SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

Science.gov (United States)

Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

2013-01-01

Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Brain-specific inactivation of the Crhr1 gene inhibits post-dependent and stress-induced alcohol intake, but does not affect relapse-like drinking

DEFF Research Database (Denmark)

Molander, Anna; Vengeliene, Valentina; Heilig, Markus

2012-01-01

, a conditional brain-specific Crhr1-knockout (Crhr1(NestinCre)) and a global knockout mouse line were studied for basal alcohol drinking, stress-induced alcohol consumption, deprivation-induced intake, and escalated alcohol consumption in the post-dependent state. In a second set of experiments, we tested CRHR1...... not affect relapse-like drinking after a deprivation period in rats. We conclude that CRH/CRHR1 extra-HPA and HPA signaling may have opposing effects on stress-related alcohol consumption. CRHR1 does not have a role in basal alcohol intake or relapse-like drinking situations with a low stress load.......Corticotropin-releasing hormone (CRH) and its receptor, CRH receptor-1 (CRHR1), have a key role in alcoholism. Especially, post-dependent and stress-induced alcohol intake involve CRH/CRHR1 signaling within extra-hypothalamic structures, but a contribution of the hypothalamic-pituitary-adrenal (HPA...

Identification of CREB3L1 as a Biomarker Predicting Doxorubicin Treatment Outcome.

Directory of Open Access Journals (Sweden)

Bray Denard

Full Text Available Doxorubicin has been shown to inhibit proliferation of cancer cells through proteolytic activation of CREB3L1 (cAMP response element binding protein 3-like 1, a transcription factor synthesized as a membrane-bound precursor. Upon doxorubicin treatment, CREB3L1 is cleaved so that the N-terminal domain of the protein can reach the nucleus where it activates transcription of genes that inhibit cell proliferation. These results suggest that the level of CREB3L1 in cancer cells may determine their sensitivity to doxorubicin.Mice transplanted with 6 lines of renal cell carcinoma (RCC were injected with doxorubicin to observe the effect of the chemotherapy on tumor growth. Immunohistochemistry and bioinformatics analyses were performed to compare CREB3L1 levels in types of cancer known to respond to doxorubicin versus those resistant to doxorubicin.Higher levels of CREB3L1 protein are correlated with increased doxorubicin sensitivity of xenograft RCC tumors (p = 0.017 by Pearson analysis. From patient tumor biopsies we analyzed, CREB3L1 was expressed in 19% of RCC, which is generally resistant to doxorubicin, but in 70% of diffuse large B-cell lymphoma that is sensitive to doxorubicin. Doxorubicin is used as the standard treatment for cancers that express the highest levels of CREB3L1 such as osteosarcoma and malignant fibrous histiocytoma but is not generally used to treat those that express the lowest levels of CREB3L1 such as RCC.Identification of CREB3L1 as the biomarker for doxorubicin sensitivity may markedly improve the doxorubicin response rate by applying doxorubicin only to patients with cancers expressing CREB3L1.

Identification of sumoylation sites in CCDC6, the first identified RET partner gene in papillary thyroid carcinoma, uncovers a mode of regulating CCDC6 function on CREB1 transcriptional activity.

Directory of Open Access Journals (Sweden)

Chiara Luise

Full Text Available CCDC6 was originally identified in chimeric genes as caused by chromosomal translocation involving the RET protooncogene in some thyroid tumors. Recognised as a 65 kDa pro-apoptotic phosphoprotein, CCDC6 has been enrolled as an ATM substrate that contribute to protect genome integrity by modulating PP4c activity in response to genotoxic stress. Recently, CCDC6 has been identified as a repressor of CREB1-dependent transcription. Sumoylation has emerged as an important mechanism in transcriptional control. Here, we report the identification and characterization of three sites of sumoylation in CCDC6 (K74, K266 and K424 which are highly conserved in vertebrates. We demonstrate that the post-translational modifications by SUMO2 constrain most of the CCDC6 protein in the cytosol and affect its functional interaction with CREB1 with a decrease of CCDC6 repressive function on CREB1 transcriptional activity. Indeed, the impairment of functional outcome of sumoylated CCDC6 is obtained knocking down all three the sumoylation sites. Interestingly, in thyroid cells the SUMO2-mediated CCDC6 post-translational modifications are induced by Forskolin, a cAMP analog. Signal transduction via the cAMP pathway is known to be ubiquitous and represents a major line of communication between many organisms and their environment. We believe that CCDC6 could be an important player in the dynamics of cAMP signaling by fine regulating CREB1 transcriptional activity in normal and transformed thyroid cells.

A CREB-Sirt1-Hes1 Circuitry Mediates Neural Stem Cell Response to Glucose Availability

Directory of Open Access Journals (Sweden)

Salvatore Fusco

2016-02-01

Full Text Available Summary: Adult neurogenesis plays increasingly recognized roles in brain homeostasis and repair and is profoundly affected by energy balance and nutrients. We found that the expression of Hes-1 (hairy and enhancer of split 1 is modulated in neural stem and progenitor cells (NSCs by extracellular glucose through the coordinated action of CREB (cyclic AMP responsive element binding protein and Sirt-1 (Sirtuin 1, two cellular nutrient sensors. Excess glucose reduced CREB-activated Hes-1 expression and results in impaired cell proliferation. CREB-deficient NSCs expanded poorly in vitro and did not respond to glucose availability. Elevated glucose also promoted Sirt-1-dependent repression of the Hes-1 promoter. Conversely, in low glucose, CREB replaced Sirt-1 on the chromatin associated with the Hes-1 promoter enhancing Hes-1 expression and cell proliferation. Thus, the glucose-regulated antagonism between CREB and Sirt-1 for Hes-1 transcription participates in the metabolic regulation of neurogenesis. : Using a combination of in vitro and in vivo studies, Fusco et al. find that excess glucose impairs the self-renewal capacity of neural stem cells through a molecular circuit that involves the transcription factor CREB and Sirtuin 1. The authors suggest that this circuitry may link nutrient excess with neurodegeneration and brain aging. Keywords: neural stem cells, adult neurogenesis, CREB, Sirt-1, nutrients, metabolism, diabetes

Interaction between CRHR1 and BDNF genes increases the risk of recurrent major depressive disorder in Chinese population.

Directory of Open Access Journals (Sweden)

Zheman Xiao

Full Text Available BACKGROUND: An important etiological hypothesis about depression is stress has neurotoxic effects that damage the hippocampal cells. Corticotropin-releasing hormone (CRH regulates brain-derived neurotrophic factor (BDNF expression through influencing cAMP and Ca2+ signaling pathways during the course. The aim of this study is to examine the single and combined effects of CRH receptor 1 (CRHR1 and BDNF genes in recurrent major depressive disorder (MDD. METHODOLOGY/PRINCIPAL FINDING: The sample consists of 181 patients with recurrent MDD and 186 healthy controls. Whether genetic variations interaction between CRHR1 and BDNF genes might be associated with increased susceptibility to recurrent MDD was studied by using a gene-based association analysis of single-nucleotide polymorphisms (SNPs. CRHR1 gene (rs1876828, rs242939 and rs242941 and BDNF gene (rs6265 were identified in the samples of patients diagnosed with recurrent MDD and matched controls. Allelic association between CRHR1 rs242939 and recurrent MDD was found in our sample (allelic: p = 0.018, genotypic: p = 0.022 with an Odds Ratio 0.454 (95% CI 0.266-0.775. A global test of these four haplotypes showed a significant difference between recurrent MDD group and control group (chi-2 = 13.117, df = 3, P = 0.016. Furthermore, BDNF and CRHR1 interactions were found in the significant 2-locus, gene-gene interaction models (p = 0.05 using a generalized multifactor dimensionality reduction (GMDR method. CONCLUSION: Our results suggest that an interaction between CRHR1 and BDNF genes constitutes susceptibility to recurrent MDD.

Influence of maternal depression on children's brooding rumination: Moderation by CRHR1 TAT haplotype.

Science.gov (United States)

Woody, Mary L; Kudinova, Anastacia Y; McGeary, John E; Knopik, Valerie S; Palmer, Rohan H C; Gibb, Brandon E

2016-01-01

There is growing evidence that brooding rumination plays a key role in the intergenerational transmission of major depressive disorder (MDD) and may be an endophenotype for depression risk. However, less is known about the mechanisms underlying this role. Therefore, the goal of the current study was to examine levels of brooding in children of mothers with a history of MDD (n = 129) compared to children of never depressed mothers (n = 126) and to determine whether the variation in a gene known to influence hypothalamic-pituitary-adrenal axis functioning--corticotropin-releasing hormone receptor 1 (CRHR1)--would moderate the link between maternal MDD and children's levels of brooding. We predicted children of mothers with a history of MDD would exhibit higher levels of brooding than children of mothers with no lifetime depression history but that this link would be stronger among children carrying no copies of the protective CRHR1 TAT haplotype. Our results supported these hypotheses and suggest that the development of brooding among children of depressed mothers, particularly children without the protective CRHR1 haplotype, may serve as an important mechanism of risk for the intergenerational transmission of depression.

IGF-1 protects cardiac myocytes from hyperosmotic stress-induced apoptosis via CREB

International Nuclear Information System (INIS)

Maldonado, Carola; Cea, Paola; Adasme, Tatiana; Collao, Andres; Diaz-Araya, Guillermo; Chiong, Mario; Lavandero, Sergio

2005-01-01

Hyperosmotic stress stimulates a rapid and pronounced apoptosis in cardiac myocytes which is attenuated by insulin-like growth factor-1 (IGF-1). Because in these cells IGF-1 induces intracellular Ca 2+ increase, we assessed whether the cyclic AMP response element-binding protein (CREB) is activated by IGF-1 through Ca 2+ -dependent signalling pathways. In cultured cardiac myocytes, IGF-1 induced phosphorylation (6.5 ± 1.0-fold at 5 min), nuclear translocation (30 min post-stimulus) and DNA binding activity of CREB. IGF-1-induced CREB phosphorylation was mediated by MEK1/ERK, PI3-K, p38-MAPK, as well as Ca 2+ /calmodulin kinase and calcineurin. Exposure of cardiac myocytes to hyperosmotic stress (sorbitol 600 mOsm) decreased IGF-1-induced CREB activation Moreover, overexpression of a dominant negative CREB abolished the anti-apoptotic effects of IGF-1. Our results suggest that IGF-1 activates CREB through a complex signalling pathway, and this transcription factor plays an important role in the anti-apoptotic action of IGF-1 in cultured cardiac myocytes

Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

Science.gov (United States)

Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

2017-10-26

Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

TGF-β signaling directly regulates transcription and functional expression of the electrogenic sodium bicarbonate cotransporter 1, NBCe1 (SLC4A4), via Smad4 in mouse astrocytes.

Science.gov (United States)

Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni

2017-08-01

The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.

Investigation of SLC6A4 gene expression in autism spectrum disorders

Directory of Open Access Journals (Sweden)

Elif Funda Şener

2015-06-01

Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

Directory of Open Access Journals (Sweden)

Lindholm Carlström Eva

2012-05-01

Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

Science.gov (United States)

Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

2015-06-11

ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

Regulation of estradiol and progesterone production by CRH-R1 and -R2 is through divergent signaling pathways in cultured human placental trophoblasts.

Science.gov (United States)

Gao, Lu; Tao, Yi; Hu, Tianxiao; Liu, Weina; Xu, Chen; Liu, Jie; You, Xingji; Gu, Hang; Ni, Xin

2012-10-01

CRH and its related peptides urocortins (UCN) have been identified in placenta and implicated to play pivotal roles in the regulation of pregnancy and parturition in humans. The objectives of present study were to investigate the effects of endogenous CRH and its related peptides in the regulation of steroid production in placenta. Placental trophoblasts were isolated from term placenta tissues and cultured for 72 h. Estradiol (E(2)) and progesterone (P(4)) contents in culture media were determined by radioimmunoassay. Treatment of cultured trophoblasts with CRH or UCNI antibody showed decreased E(2), whereas increased P(4) production. Treatment of cells with CRH receptor type 1 antagonist antalarmin or CRH receptor type 2 (CRH-R2) antagonist astressin-2b also decreased E(2) but increased P(4) production. Knockdown of CRH receptor type 1 or CRH-R2 cells showed a decrease in E(2) production and an increase in P(4) production. In CRH-R2 knockdown cells, CRH stimulated GTP-bound Gαs protein and phosphorylated phospholipase C-β3. Adenylyl cyclase and protein kinase A inhibitors blocked CRH-induced increased E(2) production but not decreased P(4) production. PLC inhibitor U73122 and protein kinase C inhibitor chelerythrine blocked the effects of CRH on E(2) and P(4) production in CRH-R2 knockdown cells. UCNIII, the specific CRH-R2 agonist, stimulated GTP-bound Gαi protein and phosphorylated phospholipase C-β3 expression. Both U73122 and chelerythrine blocked UCNIII-induced increased E(2) production and decreased P(4) production. We suggest that CRH and its related peptides might be involved in changes in the progesterone to estrogen ratio during human pregnancy.

Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

Science.gov (United States)

Thurtle-Schmidt, Bryan H; Stroud, Robert M

2016-09-20

Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

Active CREB1 promotes a malignant TGFβ2 autocrine loop in glioblastoma.

Science.gov (United States)

Rodón, Laura; Gonzàlez-Juncà, Alba; Inda, María del Mar; Sala-Hojman, Ada; Martínez-Sáez, Elena; Seoane, Joan

2014-10-01

In advanced cancer, including glioblastoma, the TGFβ pathway acts as an oncogenic factor. Some tumors exhibit aberrantly high TGFβ activity, and the mechanisms underlying this phenomenon are not well understood. We have observed that TGFβ can induce TGFβ2, generating an autocrine loop leading to aberrantly high levels of TGFβ2. We identified cAMP-responsive element-binding protein 1 (CREB1) as the critical mediator of the induction of TGFβ2 by TGFβ. CREB1 binds to the TGFB2 gene promoter in cooperation with SMAD3 and is required for TGFβ to activate transcription. Moreover, the PI3K-AKT and RSK pathways regulate the TGFβ2 autocrine loop through CREB1. The levels of CREB1 and active phosphorylated CREB1 correlate with TGFβ2 in glioblastoma. In addition, using patient-derived in vivo models of glioblastoma, we found that CREB1 levels determine the expression of TGFβ2. Our results show that CREB1 can be considered a biomarker to stratify patients for anti-TGFβ treatments and a therapeutic target in glioblastoma. TGFβ is considered a promising therapeutic target, and several clinical trials using TGFβ inhibitors are generating encouraging results. Here, we discerned the molecular mechanisms responsible for the aberrantly high levels of TGFβ2 found in certain tumors, and we propose biomarkers to predict the clinical response to anti-TGFβ therapies. ©2014 American Association for Cancer Research.

SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

Directory of Open Access Journals (Sweden)

Onkar Singh

Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

Learning-dependent gene expression of CREB1 isoforms in the molluscan brain

Directory of Open Access Journals (Sweden)

Hisayo Sadamoto

2010-05-01

Full Text Available Cyclic AMP-responsive element binding protein1 (CREB1 has multiple functions in gene regulation. Various studies have reported that CREB1-dependent gene induction is necessary for memory formation and long-lasting behavioral changes in both vertebrates and invertebrates. In the present study, we characterized Lymnaea CREB1 (LymCREB1 mRNA isoforms of spliced variants in the central nervous system (CNS of the pond snail Lymnaea stagnalis. Among these spliced variants, the three isoforms that code a whole LymCREB1 protein are considered to be the activators for gene regulation. The other four isoforms, which code truncated LymCREB1 proteins with no kinase inducible domain, are the repressors. For a better understanding of the possible roles of different LymCREB1 isoforms, the expression level of these isoform mRNAs was investigated by a real-time quantitative RT-PCR method. Further, we examined the changes in gene expression for all the isoforms in the CNS after conditioned taste aversion (CTA learning or backward conditioning as a control. The results showed that CTA learning increased LymCREB1 gene expression, but it did not change the activator/repressor ratio. Our findings showed that the repressor isoforms, as well as the activator ones, are expressed in large amounts in the CNS, and the gene expression of CREB1 isoforms appeared to be specific for the given stimulus. This was the first quantitative analysis of the expression patterns of CREB1 isoforms at the mRNA level and their association with learning behavior.

A transcriptome-wide screen for mRNAs enriched in fetal Leydig cells: CRHR1 agonism stimulates rat and mouse fetal testis steroidogenesis.

Directory of Open Access Journals (Sweden)

Erin N McDowell

Full Text Available Fetal testis steroidogenesis plays an important role in the reproductive development of the male fetus. While regulators of certain aspects of steroidogenesis are known, the initial driver of steroidogenesis in the human and rodent fetal testis is unclear. Through comparative analysis of rodent fetal testis microarray datasets, 54 candidate fetal Leydig cell-specific genes were identified. Fetal mouse testis interstitial expression of a subset of these genes with unknown expression (Crhr1, Gramd1b, Itih5, Vgll3, and Vsnl1 was verified by whole-mount in situ hybridization. Among the candidate fetal Leydig cell-specific factors, three receptors (CRHR1, PRLR, and PROKR2 were tested for a steroidogenic function using ex vivo fetal testes treated with receptor agonists (CRH, PRL, and PROK2. While PRL and PROK2 had no effect, CRH, at low (approximately 1 to 10 nM concentration, increased expression of the steroidogenic genes Cyp11a1, Cyp17a1, Scarb1, and Star in GD15 mouse and GD17 rat testes, and in conjunction, testosterone production was increased. Exposure of GD15 fetal mouse testis to a specific CRHR1 antagonist blunted the CRH-induced steroidogenic gene expression and testosterone responses. Similar to ex vivo rodent fetal testes, ≥ 10 nM CRH exposure of MA-10 Leydig cells increased steroidogenic pathway mRNA and progesterone levels, showing CRH can enhance steroidogenesis by directly targeting Leydig cells. Crh mRNA expression was observed in rodent fetal hypothalamus, and CRH peptide was detected in rodent amniotic fluid. Together, these data provide a resource for discovering factors controlling fetal Leydig cell biology and suggest that CRHR1 activation by CRH stimulates rat and mouse fetal Leydig cell steroidogenesis in vivo.

Rolipram improves facilitation of contextual fear extinction in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced mouse model of Parkinson's disease

Directory of Open Access Journals (Sweden)

Ken-ichi Kinoshita

2017-05-01

Full Text Available Cognitive impairment often occurs in Parkinson's disease (PD, but the mechanism of onset remains unknown. Recently, we reported that PD model mice produced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP show facilitation of hippocampal memory extinction, which may be the cause of cognitive impairment in PD. When we examined the cAMP/CREB signaling in the hippocampus, decreased levels of cAMP and phosphorylated CREB were observed in the dentate gyrus (DG of MPTP-treated mice. Administration of rolipram improved the memory deficits with concomitant recovery of cAMP and phosphorylated CREB levels, suggesting that reduced cAMP/CREB signaling in the DG leads to cognitive impairment in MPTP-treated mice.

Corticotrophin-Releasing Hormone Type 1 Receptor Gene (CRHR1 Variants Predict Posttraumatic Stress Disorder Onset and Course in Pediatric Injury Patients

Directory of Open Access Journals (Sweden)

Ananda B. Amstadter

2011-01-01

Full Text Available Posttraumatic stress disorder (PTSD is a common and disabling anxiety disorder that may occur in the aftermath of exposure to potentially traumatic life events. PTSD is moderately heritable, but few specific molecular variants accounting for this heritability have been identified. Genes regulating the hypothalamic-pituitary-adrenal (HPA axis, such as corticotrophin-releasing hormone type 1 receptor gene (CRHR1, have been implicated in traumatic-stress related phenotypes but have yet to be studied in relation to PTSD. The present study sought to examine the relation between 9 single nucleotide polymorphisms (SNPs in the CRHR1 gene and posttraumatic stress symptoms in a prospective study of pediatric injury patients (n = 103 who were first assessed in the acute aftermath of their injury at the hospital. Results indicated that multiple SNPs were associated with acute symptoms at a univariate level, and after correction for multiple testing, rs12944712 was significantly related to acute PTSD symptoms. Longitudinal latent growth curve analyses suggest that rs12944712 is also related to both acute symptom level and trajectory of symptoms over time. The present study adds support for the role of CRHR1 in the stress response following potentially traumatic event exposure in youth. It should be noted that the sample size in this study was small, and therefore statistical power was low; following, results from this study should be considered preliminary. Although results are not definitive, the findings from this study warrant future replication studies on how variation in this gene relates to response to traumatic event exposure in youth.

Corticotrophin-releasing hormone type 1 receptor gene (CRHR1) variants predict posttraumatic stress disorder onset and course in pediatric injury patients.

Science.gov (United States)

Amstadter, Ananda B; Nugent, Nicole R; Yang, Bao-Zhu; Miller, Alisa; Siburian, Richie; Moorjani, Priya; Haddad, Stephen; Basu, Aditi; Fagerness, Jesen; Saxe, Glenn; Smoller, Jordan W; Koenen, Karestan C

2011-01-01

Posttraumatic stress disorder (PTSD) is a common and disabling anxiety disorder that may occur in the aftermath of exposure to potentially traumatic life events. PTSD is moderately heritable, but few specific molecular variants accounting for this heritability have been identified. Genes regulating the hypothalamic-pituitary-adrenal (HPA) axis, such as corticotrophin-releasing hormone type 1 receptor gene (CRHR1), have been implicated in traumatic-stress related phenotypes but have yet to be studied in relation to PTSD. The present study sought to examine the relation between 9 single nucleotide polymorphisms (SNPs) in the CRHR1 gene and posttraumatic stress symptoms in a prospective study of pediatric injury patients (n=103) who were first assessed in the acute aftermath of their injury at the hospital. Results indicated that multiple SNPs were associated with acute symptoms at a univariate level, and after correction for multiple testing, rs12944712 was significantly related to acute PTSD symptoms. Longitudinal latent growth curve analyses suggest that rs12944712 is also related to both acute symptom level and trajectory of symptoms over time. The present study adds support for the role of CRHR1 in the stress response following potentially traumatic event exposure in youth. It should be noted that the sample size in this study was small, and therefore statistical power was low; following, results from this study should be considered preliminary. Although results are not definitive, the findings from this study warrant future replication studies on how variation in this gene relates to response to traumatic event exposure in youth.

SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

Science.gov (United States)

Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

2017-07-03

Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

CREB1 is a strong genetic predictor of the variation in exercise heart rate response to regular exercise: the HERITAGE Family Study.

Science.gov (United States)

Rankinen, Tuomo; Argyropoulos, George; Rice, Treva; Rao, D C; Bouchard, Claude

2010-06-01

A genome-wide linkage scan identified a quantitative trait locus for exercise training-induced changes in submaximal exercise (50 W) heart rate (DeltaHR50) on chromosome 2q33.3-q34 in the HERITAGE Family Study (n=472). To fine-map the region, 1450 tag SNPs were genotyped between 205 and 215 Mb on chromosome 2. The strongest evidence of association with DeltaHR50 was observed with 2 single-nucleotide polymorphisms (SNPs) located in the 5' region of the cAMP-responsive element-binding protein 1 (CREB1) gene (rs2253206: P=1.6x10(-5) and rs2360969: P=4.3x10(-5)). The associations remained significant (P=0.01 and P=0.023, respectively) after accounting for multiple testing. Regression modeling of the 39 most significant SNPs in the single-SNP analysis identified 9 SNPs that collectively explained 20% of the DeltaHR50 variance. CREB1 SNP rs2253206 had the strongest effect (5.45% of variance), followed by SNPs in the FASTKD2 (3.1%), MAP2 (2.6%), SPAG16 (2.1%), ERBB4 (3 SNPs approximately 1.4% each), IKZF2 (1.4%), and PARD3B (1.0%) loci. In conditional linkage analysis, 6 SNPs from the final regression model (CREB1, FASTKD2, MAP2, ERBB4, IKZF2, and PARD3B) accounted for the original linkage signal: The log of the odds score dropped from 2.10 to 0.41 after adjusting for all 6 SNPs. Functional studies revealed that the common allele of rs2253206 exhibits significantly (P<0.05) lower promoter activity than the minor allele. Our data suggest that functional DNA sequence variation in the CREB1 locus is strongly associated with DeltaHR50 and explains a considerable proportion of the quantitative trait locus variance. However, at least 5 additional SNPs seem to be required to fully account for the original linkage signal.

Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

Science.gov (United States)

Lean, Choo Bee; Lee, Edmund Jon Deoon

2009-01-01

MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

DEFF Research Database (Denmark)

Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

2013-01-01

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

Science.gov (United States)

Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

2018-06-15

Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

The renal urate transporter SLC17A1 locus: confirmation of association with gout.

Science.gov (United States)

Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

2012-04-27

Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

Science.gov (United States)

Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

2012-01-01

Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

Science.gov (United States)

Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

2017-05-30

Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

Creb1 regulates late stage mammalian lung development via respiratory epithelial and mesenchymal-independent mechanisms

Science.gov (United States)

Antony, N.; McDougall, A. R.; Mantamadiotis, T.; Cole, T. J.; Bird, A. D.

2016-01-01

During mammalian lung development, the morphological transition from respiratory tree branching morphogenesis to a predominantly saccular architecture, capable of air-breathing at birth, is dependent on physical forces as well as molecular signaling by a range of transcription factors including the cAMP response element binding protein 1 (Creb1). Creb1−/− mutant mice exhibit complete neonatal lethality consistent with a lack of lung maturation beyond the branching phase. To further define its role in the developing mouse lung, we deleted Creb1 separately in the respiratory epithelium and mesenchyme. Surprisingly, we found no evidence of a morphological lung defect nor compromised neonatal survival in either conditional Creb1 mutant. Interestingly however, loss of mesenchymal Creb1 on a genetic background lacking the related Crem protein showed normal lung development but poor neonatal survival. To investigate the underlying requirement for Creb1 for normal lung development, Creb1−/− mice were re-examined for defects in both respiratory muscles and glucocorticoid hormone signaling, which are also required for late stage lung maturation. However, these systems appeared normal in Creb1−/− mice. Together our results suggest that the requirement of Creb1 for normal mammalian lung morphogenesis is not dependent upon its expression in lung epithelium or mesenchyme, nor its role in musculoskeletal development. PMID:27150575

Glutaredoxin 1 (GRX1) inhibits oxidative stress and apoptosis of chondrocytes by regulating CREB/HO-1 in osteoarthritis.

Science.gov (United States)

Sun, Jie; Wei, Xuelei; Lu, Yandong; Cui, Meng; Li, Fangguo; Lu, Jie; Liu, Yunjiao; Zhang, Xi

2017-10-01

GRX1 (glutaredoxin1), a sulfhydryl disulfide oxidoreductase, is involved in many cellular processes, including anti-oxidation, anti-apoptosis, and regulation of cell differentiation. However, the role of GRX1 in the oxidative stress and apoptosis of osteoarthritis chondrocytes remains unclear, prompting the current study. Protein and mRNA expressions were measured by Western blot and RT-qPCR. Oxidative stress was detected by the measurement of MDA and SOD contents. Cells apoptosis were detected by Annexin V-FITC/PI and caspase-3 activity assays. We found that the mRNA and protein expressions of GRX1 were significantly down-regulated in osteoarthritis tissues and cells. GRX1 overexpression increased the mRNA and protein expression of CREB and HO-1. Meanwhile, GRX1 overexpression inhibited oxidative stress and apoptosis in osteoarthritis chondrocytes. Furthermore, we found that GRX1 overexpression regulated HO-1 by increasing CREB, and that HO-1 regulated oxidative stress and apoptosis in osteoarthritis chondrocytes. Thus, GRX1 overexpression constrains oxidative stress and apoptosis in osteoarthritis chondrocytes by regulating CREB/HO-1, providing a novel insight into the molecular mechanism and potential treatment of osteoarthritis. Copyright © 2017. Published by Elsevier Ltd.

Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

Directory of Open Access Journals (Sweden)

Jing Yuan

Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

Science.gov (United States)

Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

2017-01-01

Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

NARCIS (Netherlands)

Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

2014-01-01

During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

Science.gov (United States)

Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

2018-03-05

Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

Directory of Open Access Journals (Sweden)

Mao Lin

2014-01-01

Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

A CREB1 Gene Polymorphism (rs2253206) Is Associated with Prospective Memory in a Healthy Cohort.

Science.gov (United States)

Avgan, Nesli; Sutherland, Heidi G; Lea, Rodney A; Spriggens, Lauren K; Haupt, Larisa M; Shum, David H K; Griffiths, Lyn R

2017-01-01

Prospective memory (PM) is generally defined as remembering to perform intended actions in the future and is important for functioning in daily life. Cyclic adenosine monophosphate (cAMP) responsive element binding protein 1 (CREB1) plays an important role in cognitive functions. In this study, we hypothesized that genetic variation in the CREB1 gene is associated with PM. We genotyped a CREB1 promoter polymorphism rs2253206 and tested it for association with PM in 619 healthy subjects. PM performance was measured using the Prospective and Retrospective Memory Questionnaire (PRMQ), the Comprehensive Assessment of Prospective Memory (CAPM), and the Memory for Intentions Screening Test (MIST). Generalized linear model analysis was conducted for each PM test independently using different inheritance models to identify any associations ( p CAPM instrumental activities of daily living measure ( p = 0.016). These results suggest that the rs2253206 polymorphism in the CREB1 gene locus is associated with PM in healthy individuals and contributes to knowledge on the genetics of this particular type of memory.

Association of serotonin transporter (SLC6A4 & receptor (5HTR1A, 5HTR2A polymorphisms with response to treatment with escitalopram in patients with major depressive disorder : A preliminary study

Directory of Open Access Journals (Sweden)

Aniruddha Basu

2015-01-01

Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.

Molecular interactions involved in the transactivation of the human T-cell leukemia virus type 1 promoter mediated by Tax and CREB-2 (ATF-4).

Science.gov (United States)

Gachon, F; Thebault, S; Peleraux, A; Devaux, C; Mesnard, J M

2000-05-01

The human T-cell leukemia virus type 1 (HTLV-1) Tax protein activates viral transcription through three 21-bp repeats located in the U3 region of the HTLV-1 long terminal repeat and called Tax-responsive elements (TxREs). Each TxRE contains nucleotide sequences corresponding to imperfect cyclic AMP response elements (CRE). In this study, we demonstrate that the bZIP transcriptional factor CREB-2 is able to bind in vitro to the TxREs and that CREB-2 binding to each of the 21-bp motifs is enhanced by Tax. We also demonstrate that Tax can weakly interact with CREB-2 bound to a cellular palindromic CRE motif such as that found in the somatostatin promoter. Mutagenesis of Tax and CREB-2 demonstrates that both N- and C-terminal domains of Tax and the C-terminal region of CREB-2 are required for direct interaction between the two proteins. In addition, the Tax mutant M47, defective for HTLV-1 activation, is unable to form in vitro a ternary complex with CREB-2 and TxRE. In agreement with recent results suggesting that Tax can recruit the coactivator CREB-binding protein (CBP) on the HTLV-1 promoter, we provide evidence that Tax, CREB-2, and CBP are capable of cooperating to stimulate viral transcription. Taken together, our data highlight the major role played by CREB-2 in Tax-mediated transactivation.

Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

Directory of Open Access Journals (Sweden)

Hsin-Chou Yang

Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

Higher FKBP5, COMT, CHRNA5, and CRHR1 allele burdens are associated with PTSD and interact with trauma exposure: implications for neuropsychiatric research and treatment

Directory of Open Access Journals (Sweden)

Boscarino JA

2012-03-01

Full Text Available Joseph A Boscarino1,2, Porat M Erlich1,3, Stuart N Hoffman4, Xiaopeng Zhang51Center for Health Research, Geisinger Clinic, Danville, PA, 2Department of Psychiatry, 3Department of Medicine, Temple University School of Medicine, Philadelphia, PA, 4Department of Neurology, 5Department of Anesthesiology, Geisinger Clinic, Danville, PA, USAObjective: The study aim was to assess the cumulative burden of polymorphisms located within four genetic loci previously associated with posttraumatic stress disorder (PTSD among outpatients at risk for PTSD.Methods: Diagnostic interviews were completed and DNA samples collected among 412 pain patients to determine if FKBP5 (rs9470080, COMT (rs4680, CHRNA5 (rs16969968, and CRHR1 (rs110402 single nucleotide polymorphisms were cumulatively associated with increased risk for PTSD.Results: In bivariate analyses, it was found that a count of specific PTSD risk alleles located within FKBP5, COMT, CHRNA5, and CRHR1 genetic loci (allele range = 0–6, mean count = 2.92, standard deviation = 1.36 was associated with lifetime (t [409] = 3.430, P = 0.001 and early onset PTSD (t [409] = 4.239, P = 0.000028. In logistic regression, controlling for demographic factors, personality traits, and trauma exposures, this risk allele count remained associated with both lifetime (odds ratio = 1.49, P = 0.00158 and early onset PTSD (odds ratio = 2.36, P = 0.000093. Interaction effects were also detected, whereby individuals with higher risk allele counts and higher trauma exposures had an increased risk of lifetime PTSD (allele count × high trauma, P = 0.026 and early onset PTSD (allele count × high trauma, P = 0.016 in these logistic regressions. Those with no or few risk alleles appeared resilient to PTSD, regardless of exposure history.Conclusion: A cumulative risk allele count involving four single nucleotide polymorphisms located within the FKBP5, COMT, CHRNA5, and CRHR1 genes are associated with PTSD. Level of trauma exposure

TLR4 induces CREB-mediated IL-6 production via upregulation of F-spondin to promote vascular smooth muscle cell migration

Energy Technology Data Exchange (ETDEWEB)

Lee, Guan-Lin [Institute of Cellular and System Medicine, National Health Research Institutes, Zhunan, Taiwan (China); Graduate Institutes of Life Sciences, National Defense Medical Center, Taipei, Taiwan (China); Wu, Jing-Yiing [Institute of Cellular and System Medicine, National Health Research Institutes, Zhunan, Taiwan (China); Yeh, Chang-Ching [Institute of Cellular and System Medicine, National Health Research Institutes, Zhunan, Taiwan (China); Graduate Institutes of Life Sciences, National Defense Medical Center, Taipei, Taiwan (China); Kuo, Cheng-Chin, E-mail: kuocc@nhri.org.tw [Institute of Cellular and System Medicine, National Health Research Institutes, Zhunan, Taiwan (China); Graduate Institutes of Life Sciences, National Defense Medical Center, Taipei, Taiwan (China); Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan (China)

2016-05-13

Toll-like receptor 4 (TLR4) is important in promoting inflammation and vascular smooth muscle cell (VSMC) migration, both of which contribute to atherosclerosis development and progression. But the mechanism underlying the regulation of TLR4 in VSMC migration remains unclear. Stimulation of VSMCs with LPS increased the cellular level of F-spondin which is associated with the regulation of proinflammatory cytokine production. The LPS-induced F-spondin expression depended on TLR4-mediated PI3K/Akt pathway. Suppression of F-spondin level by siRNA inhibited not only F-spondin expression but also LPS-induced phosphorylation of cAMP response element binding protein (CREB) and IL-6 expression, VSMC migration and proliferation as well as MMP9 expression. Moreover, suppression of CREB level by siRNA inhibited TLR4-induced IL-6 production and VSMC migration. Inhibition of F-spondin siRNA on LPS-induced migration was restored by addition of exogenous recombinant mouse IL-6. We conclude that upon ligand binding, TLR4 activates PI3K/Akt signaling to induce F-spondin expression, subsequently control CREB-mediated IL-6 production to promote VSMC migration. These findings provide vital insights into the essential role of F-spondin in VSMC function and will be valuable for developing new therapeutic strategies against atherosclerosis. -- Highlights: •LPS-induced F-spondin expression of VSMCs is via a TLR4/PI3K/Akt signaling. •F-spondin is pivotal for LPS-induced CREB-mediated IL-6 production. •F-spondin is required for LPS-induced VSMC migration and proliferation.

TLR4 induces CREB-mediated IL-6 production via upregulation of F-spondin to promote vascular smooth muscle cell migration

International Nuclear Information System (INIS)

Lee, Guan-Lin; Wu, Jing-Yiing; Yeh, Chang-Ching; Kuo, Cheng-Chin

2016-01-01

Toll-like receptor 4 (TLR4) is important in promoting inflammation and vascular smooth muscle cell (VSMC) migration, both of which contribute to atherosclerosis development and progression. But the mechanism underlying the regulation of TLR4 in VSMC migration remains unclear. Stimulation of VSMCs with LPS increased the cellular level of F-spondin which is associated with the regulation of proinflammatory cytokine production. The LPS-induced F-spondin expression depended on TLR4-mediated PI3K/Akt pathway. Suppression of F-spondin level by siRNA inhibited not only F-spondin expression but also LPS-induced phosphorylation of cAMP response element binding protein (CREB) and IL-6 expression, VSMC migration and proliferation as well as MMP9 expression. Moreover, suppression of CREB level by siRNA inhibited TLR4-induced IL-6 production and VSMC migration. Inhibition of F-spondin siRNA on LPS-induced migration was restored by addition of exogenous recombinant mouse IL-6. We conclude that upon ligand binding, TLR4 activates PI3K/Akt signaling to induce F-spondin expression, subsequently control CREB-mediated IL-6 production to promote VSMC migration. These findings provide vital insights into the essential role of F-spondin in VSMC function and will be valuable for developing new therapeutic strategies against atherosclerosis. -- Highlights: •LPS-induced F-spondin expression of VSMCs is via a TLR4/PI3K/Akt signaling. •F-spondin is pivotal for LPS-induced CREB-mediated IL-6 production. •F-spondin is required for LPS-induced VSMC migration and proliferation.

Upregulation of the Creatine Transporter Slc6A8 by Klotho

Directory of Open Access Journals (Sweden)

Ahmad Almilaji

2014-11-01

Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

Directory of Open Access Journals (Sweden)

Yun-Fang Jia

2017-07-01

Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

Regulators of Slc4 bicarbonate transporter activity

Directory of Open Access Journals (Sweden)

Ian M. Thornell

2015-06-01

Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

Science.gov (United States)

Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

2016-11-01

A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

Science.gov (United States)

Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

2017-01-01

The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

Directory of Open Access Journals (Sweden)

Dale W Hailey

Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

Science.gov (United States)

Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

2009-01-01

Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

Science.gov (United States)

Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

2015-06-01

Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

Directory of Open Access Journals (Sweden)

Mizuno T

2015-07-01

Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

The α and Δ isoforms of CREB1 are required to maintain normal pulmonary vascular resistance.

Directory of Open Access Journals (Sweden)

Lili Li

Full Text Available Chronic hypoxia causes pulmonary hypertension associated with structural alterations in pulmonary vessels and sustained vasoconstriction. The transcriptional mechanisms responsible for these distinctive changes are unclear. We have previously reported that CREB1 is activated in the lung in response to alveolar hypoxia but not in other organs. To directly investigate the role of α and Δ isoforms of CREB1 in the regulation of pulmonary vascular resistance we examined the responses of mice in which these isoforms of CREB1 had been inactivated by gene mutation, leaving only the β isoform intact (CREB(αΔ mice. Here we report that expression of CREB regulated genes was altered in the lungs of CREB(αΔ mice. CREB(αΔ mice had greater pulmonary vascular resistance than wild types, both basally in normoxia and following exposure to hypoxic conditions for three weeks. There was no difference in rho kinase mediated vasoconstriction between CREB(αΔ and wild type mice. Stereological analysis of pulmonary vascular structure showed characteristic wall thickening and lumen reduction in hypoxic wild-type mice, with similar changes observed in CREB(αΔ. CREB(αΔ mice had larger lungs with reduced epithelial surface density suggesting increased pulmonary compliance. These findings show that α and Δ isoforms of CREB1 regulate homeostatic gene expression in the lung and that normal activity of these isoforms is essential to maintain low pulmonary vascular resistance in both normoxic and hypoxic conditions and to maintain the normal alveolar structure. Interventions that enhance the actions of α and Δ isoforms of CREB1 warrant further investigation in hypoxic lung diseases.

Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

Directory of Open Access Journals (Sweden)

Mignon Laurence

2010-02-01

Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

Cross-Sectional and Longitudinal Effects of CREB1 Genotypes on Individual Differences in Memory and Executive Function: Findings from the BLSA

Directory of Open Access Journals (Sweden)

Claudia Wolf

2017-05-01

Full Text Available Purpose: Previously, we have shown that the SNP rs10932201 genotype of the cyclic AMP responsive element binding protein 1 gene (CREB1 contributes to individual differences in executive and memory function at the neural system and behavioral levels in healthy, young adults. However, longitudinal effects of CREB1 genotypes on cognition have not yet been addressed. Furthermore we were interested in replicating associations between CREB1 genotypes and human cognition in previous cross-sectional studies and explore whether APOE4 status might modify these relations.Materials and Methods: We investigated whether common, independent tag SNPs within CREB1 (rs2253206, rs10932201, rs6785 influence individual differences in age-related longitudinal change and level of executive function and memory performance independent of baseline age, sex, APOE4 status, and education. Our analysis included data from cognitively unimpaired older adults participating in the Baltimore Longitudinal Study of Aging. Eleven measures from six cognitive tests (sample sizes range 617–786 were analyzed using linear mixed effects and generalized estimating equations models. Mean baseline age ranged from 50 to 69 years and mean time of follow-up (interval ranged from 8 to 22 years.Results: We found significant effects of all three CREB1 SNPs on performance level and/or longitudinal change in performance based on eight measures assessing semantic memory, episodic memory, or both executive function and semantic memory. SNP rs10932201 showed the most significant and largest effect (Cohen’s d = -0.70, p < 0.01 on age-related longitudinal decline of semantic memory. Additionally, we show interactions between all three CREB1 SNPs and APOE4 status on age-related longitudinal declines and levels of memory and executive function.Conclusion: Our results suggest that CREB1 genotypes independently and by interactions with APOE4 status contribute to individual differences in cognitive aging.

Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

Directory of Open Access Journals (Sweden)

Deborah Cook

2008-09-01

Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

YC-1 potentiates cAMP-induced CREB activation and nitric oxide production in alveolar macrophages

Energy Technology Data Exchange (ETDEWEB)

Hwang, Tsong-Long, E-mail: htl@mail.cgu.edu.tw [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Chinese Herbal Medicine Research Team, Healthy Aging Research Center, Chang Gung University, Kweishan, Taoyuan, Taiwan (China); Tang, Ming-Chi [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Kuo, Liang-Mou [Department of General Surgery, Chang Gung Memorial Hospital at Chia-Yi, Taiwan (China); Chang, Wen-De; Chung, Pei-Jen; Chang, Ya-Wen; Fang, Yao-Ching [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China)

2012-04-15

Alveolar macrophages play significant roles in the pathogenesis of several inflammatory lung diseases. Increases in exhaled nitric oxide (NO) are well documented to reflect disease severity in the airway. In this study, we investigated the effect of 3-(5′-hydroxymethyl-2′-furyl)-1-benzyl indazole (YC-1), a known activator of soluble guanylyl cyclase, on prostaglandin (PG)E{sub 1} (a stable PGE{sub 2} analogue) and forskolin (a adenylate cyclase activator) induced NO production and inducible NO synthase (iNOS) expression in rat alveolar macrophages (NR8383). YC-1 did not directly cause NO production or iNOS expression, but drastically potentiated PGE{sub 1}- or forskolin-induced NO production and iNOS expression in NR8383 alveolar macrophages. Combination treatment with YC-1 and PGE{sub 1} significantly increased phosphorylation of the cAMP response element-binding protein (CREB), but not nuclear factor (NF)-κB activation. The combined effect on NO production, iNOS expression, and CREB phosphorylation was reversed by a protein kinase (PK)A inhibitor (H89), suggesting that the potentiating functions were mediated through a cAMP/PKA signaling pathway. Consistent with this, cAMP analogues, but not the cGMP analogue, caused NO release, iNOS expression, and CREB activation. YC-1 treatment induced an increase in PGE{sub 1}-induced cAMP formation, which occurred through the inhibition of cAMP-specific phosphodiesterase (PDE) activity. Furthermore, the combination of rolipram (an inhibitor of PDE4), but not milronone (an inhibitor of PDE3), and PGE{sub 1} also triggered NO production and iNOS expression. In summary, YC-1 potentiates PGE{sub 1}-induced NO production and iNOS expression in alveolar macrophages through inhibition of cAMP PDE activity and activation of the cAMP/PKA/CREB signaling pathway. Highlights: ► YC-1 potentiated PGE1-induced iNOS expression in alveolar macrophages. ► The combination of YC-1 and PGE1 increased CREB but not NFκB activation. �

Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

Science.gov (United States)

Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

2017-04-01

The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

DEFF Research Database (Denmark)

Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

2012-01-01

BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

Directory of Open Access Journals (Sweden)

Dongsha Wang

Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Directory of Open Access Journals (Sweden)

Anna Rita Cappello

2018-04-01

Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Science.gov (United States)

Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

2018-04-01

The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

Science.gov (United States)

Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

2011-02-01

We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

Science.gov (United States)

Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

2012-01-01

Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

Science.gov (United States)

Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

2016-01-01

To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

Dicty_cDB: SLC456 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

Directory of Open Access Journals (Sweden)

Stefano Luisa

2005-01-01

Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

Science.gov (United States)

Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

2011-09-30

Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Triiodothyronine Acutely Stimulates Glucose Transport into L6 Muscle Cells Without Increasing Surface GLUT4, GLUT1, or GLUT3

Science.gov (United States)

Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira

2012-01-01

Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

Directory of Open Access Journals (Sweden)

Clifford Jacobs

2014-06-01

Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

Science.gov (United States)

González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

2015-01-01

Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

The role of SLC2A1 in early onset and childhood absence epilepsies

DEFF Research Database (Denmark)

Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

2013-01-01

Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

Science.gov (United States)

Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

2016-10-01

Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

Directory of Open Access Journals (Sweden)

Pingting Liu

2017-01-01

Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

Directory of Open Access Journals (Sweden)

Daniela Paccagnini

2009-09-01

Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

Directory of Open Access Journals (Sweden)

Etienne Masle-Farquhar

2017-05-01

Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

CREB activity in dopamine D1 receptor expressing neurons regulates cocaine-induced behavioral effects

Science.gov (United States)

Bilbao, Ainhoa; Rieker, Claus; Cannella, Nazzareno; Parlato, Rosanna; Golda, Slawomir; Piechota, Marcin; Korostynski, Michal; Engblom, David; Przewlocki, Ryszard; Schütz, Günther; Spanagel, Rainer; Parkitna, Jan R.

2014-01-01

It is suggested that striatal cAMP responsive element binding protein (CREB) regulates sensitivity to psychostimulants. To test the cell-specificity of this hypothesis we examined the effects of a dominant-negative CREB protein variant expressed in dopamine receptor D1 (D1R) neurons on cocaine-induced behaviors. A transgenic mouse strain was generated by pronuclear injection of a BAC-derived transgene harboring the A-CREB sequence under the control of the D1R gene promoter. Compared to wild-type, drug-naïve mutants showed moderate alterations in gene expression, especially a reduction in basal levels of activity-regulated transcripts such as Arc and Egr2. The behavioral responses to cocaine were elevated in mutant mice. Locomotor activity after acute treatment, psychomotor sensitization after intermittent drug injections and the conditioned locomotion after saline treatment were increased compared to wild-type littermates. Transgenic mice had significantly higher cocaine conditioned place preference, displayed normal extinction of the conditioned preference, but showed an augmented cocaine-seeking response following priming-induced reinstatement. This enhanced cocaine-seeking response was associated with increased levels of activity-regulated transcripts and prodynorphin. The primary reinforcing effects of cocaine were not altered in the mutant mice as they did not differ from wild-type in cocaine self-administration under a fixed ratio schedule at the training dose. Collectively, our data indicate that expression of a dominant-negative CREB variant exclusively in neurons expressing D1R is sufficient to recapitulate the previously reported behavioral phenotypes associated with virally expressed dominant-negative CREB. PMID:24966820

Dicty_cDB: SLC405 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

Positive selection in the SLC11A1 gene in the family Equidae

DEFF Research Database (Denmark)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

2016-01-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

Directory of Open Access Journals (Sweden)

Yan Xiaofei

2011-09-01

Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

International Nuclear Information System (INIS)

Zuloaga, R.; Fuentes, E.N.; Molina, A.; Valdés, J.A.

2013-01-01

Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP 3 /calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation

The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

Energy Technology Data Exchange (ETDEWEB)

Zuloaga, R. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Fuentes, E.N.; Molina, A. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile); Valdés, J.A., E-mail: jvaldes@unab.cl [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile)

2013-10-18

Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

Deletion of the betaine-GABA transporter (BGT1; slc6a12) gene does not affect seizure thresholds of adult mice

DEFF Research Database (Denmark)

Lehre, A C; Rowley, N M; Zhou, Y

2011-01-01

of the GAT1 by the clinically available anti-epileptic drug tiagabine has been an effective strategy for the treatment of some patients with partial seizures. Recently, the investigational drug EF1502, which inhibits both GAT1 and BGT1, was found to exert an anti-convulsant action synergistic...... to that of tiagabine, supposedly due to inhibition of BGT1. The present study addresses the role of BGT1 in seizure control and the effect of EF1502 by developing and exploring a new mouse line lacking exons 3-5 of the BGT1 (slc6a12) gene. The deletion of this sequence abolishes the expression of BGT1 mRNA. However......, homozygous BGT1-deficient mice have normal development and show seizure susceptibility indistinguishable from that in wild-type mice in a variety of seizure threshold models including: corneal kindling, the minimal clonic and minimal tonic extension seizure threshold tests, the 6Hz seizure threshold test...

Dicty_cDB: SLC466 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

Science.gov (United States)

Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

2017-07-01

To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

Science.gov (United States)

Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

2013-01-01

To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

Science.gov (United States)

Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

2015-09-01

Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

Science.gov (United States)

Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

2017-07-05

Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

Substrate specificity of the electrogenic sodium/bicarbonate cotransporter NBCe1-A (SLC4A4, variant A) from humans and rabbits.

Science.gov (United States)

Lee, Seong-Ki; Boron, Walter F; Parker, Mark D

2013-04-01

In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.

Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

Directory of Open Access Journals (Sweden)

Eduardo Tarazona-Santos

Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

Dicty_cDB: SLC492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

Epigenetic modification of miR-10a regulates renal damage by targeting CREB1 in type 2 diabetes mellitus.

Science.gov (United States)

Shan, Qun; Zheng, Guihong; Zhu, Aihua; Cao, Li; Lu, Jun; Wu, Dongmei; Zhang, ZiFeng; Fan, Shaohua; Sun, Chunhui; Hu, Bin; Zheng, Yuanlin

2016-09-01

Emerging evidence has shown that microRNA-mediated gene expression modulation plays a crucial role in the pathogenesis of type 2 diabetes mellitus, but the novel miRNAs involved in type 2 diabetes and its functional regulatory mechanisms still need to be determined. In this study, we assessed the role of miR-10a in extracellular matrix accumulation in the kidney of diabetic mellitus induced by combining administration of chronic high fat diet (HFD) and low dosage of streptozotocin (STZ, 35mg/kg). Here, we found that HFD/STZ administration decreased the level of microRNA (miR-10a) expression in ICR strain mice. Overexpression of miR-10a alleviated the increased ratio of urine albumin-to-creatinine (ACR) ratio of HFD/STZ mice. In contrast, knockdown of miR-10a increased the ratio of kidney ACR in naïve mice. Furthermore, cAMP response element binding protein 1 (CREB1) was validated as a target of miR-10a in vitro and in vivo. CREB1 and its downstream fibronectin (FN, extracellular matrix) were increased in HFD/STZ-treated mice, which was reversed by kidney miR-10a overexpression. The content of CREB1 and FN was increased by miR-10a knockdown in kidney of naïve mice. Furthermore, histone deacetylase 3 (HDAC3) was revealed to be increased in kidney of HFD/STZ mice, accompanied with the augmentation of ACR ratio and FN level. Knockdown of HDAC3 with siRNA significantly caused the increase of miR-10a, resulting in the decrease in CREB1 and FN expression in kidney of HFD/STZ mice. Contrarily, HDAC3 overexpression mediated by lentivirus decreased miR-10a content, and enhanced ACR value, CREB1 and FN formation in naïve mice. Collectively, these results elucidate that HDAC3/miR-10a/CREB1 serves as a new mechanism underlying kidney injury, providing potential therapeutic targets in type 2 diabetes. Copyright © 2016. Published by Elsevier Inc.

Epigenetic modification of miR-10a regulates renal damage by targeting CREB1 in type 2 diabetes mellitus

Energy Technology Data Exchange (ETDEWEB)

Shan, Qun, E-mail: shanp@jsnu.edu.cn; Zheng, Guihong, E-mail: ghzhengsd@jsnu.edu.cn; Zhu, Aihua, E-mail: ahzhu@jsnu.edu.cn; Cao, Li, E-mail: 948113717@qq.com; Lu, Jun, E-mail: lu-jun75@163.com; Wu, Dongmei, E-mail: wdm8610@jsnu.edu.cn; Zhang, ZiFeng, E-mail: zhangzifengsuper@jsnu.edu.cn; Fan, Shaohua, E-mail: fshfly@126.com; Sun, Chunhui, E-mail: 306484866@qq.com; Hu, Bin, E-mail: hubin@jsnu.edu.cn; Zheng, Yuanlin, E-mail: ylzheng@jsnu.edu.cn

2016-09-01

Emerging evidence has shown that microRNA-mediated gene expression modulation plays a crucial role in the pathogenesis of type 2 diabetes mellitus, but the novel miRNAs involved in type 2 diabetes and its functional regulatory mechanisms still need to be determined. In this study, we assessed the role of miR-10a in extracellular matrix accumulation in the kidney of diabetic mellitus induced by combining administration of chronic high fat diet (HFD) and low dosage of streptozotocin (STZ, 35 mg/kg). Here, we found that HFD/STZ administration decreased the level of microRNA (miR-10a) expression in ICR strain mice. Overexpression of miR-10a alleviated the increased ratio of urine albumin-to-creatinine (ACR) ratio of HFD/STZ mice. In contrast, knockdown of miR-10a increased the ratio of kidney ACR in naïve mice. Furthermore, cAMP response element binding protein 1 (CREB1) was validated as a target of miR-10a in vitro and in vivo. CREB1 and its downstream fibronectin (FN, extracellular matrix) were increased in HFD/STZ-treated mice, which was reversed by kidney miR-10a overexpression. The content of CREB1 and FN was increased by miR-10a knockdown in kidney of naïve mice. Furthermore, histone deacetylase 3 (HDAC3) was revealed to be increased in kidney of HFD/STZ mice, accompanied with the augmentation of ACR ratio and FN level. Knockdown of HDAC3 with siRNA significantly caused the increase of miR-10a, resulting in the decrease in CREB1 and FN expression in kidney of HFD/STZ mice. Contrarily, HDAC3 overexpression mediated by lentivirus decreased miR-10a content, and enhanced ACR value, CREB1 and FN formation in naïve mice. Collectively, these results elucidate that HDAC3/miR-10a/CREB1 serves as a new mechanism underlying kidney injury, providing potential therapeutic targets in type 2 diabetes. - Highlights: • Diabetes induces the decrease of miR-10a level in the kidney. • MiR-10a overexpression improves kidney damage of diabetes. • MiR-10a targeting CREB1/FN

Epigenetic modification of miR-10a regulates renal damage by targeting CREB1 in type 2 diabetes mellitus

International Nuclear Information System (INIS)

Shan, Qun; Zheng, Guihong; Zhu, Aihua; Cao, Li; Lu, Jun; Wu, Dongmei; Zhang, ZiFeng; Fan, Shaohua; Sun, Chunhui; Hu, Bin; Zheng, Yuanlin

2016-01-01

Emerging evidence has shown that microRNA-mediated gene expression modulation plays a crucial role in the pathogenesis of type 2 diabetes mellitus, but the novel miRNAs involved in type 2 diabetes and its functional regulatory mechanisms still need to be determined. In this study, we assessed the role of miR-10a in extracellular matrix accumulation in the kidney of diabetic mellitus induced by combining administration of chronic high fat diet (HFD) and low dosage of streptozotocin (STZ, 35 mg/kg). Here, we found that HFD/STZ administration decreased the level of microRNA (miR-10a) expression in ICR strain mice. Overexpression of miR-10a alleviated the increased ratio of urine albumin-to-creatinine (ACR) ratio of HFD/STZ mice. In contrast, knockdown of miR-10a increased the ratio of kidney ACR in naïve mice. Furthermore, cAMP response element binding protein 1 (CREB1) was validated as a target of miR-10a in vitro and in vivo. CREB1 and its downstream fibronectin (FN, extracellular matrix) were increased in HFD/STZ-treated mice, which was reversed by kidney miR-10a overexpression. The content of CREB1 and FN was increased by miR-10a knockdown in kidney of naïve mice. Furthermore, histone deacetylase 3 (HDAC3) was revealed to be increased in kidney of HFD/STZ mice, accompanied with the augmentation of ACR ratio and FN level. Knockdown of HDAC3 with siRNA significantly caused the increase of miR-10a, resulting in the decrease in CREB1 and FN expression in kidney of HFD/STZ mice. Contrarily, HDAC3 overexpression mediated by lentivirus decreased miR-10a content, and enhanced ACR value, CREB1 and FN formation in naïve mice. Collectively, these results elucidate that HDAC3/miR-10a/CREB1 serves as a new mechanism underlying kidney injury, providing potential therapeutic targets in type 2 diabetes. - Highlights: • Diabetes induces the decrease of miR-10a level in the kidney. • MiR-10a overexpression improves kidney damage of diabetes. • MiR-10a targeting CREB1/FN

CREB mediates the insulinotropic and anti-apoptotic effects of GLP-1 signaling in adult mouse β-cells

Directory of Open Access Journals (Sweden)

Soona Shin

2014-11-01

Conclusions: In sum, our studies using conditional gene deletion put into question current notions about the importance of CREB in regulating β-cell function and mass. However, we reveal an important role for CREB in the β-cell response to GLP-1 receptor signaling, further validating CREB as a therapeutic target for diabetes.

Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

Science.gov (United States)

Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

2018-01-01

The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

Neurons efficiently repair glutamate-induced oxidative DNA damage by a process involving CREB-mediated up-regulation of apurinic endonuclease 1

DEFF Research Database (Denmark)

Yang, Jenq-Lin; Tadokoro, Takashi; Keijzers, Guido

2010-01-01

inhibitor (KN-93) blocked the ability of glutamate to induce CREB phosphorylation and APE1 expression. Selective depletion of CREB using RNA interference prevented glutamate-induced up-regulation of APE1. Thus, glutamate receptor stimulation triggers Ca(2+)- and mitochondrial reactive oxygen species...

Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

Directory of Open Access Journals (Sweden)

Quirino Cordeiro

2010-10-01

Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,051,69 e genotípicas (χ2=6,56, 2d.f. , p=0,03 entre pacientes e controles. Assim, o polimorfismo SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

Directory of Open Access Journals (Sweden)

Xin Wen

Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

Science.gov (United States)

Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

2017-10-01

Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

[The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

Science.gov (United States)

Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

2014-01-01

We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated Caco-2, LLC-PK1 and rat renal SKPT cells.

Science.gov (United States)

Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob; Holm, René; Nielsen, Carsten Uhd

2016-01-20

The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells, porcine LLC-PK1 cells, and rat SKPT cells using radiolabelled taurine. Hyperosmotic conditions were obtained by incubation with raffinose (final osmolality of 500mOsm) for 24h prior to the uptake experiments. Expression of the taurine transporter, TauT, was investigated at the mRNA level by real-time PCR. Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2.02, 4.19, 4.94, 31.4 and 39.9mM, respectively. In conclusion, GABA mimetics inhibited taurine uptake in hyperosmotic rat renal SKPT cells. SKPT cells, which seem to be a useful model for investigating taurine transport in the short-term presence of high concentrations of osmolytes. Furthermore, analogues of β-alanine appear to have higher affinities for TauT than GABA-analogues. Copyright © 2015 Elsevier B.V. All rights reserved.

Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated caco-2, LLC-PK1 and rat renal SKPT cells

DEFF Research Database (Denmark)

Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk

2016-01-01

The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...

Dicty_cDB: SLC424 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia

Science.gov (United States)

Liu, Rong-Yu; Cleary, Leonard J.; Byrne, John H.

2011-01-01

Accumulating evidence suggests that the transcriptional activator CREB1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. Moreover, creb1 is among the genes activated by CREB1, suggesting a role for this protein beyond the induction phase of LTF. The time course of the requirement for CREB1 synthesis in the consolidation of long-term facilitation was examined using RNA interference (RNAi) techniques in sensorimotor co-cultures. Injection of CREB1 small-interfering RNA (siRNA) immediately or 10 h after 5-HT treatment blocked LTF when measured at 24 h and 48 h after treatment. In contrast, CREB1 siRNA did not block LTF when injected 16 h after 5-HT treatment. These results demonstrate that creb1 expression must be sustained for a relatively long time in order to support the consolidation of LTF. In addition, LTF is also accompanied by a long-term increase in the excitability (LTE) of sensory neurons (SNs). Because LTE was observed in the isolated SN after 5-HT treatment, this long-term change was intrinsic to that element of the circuit. LTE was blocked when CREB1 siRNA was injected into isolated SNs immediately after 5-HT treatment. These data suggest that 5-HT-induced CREB1 synthesis is required for consolidation of both LTF and LTE. PMID:21543617

Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

Science.gov (United States)

Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

2014-02-01

Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

Solute carrier protein family 11 member 1 (Slc11a1) activation efficiently inhibits Leishmania donovani survival in host macrophages.

Science.gov (United States)

Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K

2017-09-01

Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.

[Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

Science.gov (United States)

Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

2012-03-01

The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

Energy Technology Data Exchange (ETDEWEB)

Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

1995-12-10

The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

Directory of Open Access Journals (Sweden)

Amy J Osborne

Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

Dicty_cDB: SLC411 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

Directory of Open Access Journals (Sweden)

Naila Al Mahmuda

2016-05-01

Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

Small molecule kaempferol modulates PDX-1 protein expression and subsequently promotes pancreatic β-cell survival and function via CREB

Science.gov (United States)

Zhang, Yanling.; Zhen, Wei.; Maechler, Pierre; Liu, Dongmin

2013-01-01

Chronic hyperlipidemia causes β-cell apoptosis and dysfunction, thereby contributing to the pathogenesis of T2D. Thus, searching for agents to promote pancreatic β-cell survival and improve its function could be a promising strategy to prevent and treat T2D. We investigated the effects of kaempferol, a small molecule isolated from ginkgo biloba, on apoptosis and function of β-cells and further determined the mechanism underlying its actions. Kaempferol treatment promoted viability, inhibited apoptosis, and reduced caspase-3 activity in INS-1E cells and human islets chronically exposed to palmitate. In addition, kaempferol prevented the lipotoxicity-induced down-regulation of anti-apoptotic proteins Akt and Bcl-2. The cytoprotective effects of kaempferol were associated with improved insulin secretion, synthesis, and PDX-1 expression. Chronic hyperlipidemia significantly diminished cAMP production, PKA activation, and CREB phosphorylation and its regulated transcriptional activity in β-cells, all of which were restored by kaempferol treatment. Disruption of CREB expression by transfection of CREB siRNA in INS-1E cells or adenoviral transfer of dominant-negative forms of CREB in human islets ablated kaempferol protection of β-cell apoptosis and dysfunction caused by palmitate. Incubation of INS-1E cells or human islets with kaempferol for 48 h induced PDX-1 expression. This effect of kaempferol on PDX-1 expression was not shared by a host of structurally related flavonoid compounds. PDX-1 gene knockdown reduced kaempferol–stimulated cAMP generation and CREB activation in INS-1E cells. These findings demonstrate that kaempferol is a novel survivor factor for pancreatic β-cells via up-regulating the PDX-1/cAMP/PKA/CREB signaling cascade. PMID:22819546

Dicty_cDB: SLC494 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

2009-10-15

3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

DEFF Research Database (Denmark)

Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

2012-01-01

ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

Dicty_cDB: SLC418 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

Dicty_cDB: SLC420 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

Dicty_cDB: SLC481 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

DEFF Research Database (Denmark)

Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

2015-01-01

The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

Estradiol-induced regulation of GLUT4 in 3T3-L1 cells: involvement of ESR1 and AKT activation.

Science.gov (United States)

Campello, Raquel S; Fátima, Luciana A; Barreto-Andrade, João Nilton; Lucas, Thais F; Mori, Rosana C; Porto, Catarina S; Machado, Ubiratan F

2017-10-01

Impaired insulin-stimulated glucose uptake involves reduced expression of the GLUT4 (solute carrier family 2 facilitated glucose transporter member 4, SLC2A4 gene). 17β-estradiol (E 2 ) modulates SLC2A4 /GLUT4 expression, but the involved mechanisms are unclear. Although E 2 exerts biological effects by binding to estrogen receptors 1/2 (ESR1/2), which are nuclear transcriptional factors; extranuclear effects have also been proposed. We hypothesize that E 2 regulates GLUT4 through an extranuclear ESR1 mechanism. Thus, we investigated the effects of E 2 upon (1) subcellular distribution of ESRs and the proto-oncogene tyrosine-protein kinases (SRC) involvement; (2) serine/threonine-protein kinase (AKT) activation; (3) Slc2a4 /GLUT4 expression and (4) GLUT4 subcellular distribution and glucose uptake in 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were cultivated or not with E 2 for 24 h, and additionally treated or not with ESR1-selective agonist (PPT), ESR1-selective antagonist (MPP) or selective SRC inhibitor (PP2). Subcellular distribution of ESR1, ESR2 and GLUT4 was analyzed by immunocytochemistry; Slc2a4 mRNA and GLUT4 were quantified by qPCR and Western blotting, respectively; plasma membrane GLUT4 translocation and glucose uptake were analyzed under insulin stimulus for 20 min or not. E 2 induced (1) translocation of ESR1, but not of ESR2, from nucleus to plasma membrane and AKT phosphorylation, effects mimicked by PPT and blocked by MPP and PP2; (2) increased Slc2a4 /GLUT4 expression and (3) increased insulin-stimulated GLUT4 translocation and glucose uptake. In conclusion, E 2 treatment promoted a SRC-mediated nucleus-plasma membrane shuttle of ESR1, and increased AKT phosphorylation, Slc2a4 /GLUT4 expression and plasma membrane GLUT4 translocation; consequently, improving insulin-stimulated glucose uptake. These results unravel mechanisms through which estrogen improves insulin sensitivity. © 2017 Society for Endocrinology.

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

Period1 gates the circadian modulation of memory-relevant signaling in mouse hippocampus by regulating the nuclear shuttling of the CREB kinase pP90RSK.

Science.gov (United States)

Rawashdeh, Oliver; Jilg, Antje; Maronde, Erik; Fahrenkrug, Jan; Stehle, Jörg H

2016-09-01

Memory performance varies over a 24-h day/night cycle. While the detailed underlying mechanisms are yet unknown, recent evidence suggests that in the mouse hippocampus, rhythmic phosphorylation of mitogen-activated protein kinase (MAPK) and cyclic adenosine monophosphate response element-binding protein (CREB) are central to the circadian (~ 24 h) regulation of learning and memory. We recently identified the clock protein PERIOD1 (PER1) as a vehicle that translates information encoding time of day to hippocampal plasticity. We here elaborate how PER1 may gate the sensitivity of memory-relevant hippocampal signaling pathways. We found that in wild-type mice (WT), spatial learning triggers CREB phosphorylation only during the daytime, and that this effect depends on the presence of PER1. The time-of-day-dependent induction of CREB phosphorylation can be reproduced pharmacologically in acute hippocampal slices prepared from WT mice, but is absent in preparations made from Per1-knockout (Per1(-/-) ) mice. We showed that the PER1-dependent CREB phosphorylation is regulated downstream of MAPK. Stimulation of WT hippocampal neurons triggered the co-translocation of PER1 and the CREB kinase pP90RSK (pMAPK-activated ribosomal S6 kinase) into the nucleus. In hippocampal neurons from Per1(-/-) mice, however, pP90RSK remained perinuclear. A co-immunoprecipitation assay confirmed a high-affinity interaction between PER1 and pP90RSK. Knocking down endogenous PER1 in hippocampal cells inhibited adenylyl cyclase-dependent CREB activation. Taken together, the PER1-dependent modulation of cytoplasmic-to-nuclear signaling in the murine hippocampus provides a molecular explanation for how the circadian system potentially shapes a temporal framework for daytime-dependent memory performance, and adds a novel facet to the versatility of the clock gene protein PER1. We provide evidence that the circadian clock gene Period1 (Per1) regulates CREB phosphorylation in the mouse hippocampus

Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

Science.gov (United States)

Archer, N S; Nassif, N T; O'Brien, B A

2015-06-01

A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

DA-9801 promotes neurite outgrowth via ERK1/2-CREB pathway in PC12 cells.

Science.gov (United States)

Won, Jong Hoon; Ahn, Kyong Hoon; Back, Moon Jung; Ha, Hae Chan; Jang, Ji Min; Kim, Ha Hyung; Choi, Sang-Zin; Son, Miwon; Kim, Dae Kyong

2015-01-01

In the present study, we examined the mechanisms underlying the effect of DA-9801 on neurite outgrowth. We found that DA-9801 elicits its effects via the mitogen-activated protein kinase (MEK) extracellular signal-regulated kinase (ERK)1/2-cAMP response element-binding protein (CREB) pathway. DA-9801, an extract from a mixture of Dioscorea japonica and Dioscorea nipponica, was reported to promote neurite outgrowth in PC12 cells. The effects of DA-9801 on cell viability and expression of neuronal markers were evaluated in PC12 cells. To investigate DA-9801 action, specific inhibitors targeting the ERK signaling cascade were used. No cytotoxicity was observed in PC12 cells at DA-9801 concentrations of less than 30 µg/mL. In the presence of nerve growth factor (NGF, 2 ng/mL), DA-9801 promoted neurite outgrowth and increased the relative mRNA levels of neurofilament-L (NF-L), a marker of neuronal differentiation. The Raf-1 inhibitor GW5074 and MEK inhibitor PD98059 significantly attenuated DA-9801-induced neurite outgrowth. Additionally, the MEK1 and MEK2 inhibitor SL327 significantly attenuated the increase in the percentage of neurite-bearing PC12 cells induced by DA-9801 treatment. Conversely, the selective p38 mitogen-activated protein kinase inhibitor SB203580 did not attenuate the DA-9801 treatment-induced increase in the percentage of neurite-bearing PC12 cells. DA-9801 enhanced the phosphorylation of ERK1/2 and CREB in PC12 cells incubated with and without NGF. Pretreatment with PD98059 blocked the DA-9801-induced phosphorylation of ERK1/2 and CREB. In conclusion, DA-9801 induces neurite outgrowth by affecting the ERK1/2-CREB signaling pathway. Insights into the mechanism underlying this effect of DA-9801 may suggest novel potential strategies for the treatment of peripheral neuropathy.

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

Science.gov (United States)

Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

2017-10-19

The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

Dicty_cDB: SLC433 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

IL-1β Upregulates StAR and Progesterone Production Through the ERK1/2- and p38-Mediated CREB Signaling Pathways in Human Granulosa-Lutein Cells.

Science.gov (United States)

Dang, Xuan; Zhu, Qinling; He, Yaqiong; Wang, Yuan; Lu, Yao; Li, Xiaoxue; Qi, Jia; Wu, Hasiximuke; Sun, Yun

2017-10-01

The proinflammatory cytokine interleukin-1β (IL-1β) may be involved in several ovulation-associated events, such as protease synthesis, prostaglandin production, and steroidogenesis in granulosa cells. However, the exact effect of IL-1β on progesterone synthesis in granulosa cells and the underlying mechanism remain unclear. By using cultured granulosa-lutein cells collected from women undergoing in vitro fertilization or intracytoplasmic sperm injection, we found that IL-1β upregulated steroidogenic acute regulatory protein (StAR) expression and progesterone synthesis in granulosa-lutein cells, which was comparable with luteinizing hormone effect and could be abolished by an IL-1 receptor antagonist. Moreover, IL-1β activated the phosphorylation of cyclic adenosine monophosphate response element-binding protein (CREB), and knockdown of CREB attenuated the induction of StAR expression and progesterone synthesis by IL-1β in granulosa-lutein cells. Furthermore, IL-1β activated the extracellular signal-regulated kinase (ERK)1/2 and p38 pathways and inhibition of the ERK1/2 and p38 pathways attenuated the IL-1β-induced phosphorylation of CREB, StAR expression, and progesterone synthesis in granulosa-lutein cells. In conclusion, IL-1β could upregulate StAR expression and stimulate progesterone biosynthesis through increase in CREB phosphorylation via activating the ERK1/2 and p38 pathways in human granulosa-lutein cells. Copyright © 2017 Endocrine Society.

Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

Science.gov (United States)

Rao, Suryadevara S; Hildebrand, David

2009-10-01

The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

Science.gov (United States)

Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

2017-01-01

Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Involvement of TORC2, a CREB co-activator, in the in vivo-specific transcriptional control of HTLV-1

Directory of Open Access Journals (Sweden)

Furuta Rika A

2009-08-01

Full Text Available Abstract Background Human T-cell leukemia virus type 1 (HTLV-1 causes adult T -cell leukemia (ATL but the expression of HTLV-1 is strongly suppressed in the peripheral blood of infected people. However, such suppression, which may explain the long latency in the development of ATL, is readily reversible, and viral expression resumes quickly with ex vivo culture of infected T -cells. To investigate the mechanism of in vivo -specific transcriptional suppression, we established a mouse model in which mice were intraperitoneally administered syngeneic EL4 T -lymphoma cells transduced with a recombinant retrovirus expressing a GFP-Tax fusion protein, Gax, under the control of the HTLV-1 enhancer (EL4-Gax. Results Gax gene transcription was silenced in vivo but quickly up-regulated in ex vivo culture. Analysis of integrated Gax reporter gene demonstrated that neither CpG methylation of the promoter DNA nor histone modification was associated with the reversible suppression. ChIP-analysis of LTR under suppression revealed reduced promoter binding of TFIIB and Pol-II, but no change in the binding of CREB or CBP/p300 to the viral enhancer sequence. However, the expression of TORC2, a co-activator of CREB, decreased substantially in the EL4-Gax cells in vivo, and this returned to normal levels in ex vivo culture. The reduced expression of TORC2 was associated with translocation from the nucleus to the cytoplasm. A knock-down experiment with siRNA confirmed that TORC2 was the major functional protein of the three TORC-family proteins (TORC1, 2, 3 in EL4-Gax cells. Conclusion These results suggest that the TORC2 may play an important role in the in vivo -specific transcriptional control of HTLV-1. This study provides a new model for the reversible mechanism that suppresses HTLV-1 expression in vivo without the DNA methylation or hypoacetylated histones that is observed in the primary cells of most HTLV-1 -infected carriers and a substantial number of ATL

Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

Science.gov (United States)

Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

2014-04-01

Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

Dicty_cDB: SLC402 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

Aripiprazole Increases the PKA Signalling and Expression of the GABAA Receptor and CREB1 in the Nucleus Accumbens of Rats.

Science.gov (United States)

Pan, Bo; Lian, Jiamei; Huang, Xu-Feng; Deng, Chao

2016-05-01

The GABAA receptor is implicated in the pathophysiology of schizophrenia and regulated by PKA signalling. Current antipsychotics bind with D2-like receptors, but not the GABAA receptor. The cAMP-responsive element-binding protein 1 (CREB1) is also associated with PKA signalling and may be related to the positive symptoms of schizophrenia. This study investigated the effects of antipsychotics in modulating D2-mediated PKA signalling and its downstream GABAA receptors and CREB1. Rats were treated orally with aripiprazole (0.75 mg/kg, ter in die (t.i.d.)), bifeprunox (0.8 mg/kg, t.i.d.), haloperidol (0.1 mg/kg, t.i.d.) or vehicle for 1 week. The levels of PKA-Cα and p-PKA in the prefrontal cortex (PFC), nucleus accumbens (NAc) and caudate putamen (CPu) were detected by Western blots. The mRNA levels of Gabrb1, Gabrb2, Gabrb3 and Creb1, and their protein expression were measured by qRT-PCR and Western blots, respectively. Aripiprazole elevated the levels of p-PKA and the ratio of p-PKA/PKA in the NAc, but not the PFC and CPu. Correlated with this elevated PKA signalling, aripiprazole elevated the mRNA and protein expression of the GABAA (β-1) receptor and CREB1 in the NAc. While haloperidol elevated the levels of p-PKA and the ratio of p-PKA/PKA in both NAc and CPu, it only tended to increase the expression of the GABAA (β-1) receptor and CREB1 in the NAc, but not the CPu. Bifeprunox had no effects on PKA signalling in these brain regions. These results suggest that aripiprazole has selective effects on upregulating the GABAA (β-1) receptor and CREB1 in the NAc, probably via activating PKA signalling.

2-(4-Methoxyphenyl)ethyl-2-acetamido-2-deoxy-β-D-pyranoside confers neuroprotection in cell and animal models of ischemic stroke through calpain1/PKA/CREB-mediated induction of neuronal glucose transporter 3

Energy Technology Data Exchange (ETDEWEB)

Yu, Shu; Cheng, Qiong; Li, Lu; Liu, Mei; Yang, Yumin; Ding, Fei, E-mail: dingfei@ntu.edu.cn

2014-06-15

Salidroside is proven to be a neuroprotective agent of natural origin, and its analog, 2-(4-Methoxyphenyl)ethyl-2-acetamido-2-deoxy-β-D-pyranoside (named SalA-4 g), has been synthesized in our lab. In this study, we showed that SalA-4 g promoted neuronal survival and inhibited neuronal apoptosis in primary hippocampal neurons exposed to oxygen and glucose deprivation (OGD) and in rats subjected to ischemia by transient middle cerebral artery occlusion (MCAO), respectively, and that SalA-4 g was more neuroprotective than salidroside. We further found that SalA-4 g elevated glucose uptake in OGD-injured primary hippocampal neurons and increased the expression and recruitment of glucose transporter 3 (GLUT3) in ischemic brain. Signaling analysis revealed that SalA-4 g triggered the phosphorylation of CREB, and increased the expression of PKA RII in primary hippocampal neurons exposed to OGD injury, while inhibition of PKA/CREB by H-89 alleviated the elevation in glucose uptake and GLUT3 expression, and blocked the protective effects of SalA-4 g. Moreover, SalA-4 g was noted to inhibit intracellular Ca{sup 2+} influx and calpain1 activation in OGD-injured primary hippocampal neurons. Our results suggest that SalA-4 g neuroprotection might be mediated by increased glucose uptake and elevated GLUT3 expression through calpain1/PKA/CREB pathway. - Highlights: • A salidroside (Sal) analog (SalA-4 g) is prepared to be more neuroprotective than Sal. • SalA-4 g protected hippocampal neurons from oxygen and glucose deprivation insult. • SalA-4 g reduced ischemic injury after transient middle cerebral artery occlusion in rats. • Neuroprotection of SalA-4 g was mediated by GLUT3 level via calpain/PKA/CREB pathway.

2-(4-Methoxyphenyl)ethyl-2-acetamido-2-deoxy-β-D-pyranoside confers neuroprotection in cell and animal models of ischemic stroke through calpain1/PKA/CREB-mediated induction of neuronal glucose transporter 3

International Nuclear Information System (INIS)

Yu, Shu; Cheng, Qiong; Li, Lu; Liu, Mei; Yang, Yumin; Ding, Fei

2014-01-01

Salidroside is proven to be a neuroprotective agent of natural origin, and its analog, 2-(4-Methoxyphenyl)ethyl-2-acetamido-2-deoxy-β-D-pyranoside (named SalA-4 g), has been synthesized in our lab. In this study, we showed that SalA-4 g promoted neuronal survival and inhibited neuronal apoptosis in primary hippocampal neurons exposed to oxygen and glucose deprivation (OGD) and in rats subjected to ischemia by transient middle cerebral artery occlusion (MCAO), respectively, and that SalA-4 g was more neuroprotective than salidroside. We further found that SalA-4 g elevated glucose uptake in OGD-injured primary hippocampal neurons and increased the expression and recruitment of glucose transporter 3 (GLUT3) in ischemic brain. Signaling analysis revealed that SalA-4 g triggered the phosphorylation of CREB, and increased the expression of PKA RII in primary hippocampal neurons exposed to OGD injury, while inhibition of PKA/CREB by H-89 alleviated the elevation in glucose uptake and GLUT3 expression, and blocked the protective effects of SalA-4 g. Moreover, SalA-4 g was noted to inhibit intracellular Ca 2+ influx and calpain1 activation in OGD-injured primary hippocampal neurons. Our results suggest that SalA-4 g neuroprotection might be mediated by increased glucose uptake and elevated GLUT3 expression through calpain1/PKA/CREB pathway. - Highlights: • A salidroside (Sal) analog (SalA-4 g) is prepared to be more neuroprotective than Sal. • SalA-4 g protected hippocampal neurons from oxygen and glucose deprivation insult. • SalA-4 g reduced ischemic injury after transient middle cerebral artery occlusion in rats. • Neuroprotection of SalA-4 g was mediated by GLUT3 level via calpain/PKA/CREB pathway

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

Directory of Open Access Journals (Sweden)

Hassen Hadj-Kacem

2010-01-01

Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

Science.gov (United States)

Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

2010-01-01

The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

Science.gov (United States)

Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

2015-01-01

Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

Dicty_cDB: SLC428 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

Dicty_cDB: SLC461 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

Dicty_cDB: SLC437 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

Cytoplasmic location of α1A voltage-gated calcium channel C-terminal fragment (Cav2.1-CTF aggregate is sufficient to cause cell death.

Directory of Open Access Journals (Sweden)

Makoto Takahashi

Full Text Available The human α1A voltage-dependent calcium channel (Cav2.1 is a pore-forming essential subunit embedded in the plasma membrane. Its cytoplasmic carboxyl(C-tail contains a small poly-glutamine (Q tract, whose length is normally 4∼19 Q, but when expanded up to 20∼33Q, the tract causes an autosomal-dominant neurodegenerative disorder, spinocerebellar ataxia type 6 (SCA6. A recent study has shown that a 75-kDa C-terminal fragment (CTF containing the polyQ tract remains soluble in normal brains, but becomes insoluble mainly in the cytoplasm with additional localization to the nuclei of human SCA6 Purkinje cells. However, the mechanism by which the CTF aggregation leads to neurodegeneration is completely elusive, particularly whether the CTF exerts more toxicity in the nucleus or in the cytoplasm. We tagged recombinant (rCTF with either nuclear-localization or nuclear-export signal, created doxycyclin-inducible rat pheochromocytoma (PC12 cell lines, and found that the CTF is more toxic in the cytoplasm than in the nucleus, the observations being more obvious with Q28 (disease range than with Q13 (normal-length. Surprisingly, the CTF aggregates co-localized both with cAMP response element-binding protein (CREB and phosphorylated-CREB (p-CREB in the cytoplasm, and Western blot analysis showed that the quantity of CREB and p-CREB were both decreased in the nucleus when the rCTF formed aggregates in the cytoplasm. In human brains, polyQ aggregates also co-localized with CREB in the cytoplasm of SCA6 Purkinje cells, but not in other conditions. Collectively, the cytoplasmic Cav2.1-CTF aggregates are sufficient to cause cell death, and one of the pathogenic mechanisms may be abnormal CREB trafficking in the cytoplasm and reduced CREB and p-CREB levels in the nuclei.

Cytoplasmic Location of α1A Voltage-Gated Calcium Channel C-Terminal Fragment (Cav2.1-CTF) Aggregate Is Sufficient to Cause Cell Death

Science.gov (United States)

Takahashi, Makoto; Obayashi, Masato; Ishiguro, Taro; Sato, Nozomu; Niimi, Yusuke; Ozaki, Kokoro; Mogushi, Kaoru; Mahmut, Yasen; Tanaka, Hiroshi; Tsuruta, Fuminori; Dolmetsch, Ricardo; Yamada, Mitsunori; Takahashi, Hitoshi; Kato, Takeo; Mori, Osamu; Eishi, Yoshinobu; Mizusawa, Hidehiro; Ishikawa, Kinya

2013-01-01

The human α1A voltage-dependent calcium channel (Cav2.1) is a pore-forming essential subunit embedded in the plasma membrane. Its cytoplasmic carboxyl(C)-tail contains a small poly-glutamine (Q) tract, whose length is normally 4∼19 Q, but when expanded up to 20∼33Q, the tract causes an autosomal-dominant neurodegenerative disorder, spinocerebellar ataxia type 6 (SCA6). A recent study has shown that a 75-kDa C-terminal fragment (CTF) containing the polyQ tract remains soluble in normal brains, but becomes insoluble mainly in the cytoplasm with additional localization to the nuclei of human SCA6 Purkinje cells. However, the mechanism by which the CTF aggregation leads to neurodegeneration is completely elusive, particularly whether the CTF exerts more toxicity in the nucleus or in the cytoplasm. We tagged recombinant (r)CTF with either nuclear-localization or nuclear-export signal, created doxycyclin-inducible rat pheochromocytoma (PC12) cell lines, and found that the CTF is more toxic in the cytoplasm than in the nucleus, the observations being more obvious with Q28 (disease range) than with Q13 (normal-length). Surprisingly, the CTF aggregates co-localized both with cAMP response element-binding protein (CREB) and phosphorylated-CREB (p-CREB) in the cytoplasm, and Western blot analysis showed that the quantity of CREB and p-CREB were both decreased in the nucleus when the rCTF formed aggregates in the cytoplasm. In human brains, polyQ aggregates also co-localized with CREB in the cytoplasm of SCA6 Purkinje cells, but not in other conditions. Collectively, the cytoplasmic Cav2.1-CTF aggregates are sufficient to cause cell death, and one of the pathogenic mechanisms may be abnormal CREB trafficking in the cytoplasm and reduced CREB and p-CREB levels in the nuclei. PMID:23505410

Dicty_cDB: SLC495 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

Dicty_cDB: SLC469 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

Dicty_cDB: SLC452 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

Science.gov (United States)

Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

2017-01-01

ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

Dicty_cDB: SLC442 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

Science.gov (United States)

Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

2011-07-29

Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

Characterization of SLC transporters in human skin

Directory of Open Access Journals (Sweden)

Marion Alriquet

2015-03-01

Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

Atorvastatin inhibits insulin synthesis by inhibiting the Ras/Raf/ERK/CREB pathway in INS-1 cells

Science.gov (United States)

Sun, Hongxi; Li, Yu; Sun, Bei; Hou, Ningning; Yang, Juhong; Zheng, Miaoyan; Xu, Jie; Wang, Jingyu; Zhang, Yi; Zeng, Xianwei; Shan, Chunyan; Chang, Bai; Chen, Liming; Chang, Baocheng

2016-01-01

Abstract Backround: Type 2 diabetes has become a global epidemic disease. Atorvastatin has become a cornerstone in the prevention and treatment of atherosclerosis. However, increasing evidence showed that statins can dose-dependently increase the risk of diabetes mellitus. The mechanism is not clear. Objective: The Ras complex pathway (Ras/Raf/extracellular signal-regulated kinase [ERK]/cAMP response element-binding protein [CREB]) is the major pathway that regulates the gene transcription. Except for the inhibition of cholesterol synthesis by inhibiting the 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-COA) reductase, statins can also downregulate the phosphorylation of a series of downstream substrates including the key proteins of the Ras complex pathway, therefore may inhibit the insulin syntheses in pancreatic beta cells. In our study, we investigated the inhibitory effect and the underlying mechanism of atorvastatin on insulin synthesis in rat islets. Methods: Islets were isolated from Wistar rats and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium. The insulin content in the medium was measured by radioimmunoassay before and after the treatment of 50 μM atorvastatin. Effect of atorvastatin on the expression of insulin message Ribonucleic acid (mRNA) in pancreatic islet beta cells was also detected using quantitative real-time polymerase chain reaction. Western blotting was used to explore the possible role of the Ras complex pathway (Ras/Raf/ERK/CREB) in atorvastatin-inhibited insulin synthesis. The effects of atorvastatin on the binding of nuclear transcription factor p-CREB with CRE in INS-1 cells were examined via chromatin immunoprecipitation assay. Results: Compared with the control group, the insulin level decreased by 27.1% at 24 hours after atorvastatin treatment. Atorvastatin inhibited insulin synthesis by decreasing insulin mRNA expression of pancreatic islet beta cells. The activities of Ras, Raf-1, and p-CREB in the Ras complex

Cathepsin D Specifically Cleaves the Chemokines Macrophage Inflammatory Protein-1α, Macrophage Inflammatory Protein-1β, and SLC That Are Expressed in Human Breast Cancer

Science.gov (United States)

Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca

2003-01-01

Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610

Dicty_cDB: SLC490 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC484 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

Science.gov (United States)

Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

2012-01-01

Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Dicty_cDB: SLC448 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

Dicty_cDB: SLC444 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

Positive selection in the SLC11A1 gene in the family Equidae.

Science.gov (United States)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

2016-05-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

Science.gov (United States)

Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

2018-04-12

Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

Photochemistry of 1 and 2-(2-methylphenyl)-1,6-heptadiene. [4a-methyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene

Energy Technology Data Exchange (ETDEWEB)

Barrows, R.D.; Hornback, J.M.

1982-01-01

In an attempt to synthesize partially saturated phenanthrene derivatives by an intramolecular Diels-Alder reaction between a photochemically produced o-xylylene (diene) and a tethered dienophile, it was found that 1 and 2 underwent a photochemically allowed (2 + 2) cycloaddition. Irradiation of 1 gave 6-(2-methylphenyl)bicyclo(3.2.0)heptane in 86% yield. Upon irradiation of 2, a benzvalene rearrangement of 2 first took place, producing the meta isomer 2-(3-methylphenyl)-1,6-heptadiene, followed by a (2 + 2) photocycloaddition giving 1-(3-methylphenyl)bicyclo(3.2.0)heptane in 15% yield. Direct irradiation of 2-(3-methylphenyl)-1,6-heptadiene gave the same bicyclo derivative as 2 in 34% yield. Examination of the fluorescence spectra of 1 and 2 in comparison with 1-(2-methylphenyl)propene and 2-(2-methylphenyl)-1-butene, respectively, has shown that 1 may be biased toward (2 + 2) cycloaddition where 2 is not biased toward (2 + 2) photocycloization. Attempts to produce 4a-methyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene by an intramolecular Diels-Alder reaction of the o-xylylene produced by irradiation of 3 will also be described.

Defining the phenotypic spectrum of SLC6A1 mutations

DEFF Research Database (Denmark)

Johannesen, Katrine M.; Gardella, Elena; Linnankivi, Tarja

2018-01-01

/polyspikes-and-slow waves in 25/31. Two patients developed an EEG pattern resembling electrical status epilepticus during sleep. Ataxia was observed in 7/34 cases. We describe 7 truncating and 18 missense variants, including 4 recurrent variants (Gly232Val, Ala288Val, Val342Met, and Gly362Arg). Significance: Most patients...... members. Four previously published cases were included for further electroclinical description. In total, we reviewed the electroclinical data of 34 subjects. Results: Cognitive development was impaired in 33/34 (97%) subjects; 28/34 had mild to moderate ID, with language impairment being the most common...... feature. Epilepsy was diagnosed in 31/34 cases with mean onset at 3.7 years. Cognitive assessment before epilepsy onset was available in 24/31 subjects and was normal in 25% (6/24), and consistent with mild ID in 46% (11/24) or moderate ID in 17% (4/24). Two patients had speech delay only, and 1 had...

Dicty_cDB: SLC483 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Family-Based Association Study Between SLC2A1, HK1, and LEPR Polymorphisms With Myelomeningocele in Chile

Science.gov (United States)

Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva

2013-01-01

Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181

Dicty_cDB: SLC478 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

Dicty_cDB: SLC429 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

1,1′-{1,4-Phenylene bis[3-(6-chloro-2-methyl-4-phenylquinolin-3-yl-4,5-dihydro-1H-pyrazole-5,1-diyl]}dibutan-1-one

Directory of Open Access Journals (Sweden)

Allaoua Kedjadja

2015-10-01

Full Text Available A new polycyclic compound, 1,1′-{1,4-phenylene bis[3-(6-chloro-2-methyl-4-phenylquinolin-3-yl-4,5-dihydro-1H-pyrazole-5,1-diyl]}dibutan-1-one (3 has been synthesized by cyclocondensation of (2E,2′E-1,1′-bis(6-chloro-2-methyl-4-phenylquinolin-3-yl-3,3′-(1,4-phenylenediprop-2-en-1-one (2 and hydrazine hydrate in butanoic acid. The structure of this compound was established by elemental analysis, 1H-NMR, 13C-NMR, mass and IR spectroscopy.

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC455 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

A 7666-bp genomic deletion is frequent in Chinese Han deaf patients with non-syndromic enlarged vestibular aqueduct but without bi-allelic SLC26A4 mutations.

Science.gov (United States)

Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao

2015-12-01

To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

Science.gov (United States)

Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

2017-07-01

Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.