-126 amyloid formation is explored in the present study using turbidity, atomic force microscopy (AFM), and cellular toxicity assay. Turbidity and AFM studies clearly depict that the SSMs-ectoine and mannosylglyceramide (MGA) inhibit the PrP106-126 aggregation. Our study also connotes that ectoine and MGA offer strong resistance to prion peptide-induced toxicity in human neuroblastoma cells, concluding that such molecules can be potential inhibitors of prion aggregation and toxicity
Small Molecule Anticonvulsant Agents with Potent In Vitro Neuroprotection
Smith, Garry R.; Zhang, Yan; Du, Yanming; Kondaveeti, Sandeep K.; Zdilla, Michael J.; Reitz, Allen B.
2012-01-01
Severe seizure activity is associated with recurring cycles of excitotoxicity and oxidative stress that result in progressive neuronal damage and death. Intervention to halt these pathological processes is a compelling disease-modifying strategy for the treatment of seizure disorders. In the present study, a core small molecule with anticonvulsant activity has been structurally optimized for neuroprotection. Phenotypic screening of rat hippocampal cultures with nutrient medium depleted of antioxidants was utilized as a disease model. Increased cell death and decreased neuronal viability produced by acute treatment with glutamate or hydrogen peroxide were prevented by our novel molecules. The neuroprotection associated with this chemical series has marked structure activity relationships that focus on modification of the benzylic position of a 2-phenyl-2-hydroxyethyl sulfamide core structure. Complete separation between anticonvulsant activity and neuroprotective action was dependent on substitution at the benzylic carbon. Chiral selectivity was evident in that the S-enantiomer of the benzylic hydroxy group had neither neuroprotective nor anticonvulsant activity, while the R-enantiomer of the lead compound had full neuroprotective action at ≤40 nM and antiseizure activity in three animal models. These studies indicate that potent, multifunctional neuroprotective anticonvulsants are feasible within a single molecular entity. PMID:22535312
Siloxides as supporting ligands in uranium(III)-mediated small-molecule activation
Energy Technology Data Exchange (ETDEWEB)
Mougel, Victor; Camp, Clement; Pecaut, Jacques; Mazzanti, Marinella [Laboratoire de Reconnaissance Ionique et Chimie de Coordination, SCIB, UMR-E3 CEA-UJF, INAC, CEA-Grenoble (France); Coperet, Christophe [Laboratory of Inorganic Chemistry, ETH Zurich (Switzerland); Maron, Laurent; Kefalidis, Christos E. [LPCNO, CNRS and INSA, UPS, Universite de Toulouse (France)
2012-12-03
Siloxides can support U..in the reduction of small molecules with uranium complexes. The treatment of [U{N(SiMe_3)_2}{sub 3}] with HOSi(OtBu){sub 3} (3 equiv) yielded a novel homoleptic uranium(III) siloxide complex 1, which acted as a two-electron reducing agent toward CS{sub 2} and CO{sub 2}. Complex 1 also reduced toluene to afford a diuranium inverted-sandwich complex. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
A Structural Perspective on the Modulation of Protein-Protein Interactions with Small Molecules.
Demirel, Habibe Cansu; Dogan, Tunca; Tuncbag, Nurcan
2018-05-31
Protein-protein interactions (PPIs) are the key components in many cellular processes including signaling pathways, enzymatic reactions and epigenetic regulation. Abnormal interactions of some proteins may be pathogenic and cause various disorders including cancer and neurodegenerative diseases. Although inhibiting PPIs with small molecules is a challenging task, it gained an increasing interest because of its strong potential for drug discovery and design. The knowledge of the interface as well as the structural and chemical characteristics of the PPIs and their roles in the cellular pathways are necessary for a rational design of small molecules to modulate PPIs. In this study, we review the recent progress in the field and detail the physicochemical properties of PPIs including binding hot spots with a focus on structural methods. Then, we review recent approaches for structural prediction of PPIs. Finally, we revisit the concept of targeting PPIs in a systems biology perspective and we refer to the non-structural approaches, usually employed when the structural information is not present. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Nanopore Device for Reversible Ion and Molecule Sensing or Migration
Pourmand, Nader (Inventor); Vilozny, Boaz (Inventor); Actis, Paolo (Inventor); Seger, R. Adam (Inventor); Singaram, Bakthan (Inventor)
2015-01-01
Disclosed are methods and devices for detection of ion migration and binding, utilizing a nanopipette adapted for use in an electrochemical sensing circuit. The nanopipette may be functionalized on its interior bore with metal chelators for binding and sensing metal ions or other specific binding molecules such as boronic acid for binding and sensing glucose. Such a functionalized nanopipette is comprised in an electrical sensor that detects when the nanopipette selectively and reversibly binds ions or small molecules. Also disclosed is a nanoreactor, comprising a nanopipette, for controlling precipitation in aqueous solutions by voltage-directed ion migration, wherein ions may be directed out of the interior bore by a repulsing charge in the bore.
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Inhibition of SIRT1 by a small molecule induces apoptosis in breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Kalle, Arunasree M., E-mail: arunasreemk@ilsresearch.org [Institute of Life Sciences, University of Hyderabad Campus, Hyderabad, AP 500 046 (India); Mallika, A. [Institute of Life Sciences, University of Hyderabad Campus, Hyderabad, AP 500 046 (India); Badiger, Jayasree [HKE' s Smt. V.G. College for Women, Aiwan-E-Shahi Area, Gulbarga, KA 585 102 (India); Alinakhi [Institute of Life Sciences, University of Hyderabad Campus, Hyderabad, AP 500 046 (India); Talukdar, Pinaki [Department of Chemistry, Indian Institute of Science Education and Research, First Floor, Central Tower, Sai Trinity Building Garware Circle, Sutarwadi, PashanPune, Maharashtra 411 021 (India); Sachchidanand [Lupin Research Park, 46/47, A, Village Nande, Taluka Mulshi, Dist. Pune 411 042 (India)
2010-10-08
Research highlights: {yields} Novel small molecule SIRT1 inhibitor better than sirtinol. {yields} IC{sub 50} 500 nM. {yields} Specific tumor cytotoxicity towards breast cancer cells. {yields} Restoration of H3K9 acetylation levels to baseline when co-treated with SIRT1 activator (Activator X) and inhibitor (ILS-JGB-1741). -- Abstract: Overexpression of SIRT1, a NAD{sup +}-dependent class III histone deacetylases (HDACs), is implicated in many cancers and therefore could become a promising antitumor target. Here we demonstrate a small molecule SIRT1 inhibitor, ILS-JGB-1741(JGB1741) with potent inhibitory effects on the proliferation of human metastatic breast cancer cells, MDA-MB 231. The molecule has been designed using medicinal chemistry approach based on known SIRT1 inhibitor, sirtinol. The molecule showed a significant inhibition of SIRT1 activity compared to sirtinol. Studies on the antitumor effects of JGB on three different cancer cell lines, K562, HepG2 and MDA-MB 231 showed an IC{sub 50} of 1, 10 and 0.5 {mu}M, respectively. Further studies on MDA-MB 231 cells showed a dose-dependent increase in K9 and K382 acetylation of H3 and p53, respectively. Results also demonstrated that JGB1741-induced apoptosis is associated with increase in cytochrome c release, modulation in Bax/Bcl2 ratio and cleavage of PARP. Flowcytometric analysis showed increased percentage of apoptotic cells, decrease in mitochondrial membrane potential and increase in multicaspase activation. In conclusion, the present study indicates the potent apoptotic effects of JGB1741 in MDA-MB 231 cells.
International Nuclear Information System (INIS)
Chew, H.; McNulty, P.J.
1982-01-01
In earlier work a model of fluorescent and Raman scattering by active molecules represented as classical electric dipoles embedded in small particles was developed. The intensity and angular distribution of the inelastically scattered radiation was shown to depend on the geometric and optical properties of the particle. The model was originally developed for particles having spherical shape and later extended to concentric spheres, cylinders, and prolate spheroids. The active molecules were originally assumed to be isotropically polarizable. The model has been recently extended to certain types of anisotropically polarizable molecules. The model had also been applied to particles having internal structure
Smith, Brandon; Clark, Michael; Grieco, Christopher; Larsen, Alec; Asbury, John; Gomez, Enrique
2015-03-01
Crystalline organic molecules often exhibit the ability to form multiple crystal structures depending on the processing conditions. Exploiting this polymorphism to optimize molecular orbital overlap between adjacent molecules within the unit lattice of conjugated polymers is an approach to enhance charge transport within the material. We have demonstrated the formation of tighter π- π stacking poly(3-hexylthiophene-2,5-diyl) polymorphs in films spin coated from ferrocene-containing solutions using grazing incident X-ray diffraction. As a result, we found that the addition of ferrocene to casting solutions yields thin-film transistors which exhibit significantly higher source-drain current and charge mobilities than neat polymer devices. Insights gleaned from ferrocene/poly(3-hexylthiophene) mixtures can serve as a template for selection and optimization of next generation small molecule/polymer systems possessing greater baseline charge mobilities. Ultimately, the development of such techniques to enhance the characteristics of organic transistors without imparting high costs or loss of advantageous properties will be a critical factor determining the future of organic components within the electronics market.
International Nuclear Information System (INIS)
Kusakabe, Toshio; Kitamuro, Satoshi; Nakai, Yohta; Tawara, Hiroyuki; Sasao, Mamiko
2012-01-01
Charge-transfer cross sections of the ground state He + ions in collisions with He atoms and simple molecules (H 2 , D 2 , N 2 , CO and CO 2 ) have been measured in the energy range of 0.20 to 4.0 keV with the initial growth rate method. Since previously published experimental data are scattered in the low energy region, the present observations would provide reasonably reliable cross section data below 4 keV. The charge transfer accompanied by dissociation of product molecular ion can be dominant at low energies for molecular targets. In He + + D 2 collisions, any isotope effect was not observed over the present energy range, compared to H 2 molecule. (author)
Energy Technology Data Exchange (ETDEWEB)
Thomas, Christine M. [Brandeis Univ., Waltham, MA (United States)
2015-08-01
Recent attention in the chemical community has been focused on the energy efficient and environmentally benign conversion of abundant small molecules (CO2, H2O, etc.) to useful liquid fuels. This project addresses these goals by examining fundamental aspects of catalyst design to ultimately access small molecule activation processes under mild conditions. Specifically, Thomas and coworkers have targetted heterobimetallic complexes that feature metal centers with vastly different electronic properties, dictated both by their respective positions on the periodic table and their coordination environment. Unlike homobimetallic complexes featuring identical or similar metals, the bonds between metals in early/late heterobimetallics are more polarized, with the more electron-rich late metal center donating electron density to the more electron-deficient early metal center. While metal-metal bonds pose an interesting strategy for storing redox equivalents and stabilizing reactive metal fragments, the polar character of metal-metal bonds in heterobimetallic complexes renders these molecules ideally poised to react with small molecule substrates via cleavage of energy-rich single and double bonds. In addition, metal-metal interactions have been shown to dramatically affect redox potentials and promote multielectron redox activity, suggesting that metal-metal interactions may provide a mechanism to tune redox potentials and access substrate reduction/activation at mild overpotentials. This research project has provided a better fundamental understanding of how interactions between transition metals can be used as a strategy to promote and/or control chemical transformations related to the clean production of fuels. While this project focused on the study of homogeneous systems, it is anticipated that the broad conclusions drawn from these investigations will be applicable to heterogeneous catalysis as well, particularly on heterogeneous processes that occur at interfaces in
Directory of Open Access Journals (Sweden)
Alexandra Mikhailova
2014-02-01
Full Text Available Human induced pluripotent stem cells (hiPSCs offer unique opportunities for developing novel cell-based therapies and disease modeling. In this study, we developed a directed differentiation method for hiPSCs toward corneal epithelial progenitor cells capable of terminal differentiation toward mature corneal epithelial-like cells. In order to improve the efficiency and reproducibility of our method, we replicated signaling cues active during ocular surface ectoderm development with the help of two small-molecule inhibitors in combination with basic fibroblast growth factor (bFGF in serum-free and feeder-free conditions. First, small-molecule induction downregulated the expression of pluripotency markers while upregulating several transcription factors essential for normal eye development. Second, protein expression of the corneal epithelial progenitor marker p63 was greatly enhanced, with up to 95% of cells being p63 positive after 5 weeks of differentiation. Third, corneal epithelial-like cells were obtained upon further maturation.
Small Molecules Inspired by the Natural Product Withanolides as Potent Inhibitors of Wnt Signaling.
Sheremet, Michael; Kapoor, Shobhna; Schröder, Peter; Kumar, Kamal; Ziegler, Slava; Waldmann, Herbert
2017-09-19
Wnt signaling is a fundamental pathway that drives embryonic development and is essential for stem cell maintenance and tissue homeostasis. Dysregulation of Wnt signaling is linked to various diseases, and a constitutively active Wnt pathway drives tumorigenesis. Thus, disruption of the Wnt response is deemed a promising strategy for cancer drug discovery. However, only few clinical drug candidates that target Wnt signaling are available so far, and new small-molecule modulators of Wnt-related processes are in high demand. Here we describe the synthesis of small molecules inspired by withanolide natural products by using a pregnenolone-derived β-lactone as the key intermediate that was transformed into a δ-lactone appended to the D-ring of the steroidal scaffold. This natural-product-inspired compound library contained potent inhibitors of Wnt signaling that act upstream of the destruction complex to stabilize Axin in a tankyrase-independent manner. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Vannahme, Christoph; Dufva, Martin; Kristensen, Anders
2014-01-01
Label-free imaging is a promising tool for the study of biological processes such as cell adhesion and small molecule signaling processes. In order to image in two dimensions of space current solutions require motorized stages which results in low imaging frame rates. Here, a highly sensitive...... distributed feedback (DFB) dye laser sensor for real-time label-free imaging without any moving parts enabling a frame rate of 12 Hz is presented. The presence of molecules on the laser surface results in a wavelength shift which is used as sensor signal. The unique DFB laser structure comprises several areas...
International Nuclear Information System (INIS)
Chang, Sehoon; Park, Hyesung; Cheng, Jayce J; Rekemeyer, Paul H; Gradečak, Silvija
2014-01-01
We demonstrate improved photovoltaic performance of ZnO nanowire/poly(3-hexylthiophene) (P3HT) nanofiber hybrid devices using an interfacial modification of ZnO nanowires. Formation of cascade energy levels between the ZnO nanowire and P3HT nanofiber was achieved by interfacial modification of ZnO nanowires using small molecules tetraphenyldibenzoperiflanthene (DBP) and 3,4,9,10-perylenetetracarboxylic bisbenzimidazole (PTCBI). The successful demonstration of improved device performance owing to the cascade energy levels by small molecule modification is a promising approach toward highly efficient organic/inorganic hybrid solar cells. (paper)
A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules
DEFF Research Database (Denmark)
Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum
2014-01-01
. The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...
Multi-Excitonic Quantum Dot Molecules
Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.
Directory of Open Access Journals (Sweden)
Chao-Yie Yang
Full Text Available The interleukin-1 receptor (IL-1R is the founding member of the interleukin 1 receptor family which activates innate immune response by its binding to cytokines. Reports showed dysregulation of cytokine production leads to aberrant immune cells activation which contributes to auto-inflammatory disorders and diseases. Current therapeutic strategies focus on utilizing antibodies or chimeric cytokine biologics. The large protein-protein interaction interface between cytokine receptor and cytokine poses a challenge in identifying binding sites for small molecule inhibitor development. Based on the significant conformational change of IL-1R type 1 (IL-1R1 ectodomain upon binding to different ligands observed in crystal structures, we hypothesized that transient small molecule binding sites may exist when IL-1R1 undergoes conformational transition and thus suitable for inhibitor development. Here, we employed accelerated molecular dynamics (MD simulation to efficiently sample conformational space of IL-1R1 ectodomain. Representative IL-1R1 ectodomain conformations determined from the hierarchy cluster analysis were analyzed by the SiteMap program which leads to identify small molecule binding sites at the protein-protein interaction interface and allosteric modulator locations. The cosolvent mapping analysis using phenol as the probe molecule further confirms the allosteric modulator site as a binding hotspot. Eight highest ranked fragment molecules identified from in silico screening at the modulator site were evaluated by MD simulations. Four of them restricted the IL-1R1 dynamical motion to inactive conformational space. The strategy from this study, subject to in vitro experimental validation, can be useful to identify small molecule compounds targeting the allosteric modulator sites of IL-1R and prevent IL-1R from binding to cytokine by trapping IL-1R in inactive conformations.
Small interfering RNA delivery through positively charged polymer nanoparticles
International Nuclear Information System (INIS)
Dragoni, Luca; Cesana, Alberto; Moscatelli, Davide; Ferrari, Raffaele; Morbidelli, Massimo; Lupi, Monica; Falcetta, Francesca; Ubezio, Paolo; D’Incalci, Maurizio
2016-01-01
Small interfering RNA (siRNA) is receiving increasing attention with regard to the treatment of many genetic diseases, both acquired and hereditary, such as cancer and diabetes. Being a high molecular weight (MW) polyanion, siRNA is not able to cross a cell membrane, and in addition it is unstable in physiological conditions. Accordingly, a biocompatible nanocarrier able to deliver siRNA into cells is needed. In this work, we synthesized biocompatible positively charged nanoparticles (NPs) following a two-step process that involves ring opening polymerization (ROP) and emulsion free radical polymerization (EFRP). Firstly, we proved the possibility of fine tuning the NPs’ characteristics (e.g. size and surface charge) by changing the synthetic process parameters. Then the capability in loading and delivering undamaged siRNA into a cancer cell cytoplasm has been shown. This latter process occurs through the biodegradation of the polymer constituting the NPs, whose kinetics can be tuned by adjusting the polymer’s MW. Finally, the ability of NPs to carry siRNA inside the cells in order to inhibit their target gene has been demonstrated using green flourescent protein positive cells. (paper)
Identification of potential small molecule binding pockets on Rho family GTPases.
Directory of Open Access Journals (Sweden)
Juan Manuel Ortiz-Sanchez
Full Text Available Rho GTPases are conformational switches that control a wide variety of signaling pathways critical for eukaryotic cell development and proliferation. They represent attractive targets for drug design as their aberrant function and deregulated activity is associated with many human diseases including cancer. Extensive high-resolution structures (>100 and recent mutagenesis studies have laid the foundation for the design of new structure-based chemotherapeutic strategies. Although the inhibition of Rho signaling with drug-like compounds is an active area of current research, very little attention has been devoted to directly inhibiting Rho by targeting potential allosteric non-nucleotide binding sites. By avoiding the nucleotide binding site, compounds may minimize the potential for undesirable off-target interactions with other ubiquitous GTP and ATP binding proteins. Here we describe the application of molecular dynamics simulations, principal component analysis, sequence conservation analysis, and ensemble small-molecule fragment mapping to provide an extensive mapping of potential small-molecule binding pockets on Rho family members. Characterized sites include novel pockets in the vicinity of the conformationaly responsive switch regions as well as distal sites that appear to be related to the conformations of the nucleotide binding region. Furthermore the use of accelerated molecular dynamics simulation, an advanced sampling method that extends the accessible time-scale of conventional simulations, is found to enhance the characterization of novel binding sites when conformational changes are important for the protein mechanism.
International Nuclear Information System (INIS)
Liu Xiao-Dong; Xu Zheng; Zhang Fu-Jun; Zhao Su-Ling; Zhang Tian-Hui; Gong Wei; Song Jing-Lu; Kong Chao; Yan Guang; Xu Xu-Rong
2010-01-01
In this work, the influence of a small-molecule material, tris(8-hydroxyquinoline) aluminum (Alq 3 ), on bulk heterojunction (BHJ) polymer solar cells (PSCs) is investigated in devices based on the blend of poly(2-methoxy-5-(2-ethylhexyloxy)-1,4-phenylenevinylene) (MEH-PPV) and [6,6]-phenyl-C 61 -butyric acid methyl ester (PCBM). By doping Alq 3 into MEH-PPV:PCBM solution, the number of MEH-PPV excitons can be effectively increased due to the energy transfer from Alq 3 to MEH-PPV, which probably induces the increase of photocurrent generated by excitons dissociation. However, the low carrier mobility of Alq 3 is detrimental to the efficient charge transport, thereby blocking the charge collection by the respective electrodes. The balance between photon absorption and charge transport in the active layer plays a key role in the performance of PSCs. For the case of 5 wt.% Alq 3 doping, the device performance is deteriorated rather than improved as compared with that of the undoped device. On the other hand, we adopt Alq 3 as a buffer layer instead of commonly used LiF. All the photovoltaic parameters are improved, yielding an 80% increase in power conversion efficiency (PCE) at the optimum thickness (1 nm) as compared with that of the device without any buffer layer. Even for the 5 wt.% Alq 3 doped device, the PCE has a slight enhancement compared with that of the standard device after modification with 1 nm (or 2 nm) thermally evaporated Alq 3 . The performance deterioration of Alq 3 -doped devices can be explained by the low solubility of Alq 3 , which probably deteriorates the bicontinuous D—A network morphology; while the performance improvement of the devices with Alq 3 as a buffer layer is attributed to the increased light harvesting, as well as blocking the hole leakage from MEH-PPV to the aluminum (Al) electrode due to the lower highest occupied molecular orbital (HOMO) level of Alq 3 compared with that of MEH-PPV
Next-generation small molecule therapies for heart failure: 2015 and beyond.
Malinowski, Justin T; St Jean, David J
2018-05-15
Poor prognosis coupled with significant economic burden makes heart failure (HF) one of the largest issues currently facing the world population. Although a significant number of new therapies have emerged over the past 20 years to treat the underlying physiological risk factors, only two new medications specifically for HF have been approved since 2007. This perspective provides an overview of recently approved treatment options for HF and as well as an update on additional small molecule therapies currently in clinical development. Copyright © 2018 Elsevier Ltd. All rights reserved.
Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization
International Nuclear Information System (INIS)
Kim, Sun Young; Song, Kyung-A; Kieff, Elliott; Kang, Myung-Soo
2012-01-01
Highlights: ► Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. ► A small molecule and a peptide as EBNA1 dimerization inhibitors identified. ► Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. ► Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)’s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation. In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459–607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-Jκ binding to the Jκ site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560–574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with EBNA1 in vitro, and repressed EBNA1-dependent transcription in vivo. Collectively, this study describes two
Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization
Energy Technology Data Exchange (ETDEWEB)
Kim, Sun Young; Song, Kyung-A [Samsung Advanced Institute for Health Sciences and Technology (SAIHST), Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Samsung Biomedical Research Institute (SBRI), Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Kieff, Elliott [Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA 02115 (United States); Kang, Myung-Soo, E-mail: mkang@skku.edu [Samsung Advanced Institute for Health Sciences and Technology (SAIHST), Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Samsung Biomedical Research Institute (SBRI), Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA 02115 (United States)
2012-07-27
Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation. In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated
Single Molecule Nanoelectrochemistry in Electrical Junctions.
Nichols, Richard J; Higgins, Simon J
2016-11-15
It is now possible to reliably measure single molecule conductance in a wide variety of environments including organic liquids, ultrahigh vacuum, water, ionic liquids, and electrolytes. The most commonly used methods deploy scanning probe microscopes, mechanically formed break junctions, or lithographically formed nanogap contacts. Molecules are generally captured between a pair of facing electrodes, and the junction current response is measured as a function of bias voltage. Gating electrodes can also be added so that the electrostatic potential at the molecular bridge can be independently controlled by this third noncontacting electrode. This can also be achieved in an electrolytic environment using a four-electrode bipotentiostatic configuration, which allows independent electrode potential control of the two contacting electrodes. This is commonly realized using an electrochemical STM and enables single molecule electrical characterization as a function of electrode potential and redox state of the molecular bridge. This has emerged as a powerful tool in modern interfacial electrochemistry and nanoelectrochemistry for studying charge transport across single molecules as a function of electrode potential and the electrolytic environments. Such measurements are possible in electrolytes ranging from aqueous buffers to nonaqueous ionic liquids. In this Account, we illustrate a number of examples of single molecule electrical measurements under electrode potential control use a scanning tunneling microscope (STM) and demonstrate how these can help in the understanding of charge transport in single molecule junctions. Examples showing charge transport following phase coherent tunneling to incoherent charge hopping across redox active molecular bridges are shown. In the case of bipyridinium (or viologen) molecular wires, it is shown how electrochemical reduction leads to an increase of the single molecule conductance, which is controlled by the liquid electrochemical
ChemNet: A Transferable and Generalizable Deep Neural Network for Small-Molecule Property Prediction
Energy Technology Data Exchange (ETDEWEB)
Goh, Garrett B.; Siegel, Charles M.; Vishnu, Abhinav; Hodas, Nathan O.
2017-12-08
With access to large datasets, deep neural networks through representation learning have been able to identify patterns from raw data, achieving human-level accuracy in image and speech recognition tasks. However, in chemistry, availability of large standardized and labelled datasets is scarce, and with a multitude of chemical properties of interest, chemical data is inherently small and fragmented. In this work, we explore transfer learning techniques in conjunction with the existing Chemception CNN model, to create a transferable and generalizable deep neural network for small-molecule property prediction. Our latest model, ChemNet learns in a semi-supervised manner from inexpensive labels computed from the ChEMBL database. When fine-tuned to the Tox21, HIV and FreeSolv dataset, which are 3 separate chemical tasks that ChemNet was not originally trained on, we demonstrate that ChemNet exceeds the performance of existing Chemception models, contemporary MLP models that trains on molecular fingerprints, and it matches the performance of the ConvGraph algorithm, the current state-of-the-art. Furthermore, as ChemNet has been pre-trained on a large diverse chemical database, it can be used as a universal “plug-and-play” deep neural network, which accelerates the deployment of deep neural networks for the prediction of novel small-molecule chemical properties.
X-Ray Beam Studies of Charge Sharing in Small Pixel, Spectroscopic, CdZnTe Detectors
Allwork, Christopher; Kitou, Dimitris; Chaudhuri, Sandeep; Sellin, Paul J.; Seller, Paul; Veale, Matthew C.; Tartoni, Nicola; Veeramani, Perumal
2012-08-01
Recent advances in the growth of CdZnTe material have allowed the development of small pixel, spectroscopic, X-ray imaging detectors. These detectors have applications in a diverse range of fields such as medical, security and industrial sectors. As the size of the pixels decreases relative to the detector thickness, the probability that charge is shared between multiple pixels increases due to the non zero width of the charge clouds drifting through the detector. These charge sharing events will result in a degradation of the spectroscopic performance of detectors and must be considered when analyzing the detector response. In this paper charge sharing and charge loss in a 250 μm pitch CdZnTe pixel detector has been investigated using a mono-chromatic X-ray beam at the Diamond Light Source, U.K. Using a 20 μm beam diameter the detector response has been mapped for X-ray energies both above (40 keV) and below (26 keV) the material K-shell absorption energies to study charge sharing and the role of fluorescence X-rays in these events.
Novel Small Molecule Inhibitors of Choline Kinase Identified by Fragment-Based Drug Discovery.
Zech, Stephan G; Kohlmann, Anna; Zhou, Tianjun; Li, Feng; Squillace, Rachel M; Parillon, Lois E; Greenfield, Matthew T; Miller, David P; Qi, Jiwei; Thomas, R Mathew; Wang, Yihan; Xu, Yongjin; Miret, Juan J; Shakespeare, William C; Zhu, Xiaotian; Dalgarno, David C
2016-01-28
Choline kinase α (ChoKα) is an enzyme involved in the synthesis of phospholipids and thereby plays key roles in regulation of cell proliferation, oncogenic transformation, and human carcinogenesis. Since several inhibitors of ChoKα display antiproliferative activity in both cellular and animal models, this novel oncogene has recently gained interest as a promising small molecule target for cancer therapy. Here we summarize our efforts to further validate ChoKα as an oncogenic target and explore the activity of novel small molecule inhibitors of ChoKα. Starting from weakly binding fragments, we describe a structure based lead discovery approach, which resulted in novel highly potent inhibitors of ChoKα. In cancer cell lines, our lead compounds exhibit a dose-dependent decrease of phosphocholine, inhibition of cell growth, and induction of apoptosis at low micromolar concentrations. The druglike lead series presented here is optimizable for improvements in cellular potency, drug target residence time, and pharmacokinetic parameters. These inhibitors may be utilized not only to further validate ChoKα as antioncogenic target but also as novel chemical matter that may lead to antitumor agents that specifically interfere with cancer cell metabolism.
A High-Throughput Small Molecule Screen for C. elegans Linker Cell Death Inhibitors.
Directory of Open Access Journals (Sweden)
Andrew R Schwendeman
Full Text Available Programmed cell death is a ubiquitous process in metazoan development. Apoptosis, one cell death form, has been studied extensively. However, mutations inactivating key mammalian apoptosis regulators do not block most developmental cell culling, suggesting that other cell death pathways are likely important. Recent work in the nematode Caenorhabditis elegans identified a non-apoptotic cell death form mediating the demise of the male-specific linker cell. This cell death process (LCD, linker cell-type death is morphologically conserved, and its molecular effectors also mediate axon degeneration in mammals and Drosophila. To develop reagents to manipulate LCD, we established a simple high-throughput screening protocol for interrogating the effects of small molecules on C. elegans linker cell death in vivo. From 23,797 compounds assayed, 11 reproducibly block linker cell death onset. Of these, five induce animal lethality, and six promote a reversible developmental delay. These results provide proof-of principle validation of our screening protocol, demonstrate that developmental progression is required for linker cell death, and suggest that larger scale screens may identify LCD-specific small-molecule regulators that target the LCD execution machinery.
Quantum Chemical Studies of Actinides and Lanthanides: From Small Molecules to Nanoclusters
Vlaisavljevich, Bess
Research into actinides is of high interest because of their potential applications as an energy source and for the environmental implications therein. Global concern has arisen since the development of the actinide concept in the 1940s led to the industrial scale use of the commercial nuclear energy cycle and nuclear weapons production. Large quantities of waste have been generated from these processes inspiring efforts to address fundamental questions in actinide science. In this regard, the objective of this work is to use theory to provide insight and predictions into actinide chemistry, where experimental work is extremely challenging because of the intrinsic difficulties of the experiments themselves and the safety issues associated with this type of chemistry. This thesis is a collection of theoretical studies of actinide chemistry falling into three categories: quantum chemical and matrix isolation studies of small molecules, the electronic structure of organoactinide systems, and uranyl peroxide nanoclusters and other solid state actinide compounds. The work herein not only spans a wide range of systems size but also investigates a range of chemical problems. Various quantum chemical approaches have been employed. Wave function-based methods have been used to study the electronic structure of actinide containing molecules of small to middle-size. Among these methods, the complete active space self consistent field (CASSCF) approach with corrections from second-order perturbation theory (CASPT2), the generalized active space SCF (GASSCF) approach, and Moller-Plesset second-order perturbation theory (MP2) have been employed. Likewise, density functional theory (DFT) has been used along with analysis tools like bond energy decomposition, bond orders, and Bader's Atoms in Molecules. From these quantum chemical results, comparison with experimentally obtained structures and spectra are made.
Abdelsamie, Maged
2015-09-29
The ease with which small-molecule donors crystallize during solution processing is directly linked to the need for solvent additives. Donor molecules that get trapped in disordered (H1) or liquid crystalline (T1) mesophases require additive processing to promote crystallization, phase separation, and efficient light harvesting. A donor material (X2) that crystallizes directly from solution yields additive-free solar cells with an efficiency of 7.6%. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Ruud, K.; Helgaker, T.; Jørgensen, Poul
1994-01-01
We report a systematic investigation of the magnetizability of a series of small molecules. The use of London atomic orbitals ensures gauge invariance and a fast basis set convergence. Good agreement is obtained with experimental magnetizabilities, both isotropic and anisotropic. The calculations...
Burns, Michael C; Howes, Jennifer E; Sun, Qi; Little, Andrew J; Camper, DeMarco V; Abbott, Jason R; Phan, Jason; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W
2018-05-01
K-RAS is mutated in approximately 30% of human cancers, resulting in increased RAS signaling and tumor growth. Thus, RAS is a highly validated therapeutic target, especially in tumors of the pancreas, lung and colon. Although directly targeting RAS has proven to be challenging, it may be possible to target other proteins involved in RAS signaling, such as the guanine nucleotide exchange factor Son of Sevenless (SOS). We have previously reported on the discovery of small molecules that bind to SOS1, activate SOS-mediated nucleotide exchange on RAS, and paradoxically inhibit ERK phosphorylation (Burns et al., PNAS, 2014). Here, we describe the discovery of additional, structurally diverse small molecules that also bind to SOS1 in the same pocket and elicit similar biological effects. We tested >160,000 compounds in a fluorescence-based assay to assess their effects on SOS-mediated nucleotide exchange. X-Ray structures revealed that these small molecules bind to the CDC25 domain of SOS1. Compounds that elicited high levels of nucleotide exchange activity in vitro increased RAS-GTP levels in cells, and inhibited phospho ERK levels at higher treatment concentrations. The identification of structurally diverse SOS1 binding ligands may assist in the discovery of new molecules designed to target RAS-driven tumors. Copyright © 2018 Elsevier Inc. All rights reserved.
Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk
2017-07-01
Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.
Storage of charge carriers on emitter molecules in organic light-emitting diodes
Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn
2012-08-01
Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.
An evaluation of a pre-charging pulse-jet filter for small combustor particulate control
Energy Technology Data Exchange (ETDEWEB)
Quimby, J.M.
1990-04-01
The objective of this test program is the performance and economic evaluation of a pre charged-pulse jet filter as the principal particulate control device for a commercial or industrial scale coal fired combustor. Performance factors that will be considered are the effects of particle charge, air/cloth ratio, fabric types, percent humidity and inlet particulate loading on fine particle collection efficiency, and pressure drop. Economic factors that will be considered are capital costs, energy and other operating costs, and maintenance costs. The program will result in a recommendation regarding the relative suitability of the pre charged pulse-jet filter for small combustor particulate control, as compared to other control devices. Fine particle control capability, ease of operation, and overall economics will be taken into consideration in making comparisons.
A novel small molecule inhibitor of hepatitis C virus entry.
Directory of Open Access Journals (Sweden)
Carl J Baldick
Full Text Available Small molecule inhibitors of hepatitis C virus (HCV are being developed to complement or replace treatments with pegylated interferons and ribavirin, which have poor response rates and significant side effects. Resistance to these inhibitors emerges rapidly in the clinic, suggesting that successful therapy will involve combination therapy with multiple inhibitors of different targets. The entry process of HCV into hepatocytes represents another series of potential targets for therapeutic intervention, involving viral structural proteins that have not been extensively explored due to experimental limitations. To discover HCV entry inhibitors, we utilized HCV pseudoparticles (HCVpp incorporating E1-E2 envelope proteins from a genotype 1b clinical isolate. Screening of a small molecule library identified a potent HCV-specific triazine inhibitor, EI-1. A series of HCVpp with E1-E2 sequences from various HCV isolates was used to show activity against all genotype 1a and 1b HCVpp tested, with median EC50 values of 0.134 and 0.027 µM, respectively. Time-of-addition experiments demonstrated a block in HCVpp entry, downstream of initial attachment to the cell surface, and prior to or concomitant with bafilomycin inhibition of endosomal acidification. EI-1 was equally active against cell-culture adapted HCV (HCVcc, blocking both cell-free entry and cell-to-cell transmission of virus. HCVcc with high-level resistance to EI-1 was selected by sequential passage in the presence of inhibitor, and resistance was shown to be conferred by changes to residue 719 in the carboxy-terminal transmembrane anchor region of E2, implicating this envelope protein in EI-1 susceptibility. Combinations of EI-1 with interferon, or inhibitors of NS3 or NS5A, resulted in additive to synergistic activity. These results suggest that inhibitors of HCV entry could be added to replication inhibitors and interferons already in development.
Live-cell microscopy reveals small molecule inhibitor effects on MAPK pathway dynamics.
Directory of Open Access Journals (Sweden)
Daniel J Anderson
Full Text Available Oncogenic mutations in the mitogen activated protein kinase (MAPK pathway are prevalent in human tumors, making this pathway a target of drug development efforts. Recently, ATP-competitive Raf inhibitors were shown to cause MAPK pathway activation via Raf kinase priming in wild-type BRaf cells and tumors, highlighting the need for a thorough understanding of signaling in the context of small molecule kinase inhibitors. Here, we present critical improvements in cell-line engineering and image analysis coupled with automated image acquisition that allow for the simultaneous identification of cellular localization of multiple MAPK pathway components (KRas, CRaf, Mek1 and Erk2. We use these assays in a systematic study of the effect of small molecule inhibitors across the MAPK cascade either as single agents or in combination. Both Raf inhibitor priming as well as the release from negative feedback induced by Mek and Erk inhibitors cause translocation of CRaf to the plasma membrane via mechanisms that are additive in pathway activation. Analysis of Erk activation and sub-cellular localization upon inhibitor treatments reveals differential inhibition and activation with the Raf inhibitors AZD628 and GDC0879 respectively. Since both single agent and combination studies of Raf and Mek inhibitors are currently in the clinic, our assays provide valuable insight into their effects on MAPK signaling in live cells.
Small organic molecules modulating iodine uptake in thyroid
International Nuclear Information System (INIS)
Ambroise, Y.
2006-01-01
The thyroid gland accumulates large quantities of iodine. This uptake is needed for the production of iodinated hormones (T3 and T4). The first step in the iodine accumulation is a basolateral transport of iodide ions by the cloned 'Natrium Iodide Sym-porter' also called NIS. Using high-throughput screening techniques, we have identified a series of inhibitors of the iodide uptake in thyrocytes. These compounds are of medical significance in case of thyroid deregulation and can also offer solutions for radio-iodine detoxification in case of emergency situations (nuclear industry...). In addition, these small organic molecules can be important tools for the understanding of NIS structure and functions In parallel, we have identified and characterized a single compound capable to strongly enhance the amount of intra-cellular iodide in rat thyrocytes (FRTL5) as well as in HEK293 cells transfected with hNIS (Natrium/Iodide Sym-porter). Preliminary studies show that this effect is NIS dependant, and is induced by alternative and unknown mechanisms. Future work will consist in unraveling the mode of action of this molecule. These informations will help us not only to better understand the iodide pathways in the thyroid, but also to design more active analogues. We will use photo-labelling techniques to identify new proteins involved in the iodide transfer and retention. In addition, preliminary experiments are underway to validate our compound as an anti-cancer agent. Targeted NIS gene delivery into tumors plus radio-iodide injection leads to tumor size regression. Unfortunately, doses of radioactivity are to high for safe treatment. Our compound may lead to enhanced radio-iodide entrapment, thus necessitating lower doses of radioactivity for tumor regression. (author)
Charge Transfer Based Colorimetric Detection of Silver Ion
Energy Technology Data Exchange (ETDEWEB)
Han, Seung Choul; Kim, Kwang Seob; Choi, Soon Kyu; Oh, Jinho; Lee, Jae Wook [Dong-A Univ., Busan (Korea, Republic of)
2014-05-15
We have demonstrated the colorimetric chemosensor for detection of Ag{sup +} via formation of nanoparticles which is based on the intramolecular CT interaction between the electron-rich (2,6-dialkoxynaphthalene; Np) moiety and the electron-deficient (methyl viologen; MV{sup 2+}) moiety of a single sensor molecule. Under irradiation of light, Ag{sup +} was reduced to very small silver nanoparticle by CT interaction in the presence of OEGs as flexible recognition moiety of Ag{sup +} and stabilizer for Ag nanoparticles, thus Ag nanoparticles resulted to reddish brown in the color change of sensor solution, gradually. Therefore, the charge-transfer interaction between an electron-deficient and an electron-rich units existing at a sensor molecule can be regarded as a new and efficient method to construct various colorimetric chemosensors. Donor.acceptor interactions or charge transfer (CT) interactions are an important class of non-covalent interactions and have been widely exploited in self-assembling systems. Beyond molecular chemistry, supramolecular chemistry aims at constituting highly complex, functional chemical systems from components held together by intermolecular forces. Chemosensors are the molecules of abiotic origin that bind selectively and reversibly with the analyte with concomitant change in one or more properties of the system. The recognition and signaling of ionic and neutral species of varying complexity is one of the most intensively studied areas of contemporary supramolecular chemistry.
Small Molecule Targeting of a MicroRNA Associated with Hepatocellular Carcinoma.
Childs-Disney, Jessica L; Disney, Matthew D
2016-02-19
Development of precision therapeutics is of immense interest, particularly as applied to the treatment of cancer. By analyzing the preferred cellular RNA targets of small molecules, we discovered that 5"-azido neomycin B binds the Drosha processing site in the microRNA (miR)-525 precursor. MiR-525 confers invasive properties to hepatocellular carcinoma (HCC) cells. Although HCC is one of the most common cancers, treatment options are limited, making the disease often fatal. Herein, we find that addition of 5"-azido neomycin B and its FDA-approved precursor, neomycin B, to an HCC cell line selectively inhibits production of the mature miRNA, boosts a downstream protein, and inhibits invasion. Interestingly, neomycin B is a second-line agent for hepatic encephalopathy (HE) and bacterial infections due to cirrhosis. Our results provocatively suggest that neomycin B, or second-generation derivatives, may be dual functioning molecules to treat both HE and HCC. Collectively, these studies show that rational design approaches can be tailored to disease-associated RNAs to afford potential lead therapeutics.
Controlling destiny through chemistry: small-molecule regulators of cell fate.
Firestone, Ari J; Chen, James K
2010-01-15
Controlling cell fate is essential for embryonic development, tissue regeneration, and the prevention of human disease. With each cell in the human body sharing a common genome, achieving the appropriate spectrum of stem cells and their differentiated lineages requires the selective activation of developmental signaling pathways, the expression of specific target genes, and the maintenance of these cellular states through epigenetic mechanisms. Small molecules that target these regulatory processes are therefore valuable tools for probing and manipulating the molecular mechanisms by which stem cells self-renew, differentiate, and arise from somatic cell reprogramming. Pharmacological modulators of cell fate could also help remediate human diseases caused by dysregulated cell proliferation or differentiation, heralding a new era in molecular therapeutics.
A study of small molecule ingress into planar and cylindrical materials using ion beam analysis
International Nuclear Information System (INIS)
Smith, R.W.
2001-12-01
Ion beam analysis techniques have been developed to allow profiling of small molecules diffused into materials at depths ranging from 10 -7 to 10 -1 m. A model DPS/PS/DPS triple-layer film and D( 3 He,p) 4 He nuclear reaction analysis was used to test the applicability of a novel data processing program - the IBA DataFurnace - to nuclear reaction data. The same reaction and program were used to depth profile the diffusion of heavy water into cellophane. A scanning 3 He micro-beam technique was developed to profile the diffusion of small molecules into both planar and cylindrical materials. The materials were exposed to liquids containing deuterium labelled molecules. A cross-section was exposed by cutting the material perpendicular to the surface and this was bombarded by a scanning 3 He micro-beam. Nuclear reaction analysis was used to profile the diffusing molecules, particle induced X-ray emission (in most cases) to locate the matrix and Rutherford backscattering for normalisation. Two-dimensional maps showing the molecular distribution over the cross-section were obtained. From these one-dimensional concentration profiles were produced. Water diffusion was studied into a planar and a cylindrical polymer, three different planar fibre optic grade glasses and both a fibre optic pressure sensor and communication fibre. The diffusion of dye into hair was also investigated. These studies have provided information about the diffusion mechanisms that take place, and where relevant diffusion coefficients have been obtained using either a semi-infinite medium Fickian planar diffusion model or a cylindrical Fickian diffusion model. (author)
Waved graphene: Unique structure for the adsorption of small molecules
International Nuclear Information System (INIS)
Pan, Hui
2017-01-01
We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H_2, N_2, NO, and CO are increased by 6–9 times, and that for O_2 is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H_2 on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O_2 on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.
Waved graphene: Unique structure for the adsorption of small molecules
Energy Technology Data Exchange (ETDEWEB)
Pan, Hui, E-mail: huipan@umac.mo
2017-03-01
We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H{sub 2}, N{sub 2}, NO, and CO are increased by 6–9 times, and that for O{sub 2} is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H{sub 2} on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O{sub 2} on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.
Bhattacharya, Atanu; Bernstein, Elliot R
2011-10-06
The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen
Exciplex: An Intermolecular Charge-Transfer Approach for TADF.
Sarma, Monima; Wong, Ken-Tsung
2018-04-03
Organic materials that display thermally activated delayed fluorescence (TADF) are a striking class of functional materials that have witnessed a booming progress in recent years. In addition to pure TADF emitters achieved by the subtle manipulations of intramolecular charge transfer processes with sophisticated molecular structures, a new class of efficient TADF-based OLEDs with emitting layer formed by blending electron donor and acceptor molecules that involve intermolecular charge transfer have also been fabricated. In contrast to pure TADF materials, the exciplex-based systems can realize small ΔEST (0-0.05 eV) much more easily since the electron and hole are positioned on two different molecules, thereby giving small exchange energy. Consequently, exciplex-based OLEDs have the prospective to maximize the TADF contribution and achieve theoretical 100% internal quantum efficiency. Therefore, the challenging issue of achieving small ΔEST in organic systems could be solved. In this article, we summarize and discuss the latest and most significant developments regarding these rapidly evolving functional materials, wherein the majority of the reported exciplex forming systems are categorized into two sub-groups, viz. (a) exciplex as TADF emitters and (b) those as hosts for fluorescent, phosphorescent and TADF dopants according to their structural features and applications. The working mechanisms of the direct electroluminescence from the donor/acceptor interface and the exciplex-forming systems as co-host for the realization of high efficiency OLEDs are reviewed and discussed. This article delivers a summary of the current progresses and achievements of exciplex-based researches and points out the future challenges to trigger more research endeavors to this growing field.
Powers, Jennifer L.; Rippe, Karen Duda; Imarhia, Kelly; Swift, Aileen; Scholten, Melanie; Islam, Naina
2012-01-01
ELISA (enzyme-linked immunosorbent assay) is a widely used technique with applications in disease diagnosis, detection of contaminated foods, and screening for drugs of abuse or environmental contaminants. However, published protocols with a focus on quantitative detection of small molecules designed for teaching laboratories are limited. A…
Directory of Open Access Journals (Sweden)
Konstantin V. Kudryavtsev
2014-01-01
Full Text Available This study was designed to determine novel small-molecule agents influencing the pathogenesis of gastric lesions induced by stress. To achieve this goal, four novel organic compounds containing structural fragments with known antioxidant activity were synthesized, characterized by physicochemical methods, and evaluated in vivo at water immersion restraint conditions. The levels of lipid peroxidation products and activities of antioxidative system enzymes were measured in gastric mucosa and correlated with the observed gastroprotective activity of the active compounds. Prophylactic single-dose 1 mg/kg treatment with (2-hydroxyphenylthioacetyl derivatives of L-lysine and L-proline efficiently decreases up to 86% stress-induced stomach ulceration in rats. Discovered small-molecule antiulcer agents modulate activities of gastric mucosa tissue superoxide dismutase, catalase, and xanthine oxidase in concerted directions. Gastroprotective effect of (2-hydroxyphenylthioacetyl derivatives of L-lysine and L-proline at least partially depends on the correction of gastric mucosa oxidative balance.
Lewallen, Daniel M; Sreelatha, Anju; Dharmarajan, Venkatasubramanian; Madoux, Franck; Chase, Peter; Griffin, Patrick R; Orth, Kim; Hodder, Peter; Thompson, Paul R
2014-02-21
Enzymatic transfer of the AMP portion of ATP to substrate proteins has recently been described as an essential mechanism of bacterial infection for several pathogens. The first AMPylator to be discovered, VopS from Vibrio parahemolyticus, catalyzes the transfer of AMP onto the host GTPases Cdc42 and Rac1. Modification of these proteins disrupts downstream signaling events, contributing to cell rounding and apoptosis, and recent studies have suggested that blocking AMPylation may be an effective route to stop infection. To date, however, no small molecule inhibitors have been discovered for any of the AMPylators. Therefore, we developed a fluorescence-polarization-based high-throughput screening assay and used it to discover the first inhibitors of protein AMPylation. Herein we report the discovery of the first small molecule VopS inhibitors (e.g., calmidazolium, GW7647, and MK886) with Ki's ranging from 6 to 50 μM and upward of 30-fold selectivity versus HYPE, the only known human AMPylator.
Small Talk: Children's Everyday `Molecule' Ideas
Jakab, Cheryl
2013-08-01
This paper reports on 6-11-year-old children's `sayings and doings' (Harré 2002) as they explore molecule artefacts in dialectical-interactive teaching interviews (Fleer, Cultural Studies of Science Education 3:781-786, 2008; Hedegaard et al. 2008). This sociocultural study was designed to explore children's everyday awareness of and meaning-making with cultural molecular artefacts. Our everyday world is populated with an ever increasing range of molecular or nanoworld words, symbols, images, and games. What do children today say about these artefacts that are used to represent molecular world entities? What are the material and social resources that can influence a child's everyday and developing scientific ideas about `molecules'? How do children interact with these cognitive tools when given expert assistance? What meaning-making is afforded when children are socially and materially assisted in using molecular tools in early chemical and nanoworld thinking? Tool-dependent discursive studies show that provision of cultural artefacts can assist and direct developmental thinking across many domains of science (Schoultz et al., Human Development 44:103-118, 2001; Siegal 2008). Young children's use of molecular artefacts as cognitive tools has not received much attention to date (Jakab 2009a, b). This study shows 6-11-year-old children expressing everyday ideas of molecular artefacts and raising their own questions about the artefacts. They are seen beginning to domesticate (Erneling 2010) the words, symbols, and images to their own purposes when given the opportunity to interact with such artefacts in supported activity. Discursive analysis supports the notion that using `molecules' as cultural tools can help young children to begin `putting on molecular spectacles' (Kind 2004). Playing with an interactive game (ICT) is shown to be particularly helpful in assisting children's early meaning-making with representations of molecules, atoms, and their chemical symbols.
Charge transport in single photochromic molecular junctions
Kim, Youngsang; Pietsch, T.; Scheer, Elke; Hellmuth, T.; Pauly, F.; Sysoiev, D.; Huhn, T.; Exner, T.; Groth, U.; Steiner, U.; Erbe, A.
2012-02-01
Recently, photoswitchable molecules, i.e. diarylethene, gained significant interest due to their applicability in data storage media, as optical switches, and in novel logic circuits [1]. Diarylethene-derivative molecules are the most promising candidates to design electronic functional elements, because of their excellent thermal stability, high fatigue resistance, and negligible change upon switching [1]. Here, we present the preferential conductance of specifically designed sulfur-free diarylethene molecules [2] bridging the mechanically controlled break-junctions at low temperatures [3]. The molecular energy levels and electrode couplings are obtained by evaluating the current-voltage characteristics using the single-level model [4]. The charge transport mechanism of different types of diarylethene molecules is investigated, and the results are discussed within the framework of novel theoretical predictions. [4pt] [1] M. Del Valle etal., Nat Nanotechnol 2, 176 (2007) S. J. van der Molen etal., Nano. Lett. 9, 76 (2009).[0pt] [2] D. Sysoiev etal., Chem. Eur. J. 17, 6663 (2011).[0pt] [3] Y. Kim etal., Phys. Rev. Lett. 106, 196804 (2011).[0pt] [4] Y. Kim etal., Nano Lett. 11, 3734 (2011). L. Zotti etal., Small 6, 1529 (2010).
Small-molecule inhibitors of sodium iodide sym-porter function
International Nuclear Information System (INIS)
Lecat-Guillet, N.; Merer, G.; Lopez, R.; Rousseau, B.; Ambroise, Y.; Pourcher, T.
2008-01-01
The Na + /l - sym-porter (NIS) mediates iodide uptake into thyroid follicular cells. Although NIS has been cloned and thoroughly studied at the molecular level, the biochemical processes involved in post-translational regulation of NIS are still unknown. The purpose of this study was to identify and characterize inhibitors of NIS function. These small organic molecules represent a starting point in the identification of pharmacological tools for the characterization of NIS trafficking and activation mechanisms. screening of a collection of 17020 drug-like compounds revealed new chemical inhibitors with potencies down to 40 nM. Fluorescence measurement of membrane potential indicates that these inhibitors do not act by disrupting the sodium gradient. They allow immediate and total iodide discharge from preloaded cells in accord with a specific modification of NIS activity, probably through distinct mechanisms. (authors)
Small-molecule inhibitors of sodium iodide sym-porter function
Energy Technology Data Exchange (ETDEWEB)
Lecat-Guillet, N.; Merer, G.; Lopez, R.; Rousseau, B.; Ambroise, Y. [CEA, DSV, Dept Bioorgan Chem et Isotop Labelling, Inst Biol et Biotechnol iBiTecS, F-91191 Gif Sur Yvette (France); Pourcher, T. [Univ Nice Sophia Antipolis, Dept Biochem et Nucl Toxicol, F-06107 Nice (France)
2008-07-01
The Na{sup +}/l{sup -} sym-porter (NIS) mediates iodide uptake into thyroid follicular cells. Although NIS has been cloned and thoroughly studied at the molecular level, the biochemical processes involved in post-translational regulation of NIS are still unknown. The purpose of this study was to identify and characterize inhibitors of NIS function. These small organic molecules represent a starting point in the identification of pharmacological tools for the characterization of NIS trafficking and activation mechanisms. screening of a collection of 17020 drug-like compounds revealed new chemical inhibitors with potencies down to 40 nM. Fluorescence measurement of membrane potential indicates that these inhibitors do not act by disrupting the sodium gradient. They allow immediate and total iodide discharge from preloaded cells in accord with a specific modification of NIS activity, probably through distinct mechanisms. (authors)
Chou, Kang Wei; Khan, Hadayat Ullah; Niazi, Muhammad Rizwan; Yan, Buyi; Li, Ruipeng; Payne, Marcia M.; Anthony, John Edward; Smilgies, Detlef Matthias; Amassian, Aram
2014-01-01
Spin-coating is currently the most widely used solution processing method in organic electronics. Here, we report, for the first time, a direct investigation of the formation process of the small-molecule organic semiconductor (OSC) 6,13-bis
He, Chao; He, Yaowu; Li, Aiyuan; Zhang, Dongwei; Meng, Hong
2016-10-01
Solution processed small molecule polycrystalline thin films often suffer from the problems of inhomogeneity and discontinuity. Here, we describe a strategy to solve these problems through deposition of the active layer from a blended solution of crystalline (2-phenyl[1]benzothieno[3,2-b][1]benzothiophene, Ph-BTBT) and liquid crystalline (2-(4-dodecylphenyl) [1]benzothieno[3,2-b]benzothiophene, C12-Ph-BTBT) small molecule semiconductors with the hot spin-coating method. Organic thin film transistors with average hole mobility approaching 1 cm2/V s, much higher than that of single component devices, have been demonstrated, mainly due to the improved uniformity, continuity, crystallinity, and stronger intermolecular π-π stacking in blend thin films. Our results indicate that the crystalline/liquid crystalline semiconductor blend method is an effective way to enhance the performance of organic transistors.
Cacace, Angela; Banks, Martyn; Spicer, Timothy; Civoli, Francesca; Watson, John
2003-09-01
G-protein-coupled receptors (GPCRs) are the most successful target proteins for drug discovery research to date. More than 150 orphan GPCRs of potential therapeutic interest have been identified for which no activating ligands or biological functions are known. One of the greatest challenges in the pharmaceutical industry is to link these orphan GPCRs with human diseases. Highly automated parallel approaches that integrate ultra-high throughput and focused screening can be used to identify small molecule modulators of orphan GPCRs. These small molecules can then be employed as pharmacological tools to explore the function of orphan receptors in models of human disease. In this review, we describe methods that utilize powerful ultra-high-throughput screening technologies to identify surrogate ligands of orphan GPCRs.
Peters, Katharina; Raupp, Sebastian; Hummel, Helga; Bruns, Michael; Scharfer, Philip; Schabel, Wilhelm
2016-06-01
Slot die coaters especially designed for low material consumption and doctor blades were used to process small molecule solutions for organic light-emitting diodes (OLEDs). Optimum process parameters were developed for the large-scale coating techniques to generate stable single and multiple layers only a few nanometers thick. Achieving a multilayer architecture for solution-processed OLEDs is the most challenging step. X-ray photoelectron spectroscopy sputter depth profiling was performed to determine defined interfaces between coated organic layers. Commercially available small molecules NPB (N,N'-Di(1-naphthyl)-N,N'-diphenyl-(1,1'-biphenyl)-4,4'-diamine) and BAlq (Bis(8-hdroxy-2methylquinoline)-(4-phenylphenoxy)aluminum), originally developed for vacuum deposition, were used as hole, respectively electron transport material. Defined double-layers were processed with both scalable coating methods using the orthogonal solvent approach. The use of non-orthogonal solvents resulted in complete intermixing of the material. The results are explained by calculations of solubilities and simulating drying and diffusion kinetics of the small molecule solutions.
Excitation of atoms and molecules in collisions with highly charged ions
International Nuclear Information System (INIS)
Watson, R.L.
1993-01-01
A study of the double ionization of He by high-energy N 7+ ions was extended up in energy to 40 MeV/amu. Coincidence time-of-flight studies of multicharged N 2 , O 2 , and CO molecular ions produced in collisions with 97-MeV Ar 14+ ions were completed. Analysis of the total kinetic energy distributions and comparison with the available data for CO 2+ and CO 3+ from synchrotron radiation experiments led to the conclusion that ionization by Ar-ion impact populates states having considerably higher excitation energies than those accessed by photoionization. The dissociation fractions for CO 1+ and CO 2+ molecular ions, and the branching ratios for the most prominent charge division channels of CO 2+ through CO 7+ were determined from time-of-flight singles and coincidence data. An experiment designed to investigate the orientation dependence of dissociative multielectron ionization of molecules by heavy ion impact was completed. Measurements of the cross sections for K-shell ionization of intermediate-Z elements by 30-MeV/amu H, N, Ne, and Ar ions were completed. The cross sections were determined for solid targets of Z = 13, 22, 26, 29, 32, 40, 42, 46, and 50 by recording the spectra of K x rays with a Si(Li) spectrometer
Tikhmyanova, Nadezhda; Schultz, David C.; Lee, Theresa; Salvino, Joseph M.; Lieberman, Paul M.
2014-01-01
Epstein-Barr Virus (EBV) persists as a latent infection in many lymphoid and epithelial malignancies, including Burkitt's lymphomas, nasopharyngeal carcinomas, and gastric carcinomas. Current chemotherapeutic treatments of EBV-positive cancers include broad- spectrum cytotoxic drugs that ignore the EBV-positive status of tumors. An alternative strategy, referred to as oncolytic therapy, utilizes drugs that stimulate reactivation of latent EBV to enhance the selective killing of EBV positive tumors, especially in combination with existing inhibitors of herpesvirus lytic replication, like Ganciclovir (GCV). At present, no small molecule, including histone deacetylase (HDAC) inhibitors, have proven safe or effective in clinical trials for treatment of EBV positive cancers. Aiming to identify new chemical entities that induce EBV lytic cycle, we have developed a robust high throughput cell-based assay to screen 66,840 small molecule compounds. Five structurally related tetrahydrocarboline derivatives were identified, two of which had EC50 measurements in the range of 150-170 nM. We show that these compounds reactivate EBV lytic markers ZTA and EA-D in all EBV-positive cell lines we have tested independent of the type of latency. The compounds reactivate a higher percentage of latently infected cells than HDAC inhibitors or phorbol esters in many cell types. The most active compounds showed low toxicity to EBV-negative cells, but were highly effective at selective cell killing of EBV-positive cells when combined with GCV. We conclude that we have identified a class of small molecule compounds that are highly effective at reactivating latent EBV infection in a variety of cell types, and show promise for lytic therapy in combination with GCV. PMID:24028149
A Reaction Database for Small Molecule Pharmaceutical Processes Integrated with Process Information
DEFF Research Database (Denmark)
Papadakis, Emmanouil; Anantpinijwatna, Amata; Woodley, John
2017-01-01
This article describes the development of a reaction database with the objective to collect data for multiphase reactions involved in small molecule pharmaceutical processes with a search engine to retrieve necessary data in investigations of reaction-separation schemes, such as the role of organic......; compounds participating in the reaction; use of organic solvents and their function; information for single step and multistep reactions; target products; reaction conditions and reaction data. Information for reactor scale-up together with information for the separation and other relevant information...
Charge transfer through single molecule contacts: How reliable are rate descriptions?
Directory of Open Access Journals (Sweden)
Denis Kast
2011-08-01
Full Text Available Background: The trend for the fabrication of electrical circuits with nanoscale dimensions has led to impressive progress in the field of molecular electronics in the last decade. However, a theoretical description of molecular contacts as the building blocks of future devices is challenging, as it has to combine the properties of Fermi liquids in the leads with charge and phonon degrees of freedom on the molecule. Outside of ab initio schemes for specific set-ups, generic models reveal the characteristics of transport processes. Particularly appealing are descriptions based on transfer rates successfully used in other contexts such as mesoscopic physics and intramolecular electron transfer. However, a detailed analysis of this scheme in comparison with numerically exact solutions is still elusive.Results: We show that a formulation in terms of transfer rates provides a quantitatively accurate description even in domains of parameter space where strictly it is expected to fail, e.g., at lower temperatures. Typically, intramolecular phonons are distributed according to a voltage driven steady state that can only roughly be captured by a thermal distribution with an effective elevated temperature (heating. An extension of a master equation for the charge–phonon complex, to effectively include the impact of off-diagonal elements of the reduced density matrix, provides very accurate solutions even for stronger electron–phonon coupling.Conclusion: Rate descriptions and master equations offer a versatile model to describe and understand charge transfer processes through molecular junctions. Such methods are computationally orders of magnitude less expensive than elaborate numerical simulations that, however, provide exact solutions as benchmarks. Adjustable parameters obtained, e.g., from ab initio calculations allow for the treatment of various realizations. Even though not as rigorously formulated as, e.g., nonequilibrium Green’s function
International Nuclear Information System (INIS)
Safarian, Diana; Carnec, Xavier; Tsamis, Fotini; Kajumo, Francis; Dragic, Tatjana
2006-01-01
HIV-1 coreceptors are attractive targets for novel antivirals. Here, inhibition of entry by two classes of CCR5 antagonists was investigated. We confirmed previous findings that HIV-1 isolates vary greatly in their sensitivity to small molecule inhibitors of CCR5-mediated entry, SCH-C and TAK-779. In contrast, an anti-CCR5 monoclonal antibody (PA14) similarly inhibited entry of diverse viral isolates. Sensitivity to small molecules was V3 loop-dependent and inversely proportional to the level of gp120 binding to CCR5. Moreover, combinations of the MAb and small molecules were highly synergistic in blocking HIV-1 entry, suggesting different mechanisms of action. This was confirmed by time course of inhibition experiments wherein the PA14 MAb and small molecules were shown to inhibit temporally distinct stages of CCR5 usage. We propose that small molecules inhibit V3 binding to the second extracellular loop of CCR5, whereas PA14 preferentially inhibits subsequent events such as CCR5 recruitment into the fusion complex or conformational changes in the gp120-CCR5 complex that trigger fusion. Importantly, our findings suggest that combinations of CCR5 inhibitors with different mechanisms of action will be central to controlling HIV-1 infection and slowing the emergence of resistant strains
DEFF Research Database (Denmark)
Nazmutdinov, Renat R.; Zinkicheva, Tamara T.; Zinkicheva, Tamara T.
2018-01-01
Electrochemistry at ultra-small scales, where even the single molecule or biomolecule can be characterized and manipulated, is on the way to a consolidated status. At the same time molecular electrochemistry is expanding into other areas of sophisticated nano- and molecular scale systems includin...... molecular scale metal and semiconductor nanoparticles (NPs) and other nanostructures, e.g. nanotubes, “nanoflowers” etc.. The new structures offer both new electronic properties and highly confined novel charge transfer environments....
Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua
2018-04-01
Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H] - ) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. Graphical Abstract ᅟ.
Raman and fluorescent scattering by molecules embedded in small particles
International Nuclear Information System (INIS)
Chew, H.W.; McNulty, P.J.
1983-01-01
We have formulated a model for fluorescent and Raman scattering by molecules embedded in or in the vicinity of small particles. The model takes into account the size, shape, refractive index, and morphology of the host particles. Analytic and numerical results have been obtained for spherical (one and more layers, including magnetic dipole transitions) cylindrical and spheroidal particles. Particular attention has been given to the spherical case with fluorescent/Raman scatterers uniformly distributed in the particles radiating both coherently and incohorently. Depolarization effects have been studied with suitable averaging process, and good agreement with experiment has been obtained. Analytic and numerical results have been obtained for the elastic scattering of evanescent waves; these results are useful for the study of fluorescent under excitation by evanescent waves
Small Molecules for Early Endosome-Specific Patch Clamping.
Chen, Cheng-Chang; Butz, Elisabeth S; Chao, Yu-Kai; Grishchuk, Yulia; Becker, Lars; Heller, Stefan; Slaugenhaupt, Susan A; Biel, Martin; Wahl-Schott, Christian; Grimm, Christian
2017-07-20
To resolve the subcellular distribution of endolysosomal ion channels, we have established a novel experimental approach to selectively patch clamp Rab5 positive early endosomes (EE) versus Rab7/LAMP1-positive late endosomes/lysosomes (LE/LY). To functionally characterize ion channels in endolysosomal membranes with the patch-clamp technique, it is important to develop techniques to selectively enlarge the respective organelles. We found here that two small molecules, wortmannin and latrunculin B, enlarge Rab5-positive EE when combined but not Rab7-, LAMP1-, or Rab11 (RE)-positive vesicles. The two compounds act rapidly, specifically, and are readily applicable in contrast to genetic approaches or previously used compounds such as vacuolin, which enlarges EE, RE, and LE/LY. We apply this approach here to measure currents mediated by TRPML channels, in particular TRPML3, which we found to be functionally active in both EE and LE/LY in overexpressing cells as well as in endogenously expressing CD11b+ lung-tissue macrophages. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hydrogen bonding characterization in water and small molecules
Silvestrelli, Pier Luigi
2017-06-01
The prototypical hydrogen bond in water dimer and hydrogen bonds in the protonated water dimer, in other small molecules, in water cyclic clusters, and in ice, covering a wide range of bond strengths, are theoretically investigated by first-principles calculations based on density functional theory, considering not only a standard generalized gradient approximation functional but also, for the water dimer, hybrid and van der Waals corrected functionals. We compute structural, energetic, and electrostatic (induced molecular dipole moments) properties. In particular, hydrogen bonds are characterized in terms of differential electron density distributions and profiles, and of the shifts of the centres of maximally localized Wannier functions. The information from the latter quantities can be conveyed to a single geometric bonding parameter that appears to be correlated with the Mayer bond order parameter and can be taken as an estimate of the covalent contribution to the hydrogen bond. By considering the water trimer, the cyclic water hexamer, and the hexagonal phase of ice, we also elucidate the importance of cooperative/anticooperative effects in hydrogen-bonding formation.
Bispecific small molecule-antibody conjugate targeting prostate cancer.
Kim, Chan Hyuk; Axup, Jun Y; Lawson, Brian R; Yun, Hwayoung; Tardif, Virginie; Choi, Sei Hyun; Zhou, Quan; Dubrovska, Anna; Biroc, Sandra L; Marsden, Robin; Pinstaff, Jason; Smider, Vaughn V; Schultz, Peter G
2013-10-29
Bispecific antibodies, which simultaneously target CD3 on T cells and tumor-associated antigens to recruit cytotoxic T cells to cancer cells, are a promising new approach to the treatment of hormone-refractory prostate cancer. Here we report a site-specific, semisynthetic method for the production of bispecific antibody-like therapeutics in which a derivative of the prostate-specific membrane antigen-binding small molecule DUPA was selectively conjugated to a mutant αCD3 Fab containing the unnatural amino acid, p-acetylphenylalanine, at a defined site. Homogeneous conjugates were generated in excellent yields and had good solubility. The efficacy of the conjugate was optimized by modifying the linker structure, relative binding orientation, and stoichiometry of the ligand. The optimized conjugate showed potent and selective in vitro activity (EC50 ~ 100 pM), good serum half-life, and potent in vivo activity in prophylactic and treatment xenograft mouse models. This semisynthetic approach is likely to be applicable to the generation of additional bispecific agents using drug-like ligands selective for other cell-surface receptors.
Multiple ionization dynamics of molecules in intense laser fields
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2005-01-01
A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)
Directory of Open Access Journals (Sweden)
Ramasamy Ganesamoorthy
2018-03-01
Full Text Available We report a series of bay substituted perylene diimide based donor-acceptor-donor (D-A-D type small molecule acceptor derivatives such as S-I, S-II, S-III and S-IV for small molecule based organic solar cell (SM-OSC applications. The electron rich thiophene derivatives such as thiophene, 2-hexylthiophene, 2,2′-bithiophene, and 5-hexyl-2,2′-bithiophene were used as a donor (D, and perylene diimide was used as an acceptor (A. The synthesized small molecules were confirmed by FT-IR, NMR, and HR-MS. The small molecules showed wide and strong absorption in the UV-vis region up to 750 nm, which reduced the optical band gap to <2 eV. The calculated highest occupied molecular orbital (HOMO and the lowest unoccupied molecular orbital (LUMO were comparable with those of the PC61BM. Scanning electron microscope (SEM studies confirmed the aggregation of the small molecules, S-I to S-IV. Small molecules showed thermal stability up to 300 °C. In bulk heterojunction organic solar cells (BHJ-OSCs, the S-I based device showed a maximum power conversion efficiency (PCE of 0.12% with P3HT polymer donor. The PCE was declined with respect to the number of thiophene units and the flexible alkyl chain in the bay position. Keywords: Perylene diimide, Donor–acceptor, Small molecule, Non-fullerene, Suzuki coupling
A mapping of drug space from the viewpoint of small molecule metabolism.
Directory of Open Access Journals (Sweden)
James Corey Adams
2009-08-01
Full Text Available Small molecule drugs target many core metabolic enzymes in humans and pathogens, often mimicking endogenous ligands. The effects may be therapeutic or toxic, but are frequently unexpected. A large-scale mapping of the intersection between drugs and metabolism is needed to better guide drug discovery. To map the intersection between drugs and metabolism, we have grouped drugs and metabolites by their associated targets and enzymes using ligand-based set signatures created to quantify their degree of similarity in chemical space. The results reveal the chemical space that has been explored for metabolic targets, where successful drugs have been found, and what novel territory remains. To aid other researchers in their drug discovery efforts, we have created an online resource of interactive maps linking drugs to metabolism. These maps predict the "effect space" comprising likely target enzymes for each of the 246 MDDR drug classes in humans. The online resource also provides species-specific interactive drug-metabolism maps for each of the 385 model organisms and pathogens in the BioCyc database collection. Chemical similarity links between drugs and metabolites predict potential toxicity, suggest routes of metabolism, and reveal drug polypharmacology. The metabolic maps enable interactive navigation of the vast biological data on potential metabolic drug targets and the drug chemistry currently available to prosecute those targets. Thus, this work provides a large-scale approach to ligand-based prediction of drug action in small molecule metabolism.
A mapping of drug space from the viewpoint of small molecule metabolism.
Adams, James Corey; Keiser, Michael J; Basuino, Li; Chambers, Henry F; Lee, Deok-Sun; Wiest, Olaf G; Babbitt, Patricia C
2009-08-01
Small molecule drugs target many core metabolic enzymes in humans and pathogens, often mimicking endogenous ligands. The effects may be therapeutic or toxic, but are frequently unexpected. A large-scale mapping of the intersection between drugs and metabolism is needed to better guide drug discovery. To map the intersection between drugs and metabolism, we have grouped drugs and metabolites by their associated targets and enzymes using ligand-based set signatures created to quantify their degree of similarity in chemical space. The results reveal the chemical space that has been explored for metabolic targets, where successful drugs have been found, and what novel territory remains. To aid other researchers in their drug discovery efforts, we have created an online resource of interactive maps linking drugs to metabolism. These maps predict the "effect space" comprising likely target enzymes for each of the 246 MDDR drug classes in humans. The online resource also provides species-specific interactive drug-metabolism maps for each of the 385 model organisms and pathogens in the BioCyc database collection. Chemical similarity links between drugs and metabolites predict potential toxicity, suggest routes of metabolism, and reveal drug polypharmacology. The metabolic maps enable interactive navigation of the vast biological data on potential metabolic drug targets and the drug chemistry currently available to prosecute those targets. Thus, this work provides a large-scale approach to ligand-based prediction of drug action in small molecule metabolism.
Tian, Ye; Zhang, Dujuan; Zhan, Peng; Liu, Xinyong
2014-01-01
CCR5, a member of G protein-coupled receptors superfamily, plays an important role in the HIV-1 entry process. Antagonism of this receptor finally leads to the inhibition of R5 strains of HIV entry into the human cells. The identification of CCR5 antagonists as antiviral agents will provide more option for HAART. Now, more than a decade after the first small molecule CCR5 inhibitor was discovered, great achievements have been made. In this article, we will give a brief introduction of several series of small molecule CCR5 antagonists, focused on their appealing structure evolution, essential SAR information and thereof the enlightenment of strategies on CCR5 inhibitors design.
Lagorce, David; Pencheva, Tania; Villoutreix, Bruno O; Miteva, Maria A
2009-11-13
Discovery of new bioactive molecules that could enter drug discovery programs or that could serve as chemical probes is a very complex and costly endeavor. Structure-based and ligand-based in silico screening approaches are nowadays extensively used to complement experimental screening approaches in order to increase the effectiveness of the process and facilitating the screening of thousands or millions of small molecules against a biomolecular target. Both in silico screening methods require as input a suitable chemical compound collection and most often the 3D structure of the small molecules has to be generated since compounds are usually delivered in 1D SMILES, CANSMILES or in 2D SDF formats. Here, we describe the new open source program DG-AMMOS which allows the generation of the 3D conformation of small molecules using Distance Geometry and their energy minimization via Automated Molecular Mechanics Optimization. The program is validated on the Astex dataset, the ChemBridge Diversity database and on a number of small molecules with known crystal structures extracted from the Cambridge Structural Database. A comparison with the free program Balloon and the well-known commercial program Omega generating the 3D of small molecules is carried out. The results show that the new free program DG-AMMOS is a very efficient 3D structure generator engine. DG-AMMOS provides fast, automated and reliable access to the generation of 3D conformation of small molecules and facilitates the preparation of a compound collection prior to high-throughput virtual screening computations. The validation of DG-AMMOS on several different datasets proves that generated structures are generally of equal quality or sometimes better than structures obtained by other tested methods.
Directory of Open Access Journals (Sweden)
Adnan Rafi Al Tahtawi
2016-12-01
Full Text Available Supercapacitor is one of electrical energy sources that have faster charging-discharging times when compared to other power sources, such as battery and fuel cell. Therefore, it is often used as an additional power source in an electric vehicle. In this paper, a prototype of small-scale electric vehicle simulator (EVS is built and a simple charging scheme of supercapacitor is used for education purpose. EVS is an electric vehicle prototype which can show the vehicle’s powertrain on small-scale configuration. Main components of this device are two direct current motors (DCMs with a linked axis of rotation. Therefore one of them will be able to act as a generator. The supercapacitor charging scheme is employed by controlling the relays. The hardware experimental result shows that the averages of charging current are proportional to the maximum slope angle of the road profiles. This scheme is simple due to the EVS utility and it is useful for education purpose.