Kicker for the SLC electron damping ring
International Nuclear Information System (INIS)
Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.
1987-01-01
The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see
Bunch length measurements in the SLC damping ring
International Nuclear Information System (INIS)
Decker, F.J.; Limberg, T.; Minty, M.; Ross, M.
1993-05-01
The synchrotron light of the SLC damping ring was used to measure the bunch length with a streak camera at different times in the damping cycle. There are bunch length oscillations after injection, different equilibrium length during the cycle due to rf manipulations to avoid microwave instability oscillations, and just before extraction there is a longitudinal phase space rotation (bunch muncher) to shorten the bunch length. Measurements under these different conditions are presented and compared with BPM pulse height signals. Calibration and adjustment issues and the connection of the streak camera to the SLC control system are also discussed
Impedance calculations for the improved SLC damping rings
International Nuclear Information System (INIS)
Bane, K.L.F.; Ng, C.K.
1993-04-01
A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs
The calculated longitudinal impedance of the SLC [Stanford Linear Collider] damping rings
International Nuclear Information System (INIS)
Bane, K.L.F.
1988-05-01
A high level of current dependent bunch lengthening has been observed in the north damping ring of the Stanford Linear Collider (SLC), indicating that the ring's impedance is very inductive. This level of bunch lengthening will limit the performance of the SLC. In order to study the problem of bunch lengthening in the damping ring and the possibility of reducing their inductance we compute, in this report, the longitudinal impedance of the damping ring vacuum chamber. More specifically we find the response function of the ring to a short gaussian bunch. This function will later be used as a driving term in the longitudinal equation of motion. We also identify the important inductive elements of the vacuum chamber and estimate their contribution to the total ring inductance. This information will be useful in assessing the effect of vacuum chamber modifications. 7 refs. , 8 figs., 1 tab
Bunch lengthening in the SLC [Stanford Linear Collider] damping rings
International Nuclear Information System (INIS)
Bane, K.L.F.
1990-02-01
A high level of current dependent bunch lengthening has been observed on the North damping ring of the Stanford Linear Collider (SLC). At currents of 3 x 10 10 this behavior does not appear to degrade the machine's performance significantly. However, at the higher currents that are envisioned for the future one fears that its performance could be greatly degraded due to the phenomenon of bunch lengthening. This was the motivation for the work described in this paper. In this paper we calculate the longitudinal impedance of the damping ring vacuum chamber. More specifically, in this paper we find the response function of the ring to a short Gaussian bunch, which we call the Green function wake. In addition, we try to estimate the relative importance of the different vacuum chamber objects, in order to see how we might reduce the ring impedance. This paper also describes bunch length measurements performed on the North damping ring. We use the Green function wake, discussed above, to compute the bunch lengthening. Then we compare these results with those obtained from the measurements. In addition, we calculate the current dependence of the tune distribution
Bunch lengthening calculations for the SLC [Stanford Linear Collider] damping rings
International Nuclear Information System (INIS)
Bane, K.L.F.; Ruth, R.D.
1989-03-01
The problem of bunch lengthening in electron storage rings has been treated by many people, and there have been many experiments. In the typical experiment, the theory is used to determine the impedance of the ring. What has been lacking thus far, however, is a calculation of bunch lengthening that uses a carefully calculated ring impedance (or wakefield). In this paper we begin by finding the potential well distortion due to some very simple impedance models, in order to illustrate different types of bunch lengthening behavior. We then give a prescription for extending potential well calculations into the turbulent regime once the threshold is known. Then finally, using the wakefield calculated for the SLC damping rings, combined with the measured value of the threshold, we calculate bunch lengthening for the damping rings, and compare the results with the measurements. 9 refs., 6 figs
An active feedback system to control synchrotron oscillations in the SLC Damping Rings
International Nuclear Information System (INIS)
Corredoura, P.L.; Pellegrin, J.L.; Schwarz, H.D.; Sheppard, J.C.
1989-03-01
Initially the SLC Damping Rings accomplished Robinson instability damping by operating the RF accelerating cavities slightly detuned. In order to be able to run the cavities tuned and achieve damping for Robinson instability and synchrotron oscillations at injection an active feedback system has been developed. This paper describes the theoretical basis for the feedback system and the development of the hardware. Extensive measurements of the loop response including stored beam were performed. Overall performance of the system is also reported. 3 refs., 6 figs
Simulations of Bunch Precompression at High Currents in the SLC Damping Rings
International Nuclear Information System (INIS)
Bane, K.L.F.; Minty, M.G.; Chao, A.W.
2011-01-01
In the Stanford Linear Collider (SLC) each beam, after leaving a damping ring, is compressed in the Ring-to-Linac (RTL) transfer line before entering the linear accelerator. At a bunch population of 4.0 x 10 10 particles, due to the limited energy acceptance of the RTL, approximately 15% of the beam has normally been lost. During the 1996 run, however, to eliminate this loss the bunch was partially precompressed in the damping ring, just before extraction; the beam loss in the RTL was reduced to almost zero. The operation and performance of precompression are presented by Minty et al. (1999). Also given is an analysis which, however, does not include the effects of the longitudinal wakefield on the beam dynamics. In this report we extend that analysis to include these effects.
Energy dependence of the emittance of damping ring beams
International Nuclear Information System (INIS)
Stiening, R.
1985-01-01
The energy at which the SLC damping rings are operated was chosen to be 1.21 GeV. At the time that that specification was made, the repetition rate of the SLC was expected to be 180 Hz. It is now anticipated that the repetition rate during the initial year of operation of the SLC will be 120 Hz. The following curves which show the output emittance of the damping rings as a function of input emittance and energy suggest that there is a range of energies over which the rings can be operated without changing the SLC luminosity. It should be noted that in the era of polarized beams, the damping ring energy will be fixed at the design value on account of the spin precession required in the LTR and RTL transport lines. The SLC design output emittance of the damping rings is 3 x 10 -5 radian-meters. Because of space charge disruption and quantum emission downstream of the damping rings, much lower values than the design value may not have a large beneficial effect on the luminosity. 3 figures
Ion effects in the SLC electron damping ring under exceptionally poor vacuum conditions
International Nuclear Information System (INIS)
Zimmermann, F.; Krejcik, P.; Minty, M.; Pritzkau, D.; Raubenheimer, T.; Ross, M.; Woodley, M.
1997-10-01
In 1996, due to a catastrophic kicker chamber failure in the SLC electron damping ring, the ring vacuum system was contamianted for several months. During this time, the vertical emittance of the beam extracted from the ring was increased by a large factor (4--20). The emittance slowly decreased as the vacuum pressure gradually improved. At the same time, an intermittent vertical instability was observed. Both the emittance blow-up and the instability behavior depended strongly on beam current, ring pressure, number of bunches in the ring (1 or 2), duty cycle, store time and betatron tunes. In this report, the authors describe the observations, and compare them with predictions from classical ion-trapping and ion-instability theories
Status of the SLC damping rings
International Nuclear Information System (INIS)
Hutton, A.M.; Davies-White, W.A.; Delahaye, J.P.
1985-06-01
Electron beams of full design energy 1.21 GeV and nearly full design intensity 4 x 10 10 particles/pulse (design 5 x 10 10 ) have been extracted from the Stanford Linac and successfully stored in the electron damping ring. Beams of less intensity have been extracted from the ring and reinjected into the Linac. The present intensity limits are not thought to be fundamental. The operating experience with the electron ring and the status of the construction of the positron ring will be discussed. 11 refs., 1 fig., 2 tabs
Manufacture of fast-pulsed magnets for the SLC damping rings
International Nuclear Information System (INIS)
Cassel, R.; Gross, G.; Harvey, A.; Mattison, T.
1992-01-01
A second-generation fast kicker magnet (and its power supply) was designed by Fermilab for the SLC electron damping ring. The requirements were to inject and extract two bunches of electrons, with the following magnetic field specifications: Integral peak magnetic field = 0.021 T-m, Rise/fall time (0-100%) = 56.03 ns maximum, Flat-top duration = 61.62 ns. The flat-top does not imply a plateau, but two time-stable spots of equal magnitude, since the electron bunches are short (20 ps). Many of the early problems with these magnets have been studied intensely during the last two years, and substantial progress has been made. In particular, vacuum potting with room-temperature curing silicone rubber (RTV) has been refined to give reliable high-voltage service up to 18 kV/mm, and life-times of about a year despite stored beam intensities of 3 x 10 10 electrons/bunch at 120 pps
Operating experience with high beam currents and transient beam loading in the SLC damping rings
International Nuclear Information System (INIS)
Minty, M.G.; Akre, R.; Krejcik, P.; Siemann, R.H.
1995-01-01
During the 1994 SLC run the nominal operating intensity in the damping rings was raised from 3.5 x 10 10 to greater than 4 x 10 10 particles per bunch (ppb). Stricter regulation of rf system parameters was required to maintain stability of the rf system and particle beam. Improvements were made in the feedback loops which control the cavity amplitude and loading angles. Compensation for beam loading was also required to prevent klystron saturation during repetition rate changes. To minimize the effects of transient loading on the rf system, the gain of the direct rf feedback loop and the loading angles were optimized
The electron damping ring for the SLAC Linear Collider
International Nuclear Information System (INIS)
Davies-White, W.; Hutton, A.; Harvey, A.
1987-10-01
A second damping ring to store and damp two electron bunches for the SLC project was constructed in 1985 and brought into operation early in 1986. Although generally similar to the damping ring (now used for positrons) constructed earlier, there are a number of design improvements and changes. The dipole magnetic field was raised to 2.1 T to improve damping. Sextupole fields were provided by separate permanent magnets, rather than being incorporated in the dipoles. The vacuum chambers, including the beam position monitors, were re-designed for lower longitudinal impedance. A new kicker was developed by Fermilab to handle the two electron bunches. Improvements were made to the dc septum magnet design. Several of the features are described in detail elsewhere. Where possible, the improvements were incorporated in an upgrade of the earlier damping ring
Design of the SLC damping ring to linac transport lines
International Nuclear Information System (INIS)
Fieguth, T.H.; Murray, J.J.
1983-07-01
The first and second order optics for the damping ring to linac transport line are designed to preserve the damped transverse emittance while simultaneously compressing the bunch length of the beam to that length required for reinjection into the linac. This design, including provisions for future control of beam polarization, is described
Energy spread in SLC linac with Landau damping
International Nuclear Information System (INIS)
Seeman, J.
1984-01-01
The possibility of using Landau damping to reduce the growth of the beam size due to transverse wake fields has been known for some time. Recently K. Bane has calculated the effects of Landau damping for the SLC. The energy spread is then slowly removed so that at the end of the linac it has returned to the SLC specification of less than +0.5%. The purpose of the energy spread is to reduce the resonant driving of the tail of the bunch by the head. In this note the expected energy spreads within the beam are tabulated at various positions along the linac for use by those people designing momentum dependent equipment and for those interested in Landau damping
Pulse shape adjustment for the SLC damping ring kickers
International Nuclear Information System (INIS)
Mattison, T.; Cassel, R.; Donaldson, A.; Fischer, H.; Gough, D.
1991-05-01
The difficulties with damping ring kickers that prevented operation of the SLAC Linear Collider in full multiple bunch mode have been overcome by shaping the current pulse to compensate for imperfections in the magnets. The risetime was improved by a peaking capacitor, with a tunable inductor to provide a locally flat pulse. The pulse was flattened by an adjustable droop inductor. Fine adjustment was provided by pulse forming line tuners driven by stepping motors. Further risetime improvement will be obtained by a saturating ferrite pulse sharpener. 4 refs., 3 figs
Three bunch energy stabilization for the SLC injector
International Nuclear Information System (INIS)
Sheppard, J.C.; Almog, I.; Bambade, P.S.; Clendenin, J.E.; Jobe, R.K.; Phinney, N.; Shoaee, H.; Stiening, R.F.; Thompson, K.A.
1986-09-01
Slow feedback has been developed to control the energy and energy spread of the beams which are injected into the SLC damping rings. Within a single RF pulse, two bunches of electrons and one bunch of positrons are accelerated to an energy of 1.21 GeV in the injector of the SLC. The two electron bunches are deflected into the north damping ring while the positrons are targeted into the south ring. In order to fit into the acceptance of the rings, the composite energy deviation and energy spread of the beams must be less than 2% full width. Control of the beam energy characteristics is accomplished with a set of computer controlled feedback loops which monitor the parameters of the three bunches and make adjustments to the available RF energy, RF phasing, and RF timing. This paper presents an overview of the feedback algorithms and of the special hardware developments, and reports on the operational status of the processes
Study for ILC Damping Ring at KEKB
Energy Technology Data Exchange (ETDEWEB)
Flanagan, J.W.; Fukuma, H.; Kanazawa, K.I.; Koiso, H.; Masuzawa, M.; Ohmi, Kazuhito; Ohnishi, Y.; Oide, Katsunobu; Suetsugu, Y.; Tobiyama, M.; /KEK, Tsukuba; Pivi, M.; /SLAC
2011-11-04
ILC damping ring consists of very low emittance electron and positron storage rings. It is necessary for ILC damping ring to study electron cloud effects in such low emittance positron ring. We propose a low emittance operation of KEKB to study the effects.
TOSCA calculations and measurements for the SLAC SLC damping ring dipole magnet
International Nuclear Information System (INIS)
Early, R.A.; Cobb, J.K.
1985-01-01
The SLAC damping ring dipole magnet was originally designed with removable nose pieces at the ends. Recently, a set of magnetic measurements was taken of the vertical component of induction along the center of the magnet for four different pole-end configurations and several current settings. The three dimensional computer code TOSCA, which is currently installed on the National Magnetic Fusion Energy Computer Center's Cray X-MP, was used to computer field values for the four configurations at current settings near saturation. Comparisons were made for magnetic induction as well as effective magnetic lengths for the different configurations
International Nuclear Information System (INIS)
Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.
1991-01-01
The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance
Energy Technology Data Exchange (ETDEWEB)
Rubin, David L. [Cornell Univ., Ithaca, NY (United States). Dept. of Physics
2015-01-23
Accelerators that collide high energy beams of matter and anti-matter are essential tools for the investigation of the fundamental constituents of matter, and the search for new forms of matter and energy. A “Linear Collider” is a machine that would bring high energy and very compact bunches of electrons and positrons (anti-electrons) into head-on collision. Such a machine would produce (among many other things) the newly discovered Higgs particle, enabling a detailed study of its properties. Among the most critical and challenging components of a linear collider are the damping rings that produce the very compact and intense beams of electrons and positrons that are to be accelerated into collision. Hot dilute particle beams are injected into the damping rings, where they are compressed and cooled. The size of the positron beam must be reduced more than a thousand fold in the damping ring, and this compression must be accomplished in a fraction of a second. The cold compact beams are then extracted from the damping ring and accelerated into collision at high energy. The proposed International Linear Collider (ILC), would require damping rings that routinely produce such cold, compact and intense beams. The goal of the Cornell study was a credible design for the damping rings for the ILC. Among the technical challenges of the damping rings; the development of instrumentation that can measure the properties of the very small beams in a very narrow window of time, and mitigation of the forces that can destabilize the beams and prevent adequate cooling, or worse lead to beam loss. One of the most pernicious destabilizing forces is due to the formation of clouds of electrons in the beam pipe. The electron cloud effect is a phenomenon in particle accelerators in which a high density of low energy electrons, build up inside the vacuum chamber. At the outset of the study, it was anticipated that electron cloud effects would limit the intensity of the positron ring
Small horizontal emittance in the TESLA damping ring
International Nuclear Information System (INIS)
Decking, W.
2001-01-01
The present TESLA damping ring is designed for a normalized horizontal emittance of 8x10 -6 m. γ-γ collisions at the TESLA linear collider will benefit from a further decrease of the horizontal emittance. This paper reviews the processes which limit the horizontal emittance in the damping ring. Preliminary estimates on the smallest horizontal emittance for the present TESLA damping ring design as well as an ultimate limit of the emittance reachable with the TESLA damping ring concept will be given
SLC-2000: A luminosity upgrade for the SLC
International Nuclear Information System (INIS)
Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.
1996-01-01
We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)
Electron beam depolarization in a damping ring
International Nuclear Information System (INIS)
Minty, M.
1993-04-01
Depolarization of a polarized electron beam injected into a damping ring is analyzed by extending calculations conventionally applied to proton synchrotrons. Synchrotron radiation in an electron ring gives rise to both polarizing and depolarizing effects. In a damping ring, the beam is stored for a time much less than the time for self polarization. Spin flip radiation may therefore be neglected. Synchrotron radiation without spin flips, however, must be considered as the resonance strength depends on the vertical betatron oscillation amplitude which changes as the electron beam is radiation damped. An expression for the beam polarization at extraction is derived which takes into account radiation damping. The results are applied to the electron ring at the Stanford Linear Collider and are compared with numerical matrix formalisms
Lifetime measurement of ATF damping ring
International Nuclear Information System (INIS)
Okugi, T.; Hayano, H.; Kubo, K.; Naito, T.; Terunuma, N.; Urakawa, J.; Zimmermann, F.
1998-06-01
The purpose of the ATF damping ring is the development of technologies for producing a low emittance beam required in future linear colliders such as JLC. The lifetime of the damping ring is very short (typically a few minutes). It is limited by elastic beam-gas scattering along with a small dynamic aperture, and by single intra-beam scattering (Touschek effect). The Touschek lifetime strongly depends upon the charge density of the beam, especially, the size of the vertical emittance. In this paper, the authors report the results of beam lifetime measurements in the ATF damping ring and the estimation of the vertical emittance from these measurements
Beam dynamic issues in TESLA damping ring
International Nuclear Information System (INIS)
Shiltsev, V.
1996-05-01
In this paper we study general requirements on impedances of the linear collider TESLA damping ring design. Quantitative consideration is performed for 17-km long ''dog-bone'' ring. Beam dynamics in alternative options of 6.3 and 2.3-km long damping rings is briefly discussed. 5 refs., 2 tabs
Dynamic apeerture in damping rings with realistic wigglers
Energy Technology Data Exchange (ETDEWEB)
Cai, Yunhai; /SLAC
2005-05-04
The International Linear Collider based on superconducting RF cavities requires the damping rings to have extremely small equilibrium emittance, huge circumference, fast damping time, and large acceptance. To achieve all of these requirements is a very challenging task. In this paper, we will present a systematic approach to designing the damping rings using simple cells and non-interlaced sextupoles. The designs of the damping rings with various circumferences and shapes, including dogbone, are presented. To model realistic wigglers, we have developed a new hybrid symplectic integrator for faster and accurate evaluation of dynamic aperture of the lattices.
Damping ring designs and issues
International Nuclear Information System (INIS)
Wolski, Andrzej; Decking, Winfried
2003-01-01
The luminosity performance of a future linear collider (LC) will depend critically on the performance of the damping rings. The design luminosities of the current LC proposals require rings with very short damping times, large acceptance, low equilibrium emittance and high beam intensity. We discuss the design strategies for lattices achieving the goals of dynamical stability, examine the challenges for alignment and coupling correction, and consider a variety of collective effects that threaten to limit beam quality. We put the design goals in context by referring to the experience of operating facilities, and outline the further research and development that is needed
International Nuclear Information System (INIS)
Moffeit, K.C.
1987-01-01
The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model
International Nuclear Information System (INIS)
Ross, M.
1993-04-01
The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines
International Nuclear Information System (INIS)
Kim, Eun-San
2003-01-01
This paper shows the results of a numerical study of the impedance in the Accelerator Test Facility damping ring. The longitudinal impedance in the damping ring is shown to be inductive. It is shown that the total impedance |Z || /n| is 0.23 Ω and the inductance is L = 14 nH. In the extremely low emittance beam of the damping ring, bunch lengthening is caused by both the effects of potential-well distortion and intra-beam scattering. In this paper, the bunch-lengthening due to the ring impedance is numerically investigated, and the result shows qualitative agreement with the result of an analysis performed using the bunch-length measurement. With the calculated longitudinal impedance, the instability threshold in the damping ring is estimated to be a bunch population of 3.3 x 10 10 by using both a Vlasov equation approach and a multi-particle tracking method.
The SLC control system - status and development
International Nuclear Information System (INIS)
Phinney, N.; Shoaee, H.
1987-03-01
The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development
International Nuclear Information System (INIS)
Sanchez-Chopitea, L.; Emma, P.; Van Olst, D.
1991-05-01
Beam orbits in the SLC are monitored in real time and the data is stored for future trend and correlation analysis. A background process acquires Beam Position Monitor (BPM) and Toroid data on a periodic basis and saves the general quantities such as orbit RMS and beam intensity in addition to the individual readings. Some of this data is archived by the SLC History Buffer facility and the rest is saved in files for later analysis. This has permitted the tracing of interaction point instabilities to specific devices as far away as the damping rings. In addition, the data is displayed for the operators both in summary and in full form. The different displays can be configured from the control consoles. 2 refs., 5 figs
Recommendation for the Feasibility of more Compact LC Damping Rings
Pivi, M.T.F.; Demma, T.; Guiducci, S.; Suetsugu, Y.; Shibata, K.; Ohmi, K.; Dugan, G.; Palmer, M.; Crittenden, J.A.; Harkay, K.; Boon, L.; Furman, M.A.; Venturini, M.; Celata, C.; Malyshev, O.B.; Papaphilippou, I.
2010-01-01
As part of the international Linear Collider (ILC) collaboration, we have compared the electron cloud (EC) effect for different Damping Ring (DR) designs respectively with 6.4 km and 3.2 km circumference and investigated the feasibility of the shorter damping ring with respect to the electron cloud build-up and related beam instabilities. The studies for a 3.2 km ring were carried out with beam parameters of the ILC Low Power option. A reduced damping ring circumference has been proposed for the new ILC baseline design SB2009 and would allow considerable reduction of the number of components, wiggler magnets and costs. We discuss the impact of the proposed operation of the ILC at high repetition rate 10 Hz and address the necessary modifications for the DRs. We also briefly discuss the plans for future studies including the luminosity upgrade option with shorter bunch spacing, the evaluation of mitigation techniques and the integration of the CesrTA results into the Damping Ring design
Recommendation for the Feasibility of more Compact LC Damping Rings
International Nuclear Information System (INIS)
Pivi, M.T.F.; Wang, L.; Demma, T.; Guiducci, S.; Suetsugu, Y.; Shibata, K.; Ohmi, K.; Dugan, G.; Palmer, M.; Crittenden, J.A.; Harkay, K.; Boon, L.; Furman, M.A.; Venturini, M.; Celata, C.; Malyshev, O.B.; Papaphilippou, I.
2010-01-01
As part of the international Linear Collider (ILC) collaboration, we have compared the electron cloud (EC) effect for different Damping Ring (DR) designs respectively with 6.4 km and 3.2 km circumference and investigated the feasibility of the shorter damping ring with respect to the electron cloud build-up and related beam instabilities. The studies for a 3.2 km ring were carried out with beam parameters of the ILC Low Power option. A reduced damping ring circumference has been proposed for the new ILC baseline design SB2009 (1) and would allow considerable reduction of the number of components, wiggler magnets and costs. We discuss the impact of the proposed operation of the ILC at high repetition rate 10 Hz and address the necessary modifications for the DRs. We also briefly discuss the plans for future studies including the luminosity upgrade option with shorter bunch spacing, the evaluation of mitigation techniques and the integration of the CesrTA results into the Damping Ring design.
Sensitivity Analysis for the CLIC Damping Ring Inductive Adder
Holma, Janne
2012-01-01
The CLIC study is exploring the scheme for an electron-positron collider with high luminosity and a nominal centre-of-mass energy of 3 TeV. The CLIC pre-damping rings and damping rings will produce, through synchrotron radiation, ultra-low emittance beam with high bunch charge, necessary for the luminosity performance of the collider. To limit the beam emittance blow-up due to oscillations, the pulse generators for the damping ring kickers must provide extremely flat, high-voltage pulses. The specifications for the extraction kickers of the CLIC damping rings are particularly demanding: the flattop of the output pulse must be 160 ns duration, 12.5 kV and 250 A, with a combined ripple and droop of not more than ±0.02 %. An inductive adder allows the use of different modulation techniques and is therefore a very promising approach to meeting the specifications. PSpice has been utilised to carry out a sensitivity analysis of the predicted output pulse to the value of both individual and groups of circuit compon...
Calculations of emittance and damping time effects in the SLC damping rings
International Nuclear Information System (INIS)
Limberg, T.; Moshammer, H.; Raubenheimer, T.; Spencer, J.; Siemann, R.
1992-03-01
In a recent NDR machine experiment the transverse emittance was studied as a function of store time and tune. To explain the observed transverse emittance damping time constants, the magnetic measurement data of the longitudinal field of the bending magnets had to be taken into account. The variation of the transverse emittances with tune due to misalignments and the associated anomalous dispersion is studied as well as the effect of synchrobetatron coupling due to dispersion in the RF cavities
Superconducting wiggler magnets for beam-emittance damping rings
Schoerling, Daniel
2012-01-01
Ultra-low emittance beams with a high bunch charge are necessary for the luminosity performance of linear electron-positron colliders, such as the Compact Linear Collider (CLIC). An effective way to create ultra-low emittance beams with a high bunch charge is to use damping rings, or storage rings equipped with strong damping wiggler magnets. The remanent field of the permanent magnet materials and the ohmic losses in normal conductors limit the economically achievable pole field in accelerator magnets operated at around room temperature to below the magnetic saturation induction, which is 2.15 T for iron. In wiggler magnets, the pole field in the center of the gap is reduced further like the hyperbolic cosine of the ratio of the gap size and the period length multiplied by pi. Moreover, damping wiggler magnets require relatively large gaps because they have to accept the un-damped beam and to generate, at a small period length, a large magnetic flux density amplitude to effectively damp the beam emittance....
Damping rates of the SRRC storage ring
International Nuclear Information System (INIS)
Hsu, K.T.; Kuo, C.C.; Lau, W.K.; Weng, W.T.
1995-01-01
The SRRC storage ring is a low emittance synchrotron radiation machine with nominal operation energy 1.3 GeV. The design damping time due to synchrotron radiation is 10.7, 14.4, 8.7 ms for the horizontal, vertical and longitudinal plane, respectively. The authors measured the real machine damping time as a function of bunch current, chromaticity, etc. To damp the transverse beam instability, especially in the vertical plane, they need to increase chromaticity to large positive value. The damping rates are much larger than the design values. Landau damping contribution in the longitudinal plane is quite large, especially in the multibunch mode. The estimated synchrotron tune spread from the Landau damping is in agreement with the measured coherent longitudinal coupled bunch oscillation amplitude
Proceedings of the SLAC/KEK linear collider workshop on damping ring
International Nuclear Information System (INIS)
Urakawa, J.; Yoshioka, M.
1992-07-01
Since the SLAC/KEK joint meeting was first held at SLAC in March 1987, we have had such a meeting annually with the present one the 6th. This meeting is planned to discuss the damping ring issue in particular. We have ever stressed the importance of study of damping rings and considered construction of a test damping ring as key issue for the ATF project, since we started construction of the ATF in 1987. In 1991 we had large-scale reconstruction of a building to make a shielded area where a 1.54 GeV injector linac for the ring is to be installed. (J.P.N.)
Jowett, John M; Zimmermann, Frank; Owen, H
2001-01-01
The Compact Linear Colider (CLIC) is designed to operate at 3 TeV centre-of-mass energy with a total luminosity of 10^35 cm^-2 s^-1. The overall system design leads to extremely demanding requirements on the bunch trains injected into the main libac at frequency of 100 Hz. In particular, the emittances of the intense bunches have to be about an order of magnitude smaller than presently achieved. We describe our approach to finding a damping ring design capable of meeting these requirements. Besides lattice design, emittance and damping rate considerations, a number of scattering and instability effects have to be incorporated into the optimisation of parameters. Among these, intra-bem scattering and the electron cloud effect are two of the most significant.
Chromatic correction in the SLC bunch length compressors
International Nuclear Information System (INIS)
Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.
1991-06-01
The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs
Accelerator physics highlights in the 1997/98 SLC run
International Nuclear Information System (INIS)
Assmann, R.W.; Bane, K.L.F.; Barkow, T.
1998-03-01
The authors report various accelerator physics studies and improvements from the 1997/98 run at the Stanford Linear Collider (SLC). In particular, the authors discuss damping-ring lattice diagnostics, changes to the linac set up, fast control for linac rf phase stability, new emittance tuning strategies, wakefield reduction, modifications of the final-focus optics, longitudinal bunch shaping, and a novel spot-size control at the interaction point (IP)
Optics design of Intrabeam Scattering dominated damping rings
Antoniou, Fanouria; Papaphilippou, Ioannis
A e+/e- linear collider, the Compact Linear Collider (CLIC) is under design at CERN, aiming to explore the terascale particle physics regime. The collider has been optimized at 3 TeV center of mass energy and targets a luminosity of 1034 cm-2 s-1. In order to achieve this high luminosity, high intensity bunches with ultra low emittances, in all three planes, are required. The generation of ultra low emittance is achieved in the Damping Rings (DR) complex of the collider. The large input beam emittances, especially the ones coming from the positron source, and the requirement of ultra low emittance production in a fast repetition time of 20 ms, imply that the beam damping is done in two stages. Thus, a main-damping ring (DR) and a predamping ring (PDR) are needed, for each particle species. The high bunch brightness gives rise to several collective effects, with Intra-beam scattering (IBS) being the main limitation to the ultra-low emittance. This thesis elaborates the lattice design and non-linear optimizatio...
A status report on the SLC program
International Nuclear Information System (INIS)
Prescott, C.Y.
1985-09-01
The SLC program is an accelerator experiment and a physics experiment. The progress in the accelerator experiment has been rapid, with injector and damping ring components working, conventional construction on schedule, and technical components in production. Accelerator studies will investigate beam-linac and beam-beam interactions, with application to the design of future linear colliders. The physics experiments start in 1987 to study Z 0 properties and to look for new physics effects. Detectors to fully exploit the potential physics are under construction
Configuring the SLC linac for injection into PEP
International Nuclear Information System (INIS)
Bane, K.L.F.
1989-01-01
From time to time the normal SLC physics program is to be interrupted so that beam can be delivered to PEP. In order that the switch to PEP injection (and the switch back again) can be accomplished quickly and easily, the gun, the damping rings, the linac phase ramp, the energy profile of the linac klystrons for the scavenger bunch, and the entire positron production system are to be kept the same as in the SLC configuration. What mainly remains to be changed is the linac klystron profile for the leading two bunches - those going to PEP. The new klystron profile must be such that it leaves these two beams (1) with final energies that match that of the storage ring and (2) with final energy spectra that fit within the energy aperture of the PEP transfer line. The conditions that need to be met in order to achieve these two goals are discussed in this note. 1 ref., 2 figs
International Nuclear Information System (INIS)
Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.
1993-01-01
The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC
The short circumference damping ring design for the ILC
Korostelev, Maxim S; Kuriki, Masao; Kuroda, Shigeru; Naito, Takashi; Ross, Marc; Urakawa, Junji; Zimmermann, Frank
2005-01-01
The ILC damping ring tentative design is driven by the operational scenario of the main linac, the beam-dynamics demand of producing a stable and high-quality beam, the injection/extraction scheme and the kicker performance. In this paper, a short circumference damping ring design based on TME cells is described. The ring accommodates injection kickers which provide a flat top of 280 nsec and a 60 nsec rise and fall time and very fast strip-line kickers for beam extraction with a 2 nsec rise and fall time for 3-MHz operation. The potential impact of collective effects and the possible degradation of the dynamic aperture by nonlinear-wiggler fields are estimated.
Experience with the SLC permanent magnet multipoles
International Nuclear Information System (INIS)
Gross, G.; Spencer, J.
1994-06-01
Permanent magnets have been used in the SLC Damping Rings and their injection and extraction lines since 1985. Recent upgrades of the DR vacuum chambers provided an opportunity to check DR magnets prior to higher beam current operation. Several PM sextupoles downstream of the injection kickers in the electron ring had exceeded their thermal stabilization values of 80 degrees C and some showed serious mechanical deformations and radiation >1 R at contact. We discuss our observations, measurements and a few inexpensive modifications that should improve these magnets under such conditions. A new, block matching algorithm allowed us to use magnet blocks that had been considered unusable because of very different remament field strengths and easy axis errors
Estimates of CSR Instability Thresholds for Various Storage Rings
Zimmermann, Frank
2010-01-01
We review the key predictions and conditions by several authors for the onset of longitudinal instabilities due to coherent synchrotron radiation (CSR), and evaluate them numerically for various storage rings, namely the KEKB High Energy Ring (HER) & Low Energy Ring (LER), SuperKEKB HER & LER, old and new designs of the SuperKEKB Damping Ring (DR), SuperB HER & LER, CLIC DR (2009 and 2010 design parameters), SLC DR, and ATF DR. We show that the theoretical uncertainty in the instability onset is at least at the level of 20-30% in bunch intensity. More importantly, we present some doubts about the general applicability for many of these storage rings of some commonly used formulae. To cast further light on these questions, an experiment at lower beam energy on the ATF Damping Ring is proposed.
Damping of Resonantly Forced Density Waves in Dense Planetary Rings
Lehmann, Marius; Schmidt, Jürgen; Salo, Heikki
2016-10-01
We address the stability of resonantly forced density waves in dense planetary rings.Already by Goldreich and Tremaine (1978) it has been argued that density waves might be unstable, depending on the relationship between the ring's viscosity and the surface mass density. In the recent paper (Schmidt et al. 2016) we have pointed out that when - within a fluid description of the ring dynamics - the criterion for viscous overstability is satisfied, forced spiral density waves become unstable as well. In this case, linear theory fails to describe the damping.We apply the multiple scale formalism to derive a weakly nonlinear damping relation from a hydrodynamical model.This relation describes the resonant excitation and nonlinear viscous damping of spiral density waves in a vertically integrated fluid disk with density dependent transport coefficients. The model consistently predicts linear instability of density waves in a ring region where the conditions for viscous overstability are met. In this case, sufficiently far away from the Lindblad resonance, the surface mass density perturbation is predicted to saturate to a constant value due to nonlinear viscous damping. In general the model wave damping lengths depend on a set of input parameters, such as the distance to the threshold for viscous overstability and the ground state surface mass density.Our new model compares reasonably well with the streamline model for nonlinear density waves of Borderies et al. 1986.Deviations become substantial in the highly nonlinear regime, corresponding to strong satellite forcing.Nevertheless, we generally observe good or at least qualitative agreement between the wave amplitude profiles of both models. The streamline approach is superior at matching the total wave profile of waves observed in Saturn's rings, while our new damping relation is a comparably handy tool to gain insight in the evolution of the wave amplitude with distance from resonance, and the different regimes of
Intrabeam Scattering in the NLC Main Damping Rings
International Nuclear Information System (INIS)
Wolski, Andrzej
2006-01-01
We use Bane's approximation to the Bjorken-Mtingwa theory of intrabeam scattering to calculate the emittance growth as a function of bunch charge in the KEK ATF. We find that our results are consistent with the experimental data. We then calculate the emittance growth in the NLC Main Damping Rings using the same formulae; we allow for some uncertainty in the ATF data by using two different values for the Coulomb log factor in the formulae for the emittance growth rates. We find that despite the IBS emittance growth, it should still be possible to achieve the specified transverse and longitudinal emittances in the NLC Main Damping Rings at the specified bunch charge
Fundamental Design Principles of Linear Collider Damping Rings, with an Application to CLIC
Potier, J P
2000-01-01
Damping Rings for Linear Colliders have to produce very small normalised emittances at a high repetition rate. A previous paper presented analytical expressions for the equilibrium emittance of an arc cell as a function of the deflection angle per dipole. In addition, an expression for the lattice parameters providing the minimum emittance, and a strategy to stay close to this, were proposed. This analytical approach is extended to the detailed design of Damping Rings, taking into account the straight sections and the damping wigglers. Complete rings, including wiggler and injection insections, were modelled with the MAD [1] program, and their performance was found to be in good agreement with the analytical calculation. With such an approach it is shown that a Damping Ring corresponding to the Compact Linear Collider (CLIC) parameters at 0.5 and 1 TeV centre-of-mass energy, and tunable for two different sets of emittance and injection repetition rate, can be designed using the same ring layout.
Overview of collective effects in the NLC main damping rings
International Nuclear Information System (INIS)
Wolski, A.; Santis, S. de
2002-01-01
The present design for the NLC Main Damping Rings (MDRs) meets the specifications for acceptance and extracted emittance, in the limit of zero current. However, the relatively large bunch charge and moderate energy mean that a variety of collective effects can impact the beam dynamics, leading to loss of stability or increase of equilibrium emittance. These effects include intrabeam scattering, impedance from numerous sources, fast ion instability, and (in the positron ring) electron cloud. In this note, we survey the expected impact on damping ring performance from each of a number of collective effects, and discuss the priorities for future studies in this area
Injection envelope matching in storage rings
International Nuclear Information System (INIS)
Minty, M.G.; Spence, W.L.
1995-05-01
The shape and size of the transverse phase space injected into a storage ring can be deduced from turn-by-turn measurements of the transient behavior of the beam envelope in the ring. Envelope oscillations at 2 x the β-tron frequency indicate the presence of a β-mismatch, while envelope oscillations at the β-tron frequency are the signature of a dispersion function mismatch. Experiments in injection optimization using synchrotron radiation imaging of the beam and a fast-gated camera at the SLC damping rings are reported
Electron Cloud Build Up and Instability in the CLIC Damping Rings
Rumolo, G; Papaphilippou, Y
2008-01-01
Electron cloud can be formed in the CLIC positron damping ring and cause intolerable tune shift and beam instability. Build up simulations with the Faktor2 code, developed at CERN, have been done to predict the cloud formation in the arcs and wigglers of the damping rings. HEADTAIL simulations have been used to study the effect of this electron cloud on the beam and assess the thresholds above which the electron cloud instability would set in.
Beam-based alignment at the KEK-ATF damping ring
International Nuclear Information System (INIS)
Woodley, Mark D.; Nelson, Janice; Ross, Marc; Turner, James; Wolski, A.; Kubo, Kiyoshi
2004-01-01
The damping rings of a future linear collider will have demanding alignment and stability requirements in order to achieve the low vertical emittance necessary for high luminosity. The Accelerator Test Facility (ATF) at KEK has successfully demonstrated the vertical emittance below 5 pm that is specified for the GLC/NLC Main Damping Rings. One contribution to this accomplishment has been the use of Beam Based Alignment (BBA) techniques. The mode of operation of the ATF presents particular challenges for BBA, and we describe here how we have deduced the offsets of the BPMs with respect to the quadrupoles. We also discuss a technique that allows for direct measurements of the beam-to-quad offsets
Operation and performance of bunch pre-compression for increased transmission at the SLC
International Nuclear Information System (INIS)
Minty, M.G.; Akre, R.; Decker, F.J.; Turner, J.
1997-11-01
As the beam currents at the SLC are increased, transverse aperture restrictions in the ring-to-linac transport line (RTL) become increasingly important. The RTL contains a bunch compressor which introduces a large energy variation across the bunch and hence a larger transverse beam size. Since 1994 the compressor amplitude has been operating at higher than design voltage. While advantageous for shaping the bunch distribution, this increased the bunch energy spread and therefore resulted in more beam loss. Moreover, due to current-dependent bunch lengthening in the damping ring, the higher the beam current, the more the current loss. To avoid such losses, the bunch length may be precompressed in the damping ring. Until recently, bunch precompression with high beam currents was not stable. In this paper the authors identify the reasons for the difficulties, describe the changes made to accommodate bunch precompression, and discuss performance aspects after implementation. The estimated increase in current at the interaction point is 15%
Characterization of the International Linear Collider damping ring optics
Shanks, J.; Rubin, D. L.; Sagan, D.
2014-10-01
A method is presented for characterizing the emittance dilution and dynamic aperture for an arbitrary closed lattice that includes guide field magnet errors, multipole errors and misalignments. This method, developed and tested at the Cornell Electron Storage Ring Test Accelerator (CesrTA), has been applied to the damping ring lattice for the International Linear Collider (ILC). The effectiveness of beam based emittance tuning is limited by beam position monitor (BPM) measurement errors, number of corrector magnets and their placement, and correction algorithm. The specifications for damping ring magnet alignment, multipole errors, number of BPMs, and precision in BPM measurements are shown to be consistent with the required emittances and dynamic aperture. The methodology is then used to determine the minimum number of position monitors that is required to achieve the emittance targets, and how that minimum depends on the location of the BPMs. Similarly, the maximum tolerable multipole errors are evaluated. Finally, the robustness of each BPM configuration with respect to random failures is explored.
Design for a practical, low-emittance damping ring
International Nuclear Information System (INIS)
Krejcik, P.
1988-01-01
The luminosity requirements for future high-energy linear colliders calls for very low emittances in the two beams. These low emittances can be achieved with damping rings, but, in order to reach the design goal of a factor 10 improvement over present day machines, great care must be taken in their design. This paper emphasizes the need to address simultaneously all of the factors which limit the operational emittance in the ring. Particularly since in standard designs there is a conflict between different design parameters which makes it difficult to extrapolate such designs to very low emittances. The approach chosen here is to resolve such conflicts by separating their design solutions. Wigglers are used predominantly in zero-dispersion regions to achieve the desired damping rate, whereas in the arcs high dispersion insertions are made in regions of zero curvature to allow for easier chromaticity control
Damping the e-p instability in the SNS accumulator ring
Evans, N. J.; Deibele, C.; Aleksandrov, A.; Xie, Z.
2018-03-01
A broadband, digital damper system for both transverse planes developed for the SNS accumulator ring has recently damped the first indications of the broadband 50-150 MHz e-p instability in a 1.2 MW neutron production beam. This paper presents details of the design and operation of the SNS damper system as well as results of active damping of the e-p instability in the SNS ring showing a reduction in power of betatron oscillation over the 10-300 MHz band of up to 70%. The spectral content of the beam during operation, with and without the damper system is presented and performance of the damper system is evaluated.
R and D status of the ATF damping ring
International Nuclear Information System (INIS)
Urakawa, Junji
1994-01-01
The KEK accelerator test facility (ATF) is under construction. This paper gives the status of the design studies, the various R and D works and the construction for the damping ring of the ATF. (author)
Kicker thyratron experience from SLC
International Nuclear Information System (INIS)
Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.
1991-05-01
The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs
Investigation into electron cloud effects in the International Linear Collider positron damping ring
Energy Technology Data Exchange (ETDEWEB)
Crittenden, J. A.; Conway, J.; Dugan, G. F.; Palmer, M. A.; Rubin, D. L.; Shanks, J.; Sonnad, K. G.; Boon, L.; Harkay, K.; Ishibashi, T.; Furman, M. A.; Guiducci, S.; Pivi, M. T. F.; Wang, L.
2014-03-01
We report modeling results for electron cloud buildup and instability in the International Linear Collider positron damping ring. Updated optics, wiggler magnets, and vacuum chamber designs have recently been developed for the 5 GeV, 3.2-km racetrack layout. An analysis of the synchrotron radiation profile around the ring has been performed, including the effects of diffuse and specular photon scattering on the interior surfaces of the vacuum chamber. The results provide input to the cloud buildup simulations for the various magnetic field regions of the ring. The modeled cloud densities thus obtained are used in the instability threshold calculations. We conclude that the mitigation techniques employed in this model will suffice to allow operation of the damping ring at the design operational specifications
Measurements of longitudinal phase space in the SLC linac
International Nuclear Information System (INIS)
Bane, K.; Adolphsen, C.; Lavine, T.L.; Ross, M.; Seeman, J.; Thompson, K.
1990-05-01
In the Stanford Linear Collider the beam leaves a damping ring and then enters the Ring-to-Linac (RTL) transfer line. In the RTL it is compressed in length by a factor of 10 by means of an rf section, with which a longitudinally correlated energy variation is induced in the beam, and a following beam line which has non-zero momentum compaction. The compressed beam then enters the linac proper. In this paper we describe three measurements of longitudinal properties of the beam in the SLC linac. We present measurements of single bunch beam loading, of the energy spectrum at the end of the linac, and of the linac bunch length. Since the results of all three measurements depend on the beam's longitudinal charge distribution in the linac they, in turn, also depend on the bunch lengthening that occurs in the damping rings, as well as on the behavior of the compressor. The results of the first two measurements, in addition, depend critically on the strength of the longitudinal wakefields in the linac. The results of these three measurements are compared with simulations. For these calculations, at any given current, the potential well distortion in the damping ring is first computed. The compression process is then simulated to obtain the longitudinal charge distribution in the linac. For the first two measurements this distribution is then convolved with the calculated longitudinal wake function of the SLAC linac in order to obtain the induced voltage. Finally, the induced voltage is combined with the effect of the linac rf wave to give the final energy spectrum. 8 refs., 5 figs
Proceedings of the Workshop on the SLAC Damping Rings in the 21st Century (DR2000)
Nixon, R
1998-01-01
The purpose of the Workshop is to assess the status and needs of the Damping Rings for the era of PEP-II. The goal is to have the Rings perform to produce the specified beam parameters with an insignificant amount of downtime. We want to achieve this status by improving the Rings where necessary, not by increasing the maintenance effort. The things that we can act upon in the immediate future are largely engineering issues to improve the integrated availability of the damping rings.
Proceedings of the Workshop on the SLAC Damping Rings in the 21st Century (DR2000)
International Nuclear Information System (INIS)
Nixon, Robbin
1998-01-01
The purpose of the Workshop is to assess the status and needs of the Damping Rings for the era of PEP-II. The goal is to have the Rings perform to produce the specified beam parameters with an insignificant amount of downtime. We want to achieve this status by improving the Rings where necessary, not by increasing the maintenance effort. The things that we can act upon in the immediate future are largely engineering issues to improve the integrated availability of the damping rings
High frequency electromagnetic characterization of NEG properties for the CLIC damping rings
Koukovini-Platia, E; Zannini, C
2014-01-01
Coating materials will be used in the CLIC damping rings (DR) to suppress two-stream effects. In particular, NEG coating is necessary to suppress fast beam ion instabilities in the electron damping ring (EDR). The electromagnetic (EM) characterization of the material properties up to high frequencies is required for the impedance modeling of the CLIC DR components. The EM properties for frequencies of few GHz are determined with the waveguide method, based on a combination of experimental measurements of the complex transmission coefficient S21 and CST 3D EM simulations. The results obtained from a NEG-coated copper (Cu) waveguide are presented in this paper.
Generation and acceleration of high intensity beams in the SLC injector
International Nuclear Information System (INIS)
Ross, M.C.; Browne, M.J.; Clendenin, J.E.; Jobe, R.K.; Seeman, J.T.; Sheppard, J.C.; Stiening, R.F.
1985-04-01
A new gun pulser and substantially increased focusing have been added to the first 100 m of the SLAC linac in order to provide a pair of intense electron bunches to the SLC damping ring. Each bunch from this injector must have 5 x 10 10 electrons, an invariant emittance γepsilon less than or equal to 1.8 x 10 -3 m-rad and the pair must have an energy spread of less than 2%. Wakefield instabilities present in earlier versions of this injector have been controlled by reducing the transverse beam dimension by a factor of 3
Tolerances for the vertical emittance in damping rings
International Nuclear Information System (INIS)
Raubenheimer, T.O.
1991-11-01
Future damping rings for linear colliders will need to have very small vertical emittances. In the limit of low beam current, the vertical emittance is primarily determined by the vertical dispersion and the betatron coupling. In this paper, the contributions to these effects from random misalignments are calculated and tolerances are derived to limit the vertical emittance with a 95% confidence level. 10 refs., 5 figs
Intrabeam Scattering Studies for the ILC Damping Rings Using a NewMATLAB Code
Energy Technology Data Exchange (ETDEWEB)
Reichel, I.; Wolski, A.
2006-06-21
A new code to calculate the effects of intrabeam scattering (IBS) has been developed in MATLAB based on the approximation suggested by K. Bane. It interfaces with the Accelerator Toolbox but can also read in lattice functions from other codes. The code has been benchmarked against results from other codes for the ATF that use this approximation or do the calculation in a different way. The new code has been used to calculate the emittance growth due to intrabeam scattering for the lattices currently proposed for the ILC Damping Rings, as IBS is a concern, especially for the electron ring. A description of the code and its user interface, as well as results for the Damping Rings, will be presented.
Intrabeam Scattering Studies for the ILC Damping Rings Using a New MATLAB Code
International Nuclear Information System (INIS)
Reichel, I.; Wolski, A.
2006-01-01
A new code to calculate the effects of intrabeam scattering (IBS) has been developed in MATLAB based on the approximation suggested by K. Bane. It interfaces with the Accelerator Toolbox but can also read in lattice functions from other codes. The code has been benchmarked against results from other codes for the ATF that use this approximation or do the calculation in a different way. The new code has been used to calculate the emittance growth due to intrabeam scattering for the lattices currently proposed for the ILC Damping Rings, as IBS is a concern, especially for the electron ring. A description of the code and its user interface, as well as results for the Damping Rings, will be presented
Status of the SLC: Developments in Linear Collider physics
International Nuclear Information System (INIS)
Krejcik, P.
1994-11-01
This paper reviews the performance of the SLAC Linear Collider, both from the perspective of a machine delivering high luminosity polarized beams for physics, and as a test for future linear colliders. The development of the SLC taken place over a number of years and the steady improvements have been documented in previous review papers. As a review paper, the list references also serves as a bibliography, pointing to the work of the many people contributing to the upgrades and commissioning of the various SLC systems. The major upgrades for this present run have been an improved final focus optics, new low impedance vacuum chambers for the damping rings and improved polarization from the electron source. The performance of the SLC is driven to some extent by its unique 3-beam operation in which the linac accelerates both the electron and positron bunches for collision, as well as the electron bunch to produce the positrons. The special attention required to maintain stable operation in the face of the interactions caused by beam loading from the bunches will (fortunately exclamation point) not be an issue in future linear colliders. They will deal instead with the problems associated with handling long bunch trains
Correction of vertical dispersion and betatron coupling for the CLIC damping ring
Korostelev, M S
2006-01-01
The sensitivity of the CLIC damping ring to various kinds of alignment errors has been studied. Without any correction, fairly small vertical misalignments of the quadrupoles and, in particular, the sextupoles, introduce unacceptable distortions of the closed orbit as well as intolerable spurious vertical dispersion and coupling due to the strong focusing optics of the damping ring. A sophisticated beam-based correction scheme has been developed to bring the design target emittances and the dynamic aperture back to the ideal value. The correction using dipolar correctors and several skew quadrupole correctors allows a minimization of the closed-orbit distortion, the cross-talk between vertical and horizontal closed orbits, the residual vertical dispersion and the betatron coupling.
Measurement of Resonance driving terms in the ATF Damping Ring
Tomás, R; Kuroda, S; Naito, T; Okugi, T; Urakawa, J; Zimmermann, F
2008-01-01
The measurement of resonance driving terms in the Damping Ring of the Accelerator Test Facility in KEK could help finding possible machine imperfections and even to optimize single particle stability through the minimization of non-linearities. The first experimental attempts of this enterprise are reported in this note.
Injection and Extraction Lines for the ILC Damping Rings
International Nuclear Information System (INIS)
Reichel, Ina
2007-01-01
The current design for the injection and extraction lines into and out of the ILC Damping Rings is presented as well as the design for the abort line. Due to changes of the geometric boundary conditions by other subsystems of the ILC, a modular approach has been used to be able to respond to recurring layout changes while reusing previously designed parts
Charged-particle incoherent-motion damping in storage rings by means of dissipative elements
International Nuclear Information System (INIS)
Derbenev, Ya.S.; Khejfets, S.A.
1979-01-01
In consecutive order a possibility of damping of beam incoherent oscillations in a storage ring was studied by means of an external dissipative system in a sufficient common case. It is shown, that a useful effect, as for the case of electron cooling, is one-particle effect of particle oscillations damping due to nonconservatism of its interaction with an external system. Each other mutual influence through the external system becomes significant with increasing beam density and results in the limitation to achievable damping decrements
A Weakly Nonlinear Model for the Damping of Resonantly Forced Density Waves in Dense Planetary Rings
Lehmann, Marius; Schmidt, Jürgen; Salo, Heikki
2016-10-01
In this paper, we address the stability of resonantly forced density waves in dense planetary rings. Goldreich & Tremaine have already argued that density waves might be unstable, depending on the relationship between the ring’s viscosity and the surface mass density. In the recent paper Schmidt et al., we have pointed out that when—within a fluid description of the ring dynamics—the criterion for viscous overstability is satisfied, forced spiral density waves become unstable as well. In this case, linear theory fails to describe the damping, but nonlinearity of the underlying equations guarantees a finite amplitude and eventually a damping of the wave. We apply the multiple scale formalism to derive a weakly nonlinear damping relation from a hydrodynamical model. This relation describes the resonant excitation and nonlinear viscous damping of spiral density waves in a vertically integrated fluid disk with density dependent transport coefficients. The model consistently predicts density waves to be (linearly) unstable in a ring region where the conditions for viscous overstability are met. Sufficiently far away from the Lindblad resonance, the surface mass density perturbation is predicted to saturate to a constant value due to nonlinear viscous damping. The wave’s damping lengths of the model depend on certain input parameters, such as the distance to the threshold for viscous overstability in parameter space and the ground state surface mass density.
Optics Design and Performance of an Ultra-Low Emittance Damping Ring for the Compact Linear Collider
Korostelev, M S
2006-01-01
A high-energy (0.5-3.0 TeV centre of mass) electron-positron Compact Linear Collider (CLIC) is being studied at CERN as a new physics facility. The design study has been optimized for 3 TeV centre-of-mass energy. Intense bunches injected into the main linac must have unprecedentedly small emittances to achieve the design luminosity 1035cm-2s-1 required for the physics experiments. The positron and electron bunch trains will be provided by the CLIC injection complex. This thesis describes an optics design and performance of a positron damping ring developed for producing such ultra-low emittance beam. The linear optics of the CLIC damping ring is optimized by taking into account the combined action of radiation damping, quantum excitation and intrabeam scattering. The required beam emittance is obtained by using a TME (Theoretical Minimum Emittance) lattice with compact arcs and short period wiggler magnets located in dispersionfree regions. The damping ring beam energy is chosen as 2.42 GeV. The lattice featu...
Coherent Instabilities of ILC Damping Ring
Energy Technology Data Exchange (ETDEWEB)
Heifets, S.; Stupakov, G.; Bane, K.; /SLAC
2006-09-27
The paper presents the first attempt to estimates the ILC damping ring impedance and compare thresholds of the classical instabilities for several designs initially proposed for the DR. The work was carried out in the spring of 2006. Since then the choice of the DR is narrowed. Nevertheless, the analysis described may be useful for the next iterations of the beam stability. Overall, the conventional instabilities will have little impact on the ring performance provided the careful design of the ring minimizes the impedance below acceptable level indicated above. The only exception is the transverse CB instability. The longitudinal CB is less demanding. However, even the transverse CB instability would have threshold current above nominal provided the aperture in the wigglers is increased from 8 mm to 16 mm. The microwave instability needs more studies. Nevertheless, we should remember that the ILC DR is different from existing high-current machines at least in two respects: absence of the beam-beam tune spread stabilizing beams in colliders, and unusual strict requirements for low emittance. That may cause new problems such as bunch emittance dilution due to high-frequency wakes (BPMs, grooves), etc. Even if such a possibility exists, it probably universal for all machines and ought be addressed in the design of vacuum components rather than have effect on the choice of the machine design.
AUTHOR|(SzGeCERN)728476; Toral Fernandez, Fernando
In the framework of the design study of Future Linear Colliders, the Compact Linear Collider (CLIC) aims for electron-positron collisions with high luminosity at a nominal centre-of-mass energy of 3 TeV. To achieve the luminosity requirements, Pre-Damping Rings (PDRs) and Damping Rings (DRs) are required: they reduce the beam emittance before the beam is accelerated in the main linac. Several injection and extraction systems are needed to inject and extract the beam from the PDRs and DRs. The work of this Thesis consists of the design, fabrication and laboratory tests of the first stripline kicker prototype for beam extraction from the CLIC DRs, although the methodology proposed can be extended to stripline kickers for any low emittance ring. The excellent field homogeneity required, as well as a good transmission of the high voltage pulse through the electrodes, has been achieved by choosing a novel electrode shape. With this new geometry, it has been possible to benefit from all the advantages that the most...
Preliminary Design of an Inductive Adder for CLIC Damping Rings
Holma, J
2011-01-01
The Compact Linear Collider (CLIC) study is exploring the scheme for an electron-positron collider with high luminosity and a nominal centre-of-mass energy of 3 TeV. The CLIC damping rings will produce ultra-low emittance beam, with high bunch charge, necessary for the luminosity performance of the collider. To limit the beam emittance blow-up due to oscillations, the pulse power modulators for the damping rings kickers must provide extremely flat, high-voltage, pulses: specifications call for a 160 ns duration flattop of 12.5 kV, 250 A, with a combined ripple and droop of not more than ±0.02 %. A solid-state modulator, the inductive adder, is a very promising approach to meeting the demanding specifications; this topology allows the use of both digital and analogue modulation. To effectively use modulation techniques to achieve such low ripple and droop requires an in-depth knowledge of the behaviour of the solid-state switching components and their gate drivers, as well as a good understanding of the overa...
Pulse Power Modulator development for the CLIC Damping Ring Kickers
Holma, Janne
2012-01-01
The Compact Linear Collider (CLIC) study is exploring the scheme for an electron-positron collider with high luminosity (10-34 – 10-35 cm-2s-1) and a nominal centre-of-mass energy of 3 TeV: CLIC would complement LHC physics in the multi-TeV range. The CLIC design relies on Pre-Damping Rings (PDR) and Damping Rings (DR) to achieve the very low emittance, through synchrotron radiation, needed for the luminosity requirements of CLIC. To limit the beam emittance blow-up due to oscillations, the pulse power modulators for the DR kickers must provide extremely flat, high-voltage pulses: the 2 GHz specification called for a 160 ns duration flat-top of 12.5 kV, 250 A, with a combined ripple and droop of not more than ±0.02 %. In order to meet these demanding specifications, a combination of broadband impedance matching, optimized electrical circuit layout and advanced control techniques is required. A solid-state modulator, the inductive adder, is the most promising approach to meeting the demanding specifications...
Coherent Synchrotron Radiation effect in damping rings
International Nuclear Information System (INIS)
Raubenheimer, T
2004-01-01
Coherent Synchrotron Radiation (CSR) can play an important role by not only increasing the energy spread and emittance of a beam, but also leading to a potential instability. Previous studies of the CSR induced longitudinal instability were carried out for the CSR impedance due to dipole magnets. In this paper, the instability due to the CSR impedance from a wiggler is studied assuming a large wiggler parameter K. The primary consideration is a low frequency microwave-like instability in the damping rings of several linear collider projects. The threshold is determined by the instability with the longest possible wavelength
A lattice with larger momentum compaction for the NLC main damping rings
International Nuclear Information System (INIS)
Wolski, Andrzej; Raubenheimer, Tor O.; Woodley, Mark; Wu, Juhao
2004-01-01
Previous lattice designs for the Next Linear Collider Main Damping Rings [1] have met the specifications for equilibrium emittance, damping rate and dynamic aperture. Concerns about the effects of the damping wiggler on the beam dynamics [2] led to the aim of reducing the total length of the wiggler to a minimum consistent with the required damping rate, so high-field dipoles were used to provide a significant energy loss in the arcs. However, recent work has shown that the wiggler effects may not be as bad as previously feared. Furthermore, other studies have suggested the need for an increased momentum compaction (by roughly a factor of four) to raise the thresholds of various collective effects. We have therefore developed a new lattice design in which we increase the momentum compaction by reducing the field strength in the arc dipoles, compensating the loss in damping rate by increasing the length of the wiggler. The new lattice again meets the specifications for emittance, damping rate and dynamic aperture, while having the benefit of significantly higher thresholds for a number of instabilities
Parameter scan for the CLIC Damping rings under the infleunce of intrabeam scattering
Antoniou, F; Martini, M; Papaphilippou, Y; Vivoli, A
2010-01-01
Due to the high bunch density, the output emittances of the CLIC Damping Rings (DR) are strongly dominated by the effect of Intrabeam Scattering (IBS). In an attempt to optimize the ring design, the bench-marking of the multiparticle tracking code SIRE with the classical IBS formalisms and approximations is first considered. The scaling of the steady state emittances and IBS growth rates is also studied, with respect to several ring parameters including energy, bunch charge and wiggler charac...
Parameter scan for the CLIC Damping rings under the infleunce of intrabeam scattering
Antoniou, F; Papaphilippou, Y; Vivoli, A
2010-01-01
Due to the high bunch density, the output emittances of the CLIC Damping Rings (DR) are strongly dominated by the effect of Intrabeam Scattering (IBS). In an attempt to optimize the ring design, the bench-marking of the multiparticle tracking code SIRE with the classical IBS formalisms and approximations is first considered. The scaling of the steady state emittances and IBS growth rates is also studied, with respect to several ring parameters including energy, bunch charge and wiggler characteristics.
Longitudinal Stability Study for the FACET-II e+ Damping Ring
Energy Technology Data Exchange (ETDEWEB)
Bane, Karl [SLAC National Accelerator Lab., Menlo Park, CA (United States)
2016-11-29
This is an initial study of the longitudinal, single-bunch stability in the proposed FACET-II e+ damping ring. It is preliminary because, at present, only a few specific features of the vacuum chamber are known.
The energy stabilization for the SLC scavenger beam
International Nuclear Information System (INIS)
Hsu, I.; Browne, M.; Himel, T.; Humphrey, R.; Jobe, K.; Ross, M.; Pellegrin, J.L.; Seeman, J.
1991-01-01
The energy of the SLC scavenger beam which is used to produce positrons must be carefully maintained so that the beam can be transported through the collimators in the dispersive region of the extraction line which leads from the Linac to the positron target. A feedforward control loop has been developed to compensate the energy fluctuations due to the beam intensity fluctuations. The loop detects the beam intensities in the damping rings and then calculates how much energy needs to be compensated due to beam loading effects. The energy is corrected by adjusting the acceleration phases of two sets of klystrons right before the extraction. Because there is feedback loop using the same controls, their interaction needs to be carefully treated. This paper presents an overview of the feedforward algorithms
The energy stabilization for the SLC scavenger beam
International Nuclear Information System (INIS)
Hsu, Ian; Browne, M.; Himel, T.; Humphrey, R.; Jobe, K.; Ross, M.; Pellegrin, J.L.; Seeman, J.
1990-08-01
The energy of the SLC scavenger beam which is used to produce positrons must be carefully maintained so that the beam can be transported through the collimators in the dispersive region of the extraction line which leads from the Linac to the positron target. A feedforward control loop has been developed to compensate the energy fluctuations due to the beam intensity fluctuations. The loop detects the beam intensities in the damping rings and then calculates how much energy needs to be compensated due to beam loading effects. The energy is corrected by adjusting the acceleration phases of two sets of klystrons right before the extraction. Because there is feedback loop using the same controls, their interaction needs to be carefully treated. This paper presents an overview of the feedforward algorithms. 3 figs
High Resolution BPM Upgrade for the ATF Damping Ring at KEK
International Nuclear Information System (INIS)
Eddy, N.; Briegel, C.; Fellenz, B.; Gianfelice-Wendt, E.; Prieto, P.; Rechenmacher, R.; Semenov, A.; Voy, D.; Wendt, M.; Zhang, D.; Terunuma, N.
2011-01-01
A beam position monitor (BPM) upgrade at the KEK Accelerator Test Facility (ATF) damping ring has been accomplished, carried out by a KEK/FNAL/SLAC collaboration under the umbrella of the global ILC R and D effort. The upgrade consists of a high resolution, high reproducibility read-out system, based on analog and digital down-conversion techniques, digital signal processing, and also implements a new automatic gain error correction schema. The technical concept and realization as well as results of beam studies are presented. The next generation of linear colliders require ultra-low vertical emittance of <2 pm-rad. The damping ring at the KEK Accelerator Test Facility (ATF) is designed to demonstrate this mission critical goal. A high resolution beam position monitor (BPM) system for the damping ring is one of the key tools for realizing this goal. The BPM system needs to provide two distnict measurements. First, a very high resolution (∼100-200nm) closed-orbit measurement which is averaged over many turns and realized with narrowband filter techniques - 'narrowband mode'. This is needed to monitor and steer the beam along an optimum orbit and to facilitate beam-based alignment to minimize non-linear field effects. Second, is the ability to make turn by turn (TBT) measurements to support optics studies and corrections necessary to achieve the design performance. As the TBT measurement necessitates a wider bandwidth, it is often referred to as 'wideband mode'. The BPM upgrade was initiated as a KEK/SLAC/FNAL collaboration in the frame of the Global Design Initiative of the International Linear Collider. The project was realized and completed using Japan-US funds with Fermilab as the core partner.
International Nuclear Information System (INIS)
Pivi, Mauro; Raubenheimer, Tor O.; Wang, Lanfa; Ohmi, Kazuhito; Wanzenberg, Rainer; Wolski, Andrzej
2007-01-01
In the beam pipe of the positron damping ring of the International Linear Collider (ILC), an electron cloud may be first produced by photoelectrons and ionization of residual gases and then increased by the secondary emission process. This paper reports the assessment of electron cloud effects in a number of configuration options for the ILC baseline configuration. Careful estimates were made of the secondary electron yield (sometimes in the literature also referred as secondary emission yield SEY or (delta), with a peak value (delta) max ) threshold for electron cloud build-up, and the related single- and coupled-bunch instabilities, as a function of beam current and surface properties for a variety of optics designs. When the configuration for the ILC damping rings was chosen at the end of 2005, the results from these studies were important considerations. On the basis of the joint theoretical and experimental work, the baseline configuration currently specifies a pair of 6 km damping rings for the positron beam, to mitigate the effects of the electron cloud that could present difficulties in a single 6 km ring. However, since mitigation techniques are now estimated to be sufficiently mature, a reduced single 6-km circumference is presently under consideration so as to reduce costs
CESR Conversion Damping Ring Studies of Electron Cloud Instabilities (CESR-TA)
International Nuclear Information System (INIS)
Rubin, David L.; Palmer, Mark A.
2011-01-01
In the International Linear Collider, two linear accelerators will accelerate bunches of positrons and electrons to over a hundred billion electron volts and collide them in a central detector. In order to obtain useful collision rates, the bunches, each containing twenty billion particles, must be compressed to a cross section of a few nanometers by a few hundred nanometers. In order to prepare these ultra high density bunches, damping rings (DRs) are employed before the linear accelerators. The DRs take the high emittance bunches that are provided by the electron and positron sources and, through the process of radiation damping, squeeze them into ultra low emittance beams that are ready for the main linear accelerators. In the damping rings, a number of effects can prevent the successful preparation of the beams. In the electron ring, an effect known as the fast ion instability can lead to beam growth and, in the positron ring, the build-up of an electron cloud (EC), which interacts with the circulating bunches, can produce the same effect. EC build-up and the subsequent interaction of the cloud with the positron beam in the DR have been identified as major risks for the successful construction of a linear collider. The CESRTA research program at the Cornell Electron Storage Ring (CESR) was developed in order to study the build-up of the EC, the details of its impact on ultra low emittance beams, as well as methods to mitigate the impact of the cloud. In the DR, the EC forms when synchrotron photons radiated from the circulating beam strike the walls of the vacuum chamber, resulting in the emission of photoelectrons. These low energy electrons can be accelerated across the vacuum chamber by the electric field of the beam, and strike the walls, causing the emission of secondary electrons. The secondary electrons are subsequently accelerated into the walls yet again via the same mechanism. The result is that the EC can rapidly begin to fill the vacuum chamber. In
CESR Conversion Damping Ring Studies of Electron Cloud Instabilities (CESR-TA)
Energy Technology Data Exchange (ETDEWEB)
Rubin, David L.; Palmer, Mark A.
2011-08-02
In the International Linear Collider, two linear accelerators will accelerate bunches of positrons and electrons to over a hundred billion electron volts and collide them in a central detector. In order to obtain useful collision rates, the bunches, each containing twenty billion particles, must be compressed to a cross section of a few nanometers by a few hundred nanometers. In order to prepare these ultra high density bunches, damping rings (DRs) are employed before the linear accelerators. The DRs take the high emittance bunches that are provided by the electron and positron sources and, through the process of radiation damping, squeeze them into ultra low emittance beams that are ready for the main linear accelerators. In the damping rings, a number of effects can prevent the successful preparation of the beams. In the electron ring, an effect known as the fast ion instability can lead to beam growth and, in the positron ring, the build-up of an electron cloud (EC), which interacts with the circulating bunches, can produce the same effect. EC build-up and the subsequent interaction of the cloud with the positron beam in the DR have been identified as major risks for the successful construction of a linear collider. The CESRTA research program at the Cornell Electron Storage Ring (CESR) was developed in order to study the build-up of the EC, the details of its impact on ultra low emittance beams, as well as methods to mitigate the impact of the cloud. In the DR, the EC forms when synchrotron photons radiated from the circulating beam strike the walls of the vacuum chamber, resulting in the emission of photoelectrons. These low energy electrons can be accelerated across the vacuum chamber by the electric field of the beam, and strike the walls, causing the emission of secondary electrons. The secondary electrons are subsequently accelerated into the walls yet again via the same mechanism. The result is that the EC can rapidly begin to fill the vacuum chamber. In
International Nuclear Information System (INIS)
Pivi, Mauro; Raubenheimer, Tor O.; Ghalam, Ali; Harkay, Katherine; Ohmi, Kazuhito; Wanzenberg, Rainer; Wolski, Andrzej; Zimmermann, Frank
2005-01-01
Collective instabilities caused by the formation of an electron cloud (EC) are a potential limitation to the performances of the damping rings for a future linear collider. In this paper, we present recent simulation results for the electron cloud build-up in damping rings of different circumferences and discuss the single-bunch instabilities driven by the electron cloud
Resistive Wall Instability in the NLC Main Damping Rings
International Nuclear Information System (INIS)
Wolski, Andrzej
2004-01-01
We study transverse coupled-bunch instabilities driven by the resistive-wall impedance in the NLC Main Damping Rings. We compare the growth rates of the different modes predicted by a simple theory using a simplified lattice model with the results of a detailed simulation that includes variation of the beta functions and the actual fill structure of the machine. We find that the results of the analytical calculations are in reasonable agreement with the simulations. We include a simple model of a bunch-by-bunch feedback system in the simulation to show that the instabilities can be damped by a feedback system having parameters that are realistic, and possibly conservative. The noise level on the feedback system pick-up must be low, to avoid driving random bunch-to-bunch jitter above the specified limit of 10 percent of the vertical beam size
Recent luminosity improvements at the SLC
International Nuclear Information System (INIS)
Raimondi, P.; Usher, T.; Akre, R.
1998-07-01
The luminosity of the SLAC Linear Collider (SLC) has been increased by more than a factor of three during the 1997--98 run. Improved alignment and emittance tuning techniques throughout the accelerator resulted in minimal emittance growth from the damping rings to the final focus. In particular, a revised strategy for wakefield cancellation using precision beam size measurements at the entrance of the final focus proved effective for optimizing emittance. The final focus lattice was modified to provide stronger demagnification near the interaction point and to remove residual higher-order aberrations. Beam sizes as small as 1.5 by 0.65 microns were achieved at full beam intensity of 4 10 10 particles per pulse. With these parameters, the mutual focusing of the beams in collision becomes significant, resulting in a further increase in the luminosity. Recorded SLD event rates confirmed the theoretical calculations of the disruption enhancement which was typically 50 to 100%
Configuration Studies and Recommendations for the ILC Damping Rings
International Nuclear Information System (INIS)
Wolski, Andrzej; Gao, Jie; Guiducci, Susanna
2006-01-01
We describe the results of studies comparing different options for the baseline configuration of the ILC damping rings. The principal configuration decisions apply to the circumference, beam energy, lattice type, and technology options for key components, including the injection/extraction kickers and the damping wigglers. To arrive at our recommended configuration, we performed detailed studies of a range of lattices representing a variety of different configuration options; these lattices are described in Chapter 2. The results of the various studies are reported in chapters covering issues of beam dynamics, technical subsystems, costs, and commissioning, reliability and upgrade ability. Our detailed recommendations for the baseline configuration are given in Chapter 7, where we also outline further research and development that is needed before a machine using our recommended configuration can be built and operated successfully. In the same chapter, we suggest possible alternatives to the baseline configuration
Lattice design for an ILC damping ring with 3 km circumference
International Nuclear Information System (INIS)
Wolski, Andrzej
2004-01-01
We describe a simple lattice that meets the specifications for the damping times and horizontal and longitudinal emittances for the International Linear Collider (ILC) damping rings. The circumference of a little over 3 km leads to a bunch spacing of around 3 ns, which will require advances in kicker technology for injection and extraction. We present the lattice design, and initial results of studies of the acceptance and collective effects. With the high bunch charge and close spacing, the ion and electron cloud effects are expected to be severe; however, the simple structure of the lattice allows for easy variation of the circumference and bunch spacing, which may make it useful for future investigations
Preliminary Design Study of a Pre-booster Damping Ring for the FCC e+e− Injector
Etisken, O; Papaphilippou, Y
2017-01-01
The aim of the FCC e+e− lepton collider is to collide particles in the energy range 40–175 GeV. The FCC e+e− injector complex needs to produce and transport high-intensity e+e− beams at a fast repetition rate of about 0.1 Hz to top up the collider at its collision energy. A basic parameter set exists for all collider energies, assuming a 10 GeV linac operating with a large number of bunches accumulating in the existing SPS, which serves as pre-accelerator and damping ring before the bunches are transferred to the high-energy booster. The purpose of this study is to provide the conceptual design of an alternative damping and accelerator ring, replacing the SPS in the current scheme. This ring will have an injection energy of around 6 GeV and an extraction energy of around 20 GeV. Apart from establishing the basic ring parameters, the final study will include the optics design and layout, and single particle linear and non-linear dynamics optimization, including magnetic and alignment error tolerances. ...
Impedance effects in the CLIC damping rings
Koukovini-Platia, E; Mounet, N; Rumolo, G; Salvant, B
2011-01-01
Due to the unprecedented brilliance of the beams, the performance of the Compact Linear Collider (CLIC) damping rings (DR) is affected by collective effects. Single bunch instability thresholds based on a broad-band resonator model and the associated coherent tune shifts have been evaluated with the HEADTAIL code. Simulations performed for positive and negative values of chromaticity showed that higher order bunch modes can be potentially dangerous for the beam stability. This study also includes the effects of high frequency resistive wall impedance due to different coatings applied on the chambers of the wigglers for e-cloud mitigation and/or ultra-low vacuum pressure. The impact of the resistive wall wake fields on the transverse impedance budget is finally discussed.
Progress on low emittance tuning for the CLIC Damping Rings
Alabau-Gonzalvo, J; Papaphilippou, Y
2014-01-01
In the frame of the CLIC main Damping Ring a study on the sensitivity of the lattice to different sources of misalignment is presented. The minimum equilibrium emittance is simulated and analytically estimated under dipole and quadrupole rolls, and quadrupole and sextupole vertical offsets. The result of this study establishes alignment tolerances to preserve the vertical emittance below the design value (1 pmrad). Non-linear dynamics studies have been done to determine the dynamic aperture in the presence of misalignments.
Wigglers and single-particle dynamics in the NLC damping rings
International Nuclear Information System (INIS)
Venturini, Marco; Wolski, Andrzej; Dragt, Alex
2003-01-01
Wiggler insertions are expected to occupy a significant portion of the lattice of the Next Linear Collider (NLC) Main Damping Rings (MDR) and have a noticeable impact on the single-particle beam dynamics. Starting from a realistic 3D representation of the magnetic fields we calculate the transfer maps for the wigglers, accounting for linear and nonlinear effects, and we study the beam dynamics with particular attention paid to the Dynamic Aperture(DA). A DA reduction is observed but appears to remain within acceptable limits
Emittance damping considerations for TESLA
International Nuclear Information System (INIS)
Floettmann, K.; Rossbach, J.
1993-03-01
Two schemes are considered to avoid very large damping rings for TESLA. The first (by K.F.) makes use of the linac tunnel to accomodate most of the damping 'ring' structure, which is, in fact, not a ring any more but a long linear structure with two small bends at each of its ends ('dog-bone'). The other scheme (by J.R.) is based on a positron (or electron, respectively) recycling scheme. It makes use of the specific TESLA property, that the full bunch train is much longer (240 km) than the linac length. The spent beams are recycled seven times after interaction, thus reducing the number of bunches to be stored in the damping ring by a factor of eight. Ultimately, this scheme can be used to operate TESLA in a storage ring mode ('storage linac'), with no damping ring at all. Finally, a combination of both schemes is considered. (orig.)
High resolution upgrade of the ATF damping ring BPM system
International Nuclear Information System (INIS)
Terunuma, N.; Urakawa, J.; Frisch, J.; May, J.; McCormick, D.; Nelson, J.; Seryi, A.; Smith, T.; Woodley, M.; Briegel, C.; Dysert, R.
2008-01-01
A beam position monitor (BPM) upgrade at the KEK Accelerator Test Facility (ATF) damping ring has been accomplished in its first stage, carried out by a KEK/FNAL/SLAC collaboration under the umbrella of the global ILC R and D effort. The upgrade consists of a high resolution, high reproducibility read-out system, based on analog and digital downconversion techniques, digital signal processing, and also tests a new automatic gain error correction schema. The technical concept and realization, as well as preliminary results of beam studies are presented
Conceptual Design of ILC Damping Ring Wiggler Straight Vacuum System
International Nuclear Information System (INIS)
Marks, S.; Kennedy, K.; Plate, D.; Schlueter, R.D.; Zisman, M.
2007-01-01
The positron and electron damping rings for the International Linear Collider will contain long straight sections consisting of twenty wiggler/quadrupole pairs. The wigglers will be based upon the CESR superconducting design. There are a number of challenges associated with the design of the wiggler straight vacuum system, in particular, the absorption of photon power generated by the wigglers. This paper will present the overall conceptual design of the wiggler straight vacuum system developed for the ILC Reference Design Report. Particular emphasis will be placed on photon power load calculations and the absorber design
Positron Options for the Linac-Ring LHeC
Zimmermann, F; Papaphilippou, Y; Schulte, D; Sievers, P; Rinolfi, L; Variola, A; Zomer, F; Braun, H H; Yakimenko, V; Bulyak, E V; Klein, M
2012-01-01
The full physics program of a future Large Hadron electron Collider (LHeC) [1] requires both pe+ and pe− collisions. For a pulsed 140-GeV or an ERL-based 60-GeV Linac-Ring LHeC this implies a challenging rate of, respectively, about 1.8 × 1015 or 4.4 × 1016 e+/s at the collision point, which is about 300 or 7000 times the rate previously obtained, at the SLAC Linear Collider (SLC). We consider providing this e+ rate through a combination of measures: (1) Reducing the required production rate from the e+ target through colliding e+ (and the LHC protons) several times before deceleration, by reusing the e+ over several acceleration/deceleration cycles, and by cooling them, e.g., with a compact tri-ring scheme or a conventional damping ring in the SPS tunnel. (2) Using an advanced target, e.g., W-granules, rotating wheel, slicedrod converter, or liquid metal jet, for converting gamma rays to e+. (3) Selecting the most powerful of several proposed gamma sources, namely Compton ERL, Compton storage ring, coher...
International Nuclear Information System (INIS)
Pivi, M.; Raubenheimer, T.O.; Furman, M.A.
2003-01-01
In the beam pipe of the Main Damping Ring (MDR) of the Next Linear Collider (NLC), ionization of residual gases and secondary emission give rise to an electron-cloud which stabilizes to equilibrium after few bunch trains. In this paper, we present recent computer simulation results for the main features of the electron cloud at the NLC and preliminary simulation results for the TESLA main damping rings, obtained with the code POSINST that has been developed at LBNL, and lately in collaboration with SLAC, over the past 7 years. Possible remedies to mitigate the effect are also discussed. We have recently included the possibility to simulate different magnetic field configurations in our code including solenoid, quadrupole, sextupole and wiggler
Application of online modeling to the operation of SLC
International Nuclear Information System (INIS)
Woodley, M.D.; Sanchez-Chopitea, L.; Shoaee, H.
1987-02-01
Online computer models of first order beam optics have been developed for the commissioning, control and operation of the entire SLC including Damping Rings, Linac, Positron Return Line and Collider Arcs. A generalized online environment utilizing these models provides the capability for interactive selection of a desired optics configuration and for the study of its properties. Automated procedures have been developed which calculate and load beamline component set-points and which can scale magnet strengths to achieve desired beam properties for any Linac energy profile. Graphic displays facilitate comparison of design, desired and actual optical characteristics of the beamlines. Measured beam properties, such as beam emittance and dispersion, can be incorporated interactively into the models and used for beamline matching and optimization of injection and extraction efficiencies and beam transmission. The online optics modeling facility also serves as the foundation for many model-driven applications such as autosteering, calculation of beam launch parameters, emittance measurement and dispersion correction
Application of online modeling to the operation of SLC
International Nuclear Information System (INIS)
Woodley, M.D.; Sanchez-Chopitea, L.; Shoaee, H.
1987-01-01
Online computer models of first order beam optics have been developed for the commissioning, control and operation of the entire SLC including Damping Rings, Linac, Positron Return Line and Collider Arcs. A generalized online environment utilizing these models provides the capability for interactive selection of a desire optics configuration and for the study of its properties. Automated procedures have been developed which calculate and load beamline component set-points and which can scale magnet strengths to achieve desired beam properties for any Linac energy profile. Graphic displays facilitate comparison of design, desired and actual optical characteristics of the beamlines. Measured beam properties, such as beam emittance and dispersion, can be incorporated interactively into the models and used for beam matching and optimization of injection and extraction efficiencies and beam transmissions. The online optics modeling facility also serves as the foundation for many model-driven applications such as autosteering, calculation of beam launch parameters, emittance measurement and dispersion correction
Achievement of ultra-low emittance beam in the ATF damping ring
Honda, Y; Araki, S; Bane, Karl Leopold Freitag; Brachmann, A; Frisch, J; Fukuda, M; Hasegawa, K; Hayano, H; Hendrickson, L; Higashi, Y; Higo, T; Hirano, K; Hirose, T; Iida, K; Imai, T; Inoue, Y; Karataev, P; Kubo, K; Kurihara, Y; Kuriki, M; Kuroda, R; Kuroda, S; Luo, X; Matsuda, M; McCormick, D; Muto, T; Nakajima, K; Nelson, J; Nomura, M; Ohashi, A; Okugi, T; Omori, T; Ross, M; Sakai, H; Sakai, I; Sasao, N; Smith, S; Suzuki, T; Takano, M; Takashi, N; Taniguchi, T; Terunuma, N; Toge, N; Turner, J; Urakawa, J; Vogel, V; Wolski, A; Woodley, M; Yamazaki, I; Yamazaki, Y; Yocky, J; Young, A; Zimmermann, Frank
2003-01-01
We report on the smallest vertical emittance achieved in single-bunch-mode operation of the ATF. The emittances were measured with a laser-wire beam-profile monitor installed in the damping ring. The bunch length and the momentum spread of the beam were also recorded under the same conditions. The smallest vertical rms emittance measured is 4 pm in the limit of zero current. It increases by a factor of 1.5 for a bunch intensity of 10^10 electrons. There are no discrepancies between the measured data and the calculations of intra-beam scattering.
Some uses of REPMM's in storage rings and colliders
International Nuclear Information System (INIS)
Spencer, J.E.
1985-04-01
Improvements for existing rings and techniques for building new rings composed entirely of passive, Rare Earth Permanent Magnet Multipoles (REPMM's) are considered using circular dipoles, quadrupoles and sextupoles. Over the past few years we have made such magnets using a single size SmCo 5 block with up to five easy-axis orientations. The final production scheme is modular in that magnets are built-up from quantized layers. All multipole layers are made in exactly the same way using algorithms differing only by the desired multipole symmetry. The method is simple, efficient and inexpensive and allows a ''do-it-yourself'' approach to constructing new magnetic elements. For rings these might include focusing optical klystrons, rotatable multipoles for diagnostics, correction or extraction, or possibly combined function systems for the unit cells. A high quality, low-beta, PMQ insertion which can change beta, tune and energy is described as well as the PMS's for the SD and SF elements of the North SLC damping ring. Because these sextupoles will be the first optical use of PM's in storage rings they are discussed in detail together with the advantages, problems and requirements of such applications. 8 refs., 4 figs
Apsimon, Robert; Barnes, Mike; Borburgh, Jan; Goddard, Brennan; Papaphilippou, Yannis; Uythoven, Jan
2014-01-01
Linear machines such as CLIC have relatively low rates of collision between bunches compared to their circular counterparts. In order to achieve the required luminosity, a very small spot size is envisaged at the interaction point, thus a low emittance beam is needed. Damping rings are essential for producing the low emittances needed for the CLIC main beam. It is crucial that the beams are injected and extracted from the damping rings in a stable and repeatable fashion to minimise emittance blow-up and beam jitter at the interaction point; both of these effects will deteriorate the luminosity at the interaction point. In this paper, the parameters and constraints of the injection and extraction systems are considered and the design of these systems is optimised within this parameter space. Related machine protection is considered in order to prevent damage from potential failure modes of the injection and extraction systems.
Damping Wiggler Study at KEK-ATF
Naito, Takashi; Honda, Yosuke; Korostelev, Maxim S; Kubo, Kiyoshi; Kuriki, Masao; Kuroda, Shigeru; Muto, Toshiya; Nakamura, Norio; Ross, Marc; Sakai, Hiroshi; Terunuma, Nobuhiro; Urakawa, Junji; Zimmermann, Frank
2005-01-01
The effects by damping wiggler magnets have been studied at KEK-ATF. The damping ring of the KEK-ATF is a 1.3 GeV storage ring capable of producing ultra-low emittance electron beams. It is significant issue to realize fast damping in the damping ring. The tuning method with 4 sets of wiggler was investigated for the ultra-low emittance beam. The performance on the beam quality, which is related to the transverse (x and y) and the longitudinal (z and dp/p), has been measured by the SR monitor, the laser wire, the streak camera and the energy spread monitor at the extraction line. We report on the operation condition and the measurement results.
SLAC-Linac-Collider (SLC) Project
International Nuclear Information System (INIS)
Wiedemann, H.
1981-02-01
The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system
Torsion of surface plate of the active support table for the ATF damping ring
International Nuclear Information System (INIS)
Takeuchi, Yasunori; Takeda, Shigeru; Kudo, Kikuo; Funahashi, Yoshisato; Kanazawa, Yasunori.
1996-01-01
Distortion of the surface plate of active support table was measured using precise tiltmeters. It is found that the surface plate is twisted when the temperature changes. The effect of this phenomenon is much smaller than the alignment tolerance of the ATF damping ring if the room temperature is controlled within 0.4degC. However, it is not negligible in the linear collider case. (author)
Global Optimization of Damping Ring Designs Using a Multi-Objective Evolutionary Algorithm
Emery, Louis
2005-01-01
Several damping ring designs for the International Linear Collider have been proposed recently. Some of the specifications, such as circumference and bunch train, are not fixed yet. Designers must make a choice anyway, select a geometry type (dog-bone or circular), an arc cell type (TME or FODO), and optimize linear and nonlinear part of the optics. The design process include straightforward steps (usually the linear optics), and some steps not so straightforward (when nonlinear optics optimization is affected by the linear optics). A first attempt at automating this process for the linear optics is reported. We first recognize that the optics is defined by just a few primary parameters (e.g., phase advance per cell) that determine the rest (e.g., quadrupole strength). In addition to the exact specification of circumference, equilibrium emittance and damping time there are some other quantities which could be optimized that may conflict with each other. A multiobjective genetic optimizer solves this problem b...
Essay: Bob Siemann-SLC Days at SLAC
International Nuclear Information System (INIS)
Raubenheimer, Tor O.
2008-01-01
Bob Siemann was a great experimentalist and an excellent teacher.We will greatly miss him. Bob came to SLAC in early 1991 to work on the Stanford Linear Collider (SLC). The SLC was a challenging accelerator which began operating in the late 1980's but still had numerous obstacles to be overcome years into operation. One of the compounding difficulties was making reproducible measurements, since the stability of the collider was poor and the diagnostics were insufficient. Bob dove into this challenge and helped design experiments and diagnostics that provided further clarity. I first got to know Bob while I was still a graduate student, trying to finish my thesis and performing some experimental studies on the SLC, which, at the time, was proving to be very difficult. Most of my expertise had been in beam theory and simulation. Dealing with the real issues of the accelerator was challenging. Bob helped me understand the difference between systematic and statistical errors, and separate operational issues from the fundamental physics. His way of teaching was not to provide an explanation but to ask enough questions so that I could find the answer on my own - this was the best way to learn. I later asked Bob to be a reader on my thesis. As in all things, he took this role extremely seriously. He read through the draft and marked every page to the point where I was regretting my decision. However, his questions again helped me understand my own work better and greatly improved my thesis. Bob was also the de facto leader of an effort focused on the damping rings and the bunch compressors. He was great to work with. He made people think for themselves and refused to simply provide answers. He also worked hard himself, expressing real interest and curiosity. After the studies of the SLC damping rings identified a sawtooth instability due to the vacuum chamber impedance as a source of many downstream fluctuations, Bob took charge of upgrading the rings. As part of this
Spin motion of electrons in the SLC linac
International Nuclear Information System (INIS)
Panofsky, W.K.H.
1990-01-01
It is generally expected that the depolarizing effects of the linear accelerator RF fields will be small. Recently Bill Atwood raised the question whether this conclusion is still correct in view of the fact that the particles in the SLC spend a larger fraction of their time at phase angles ''off crest'' due to BNS damping; since radial fields are in quadrature with the accelerating field this might imply that depolarizing effects are larger. On the other hand, because of the smaller emittance of the SLC relative to the earlier linac radial excursions would be smaller. The anticipation is therefore that the depolarizing effect will again be negligible but it might be worthwhile to update the early calculations of SLAC TN-63-97 revised in this paper
DEFF Research Database (Denmark)
Christiansen, Jens; Klit, Peder; Vølund, Anders
2007-01-01
engine. The basic idea is to use the fluid film damping coefficients to estimate the film thickness variation for a piston ring under cyclic varying load. Reynolds Equation is solved for a piston ring and the oil film thickness is determined. In this analysis hydrodynamic lubrication is assumed......In 1966 Jorgen W. Lund published an approach to find the dynamic coefficients of a journal bearing by a first order perturbation of the Reynold's equation. These coefficients made it possible to perform a rotor-bearing stability analysis for a statically loaded bearing. In the mid seventies Jorgen...
Progress report on the SLAC Linear Collider
International Nuclear Information System (INIS)
Rees, J.
1986-06-01
The SLAC Linear Collider project (SLC) is reported as being near completion. The performance specifications are tabulated both for the initial form and for eventual goals. Various parts of the SLC are described and the status of their construction is reported, including the front end electron gun and booster, the linac, damping ring, positron source, SLC arcs, and conventional facilities. 5 refs., 12 figs
Physics at the SLC [SLAC Linear Collider
International Nuclear Information System (INIS)
Swartz, M.L.
1990-11-01
The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam
RF cavity R and D at LBNL for the NLC damping rings, FY1999
International Nuclear Information System (INIS)
Rimmer, R.A.; Corlett, J.N.; Koehler, G.; Li, D.; Hartman, N.; Rasson, J.; Saleh, T.
1999-01-01
This report contains a summary of the R and D activities at LBNL on RF cavities for the NLC damping rings during fiscal year19999. These activities include the optimization of the RF design for both efficiency and damping of higher-order (HOMs), by systematic study of the cavity profile, the effect of the beam pipe diameter, nosecone angle and gap, the cross section and position of the HOM damping waveguides and the coupler. The effect of the shape of the HOM waveguides and their intersection with the cavity wall on the local surface heating is also an important factor, since it determines the highest stresses in the cavity body. This was taken into account during the optimization so that the stresses could be reduced at the same time as the HOP damping was improved over previous designs. A new method of calculating the RF heating was employed, using a recently released high frequency electromagnetic element in ANSYS. This greatly facilitates the thermal and stress analysis of the design and fabrication methods have been developed with the goals of lower stresses, fewer parts and simpler assembly compared to previous designs. This should result in substantial cost savings. Preliminary designs are described for the cavity ancillary components including the RF window, HOM loads, and tuners. A preliminary manufacturing plan is included, with an initial estimate of the resource requirements. Other cavity options are discussed which might be desirable to either lower the R/Q, for reduced transient response, or lower the residual HOM impedance to reduce coupled-bunch growth rates further still
Damping spurious harmonic resonances in the APS storage ring beam chamber
International Nuclear Information System (INIS)
Kang, Y.
1999-01-01
The APS storage ring beam chamber has been storing the beam up to 100 mA successfully. However, in some beam chambers, spurious signals corrupted the BPM outputs. The cause of the unwanted signals was investigated, and it was found that transverse electric (TE) longitudinal harmonic resonances of the beam chamber were responsible. The beam chambers have small height in the area between the ovid beam chamber and the antechamber. The structure behaves like a ridge waveguide so that the cut-off frequency of the waveguide mode becomes lower. The pass-band then includes the frequency around 350 MHz that is important to the beam position monitors (BPMs). The spurious harmonic resonances are damped with two types of dampers to restore the useful signals of the BPMs; coaxial loop dampers and lossy ceramic slab loading are used
RF cavity R and D at LBNL for the NLC Damping Rings, FY2000/2001
International Nuclear Information System (INIS)
Rimmer, R.A.; Atkinson, D.; Corlett, J.N.; Koehler, G.; Li, D.; Hartman, N.; Rasson, J.; Saleh, T.; Weidenbach, W.
2001-01-01
This report contains a summary of the R and D activities at LBNL on RF cavities for the NLC damping rings during fiscal years 2000/2001. This work is a continuation of the NLC RF system R and D of the previous year [1]. These activities include the further optimization and fine tuning of the RF cavity design for both efficiency and damping of higher-order modes (HOMs). The cavity wall surface heating and stresses were reduced at the same time as the HOM damping was improved over previous designs. Final frequency tuning was performed using the high frequency electromagnetic analysis capability in ANSYS. The mechanical design and fabrication methods have been developed with the goals of lower stresses, fewer parts and simpler assembly compared to previous designs. This should result in substantial cost savings. The cavity ancillary components including the RF window, coupling box, HOM loads, and tuners have been studied in more detail. Other cavity options are discussed which might be desirable to either further lower the HOM impedance or increase the stored energy for reduced transient response. Superconducting designs and the use of external ''energy storage'' cavities are discussed. A section is included in which the calculation method is summarized and its accuracy assessed by comparisons with the laboratory measurements of the PEP-II cavity, including errors, and with the beam-sampled spectrum
Measurement of the longitudinal parameters of an electron beam in a storage ring
International Nuclear Information System (INIS)
Krinsky, S.
1989-01-01
We discuss the determination of the longitudinal parameters of a bunched beam of electrons or positrons circulating in a storage ring. From the analysis of the beam current observed at a fixed azimuthal location, one can learn much about the longitudinal behavior. We present an elementary analysis of the time-dependence of the current. In particular, we discuss the determination of the average current, bunch length, synchrotron oscillation frequency, and the coherent synchrotron oscillation modes associated with longitudinal instabilities. A brief discussion is also given of the incoherent synchrotron oscillations, or Schottky noise. We review the electromagnetic field traveling with a charge in uniform motion, and introduce some of the most common devices used to detect this field: capacitive pick-up, stripline monitor, and DC beam current transformer. Our paper is organized as follows: We discuss the analysis of the time-dependence of the beam current. Then, the measurement of the current is considered. Finally, we describe some measurements of energy spread and bunch lengthening made recently at SLAC on the SLC damping ring. 12 refs., 6 figs
Longitudinal Single-Bunch Instability in the ILC Damping Rings: Estimate of Current Threshold
International Nuclear Information System (INIS)
Venturini, Marco; Venturini, Marco
2008-01-01
Characterization of single-bunch instabilities in the International Linear Collider (ILC) damping rings (DRs) has been indicated as a high-priority activity toward completion of an engineering design. In this paper we report on a first estimate of the current thresholds for the instability using numerical and analytical models of the wake potentials associated with the various machine components. The numerical models were derived (upon appropriate scaling) from designs of the corresponding components installed in existing machines. The current thresholds for instabilities were determined by numerical solution of the Vlasov equation for the longitudinal dynamics. For the DR baseline lattice as of Feb. 2007 we find the critical current for instability to be safely above the design specifications leaving room for further optimization of the choice of the momentum compaction
Bunch compression at the Stanford Linear Collider
International Nuclear Information System (INIS)
Holtzapple, R.L.; Decker, F.J.; Simopoulos, C.
1995-08-01
The production and measurement of short electron and positron bunches in the Stanford Linear Collider (SLC) will be presented in this paper. The bunches are compressed in a transport line between the damping rings and the linac. The electron and positron bunch distributions in the SLC linac have been measured using a Hamamatsu, model N3373-02, 500-femtosecond streak camera. The distributions were measured at the end of the SLC linac versus the bunch compressor RF voltage. The measurements are compared with simulations
PEP-II injection timing and controls
International Nuclear Information System (INIS)
Bharadwaj, V.; Browne, M.; Crane, M.; Gromme, T.; Himel, T.; Ross, M.; Stanek, M.; Ronan, M.
1997-07-01
Hardware has been built and software written and incorporated in the existing SLC accelerator control system to control injection of beam pulses from the accelerator into the PEP-II storage rings currently under construction. Hardware includes a CAMAC module to delay the machine timing fiducial in order that a beam pulse extracted from a damping ring will be injected into a selected group of four 476 MHz buckets in a PEP-II ring. Further timing control is accomplished by shifting the phase of the bunches stored in the damping rings before extraction while leaving the phase of the PEP-II stored beam unchanged. The software which drives timing devices on a pulse-to-pulse basis relies on a dedicated communication link on which one scheduling microprocessor broadcasts a 128-bit message to all distributed control microprocessors at 360 Hz. PEP-II injection will be driven by the scheduling microprocessor according to lists specifying bucket numbers in arbitrary order, and according to scheduling constraints maximizing the useful beam delivered to the SLC collider currently in operation. These lists will be generated by a microprocessor monitoring the current stored per bucket in each of the PEP-II rings
High Frequency Effects of Impedances and Coatings in the CLIC Damping Rings
Koukovini Platia, Eirini; Rumolo, G
The Compact Linear Collider (CLIC) is a 3 TeV eÅe¡ machine, currently under design at CERN, that targets to explore the terascale particle physics regime. The experiment requires a high luminosity of 2£1034 cm2 s¡1, which can be achieved with ultra low emittances delivered from the Damping Rings (DRs) complex. The high bunch brightness of the DRs gives rise to several collective effects that can limit the machine performance. Impedance studies during the design stage of the DR are of great importance to ensure safe operation under nominal parameters. As a first step, the transverse impedance model of the DRis built, accounting for the wholemachine. Beam dynamics simulations are performedwith HEADTAIL to investigate the effect on beam dynamics. For the correct impedancemodeling of the machine elements, knowledge of the material properties is essential up to hundreds of GHz, where the bunch spectrum extends. Specifically, Non Evaporable Getter (NEG) is a commonly used coating for good vacuumbut its properti...
International Nuclear Information System (INIS)
Lee, M.J.; Sheppard, J.C.; Sullenberger, M.; Woodley, M.D.
1983-09-01
On-line mathematical models have been used successfully for computer controlled operation of SPEAR and PEP. The same model control concept is being implemented for the operation of the LINAC and for the Damping Ring, which will be part of the Stanford Linear Collider (SLC). The purpose of this paper is to describe the general relationships between models, simulations and the control system for any machine at SLAC. The work we have done on the development of the empirical model for the Damping Ring will be presented as an example
Particle-in-Cell Calculations of the Electron Cloud in the ILC Positron Damping Ring Wigglers
International Nuclear Information System (INIS)
Celata, C.M.; Furman, M.A.; Vay, J.-L.; Grote, D.P.
2007-01-01
The self-consistent code suite WARP-POSINST is being used to study electron cloud effects in the ILC positron damping ring wiggler. WARP is a parallelized, 3D particle-in-cell code which is fully self-consistent for all species. The POSINST models for the production of photoelectrons and secondary electrons are used to calculate electron creation. Mesh refinement and a moving reference frame for the calculation will be used to reduce the computer time needed by several orders of magnitude. We present preliminary results for cloud buildup showing 3D electron effects at the nulls of the vertical wiggler field. First results from a benchmark of WARP-POSINST vs. POSINST are also discussed
SLC status and SLAC future plans
International Nuclear Information System (INIS)
Richter, B.
1990-01-01
In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high-energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of higher-energy linear colliders. SLAC has a major colliding-beam storage-ring program as well, including present rings and design studies on future high luminosity projects, but time constraints preclude a discussion of them. (author) 8 figs., 3 tabs
External Coulomb-Friction Damping For Hydrostatic Bearings
Buckmann, Paul S.
1992-01-01
External friction device damps vibrations of shaft and hydrostatic ring bearing in which it turns. Does not rely on wear-prone facing surfaces. Hydrostatic bearing ring clamped in radially flexing support by side plates clamped against radial surfaces by spring-loaded bolts. Plates provide friction against radial motions of shaft.
Marhauser, Frank
2017-06-01
can push the envelope towards quasi HOM-free operation suited for next generation storage and collider rings. Geometrical end-cell shape alterations for the five-cell cavity with already efficient mode damping are discussed as a possibility to further lower specific high impedance modes. The findings are eventually put into relation with demanding impedance instability thresholds in future collider rings.
Directory of Open Access Journals (Sweden)
Yosuke Honda
2003-09-01
Full Text Available We present the measurement results of electron beam emittance in the Accelerator Test Facility damping ring operated in multibunch modes. The measurements were carried out with an upgraded laser wire beam profile monitor. The monitor has now a vertical wire as well as a horizontal one and is able to make much faster measurements thanks to an increased effective laser power inside the cavity. The measured emittance shows no large bunch-to-bunch dependence in either the horizontal or vertical directions. The values of the vertical emittance are similar to those obtained in the single-bunch operation. The present results are an important step toward the realization of a high-energy linear collider.
Design of the APS transverse and longitudinal damping system
International Nuclear Information System (INIS)
Sellyey, W.; Barr, D.; Kahana, E.; Votaw, A.
1994-01-01
The main sources of instabilities in the Advanced Photon Source (APS) storage ring are expected to be higher-order modes (HOMs) of the accelerating cavities and the resistive wall impedance of the small insertion devices beam tubes. Extensive efforts are being made to reduce the Qs of HOMs. The maximum operating current of the ring will be 300 mA. At this current, analysis of measurements on cavity prototypes shows that the transverse growth rates will be less than 500/sec above radiation damping. The longitudinal growth rate due to HOMs is predicted to never exceed the radiation damping of 213/sec. The largest transverse resistive wall growth rate is calculated to be 2720/sec when 54 evenly spaced rigid bunches are used to produce 300 mA. There will be 26 additional unstable modes. The sum of these growth rates is 17,163/sec. Thus, it is clear that an effective transverse damping system will be needed and that the strength of this damper will be dominated by the resistive wall modes. A longitudinal damper system will also be built. This will provide damping about 2/3 times that due to synchrotron radiation. The most serious disturbances which can initiate instabilities will take place at injection. Typically, each bunch in the ring will be accumulated by injecting 115 of the final charge five times. A standard mode of operation is used in this paper in which there will be 54 evenly spaced bunches around the ring. During the ring filling process, the highest growth rates will occur when the last fifth of a bunch is injected into the last bunch. The largest expected vertical excursion of 1/5 of a bunch is about 5 mm. Anything larger will cause the bunch to scrape in the insertion device sections
Foucault pendulum with eddy-current damping of the elliptical motion
Mastner, G.; Vokurka, V.; Maschek, M.; Vogt, E.; Kaufmann, H. P.
1984-10-01
A newly designed Foucault pendulum is described in which the mechanical Charron ring, used throughout in previous designs for damping of the elliptical motion of the pendulum, is replaced by an electromagnetic eddy-current brake, consisting of a permanent magnet attached to the bottom of the bob and a metallic ring. This damping device is very efficient, as it is self-aligning, symmetrical in the damping effect, and never wears out. The permanent magnet is also used, together with a coil assembly and an electronic circuitry, for the dipole-torque drive of the pendulum as well as for accurate stabilization of the amplitude of the swing. A latched time display, controlled by Hall probes activated by the magnet, is used to visualize the Foucault rotation. The pendulum system and its associated electronic circuitry are described in detail. The optimizing of the drive mode is discussed. Measurements of deviations from theoretical value of the Foucault rotation velocity made automatically in a continuous run show a reproducible accuracy of ±1% or better in individual 360° rotations during the summer months. The quality factor of the pendulum as mechanical resonator was measured as a function of the amplitude in the presence of the eddy-current damping ring.
Experience with a high-brightness storage ring: the NSLS 750 MeV vuv ring
International Nuclear Information System (INIS)
Galayda, J.
1984-01-01
The NSLS vuv ring is the first implementation of the proposals of R. Chasman and G.K. Green for a synchrotron radiation source with enhanced brightness: its lattice is a series of achromatic bends with two zero-gradient dipoles each, giving small damped emittance; and these bends are connected by straight sections with zero dispersion to accommodate wigglers and undulators without degrading the radiation damping properties of the ring. The virtues of the Chasman-Green lattice, its small betatron and synchrotron emittances, may be understood with some generality; e.g. the electron γm 0 c 2 energy and the number of achromatic bends M sets a lower limit on the betatron emittance of e/sub x/ > 7.7 x 10 -13 γ 2 /M meter-radians. There is strong interest in extrapolation of this type of lattice to 6 GeV and to 32 achromatic bends. The subject of this report is the progress toward achieving performance in the vuv ring limited by the radiation damping parameters optimized in its design. 14 refs., 4 figs., 1 tab
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS
Fast and reliable kicker magnets for the SLC damping rings
International Nuclear Information System (INIS)
Mattison, T.S.; Cassel, R.L.; Donaldson, A.R.; Gross, G.
1995-01-01
The design, construction, and operation of a kicker magnet with superior electromagnetic performance and greatly improved radiation tolerance is described. A short flux return of high mu ferrite improves the field strength and linearity with current, and novel metallic field-confining structures minimize the inductance. An 8-cell structure with capacitance integrated into each cell makes the magnet a nearly perfect transmission line. The capacitor dielectric is 1 cm thick alumina-loaded epoxy, processed to eliminate air voids, and cast in a multiple step procedure developed to circumvent epoxy shrinkage. The magnet operates with pulses of up to 40 kV and 3.2 kA at 120 Hz, with magnet transit times of less than 35 nsec and field rise and fall times of less than 60 nsec
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4
ILC Damping Rings: Benefit of the Antechamber or: Antechamber vs. SEY
International Nuclear Information System (INIS)
Furman, M.A.
2011-01-01
We present simulation results of the build-up of the electron-cloud density n e for the two proposed ILC damping ring lattices, DC04 and DSB3, with particular attention to the potential benefit of an antechamber. We examine a field-free region and a dipole bending magnet, with or without an antechamber. We assume a secondary electronemission model for the chamber surface based on approximate fits to measured data for TiN, except that we let the peak value of the secondary emission yield (SEY), (delta) max , be a variable. We conclude that there is a critical value of (delta) max below which the antechamber provides a substantial benefit, roughly a factor ∼40 reduction in n e relative to the case in which max exceeds the critical value. We estimate the steady-state value of n e as a function of (delta) max , and thereby obtain the critical value of (delta) max for all cases considered. Thus, from the perspective of the electron-cloud effect, the inclusion of an antechamber in the design is justified only if (delta) max is below the critical value. The results presented here constitute a slight extension of those previously presented in March and September, 2010.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4
Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice
Directory of Open Access Journals (Sweden)
Kaifeng Yin
2017-05-01
Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4
Damping in accelerators due to classical radiation
International Nuclear Information System (INIS)
Mills, F.E.
1962-01-01
The rates of change of the magnitudes of the adiabatic invariants is calculated in the case of a Hamiltonian system subjected to generalized non conservative forces. These results are applied to the case of the classical radiation of electrons in an accelerator or storage ring. The resulting expressions for the damping rates of three independent oscillation modes suggest structures which are damping in all three modes, while at the same time allowing 'strong focussing' and the attendant strong momentum compaction. (author)
SLC status and NLC design and R and D
International Nuclear Information System (INIS)
Raubenheimer, T.O.
1996-09-01
In this paper, the authors will first review the status of the Stanford Linear Collider (SLC). In particular, they discuss the luminosity and performance issues and the accelerator studies that relate to future linear colliders. Next, they describe the present state of the Next Linear Collider (NLC) design and the ongoing R and D effort which is, in addition to the work at the SLC, supporting the design. This includes extensive ground motion measurements to verify the required stability, measurements of the dipole wakefields to verify the performance of the Damped-Detuned accelerator Structures (DDS), and tests of the rf structure BPMs that are needed to align the structure to the beam trajectory. It also includes the development and fabrication of the X-band structures, klystrons, and rf pulse compressors that are needed to accelerate the beams with gradients in excess of 50 MV/m. It should be noted that much of the material reported here is described in greater detail in other papers submitted to this conference and thus the appropriate references are included throughout. In addition, because of space limitations, they only briefly describe the design of the NLC and, instead, concentrate on the R and D that is supporting the design
DEFF Research Database (Denmark)
Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D
2013-01-01
The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...
The positron accumulator ring for the APS
International Nuclear Information System (INIS)
Crosbie, E.A.
1989-01-01
The Positron Accumulator Ring (PAR) is designed to accumulate and damp positrons from the 450-MeV linac during the 0.5-s cycle time of the injector synchrotron for the APS 7-GeV storage ring. During 0.4 s of each synchrotron cycle, up to 24 linac pulses are injected into the horizontal phase space of the PAR at a 60-Hz rate. Each injected pulse occupies about 1.3 of the circumference of the accumulator ring. After 0.1 s for longitudinal damping, the single accumulated bunch is transferred to one of the 353-MHz buckets of the injector synchrotron RF system. The bunch is accelerated to 7 GeV and transferred to the storage ring, while the PAR accumulates the next bunch of positrons. 2 refs., 3 figs., 2 tabs
The positron accumulator ring for the APS
International Nuclear Information System (INIS)
Crosbie, E.A.
1989-01-01
The Positron Accumulator Ring (PAR) is designed to accumulate and damp positrons from the 450-MeV linac during the 0.5-s cycle time of the injector synchrotron for the APS 7-GeV storage ring. During 0.4 s of each synchrotron cycle, up to 24 linac pulses are injected into the horizontal phase space of the PAR at a 60-Hz rate. Each injected pulse occupies about 1/3 of the circumference of the accumulator ring. After 0.1 s for longitudinal damping, the single accumulated bunch is transferred to one of the 353-MHz buckets of the injector synchrotron RF system. The bunch is accelerated to 7 GeV and transferred to the storage ring, while the PAR accumulates the next bunch of positrons. 2 refs., 3 figs., 2 tabs
Gallium arsenide digital integrated circuits for controlling SLAC CW-RF systems
International Nuclear Information System (INIS)
Ronan, M.T.; Lee, K.L.; Corredoura, P.; Judkins, J.G.
1989-01-01
In order to fill the PEP and SPEAR storage rings with beams from the SLC linac and damping rings, precise control of the linac subharmonic buncher and the damping ring RF is required. Recently several companies have developed resettable GaAs master/slave D-type flip-flops which are capable of operating at frequencies of 3 GHz and higher. Using these digital devices as frequency dividers, one can phase shift the SLAC CW-RF systems to optimize the timing for filling the storage rings. The authors have evaluated the performance of integrated circuits from two vendors for our particular application. Using microstrip circuit techniques, they have built and operated in the accelerator several chassis to synchronize a reset signal from the storage rings to the SLAC 2.856 GHz RF and to phase shift divide-by-four and divide-by-sixteen frequency dividers to the nearest 350 psec bucket required for filling
Gallium arsenide digital integrated circuits for controlling SLAC CW-RF systems
International Nuclear Information System (INIS)
Ronan, M.T.; Lee, K.L.; Corredoura, P.; Judkins, J.G.
1988-10-01
In order to fill the PEP and SPEAR storage rings with beams from the SLC linac and damping rings, precise control of the linac subharmonic buncher and the damping ring RF is required. Recently several companies have developed resettable GaAs master/slave D-type flip-flops which are capable of operating at frequencies of 3 GHz and higher. Using these digital devices as frequency dividers, one can phase shift the SLAC CW-RF systems to optimize the timing for filling the storage rings. We have evaluated the performance of integrated circuits from two vendors for our particular application. Using microstrip circuit techniques, we have built and operated in the accelerator several chassis to synchronize a reset signal from the storage rings to the SLAC 2.856 GHz RF and to phase shift divide-by-four and divide-by-sixteen frequency dividers to the nearest 350 psec bucket required for filling. 4 refs., 4 figs., 2 tabs
SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.
Directory of Open Access Journals (Sweden)
Chi-Jiunn Pan
Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.
SLC status and SLAC [Stanford Linear Accelerator Center] future plans
International Nuclear Information System (INIS)
Richter, B.
1989-08-01
In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of high-energy linear colliders. SLAC had a major colliding-beam storage-ring program as well, including present rings and design studies on future high-luminosity projects, but time constraints preclude a discussion of them. 8 figs., 3 tabs
International Nuclear Information System (INIS)
Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.
1987-02-01
Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed
Characterization of SLC transporters in human skin
Directory of Open Access Journals (Sweden)
Marion Alriquet
2015-03-01
Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.
Analyzing gigahertz bunch length instabilities with a digital signal processor
International Nuclear Information System (INIS)
Stege, R.E. Jr.; Krejcik, P.; Minty, M.G.
1992-11-01
A bunch length instability, nicknamed the ''sawtooth'', because of its transient behavior, has been observed at high current running in the Stanford Linear Collider (SLC) electron damping ring. The incompatibility of this instability with successful SLC naming prompted its study using a high bandwidth real-time spectrum analyzer, the Tektronix 3052 digital signal processor (DSP) system. This device has been used to study energy ramping in storage rings but this is the first time it has been used to study transient instability phenomena. It is a particularly valuable tool for use in understanding non-linear, multiple frequency phenomena. The frequency range of this device has been extended through the use of radio frequency (RF) down converters. This paper describes the measurement setup and presents some of the results
Broadband feedback systems for the damping of coherent beam instabilities in the stretcher ring ELSA
International Nuclear Information System (INIS)
Roth, Andre
2012-12-01
At the Electron Stretcher Facility ELSA an upgrade of the internal beam current up to 200 mA would be desirable in order to increase the intensity of the extracted electron beam for the future experimental hadron physics program. However, such an upgrade is mainly limited by the excitation of coherent beam instabilities in the stretcher ring. As active counteraction, broadband bunch-by-bunch feedback-systems for the longitudinal, as well as for both transverse planes were installed. After detection of the motion of each of the 27 4 stored bunches via beam position monitors, the systems determine independent correction signals for each bunch using digital signal processors. The amplified correction signals are applied to the beam by means of broadband longitudinal and transverse kicker structures. The detailed setup, the commissioning procedure and measurement results of the damping performance of the systems are presented. In addition, the operation of the longitudinal system during the fast energy ramp of 4 GeV/s from 1.2 GeV to 3.2 GeV is investigated.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul
Fast cooling of bunches in compton storage rings*
Bulyak, E; Zimmermann, F
2011-01-01
We propose an enhancement of laser radiative cooling by utilizing laser pulses of small spatial and temporal dimensions, which interact only with a fraction of an electron bunch circulating in a storage ring. We studied the dynamics of such electron bunch when laser photons scatter off the electrons at a collision point placed in a section with nonzero dispersion. In this case of ‘asymmetric cooling’, the stationary energy spread is much smaller than under conditions of regular scattering where the laser spot size is larger than the electron beam; and the synchrotron oscillations are damped faster. Coherent oscillations of large amplitude may be damped within one synchrotron period, so that this method can support the rapid successive injection of many bunches in longitudinal phase space for stacking purposes. Results of extensive simulations are presented for the performance optimization of Compton gamma-ray sources and damping rings.
Low emittance electron storage rings
Levichev, E. B.
2018-01-01
Low-emittance electron (positron) beams are essential for synchrotron light sources, linear collider damping rings, and circular Crab Waist colliders. In this review, the principles and methods of emittance minimization are discussed, prospects for developing relativistic electron storage rings with small beam phase volume are assessed, and problems related to emittance minimization are examined together with their possible solutions. The special features and engineering implementation aspects of various facilities are briefly reviewed.
SLAC modulator operation and reliability in the SLC Era
International Nuclear Information System (INIS)
Donaldson, A.R.; Ashton, J.R.
1992-06-01
A discussion of the operation and reliability of the 244 modulators in the SLAC linac with an emphasis on the past three years of operation. The linac modulators were designed and built in the 60's, upgraded for the SLAC Linear Collider (SLC) in the mid 80s, and despite their age are still reliable accelerator components. The 60s modulator operated at 65 MW peak and 83 kW average power. The upgrade resulted in 150 MW peak output at an average power of 87 kW, a modest increase since the repetition rate was dropped from 360 to 120 Hz. In the present accelerator configuration, the Linac operates as a source of electrons and positrons to a single pass coillider. The classic collider is a storage ring filled with oppositely charged, counter-rotating particles which are allowed to collide until an accelerator fault occurs and the stored beams are aborted. A reasonable storage ring can store and collide particles for as long as eight hours with a 10 or 20 minute filling time. A single pass collider, + on the other hand, can only produce e - and e + collisions at whatever rate the source operates. To be effective the SLC must operate at 120 Hz with a very high degree of reliability and on a continuous basis. Fortunately, the linac has a modest excess of modulator/klystron systems which allows some measure of redundancy and hence some freedom from the constraint that all 244 modulator/klystrons operate simultaneously. Nonetheless, high importance is placed on modulator MTBF and MTRR or, in the parlance of reliability experts and accelerator physicists, availability. This is especially true of the modulators associated with the fundamental requirements of a collider such as injection, compression and positron production
EVOLUTION OF A RING AROUND THE PLUTO–CHARON BINARY
Energy Technology Data Exchange (ETDEWEB)
Bromley, Benjamin C. [Department of Physics and Astronomy, University of Utah, 115 S 1400 E, Rm 201, Salt Lake City, UT 84112 (United States); Kenyon, Scott J., E-mail: bromley@physics.utah.edu, E-mail: skenyon@cfa.harvard.edu [Smithsonian Astrophysical Observatory, 60 Garden St., Cambridge, MA 02138 (United States)
2015-08-10
We consider the formation of satellites around the Pluto–Charon binary. An early collision between the two partners likely produced the binary and a narrow ring of debris, out of which arose the moons Styx, Nix, Kerberos, and Hydra. How the satellites emerged from the compact ring is uncertain. Here we show that a particle ring spreads from physical collisions and collective gravitational scattering, similar to migration. Around a binary, these processes take place in the reference frames of “most circular” orbits, akin to circular ones in a Keplerian potential. Ring particles damp to these orbits and avoid destructive collisions. Damping and diffusion also help particles survive dynamical instabilities driven by resonances with the binary. In some situations, particles become trapped near resonances that sweep outward with the tidal evolution of the Pluto–Charon binary. With simple models and numerical experiments, we show how the Pluto–Charon impact ring may have expanded into a broad disk, out of which grew the circumbinary moons. In some scenarios, the ring can spread well beyond the orbit of Hydra, the most distant moon, to form a handful of smaller satellites. If these small moons exist, New Horizons will find them.
Adding PCs to SLC Control System
International Nuclear Information System (INIS)
Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.
1993-05-01
The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
A model of ATL ground motion for storage rings
International Nuclear Information System (INIS)
Wolski, Andrzej; Walker, Nicholas J.
2003-01-01
Low emittance electron storage rings, such as those used in third generation light sources or linear collider damping rings, rely for their performance on highly stable alignment of the lattice components. Even if all vibration and environmental noise sources could be suppressed, diffusive ground motion will lead to orbit drift and emittance growth. Understanding such motion is important for predicting the performance of a planned accelerator and designing a correction system. A description (known as the ATL model) of ground motion over relatively long time scales has been developed and has become the standard for studies of the long straight beamlines in linear colliders. Here, we show how the model may be developed to include beamlines of any geometry. We apply the model to the NLC and TESLA damping rings, to compare their relative stability under different conditions
Directory of Open Access Journals (Sweden)
Keun Ryu
2018-04-01
Full Text Available The current work introduces a new semi-floating ring bearing (SFRB system developed for improving the rotordynamic and vibration performance of automotive turbochargers (TCs at extreme operation conditions, such as high temperature, severe external force excitation, and large rotor imbalance. The new bearing design replaces outer oil films, i.e., squeeze film dampers (SFDs, in TC SFRBs with wire mesh dampers (WMDs. This SFRB configuration integrating WMDs aims to implement reliable mechanical components, as an inexpensive and simple alternative to SFDs, with consistent and superior damping capability, as well as predictable forced performance. Since WMDs are in series with the inner oil films of SFRBs, experimentally determined force coefficients of WMDs are of great importance in the design process of TC rotor-bearing systems (RBSs. Presently, the measurements of applied static load and ensuing deflection determine the structural stiffnesses of the WMDs. The WMD damping parameters, including dissipated energy, loss factor, and dry friction coefficient, are estimated from the area of the distinctive local hysteresis loop of the load versus WMD displacement data recorded during consecutive loading-unloading cycles as a function of applied preload with a constant amplitude of motion. The changes in WMD loss factor and dry friction coefficient due to increases in preload are more significant for the WMDs with lower density. The present work shows, to date, the most comprehensive measurements of static load characteristics on the WMDs for application into small automotive TCs. More importantly, the extensive test measurements of WMD deflection versus increasing static loads will aid to anchor predictions of future computation model.
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Polarized source performance in 1992 for SLC--SLD
International Nuclear Information System (INIS)
Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.
1993-02-01
In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met
A damped detuned structure for the next linear collider
International Nuclear Information System (INIS)
Miller, R.H.; Adolphsen, C.; Bane, K.L.
1996-09-01
An X-band Damped Detuned Structure (DDS) for NLC has been fabricated as part of a collaboration between KEK and SLAC. The individual cells were diamond point machined and microwave tested at KEK. The cells were diffusion bonded at SLAC. The structure has been cold tested. The time dependence of the beam induced dipole wakefields have been measured with the SLC beam in the test station ASSET. The structure is designed so that the dipole modes have an approximately gaussian density distribution in the frequency domain. This gives an approximately gaussian decrease of the wakefields for short times (about 10 ns), which is produced by the interference among the 206 modes in the lowest dipole mode band of the 206 cell structure. Without damping, however, the wakefields then rise back to a level which is approximately equal to the expected incoherent level from the 206 modes. The damping is accomplished by means of 4 rectangular slots or manifolds (approximately 5 mm by 10 mm) equally spaced in azimuth around the structure and running the full length of the structure. These manifolds act as single mode rectangular waveguides for the lowest band dipole modes, but are cut off for the accelerating mode. The manifolds are coupled to every cell in the structure, except for 3 at each end, by means of radial slots. Each of the four manifolds will have the dipole mode frequencies traveling in both directions and so are terminated on both ends. The structure will be installed in the NLC Test Accelerator this fall
Update on the high-current injector for the Stanford Linear collider
International Nuclear Information System (INIS)
James, M.B.; Clendenin, J.E.; Ecklund, S.D.; Miller, R.H.; Sheppard, J.C.; Sinclair, C.K.; Sodja, J.
1983-03-01
The high current injector has become operational. There are two crucial areas where improvements must be made to meet collider specifications: while the injector can produce up to 10 11 e - in a single S-band bucket, initially much of this charge was captured in a low energy tail and was this not suitable for transport through the accelerator and injection into the damping ring. Pulse to pulse position jitter has been observed, resulting in transverse wake field which increases beam emittance. The problems described above contribute to substantial current loss during transport from the injector (40 MeV) to the SLC damping ring (1.2 GeV). Experimental studies are continuing with the aim of understanding and improving beam characteristics including bunch length, pulse to pulse stability and emittance. The present status of these studies is reported
A Bacon Tone Ring on an Open-Back Banjo
Politzer, David
2016-01-01
Head taps on a new Goodtime banjo rim fitted with a reproduction Bacon Professional ff tone ring are contrasted with a new Goodtime, a 2002 Goodtime, and a 1999 Goodtime fitted with a 1/4′′ diameter brass ring. Conclusions: The 1/4" ring does what’s commonly imagined, the upgrades to the Goodtime over the years are not merely cosmetic, and the Bacon ring’s biggest effect is to damp head ringing and suppress high harmonics. Detailed comparisons of the new Goodtimes with and without the Bacon r...
The proposed injection system for an asymmetric B Factory in the PEP tunnel
International Nuclear Information System (INIS)
Bloom, E.; Bulos, F.; Loew, G.; Miller, R.; Sukiennicki, B.; Mattison, T.; Barletta, W.
1991-01-01
The proposed asymmetric energy B Factory to be built in the PEP tunnel at SLAC will require a highly effective and profuse source of low emittance electron and positron bunches. The B Factory will consist of two rings of equal size, a 9 GeV electron ring and a 3.1 GeV positron ring, each with 1658 bunches with total circulating currents of 1.5 and 2.1 amperes respectively. As the luminosity lifetime of the collider is expected to be about two hours, the injector should be capable of filling the rings in a small fraction of an hour. It turns out that with some simple modifications, the SLC linac with its damping rings and positron source is ideally suited to fulfill this function effectively. The overall injection system is described
Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U
2013-01-01
Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.
Modelling of Resonantly Forced Density Waves in Dense Planetary Rings
Lehmann, M.; Schmidt, J.; Salo, H.
2014-04-01
Density wave theory, originally proposed to explain the spiral structure of galactic disks, has been applied to explain parts of the complex sub-structure in Saturn's rings, such as the wavetrains excited at the inner Lindblad resonances (ILR) of various satellites. The linear theory for the excitation and damping of density waves in Saturn's rings is fairly well developed (e.g. Goldreich & Tremaine [1979]; Shu [1984]). However, it fails to describe certain aspects of the observed waves. The non-applicability of the linear theory is already indicated by the "cusplike" shape of many of the observed wave profiles. This is a typical nonlinear feature which is also present in overstability wavetrains (Schmidt & Salo [2003]; Latter & Ogilvie [2010]). In particular, it turns out that the detailed damping mechanism, as well as the role of different nonlinear effects on the propagation of density waves remain intransparent. First attemps are being made to investigate the excitation and propagation of nonlinear density waves within a hydrodynamical formalism, which is also the natural formalism for describing linear density waves. A simple weakly nonlinear model, derived from a multiple-scale expansion of the hydrodynamic equations, is presented. This model describes the damping of "free" spiral density waves in a vertically integrated fluid disk with density dependent transport coefficients, where the effects of the hydrodynamic nonlinearities are included. The model predicts that density waves are linearly unstable in a ring region where the conditions for viscous overstability are met, which translates to a steep dependence of the shear viscosity with respect to the disk's surface density. The possibility that this dependence could lead to a growth of density waves with increasing distance from the resonance, was already mentioned in Goldreich & Tremaine [1978]. Sufficiently far away from the ILR, the surface density perturbation caused by the wave, is predicted to
Energy Technology Data Exchange (ETDEWEB)
Anon.
1990-05-15
During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)
Wolski, Andrzej
2014-01-01
The effects of synchrotron radiation on particle motion in storage rings are discussed. In the absence of radiation, particle motion is symplectic, and the beam emittances are conserved. The inclusion of radiation effects in a classical approximation leads to emittance damping: expressions for the damping times are derived. Then, it is shown that quantum radiation effects lead to excitation of the beam emittances. General expressions for the equilibrium longitudinal and horizontal (natural) emittances are derived. The impact of lattice design on the natural emittance is discussed, with particular attention to the special cases of FODO-, achromat- and theoretical-minimum-emittance-style lattices. Finally, the effects of betatron coupling and vertical dispersion (generated by magnet alignment and lattice tuning errors) on the vertical emittance are considered.
Oscillation damping of chiral string loops
International Nuclear Information System (INIS)
Babichev, Eugeny; Dokuchaev, Vyacheslav
2002-01-01
Chiral cosmic string loops tend to the stationary (vorton) configuration due to energy loss into gravitational and electromagnetic radiation. We describe the asymptotic behavior of near stationary chiral loops and their fading to vortons. General limits on the gravitational and electromagnetic energy losses by near stationary chiral loops are found. For these loops we estimate the oscillation damping time. We present solvable examples of gravitational radiation energy loss by some chiral loop configurations. The analytical dependence of string energy with time is found in the case of the chiral ring with small amplitude radial oscillations
Accelerator physics and modeling: Proceedings
International Nuclear Information System (INIS)
Parsa, Z.
1991-01-01
This report contains papers on the following topics: Physics of high brightness beams; radio frequency beam conditioner for fast-wave free-electron generators of coherent radiation; wake-field and space-charge effects on high brightness beams. Calculations and measured results for BNL-ATF; non-linear orbit theory and accelerator design; general problems of modeling for accelerators; development and application of dispersive soft ferrite models for time-domain simulation; and bunch lengthening in the SLC damping rings
Controllable damping of high-Q violin modes in fused silica suspension fibers
Dmitriev, A. V.; Mescheriakov, S. D.; Tokmakov, K. V.; Mitrofanov, V. P.
2010-01-01
Fused silica fiber suspension of the test masses will be used in the interferometric gravitational wave detectors of the next generation. This allows a significant reduction of losses in the suspension and thermal noise associated with the suspension. Unfortunately, unwanted violin modes may be accidentally excited in the suspension fibers. The Q-factor of the violin modes also exceeds 108. They have a ring-down time that is too long and may complicate the stable control of the interferometer. Results of the investigation of a violin mode active damping system are described. An original sensor and actuator were especially developed to realize the effective coupling of a thin, optically transparent, non-conducting fused silica fiber with an electric circuit. The damping system allowed the changing of the violin mode's damping rate over a wide range.
International Nuclear Information System (INIS)
Anon.
1990-01-01
During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)
Damping coherent phase oscillations by means of path-length modulation
International Nuclear Information System (INIS)
Rees, J.R.
1978-06-01
Multi-bunch storage rings and synchrotrons are typically plagued by a tendency for the bunches to indulge in unstable coherent phase oscillations engendered by their electromagnetic interactions with the vacuum chamber. In many machines feedback systems have been used successfully to damp these oscillations using a signal proportional to the coherent phase motion or the concomitant energy motion to control an auxiliary longitudinal electric field. The purpose of this note is to describe an alternative feedback system which, using the same kind of a signal, modulates the path length of the orbit of the reference particle (the synchronous particle in the absence of coherent phase oscillations) in such a way as to damp coherent oscillations. 2 refs., 1 fig
Drift chamber vertex detectors for SLC/LEP
Energy Technology Data Exchange (ETDEWEB)
Hayes, K G
1988-03-01
Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.
Energy Technology Data Exchange (ETDEWEB)
Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center
1998-07-01
The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.
International Nuclear Information System (INIS)
Phinney, N.
1998-01-01
The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider
An Over-damped Cavity Longitudinal Kicker for the PEP-II LER
McIntosh, P
2003-01-01
Both rings of PEP-II use drift tube kickers in the longitudinal bunch-by-bunch feedback system. Efforts are now underway to increase the stored beam currents and luminosity of PEP-II, and beam-induced heating of these structures, particularly in the Low Energy Ring (LER) is of concern. An alternative kicker design based on the over-damped cavity kicker, first developed by INFN-Frascati is being built for PEP-II. This low loaded Q (or wide bandwidth) structure is fed by a network of ridged waveguides coupled to a simple pill-box cavity. Beam induced RF power is also coupled out of the cavity to external loads, so that the higher order modes (HOMs) excited in the structure are well-damped. This paper details the kicker design for PEP-II and discusses some of the design trade-offs between shunt impedance and bandwidth, as well as the influence of the feedthroughs on the kicker parameters. Estimates of the expected power deposition in the cavity are also provided.
Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.
Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B
2016-08-08
Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Phinney, N.
1992-08-01
The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions
Dispersion and betatron matching into the linac
International Nuclear Information System (INIS)
Decker, F.J.; Adolphsen, C.; Corbett, W.J.; Emma, P.; Hsu, I.; Moshammer, H.; Seeman, J.T.; Spence, W.L.
1991-05-01
In high energy linear colliders, the low emittance beam from a damping ring has to be preserved all the way to the linac, in the linac and to the interaction point. In particular, the Ring-To-Linac (RTL) section of the SLAC Linear Collider (SLC) should provide an exact betatron and dispersion match from the damping ring to the linac. A beam with a non-zero dispersion shows up immediately as an increased emittance, while with a betatron mismatch the beam filaments in the linac. Experimental tests and tuning procedures have shown that the linearized beta matching algorithms are insufficient if the actual transport line has some unknown errors not included in the model. Also, adjusting quadrupole strengths steers the beam if it is offset in the quadrupole magnets. These and other effects have lead to a lengthy tuning process, which in the end improves the matching, but is not optimal. Different ideas will be discussed which should improve this matching procedure and make it a more reliable, faster and simpler process. 5 refs., 2 figs
SLC and SLD: Experimental experience with a linear collider
International Nuclear Information System (INIS)
Breidenbach, M.
1993-08-01
The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Directory of Open Access Journals (Sweden)
Anna Rita Cappello
2018-04-01
Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza
2018-04-01
The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
Controllable damping of high-Q violin modes in fused silica suspension fibers
Energy Technology Data Exchange (ETDEWEB)
Dmitriev, A V; Mescheriakov, S D; Mitrofanov, V P [Faculty of Physics, Moscow State University, Moscow 119991 (Russian Federation); Tokmakov, K V, E-mail: dmitriev@hbar.phys.msu.r, E-mail: mitr@hbar.phys.msu.r [Present address: Department of Physics, SUPA, University of Strathclyde, Glasgow G4 0NG (United Kingdom)
2010-01-21
Fused silica fiber suspension of the test masses will be used in the interferometric gravitational wave detectors of the next generation. This allows a significant reduction of losses in the suspension and thermal noise associated with the suspension. Unfortunately, unwanted violin modes may be accidentally excited in the suspension fibers. The Q-factor of the violin modes also exceeds 10{sup 8}. They have a ring-down time that is too long and may complicate the stable control of the interferometer. Results of the investigation of a violin mode active damping system are described. An original sensor and actuator were especially developed to realize the effective coupling of a thin, optically transparent, non-conducting fused silica fiber with an electric circuit. The damping system allowed the changing of the violin mode's damping rate over a wide range.
Controllable damping of high-Q violin modes in fused silica suspension fibers
International Nuclear Information System (INIS)
Dmitriev, A V; Mescheriakov, S D; Mitrofanov, V P; Tokmakov, K V
2010-01-01
Fused silica fiber suspension of the test masses will be used in the interferometric gravitational wave detectors of the next generation. This allows a significant reduction of losses in the suspension and thermal noise associated with the suspension. Unfortunately, unwanted violin modes may be accidentally excited in the suspension fibers. The Q-factor of the violin modes also exceeds 10 8 . They have a ring-down time that is too long and may complicate the stable control of the interferometer. Results of the investigation of a violin mode active damping system are described. An original sensor and actuator were especially developed to realize the effective coupling of a thin, optically transparent, non-conducting fused silica fiber with an electric circuit. The damping system allowed the changing of the violin mode's damping rate over a wide range.
DEFF Research Database (Denmark)
Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath
2007-01-01
Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...
STANFORD: Highly polarized SLC electron beams
International Nuclear Information System (INIS)
Anon.
1993-01-01
Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium
International Nuclear Information System (INIS)
Ware, A.G.
1985-01-01
Studies are being conducted at the Idaho National Engineering Laboratory to determine whether an increase in the damping values used in seismic structural analyses of nuclear piping systems is justified. Increasing the allowable damping would allow fewer piping supports which could lead to safer, more reliable, and less costly piping systems. Test data from availble literature were examined to determine the important parameters contributing to piping system damping, and each was investigated in separate-effects tests. From the combined results a world pipe damping data bank was established and multiple regression analyses performed to assess the relative contributions of the various parameters. The program is being extended to determine damping applicable to higher frequency (33 to 100 Hz) fluid-induced loadings. The goals of the program are to establish a methodology for predicting piping system damping and to recommend revised guidelines for the damping values to be included in analyses
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Performance of the SLC polarized electron source with high polarization
International Nuclear Information System (INIS)
Clendenin, J.E.; Alley, R.K.; Aoyagi, H.
1993-04-01
For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed
Measurement of electron beam polarization at the SLC
International Nuclear Information System (INIS)
Steiner, H.; California Univ., Berkeley
1988-01-01
One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)
The SLD Cerenkov Ring Imaging Detector: Progress report
International Nuclear Information System (INIS)
Ashford, V.; Bienz, T.; Bird, F.
1986-10-01
We describe test beam results from a prototype Cerenkov Ring Imaging Detector (CRID) for the SLD experiment at the SLAC Linear Collider (SLC). The system includes both liquid and gas radiators, a long drift box containing gaseous TMAE and a proportional wire chamber with charge division readout. Measurements of the multiplicity and detection resolution of Cerenkov photons, from both radiators are presented. Various design aspects of a new engineering prototype, currently under construction, are discussed and recent R and D results relevant to this effort are reported
Superconducting quadrupoles for the SLC final focus
International Nuclear Information System (INIS)
Erickson, R.; Fieguth, T.; Murray, J.J.
1987-01-01
The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient superconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance
Making electron beams for the SLC linac
International Nuclear Information System (INIS)
Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.
1984-01-01
A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table
Superconducting quadrupoles for the SLC final focus
International Nuclear Information System (INIS)
Erickson, R.; Fieguth, T.; Murray, J.J.
1987-01-01
The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient supperconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance
Directory of Open Access Journals (Sweden)
MyPhuong T Le
Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.
Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.
Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay
2017-07-05
Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The
SLC2A9 is a high-capacity urate transporter in humans.
Directory of Open Access Journals (Sweden)
Mark J Caulfield
2008-10-01
Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI
The partially filled viscous ring damper.
Alfriend, K. T.
1973-01-01
The problem of a spinning satellite with a partially filled viscous ring damper is investigated. It is shown that there are two distinct modes of motion, the nutation-synchronous mode and spin-synchronous mode. From an approximate solution of the equations of motion a time constant is obtained for each mode. From a consideration of the fluid dynamics several methods are developed for determining the damping constant.
Fay, Temple H.
2012-01-01
Quadratic friction involves a discontinuous damping term in equations of motion in order that the frictional force always opposes the direction of the motion. Perhaps for this reason this topic is usually omitted from beginning texts in differential equations and physics. However, quadratic damping is more realistic than viscous damping in many…
Design of a 4.8-m ring for inverse Compton scattering x-ray source
Directory of Open Access Journals (Sweden)
H. S. Xu
2014-07-01
Full Text Available In this paper we present the design of a 50 MeV compact electron storage ring with 4.8-meter circumference for the Tsinghua Thomson scattering x-ray source. The ring consists of four dipole magnets with properly adjusted bending radii and edge angles for both horizontal and vertical focusing, and a pair of quadrupole magnets used to adjust the horizontal damping partition number. We find that the dynamic aperture of compact storage rings depends essentially on the intrinsic nonlinearity of the dipole magnets with small bending radius. Hamiltonian dynamics is found to agree well with results from numerical particle tracking. We develop a self-consistent method to estimate the equilibrium beam parameters in the presence of the intrabeam scattering, synchrotron radiation damping, quantum excitation, and residual gas scattering. We also optimize the rf parameters for achieving a maximum x-ray flux.
Energy Technology Data Exchange (ETDEWEB)
Gethmann, Julian; Bernhard, Axel; Blomley, Edmund; Hillenbrand, Steffen; Mueller, Anke-Susanne; Smale, Nigel [Karlsruher Institut fuer Technologie (KIT) (Germany); Zolotarev, Konstantin [Budker Institute of Nuclear Physics (Russian Federation)
2016-07-01
(As a part of the CLIC collaboration) A CLIC damping wiggler prototype has been installed at the ANKA synchrotron light source in order to validate the technical design of the 3 T superconducting conduction cooled wiggler and its cryostat and to cary out studies on beam dynamical aspects including collective effects. The latter one will be the main focus in this talk. Collective effects that will occur in damping rings are an issue in ANKA's short bunch operation as well. To simulate these effects the accelerator's model including its insertion device has to be very accurate. Such a model of the ANKA storage ring in short bunch operation mode has been developed in elegant. Simulations with the damping wiggler switched on and off have been performed in order to investigate effects of the wiggler on different machine parameters. These new results will be discussed with regard to the question if on the one hand the wiggler could be used for diagnostic purposes and if on the other hand the wiggler's impact on the beam dynamics is changed by the collective effects.
Dispersion of guided modes in two-dimensional split ring lattices
DEFF Research Database (Denmark)
Hansen, Per Lunnemann; Koenderink, A. Femius
2014-01-01
. This method takes into account all retarded electrodynamic interactions as well as radiation damping self-consistently. As illustration, we analyze the dispersion of plasmon nanorod lattices, and of 2D split ring resonator lattices. Plasmon nanorod lattices support transverse and longitudinal in...
An Integrated Enterprise Accelerator Database for the SLC Control System
International Nuclear Information System (INIS)
2002-01-01
Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations
Influence of the Gilbert damping constant on the flux rise time of write head fields
International Nuclear Information System (INIS)
Ertl, Othmar; Schrefl, Thomas; Suess, Dieter; Schabes, Manfred E.
2005-01-01
Magnetic recording at fast data rates requires write heads with rapid rise times of the magnetic flux during the write process. We present three-dimensional (3D) micromagnetic finite element calculations of an entire ring head including 3D coil geometry during the writing of magnetic bits in granular media. The simulations demonstrate how input current profiles translate into magnetization processes in the head and which in turn generate the write head field. The flux rise time significantly depends on the Gilbert damping constant of the head material. Low damping causes incoherent magnetization processes, leading to long rise times and low head fields. High damping leads to coherent reversal of the magnetization in the head. As a consequence, the gap region can be quickly saturated which causes high head fields with short rise times
Survey of beam instrumentation used in SLC
International Nuclear Information System (INIS)
Ecklund, S.D.
1991-03-01
A survey of beam instruments used at SLAC in the SLC machine is presented. The basic utility and operation of each device is briefly described. The various beam instruments used at the Stanford Linear Collider (SLC), can be classified by the function they perform. Beam intensity, position and size are typical of the parameters of beam which are measured. Each type of parameter is important for adjusting or tuning the machine in order to achieve optimum performance. 39 refs
Regulators of Slc4 bicarbonate transporter activity
Directory of Open Access Journals (Sweden)
Ian M. Thornell
2015-06-01
Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.
Bursts of Coherent Synchrotron Radiation in Electron Storage Rings: a Dynamical Model
Energy Technology Data Exchange (ETDEWEB)
Venturini, Marco
2002-09-17
Evidence of coherent synchrotron radiation (CSR) has been reported recently at the electron storage rings of several light source facilities. The main features of the observations are (i) a radiation wavelength short compared to the nominal bunch length, and (ii) a coherent signal showing recurrent bursts of duration much shorter than the radiation damping time, but with spacing equal to a substantial fraction of the damping time. We present a model of beam longitudinal dynamics that reproduces these features.
Decoherence and Landau-Damping
Energy Technology Data Exchange (ETDEWEB)
Ng, K.Y.; /Fermilab
2005-12-01
The terminologies, decoherence and Landau damping, are often used concerning the damping of a collective instability. This article revisits the difference and relation between decoherence and Landau damping. A model is given to demonstrate how Landau damping affects the rate of damping coming from decoherence.
The polarized electron gun for the SLC
International Nuclear Information System (INIS)
Schultz, D.C.; Clendenin, J.; Frisch, J.; Hoyt, E.; Klaisner, L.; Woods, M.; Wright, D.; Zolotorev, M.
1992-03-01
A new polarized electron gun for use on the SLC at SLAC has been built and tested. It is a diode gun with a laser driven GaAs photocathode. It is designed to provide short (2ns) pulses of 10 A at 160 kV at 120 Hz. The design features of the gun and results from a testing program on a new and dedicated beam line are presented. Early results from operation on the SLC will also be shown
Lessons from the SLC for future LC control systems
International Nuclear Information System (INIS)
Humphrey, R.
1991-12-01
The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: Repetition rate; Sensitivity to orbit distortion; Stability/Automation; and Accelerator Development
Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.
Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong
2017-10-01
Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.
Overview on methods for formulating explicit damping matrices for non-classically damped structures
International Nuclear Information System (INIS)
Xu, J.
1998-04-01
In computing the dynamic response of a connected system with multiple components having dissimilar damping characteristics, which is often referred to as nonclassically damped system such as nuclear power plant piping systems supported by stiff structures, one needs to define the system-level damping based upon the damping information of components. This is frequently done in practice using approximate methods expressed as composite modal damping with weighting functions. However, when the difference in damping among components is substantial, the composite modal damping may become inappropriate in the characterization of the damping behavior of such systems. In recent years, several new methods have emerged with the expectation that they could produce more exact system-level damping for a group of nonclassically damped structures which are comprised of components that possess classical modal damping. In this paper, an overview is presented to examine these methods in the light of their theoretical basis, the technical merits, and practical applications. To this end, a synthesis method is described, which was shown to reduce to the other methods in the literature
Vortices trapped in discrete Josephson rings
International Nuclear Information System (INIS)
Van der Zanta, H.S.J.; Orlando, T.P.; Watanabe, Shinya; Strogatz, S.H.
1994-01-01
We report the first measurements of current- (I-V) characteristics of discrete rings of Josephson junctions. As I is increased, resonant steps appear in the I-V curve, due to phase-locking between a propagating, trapped vortex and the linear waves excited in its wake. Unexpectedly, the phase velocity of the linear waves, not the group velocity, is the physically important quantity and mode numbers outside the Brillouin zone are relevant. Our measurements show that away from the resonant steps, a single vortex can move in an environment with very little damping, making the discrete one-dimensional ring a well-defined model system for the study of ballistic and quantum vortex experiments. ((orig.))
Vortices trapped in discrete Josephson rings
Energy Technology Data Exchange (ETDEWEB)
Van der Zanta, H.S.J. [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Orlando, T.P. [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Watanabe, Shinya [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Strogatz, S.H. [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)
1994-12-01
We report the first measurements of current- (I-V) characteristics of discrete rings of Josephson junctions. As I is increased, resonant steps appear in the I-V curve, due to phase-locking between a propagating, trapped vortex and the linear waves excited in its wake. Unexpectedly, the phase velocity of the linear waves, not the group velocity, is the physically important quantity and mode numbers outside the Brillouin zone are relevant. Our measurements show that away from the resonant steps, a single vortex can move in an environment with very little damping, making the discrete one-dimensional ring a well-defined model system for the study of ballistic and quantum vortex experiments. ((orig.)).
Lessons from the SLC for future LC control systems
International Nuclear Information System (INIS)
Humphrey, R.
1992-01-01
The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)
Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.
Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun
2018-06-15
Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.
Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N
2013-01-01
To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.
Levitation properties of a ring-shaped flywheel supported by high Tc superconducting levitation
International Nuclear Information System (INIS)
Teshima, Hidekazu; Tawara, Taichi; Shimada, Ryuichi.
1997-01-01
In this paper we propose a new combination of high T c superconducting levitation and ring-shaped flywheel energy storage systems. Superconducting levitation is appropriate for rotating a ring-shaped flywheel which has neither shaft nor hub, because it is a non-contact and automatically stable levitation without any control systems. The levitation properties such as static and dynamic lateral stiffnesses, lateral damping, and lateral vibration during rotation have been investigated using a small-scaled experimental machine consisting of 16 bulk superconductors 46 mm in diameter and a ring-shaped flywheel about 300 mm in diameter. The spring constant increased as the levitation gap height decreased, and the dynamic spring constant was slightly higher than the static constant. The damping coefficient increased as the gap height decreased and the vibration amplitude increased. The experimental critical speed was in good agreement with the calculated one using a one-degree of freedom model. Finally, the possibility of large-scaled practical systems is discussed from the viewpoint of superconducting levitation. (author)
Damped nonlinear Schrodinger equation
International Nuclear Information System (INIS)
Nicholson, D.R.; Goldman, M.V.
1976-01-01
High frequency electrostatic plasma oscillations described by the nonlinear Schrodinger equation in the presence of damping, collisional or Landau, are considered. At early times, Landau damping of an initial soliton profile results in a broader, but smaller amplitude soliton, while collisional damping reduces the soliton size everywhere; soliton speeds at early times are unchanged by either kind of damping. For collisional damping, soliton speeds are unchanged for all time
The damped wave equation with unbounded damping
Freitas, Pedro; Siegl, Petr; Tretter, Christiane
2018-06-01
We analyze new phenomena arising in linear damped wave equations on unbounded domains when the damping is allowed to become unbounded at infinity. We prove the generation of a contraction semigroup, study the relation between the spectra of the semigroup generator and the associated quadratic operator function, the convergence of non-real eigenvalues in the asymptotic regime of diverging damping on a subdomain, and we investigate the appearance of essential spectrum on the negative real axis. We further show that the presence of the latter prevents exponential estimates for the semigroup and turns out to be a robust effect that cannot be easily canceled by adding a positive potential. These analytic results are illustrated by examples.
Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.
Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W
2014-04-01
Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.
Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth
Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2012-01-01
Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-01-01
The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-04-01
The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs
International Nuclear Information System (INIS)
Keller, L.P.
1982-01-01
Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment
Turn-by-Turn and Bunch-by-Bunch Transverse Profiles of a Single Bunch in a Full Ring
International Nuclear Information System (INIS)
Kraus, R.; Fisher, A.S.
2005-01-01
The apparatus described in this paper can image the evolution of the transverse profile of a single bunch, isolated from a full PEP-II ring of 1500 bunches. Using this apparatus there are two methods of single bunch imaging; bunch-by-bunch beam profiling can image every bunch in the ring a single bunch at a time with the images of sequential bunches being in order, allowing one to see variations in beam size along a train. Turn-by-turn beam profiling images a single bunch on each successive turn it makes around the ring. This method will be useful in determining the effect that an injected bunch has on a stable bunch as the oscillations of the injected bunch damp out. Turn-by-turn imaging of the synchrotron light uses a system of lenses and mirrors to image many turns of both the major and minor axis of a single bunch across the photocathode of a gateable camera. The bunch-by-bunch method is simpler: because of a focusing mirror used in porting the light from the ring, the synchrotron light from the orbiting electrons becomes an image at a certain distance from the mirror; and since the camera does not use a lens, the photocathode is set exactly at this image distance. Bunch-by-bunch profiling has shown that in the Low Energy Ring (LER) horizontal bunch size decreases along a train. Turn-by-turn profiling has been able to image 100 turns of a single bunch on one exposure of the camera. The turn-by-turn setup has also been able to image 50 turns of the minor axis showing part of the damping process of an oscillating injected charge during a LER fill. The goal is to image the damping of oscillations of injected charge for 100 turns of both the major and minor axis throughout the damping process during trickle injection. With some changes to the apparatus this goal is within reach and will make turn-by-turn imaging a very useful tool in beam diagnostics
Upregulation of the Creatine Transporter Slc6A8 by Klotho
Directory of Open Access Journals (Sweden)
Ahmad Almilaji
2014-11-01
Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.
AN N-BODY INTEGRATOR FOR GRAVITATING PLANETARY RINGS, AND THE OUTER EDGE OF SATURN'S B RING
International Nuclear Information System (INIS)
Hahn, Joseph M.; Spitale, Joseph N.
2013-01-01
A new symplectic N-body integrator is introduced, one designed to calculate the global 360° evolution of a self-gravitating planetary ring that is in orbit about an oblate planet. This freely available code is called epi i nt, and it is distinct from other such codes in its use of streamlines to calculate the effects of ring self-gravity. The great advantage of this approach is that the perturbing forces arise from smooth wires of ring matter rather than discreet particles, so there is very little gravitational scattering and so only a modest number of particles are needed to simulate, say, the scalloped edge of a resonantly confined ring or the propagation of spiral density waves. The code is applied to the outer edge of Saturn's B ring, and a comparison of Cassini measurements of the ring's forced response to simulations of Mimas's resonant perturbations reveals that the B ring's surface density at its outer edge is σ 0 = 195 ± 60 g cm –2 , which, if the same everywhere across the ring, would mean that the B ring's mass is about 90% of Mimas's mass. Cassini observations show that the B ring-edge has several free normal modes, which are long-lived disturbances of the ring-edge that are not driven by any known satellite resonances. Although the mechanism that excites or sustains these normal modes is unknown, we can plant such a disturbance at a simulated ring's edge and find that these modes persist without any damping for more than ∼10 5 orbits or ∼100 yr despite the simulated ring's viscosity ν s = 100 cm 2 s –1 . These simulations also indicate that impulsive disturbances at a ring can excite long-lived normal modes, which suggests that an impact in the recent past by perhaps a cloud of cometary debris might have excited these disturbances, which are quite common to many of Saturn's sharp-edged rings
Energy Technology Data Exchange (ETDEWEB)
Lee, Kanghee; Kang, Heungseok; Oh, Dongseok; Yoon, Kyungho; Kim, Hyungkyu; Kim, Jaeyong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2013-10-15
This paper summary the fuel assembly damping data in air/in still water/under flow, released from foreign fuel vendors, compared our data with the published data. Some technical issues in fuel assembly damping measurement testing are also briefly discussed. Understanding of each fuel assembly damping mechanisms according to the surrounding medium and flow velocity can support the fuel design improvement in fuel assembly dynamics and structural integrity aspect. Because the upgraded requirements of the newly-developed advanced reactor system will demands to minimize fuel design margin in integrity evaluation, reduction in conservatism of fuel assembly damping can contribute to alleviate the fuel design margin for sure. Damping is an energy dissipation mechanism in a vibrating mechanical structure and prevents a resonant structure from having infinite vibration amplitudes. The sources of fuel assembly damping are various from support friction to flow contribution, and it can be increased by the viscosity or drag of surrounding fluid medium or the average velocity of water flowing. Fuel licensing requires fuel design evaluation in transient or accidental condition. Dynamic response analysis of fuel assembly is to show fuel integrity and requires information on assembly-wise damping in dry condition and under wet or water flowing condition. However, damping measurement test for the full-scale fuel assembly prototype is not easy to carry out because of the scale (fuel prototype, test facility), unsteadiness of test data (scattering, random sampling and processing), instrumentation under water flowing (water-proof response measurement), and noise. LWR fuel technology division in KAERI is preparing the infra structure for damping measurement test of full-scale fuel assembly, to support fuel industries and related research activities. Here is a preliminary summary of fuel assembly damping, published in the literature. Some technical issues in fuel assembly damping
Feedback Systems for Linear Colliders
International Nuclear Information System (INIS)
1999-01-01
Feedback systems are essential for stable operation of a linear collider, providing a cost-effective method for relaxing tight tolerances. In the Stanford Linear Collider (SLC), feedback controls beam parameters such as trajectory, energy, and intensity throughout the accelerator. A novel dithering optimization system which adjusts final focus parameters to maximize luminosity contributed to achieving record performance in the 1997-98 run. Performance limitations of the steering feedback have been investigated, and improvements have been made. For the Next Linear Collider (NLC), extensive feedback systems are planned as an integral part of the design. Feedback requirements for JLC (the Japanese Linear Collider) are essentially identical to NLC; some of the TESLA requirements are similar but there are significant differences. For NLC, algorithms which incorporate improvements upon the SLC implementation are being prototyped. Specialized systems for the damping rings, rf and interaction point will operate at high bandwidth and fast response. To correct for the motion of individual bunches within a train, both feedforward and feedback systems are planned. SLC experience has shown that feedback systems are an invaluable operational tool for decoupling systems, allowing precision tuning, and providing pulse-to-pulse diagnostics. Feedback systems for the NLC will incorporate the key SLC features and the benefits of advancing technologies
Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy
Directory of Open Access Journals (Sweden)
Yangzom D. Bhutia
2017-02-01
Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy
Spin Tracking Studies for Beam Polarization Preservation in the NLC Main Damping Rings
International Nuclear Information System (INIS)
Wolski, Andrzej; Bates, Daniel
2004-01-01
We report results from studies of spin dynamics in the NLC Main Damping. Our studies have been based on spin tracking particles through the lattice under a range of conditions. We find that there are a number of spin resonances close to the nominal operating energy of 1.98 GeV; however, the effects of the resonances are weak, and the widths are narrow. We do not expect that any significant depolarization of the beam will occur during the store time
The pulsed amplitude unit for the SLC
International Nuclear Information System (INIS)
Rolfe, J.; Browne, M.J.; Jobe, R.K.
1987-02-01
There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital Converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU is a part of the system that controls the output of Klystrons in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed
The pulsed amplitude unit for the SLC
International Nuclear Information System (INIS)
Rolfe, J.; Browne, M.J.; Jobe, R.K.
1987-01-01
There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU at is as part of the system that controls the output of Klystorns in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed
Filling Landsat ETM+ SLC-off gaps using a segmentation model approach
Maxwell, Susan
2004-01-01
The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.
Feedback systems for linear colliders
Hendrickson, L; Himel, Thomas M; Minty, Michiko G; Phinney, N; Raimondi, Pantaleo; Raubenheimer, T O; Shoaee, H; Tenenbaum, P G
1999-01-01
Feedback systems are essential for stable operation of a linear collider, providing a cost-effective method for relaxing tight tolerances. In the Stanford Linear Collider (SLC), feedback controls beam parameters such as trajectory, energy, and intensity throughout the accelerator. A novel dithering optimization system which adjusts final focus parameters to maximize luminosity contributed to achieving record performance in the 1997-98 run. Performance limitations of the steering feedback have been investigated, and improvements have been made. For the Next Linear Collider (NLC), extensive feedback systems are planned as an intregal part of the design. Feedback requiremetns for JLC (the Japanese Linear Collider) are essentially identical to NLC; some of the TESLA requirements are similar but there are significant differences. For NLC, algorithms which incorporate improvements upon the SLC implementation are being prototyped. Specialized systems for the damping rings, rf and interaction point will operate at hi...
The damped wave equation with unbounded damping
Czech Academy of Sciences Publication Activity Database
Freitas, P.; Siegl, Petr; Tretter, C.
2018-01-01
Roč. 264, č. 12 (2018), s. 7023-7054 ISSN 0022-0396 Institutional support: RVO:61389005 Keywords : damped wave equation * unbounded damping * essential spectrum * quadratic operator funciton with unbounded coefficients * Schrodinger operators with complex potentials Subject RIV: BE - Theoretical Physics OBOR OECD: Atomic, molecular and chemical physics (physics of atoms and molecules including collision, interaction with radiation, magnetic resonances, Mössbauer effect) Impact factor: 1.988, year: 2016
Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd
2018-04-01
The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.
Generalized fast feedback system in the SLC
International Nuclear Information System (INIS)
Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.
1991-11-01
A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine
Numerical studies of shear damped composite beams using a constrained damping layer
DEFF Research Database (Denmark)
Kristensen, R.F.; Nielsen, Kim Lau; Mikkelsen, Lars Pilgaard
2008-01-01
Composite beams containing one or more damping layers are studied numerically. The work is based on a semi-analytical model using a Timoshenko beam theory and a full 2D finite element model. The material system analysed, is inspired by a train wagon suspension system used in a EUREKA project Sigma......!1841. For the material system, the study shows that the effect of the damping layer is strongly influenced by the presence of a stiff constraining layer, that enforces large shear strain amplitudes. The thickness of the damping rubber layer itself has only a minor influence on the overall damping....... In addition, a large influence of ill positioned cuts in the damping layer is observed....
GIANT: a computer code for General Interactive ANalysis of Trajectories
International Nuclear Information System (INIS)
Jaeger, J.; Lee, M.; Servranckx, R.; Shoaee, H.
1985-04-01
Many model-driven diagnostic and correction procedures have been developed at SLAC for the on-line computer controlled operation of SPEAR, PEP, the LINAC, and the Electron Damping Ring. In order to facilitate future applications and enhancements, these procedures are being collected into a single program, GIANT. The program allows interactive diagnosis as well as performance optimization of any beam transport line or circular machine. The test systems for GIANT are those of the SLC project. The organization of this program and some of the recent applications of the procedures will be described in this paper
International Nuclear Information System (INIS)
Peterson, J.M.; Bisognano, J.J.; Garren, A.A.; Halbach, K.; Kim, K.J.; Sah, R.C.
1984-09-01
A free-electron laser for the vuv operating in a storage ring requires an electron beam of high density and low energy spread and a short wavelength, narrow-gap undulator. These conditions tend to produce longitudinal and transverse beam instabilities, excessive beam growth through multiple intrabeam scattering, and a short gas-scattering lifetime. Passing the beam only occasionally through the undulator in a by-pass straight section, as proposed by Murphy and Pellegrini, allows operation in a high-gain, single-pass mode and a long gas-scattering lifetime. Several storage ring designs have been considered to see how best to satisfy the several requirements. Each features a by-pass, a low-emittance lattice, and built-in wigglers for enhanced damping to counteract the intra-beam scattering. 15 references, 3 figures, 2 tables
Electron Cloud Mitigation in the Spallation Neutron Source Ring
International Nuclear Information System (INIS)
Wei, J.; Blaskiewicz, Michael; Brodowski, J.; Cameron, P.; Davino, Daniele; Fedotov, A.; He, P.; Hseuh, H.; Lee, Y.Y.; Ludewig, H.; Meng, W.; Raparia, D.; Tuozzolo, J.; Zhang, S.Y.; Catalan-Lasheras, N.; Macek, R.J.; Furman, Miguel A.; Aleksandrov, A.; Cousineau, S.; Danilov, V.; Henderson, S.
2008-01-01
The Spallation Neutron Source (SNS) accumulator ring is designed to accumulate, via H - injection, protons of 2 MW beam power at 1 GeV kinetic energy at a repetition rate of 60 Hz [1]. At such beam intensity, electron-cloud is expected to be one of the intensity-limiting mechanisms that complicate ring operations. This paper summarizes mitigation strategy adopted in the design, both in suppressing electron-cloud formation and in enhancing Landau damping, including tapered magnetic field and monitoring system for the collection of stripped electrons at injection, TiN coated beam chamber for suppression of the secondary yield, clearing electrodes dedicated for the injection region and parasitic on BPMs around the ring, solenoid windings in the collimation region, and planning of vacuum systems for beam scrubbing upon operation
Electron-cloud mitigation in the spallation neutron source ring
International Nuclear Information System (INIS)
Wei, J.; Blaskiewicz, M.; Brodowski, J.; Cameron, P.; Davino, D.; Fedotov, A.; He, P.; Hseuh, H.; Lee, Y.Y.; Meng, W.; Raparia, D.; Tuozzolo, J.; Zhang, S.Y.; Danilov, V.; Henderson, S.; Furman, M.; Pivi, M.; Macek, R.
2003-01-01
The Spallation Neutron Source (SNS) accumulator ring is designed to accumulate, via H- injection, protons of 2 MW beam power at 1 GeV kinetic energy at a repetition rate of 60 Hz [1]. At such beam intensity, electron cloud is expected to be one of the intensity-limiting mechanisms that complicate ring operations. This paper summarizes mitigation strategy adopted in the design, both in suppressing electron-cloud formation and in enhancing Landau damping, including tapered magnetic field and monitoring system for the collection of stripped electrons at injection, TiN coated beam chamber for suppression of the secondary yield, clearing electrodes dedicated for the injection region and parasitic on BPMs around the ring, solenoid windings in the collimation region, and planning of vacuum systems for beam scrubbing upon operation
Dispersive effects of transverse displacements of SLC Arc magnets
International Nuclear Information System (INIS)
Murray, J.J.; Fieguth, T.; Kheifets, S.
1986-01-01
The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method
The Optical Design of the PEP-II Injection Beamlines
Fieguth, T
1996-01-01
The optical design of the PEP-II electron and positron Injection Beamlines is described. Use of the existing high power, low emittance beams available from the SLC damping rings require that pulsed extraction of 9.0 GeV electrons and 3.1 GeV positrons for injection into the PEP-II rings occur in the early sectors of the accelerator. More than 5 kilometers of new beam transport lines have been designed and are being constructed to bring these beams to their respective rings. The optical design maximizes the tolerance to errors especially to those contributing to beam size and position jitter. Secondly, the design minimizes costs by utilizing existing components or component designs and minimizing the number required. Here we discuss important attributes including choice of lattice, specification of error tolerances, including errors in construction, alignment, field errors, power supply stability, and orbit correction.
The Optical Design of the PEP-II Injection Beamlines
Energy Technology Data Exchange (ETDEWEB)
Fieguth, Ted
2003-05-23
The optical design of the PEP-II electron and positron Injection Beamlines is described. Use of the existing high power, low emittance beams available from the SLC damping rings require that pulsed extraction of 9.0 GeV electrons and 3.1 GeV positrons for injection into the PEP-II rings occur in the early sectors of the accelerator. More than 5 kilometers of new beam transport lines have been designed and are being constructed to bring these beams to their respective rings. The optical design maximizes the tolerance to errors especially to those contributing to beam size and position jitter. Secondly, the design minimizes costs by utilizing existing components or component designs and minimizing the number required. Here we discuss important attributes including choice of lattice, specification of error tolerances, including errors in construction, alignment, field errors, power supply stability, and orbit correction.
International Nuclear Information System (INIS)
Ware, A.G.
1986-01-01
The Idaho National Engineering Laboratory (INEL) is conducting a research program to assist the United States Nuclear Regulatory Commission (USNRC) in determining best-estimate damping values for use in the dynamic analysis of nuclear power plant piping systems. This paper describes four tasks in the program that were undertaken in FY-86. In the first task, tests were conducted on a 5-in. INEL laboratory piping system and data were analyzed from a 6-in. laboratory system at the ANCO Engineers facility to investigate the parameters influencing damping in the seismic frequency range. Further tests were conducted on 3- and 5-in. INEL laboratory piping systems as the second task to determine damping values representative of vibrations in the 33 to 100 Hz range, typical of hydrodynamic transients. In the third task a statistical evaluation of the available damping data was conduted to determine probability distributions suitable for use in probabilistic risk assessments (PRAs), and the final task evaluated damping data at high strain levels
Precise system stabilization at SLC using dither techniques
International Nuclear Information System (INIS)
Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.
1993-01-01
A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation
Beam-based alignment technique for the SLC [Stanford Linear Collider] linac
International Nuclear Information System (INIS)
Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.
1989-03-01
Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs
Power oscillation damping controller
DEFF Research Database (Denmark)
2012-01-01
A power oscillation damping controller is provided for a power generation device such as a wind turbine device. The power oscillation damping controller receives an oscillation indicating signal indicative of a power oscillation in an electricity network and provides an oscillation damping control...
Generalized fast feedback system in the SLC
International Nuclear Information System (INIS)
Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.
1992-01-01
A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine. (author)
Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A
2016-11-01
The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.
Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode
2017-10-26
Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Fay, Temple H.
2012-01-01
Viscous damping is commonly discussed in beginning differential equations and physics texts but dry friction or Coulomb friction is not despite dry friction being encountered in many physical applications. One reason for avoiding this topic is that the equations involve a jump discontinuity in the damping term. In this article, we adopt an energy…
Directory of Open Access Journals (Sweden)
S. Zhu
1998-01-01
Full Text Available Magnetic damping is one of the important parameters that control the response and stability of maglev systems. An experimental study to measure magnetic damping directly is presented. A plate attached to a permanent magnet levitated on a rotating drum was tested to investigate the effect of various parameters, such as conductivity, gap, excitation frequency, and oscillation amplitude, on magnetic damping. The experimental technique is capable of measuring all of the magnetic damping coefficients, some of which cannot be measured indirectly.
Damping characteristics of reinforced concrete structures
International Nuclear Information System (INIS)
Hisano, M.; Nagashima, I.; Kawamura, S.
1987-01-01
Reinforced concrete structures in a nuclear power plant are not permitted to go far into the inelasticity generally, even when subjected to strong ground motion. Therefore it is important to evaluate the damping appropriately in linear and after cracking stage before yielding in the dynamic response analysis. Next three dampings are considered of reinforced concrete structures. 1) Internal damping in linear range material damping of concrete without cracks;2) Hysteretic damping in inelastic range material hysteretic damping of concrete due to cracking and yielding;3) Damping due to the energy dissipation into the ground. Among these damping material damping affects dynamic response of a nuclear power plant on hard rock site where damping due to energy dissipation into the ground is scarcely expected. However material damping in linear and slightly nonlinear range have only been assumed without enough experimental data. In this paper such damping is investigated experimentally by the shaking table tests of reinforced concrete box-walls which modeled roughly the outer wall structure of a P.W.R. type nuclear power plant
SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*
Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas
2010-01-01
Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830
Mask locations in the SLC final focus region
International Nuclear Information System (INIS)
Cence, R.J.
1983-01-01
The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point
New developments in ultrasonic inspection of retaining rings on generators in operation
International Nuclear Information System (INIS)
Koch-Mathian, A.
1990-01-01
The ultrasonic inspection of retaining rings of operating generators has been operational since 1986. The aim of this presentation is to outline the experience acquired on many retaining rings on different types of generators. In-situ inspections have made it possible to detect more exactly the different shape echoes for the various elements located beneath the retaining ring such as rotor teeth, damping and epoxy insulation. Various methods of identifying these parts are currently being developed. Investigation on corroded retaining rings has made it possible to demonstrate the close correlation between the transverse beam detection and the presence of actual cracks identified by micrograph. The specific facies of these cracks precludes the use of classic dimensioning techniques, but a method based on longitudinal wave detection has already given encouraging results
The injection system of the stretcher ring ELSA
International Nuclear Information System (INIS)
Dreist, A.
1989-07-01
For the stretcher ring ELSA in the framwork of this thesis an injection system has been concipated and constructed which should allow all projected operational modes of this stretcher ring, the stretcher, the post-acceleration, and the accumulation mode. The proof could be performed that the realized concept allows all these operational modes. Furthermore it could be shown that the injection shifted from the equilibrium orbit has no disadvantageous effects on a uniform extraction and by this on a high touching ratio. In fact it is even possible to apply the decay of the coherent betatron oscillations around the equilibrium orbit, caused by injection of the incident beam shifted from the equilibrium orbit, to diagnosis purposes: By reproduction of this damping process in a simulation model statements on nonlinearities present in the ring and by this statements on the actual phase-space structure are possible. It has so been shown that the concept presented in this thesis and realized for this thesis represents a suited injection system for the stretcher ring ELSA. (orig.) [de
Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice
Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo
2016-01-01
Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...
Coupled-bunch instabilities in the APS ring
International Nuclear Information System (INIS)
Emery, L.
1991-01-01
A study of coupled bunch instabilities for the APS storage ring is presented. The instabilities are driven by the higher-order modes of the fifteen 352-MHz single-cell RF cavities. These modes are modeled using the 2-D cavity program URMEL. The program ZAP is then used to estimate the growth time of the instabilities for an equally-spaced bunch pattern. The cavity modes most responsible for the instabilities will be singles out for damping. 7 refs., 5 tabs
Limitations of interaction-point spot-size tuning at the SLC
International Nuclear Information System (INIS)
Emma, P.; Hendrickson, L.J.; Zimmermann, F.; Raimondi, P.
1997-05-01
At the Stanford Linear Collider (SLC), the interaction-point spot size is minimized by repeatedly correcting, for both beams, various low-order optical aberrations, such as dispersion, waist position or coupling. These corrections are performed about every 8 hours, by minimizing the IP spot size while exciting different orthogonal combinations of final-focus magnets. The spot size itself is determined by measuring the beam deflection angle as a function of the beam-beam separation. Additional information is derived from the energy loss due to beamstrahlung and from luminosity-related signals. In the 1996 SLC run, the typical corrections were so large as to imply a 20-40% average luminosity loss due to residual uncompensated or fluctuating tunable aberrations. In this paper, the authors explore the origin of these large tuning corrections and study possible mitigations for the next SLC run
Extended Rayleigh Damping Model
Directory of Open Access Journals (Sweden)
Naohiro Nakamura
2016-07-01
Full Text Available In dynamic analysis, frequency domain analysis can be used if the entire structure is linear. However, time history analysis is generally used if nonlinear elements are present. Rayleigh damping has been widely used in time history response analysis. Many articles have reported the problems associated with this damping and suggested remedies. A basic problem is that the frequency area across which the damping ratio is almost constant is too narrow. If the area could be expanded while incurring only a small increase in computational cost, this would provide an appropriate remedy for this problem. In this study, a novel damping model capable of expanding the constant frequency area by more than five times was proposed based on the study of a causal damping model. This model was constructed by adding two terms to the Rayleigh damping model and can be applied to the linear elements in the time history analysis of a nonlinear structure. The accuracy and efficiency of the model were confirmed using example analyses.
Beam determination of quadrupole misalignments and beam position monitor biases in the SLC linac
International Nuclear Information System (INIS)
Lavine, T.L.; Seeman, J.T.; Atwood, W.B.; Himel, T.M.; Petersen, A.; Adolphsen, C.E.
1988-09-01
Misalignments of magnetic quadrupoles and biases in beam position monitors (BPMs) in the Stanford Linear Collider (SLC) linac can lead to a situation in which the beam is off-center in the disk-loaded waveguide accelerator structure. The off-center beam produces wakefields which can limit SLC performance by causing unacceptably large emittance growth. We present a general method for determining quadrupole misalignments and BPM biases in the SLC linac by using beam trajectory measurements. The method utilizes both electron and positron beams on opposite rf cycles in the same linac lattice to determine simultaneously magnetic quadrupole misalignments and BPM biases. The two-beam trajectory data may be acquired without interrupting SLC colliding beam operations. 2 refs., 5 figs
Lázaro, Mario
2018-01-01
In this paper, nonviscous, nonproportional, vibrating structures are considered. Nonviscously damped systems are characterized by dissipative mechanisms which depend on the history of the response velocities via hereditary kernel functions. Solutions of the free motion equation lead to a nonlinear eigenvalue problem involving mass, stiffness and damping matrices. Viscoelasticity leads to a frequency dependence of this latter. In this work, a novel closed-form expression to estimate complex eigenvalues is derived. The key point is to consider the damping model as perturbed by a continuous fictitious parameter. Assuming then the eigensolutions as function of this parameter, the computation of the eigenvalues sensitivity leads to an ordinary differential equation, from whose solution arises the proposed analytical formula. The resulting expression explicitly depends on the viscoelasticity (frequency derivatives of the damping function), the nonproportionality (influence of the modal damping matrix off-diagonal terms). Eigenvectors are obtained using existing methods requiring only the corresponding eigenvalue. The method is validated using a numerical example which compares proposed with exact ones and with those determined from the linear first order approximation in terms of the damping matrix. Frequency response functions are also plotted showing that the proposed approach is valid even for moderately or highly damped systems.
The SLC polarized electron source
International Nuclear Information System (INIS)
Clendenin, J.E.
1990-10-01
A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs
International Nuclear Information System (INIS)
Rees, John; Chao, Alexander
2008-01-01
Landau damping, as the term is used in accelerator science, is a physical process in which an ensemble of harmonic oscillators--an accelerator beam, for example--that would otherwise be unstable is stabilized by a spread in the natural frequencies of the oscillators. This is a study of the most basic aspects of that process. It has two main goals: to gain a deeper insight into the mechanism of Landau damping and to find the coherent motion of the ensemble and thus the dependence of the total damping rate on the frequency spread
Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.
International Nuclear Information System (INIS)
Anderson, M.J.; Barta, D.A.; Lindquist, M.R.; Renkey, E.J.; Ryan, J.A.
1983-06-01
LMFBR pipe systems typically utilize a thicker insulation package than that used on water plant pipe systems. They are supported with special insulated pipe clamps. Mechanical snubbers are employed to resist seismic loads. Recent laboratory testing has indicated that these features provide significantly more damping than presently allowed by Regulatory Guide 1.61 for water plant pipe systems. This paper presents results of additional in-situ vibration tests conducted on FFTF pipe systems. Pipe damping values obtained at various excitation levels are presented. Effects of filtering data to provide damping values at discrete frequencies and the alternate use of a single equivalent modal damping value are discussed. These tests further confirm that damping in typical LMFBR pipe systems is larger than presently used in pipe design. Although some increase in damping occurred with increased excitation amplitude, the effect was not significant. Recommendations are made to use an increased damping value for both the OBE and DBE seismic events in design of LMFBR pipe systems
International Nuclear Information System (INIS)
Warnock, R.L.
2000-01-01
The authors propose and illustrate a general numerical method to follow the probability distribution in phase space as a function of time. It applies to any multiparticle system governed by Liouville, Vlasov or Vlasov-Fokker-Planck dynamics. The technique, based on discretization of the local Perron-Frobenius operator, is simple in concept, easy to implement, and numerically stable in examples studied to date. The authors illustrate by treating longitudinal dynamics in electron storage rings with realistic wake field. Applied to the SLC damping rings, the method gives the observed current threshold for bunch lengthening, and several aspects of observed behavior above threshold, including the presence of a bursting or sawtooth mode. In contrast to previous particle-in-cell simulations, the authors have very low numerical noise and the ability to follow the motion over several damping times. The method has also been applied to the coherent beam-beam interaction. It appears likely that this approach will be of interest for some of the central problems of this workshop, for instance matching of space-charge dominated beams to a focusing channel, and coherent synchrotron radiation with self-consistent charge/current density
Damped button electrode for B-Factory BPM system
Energy Technology Data Exchange (ETDEWEB)
Shintake, T; Akasaka, N; Obina, T; Chin, Y H [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan)
1996-08-01
A new concept of damping of resonances in a button electrode has been proposed and tested in the BPM system for the B-Factory project at KEK (KEKB). Since a very high current beam has to be stored in the machine, even a small resonance in the ring will result in losing a beam due to multi-bunch instabilities. In a conventional button electrode used in BPMs, a TE110 mode resonance can be trapped in the gap between the electrode and the vacuum chamber. In order to damp this mode, the diameter of the electrode has been chosen to be small to increase the resonance frequency and to radiate the power into the beam pipe. In addition, an asymmetric structure is applied to extract the EM energy of the TE110 mode into the coaxial cable as the propagating TEM mode which has no cut-off frequency. Results of the computer simulations and tests with cold models are reported. The quality factor of the TE110 mode was small enough due to the radiation into the beam pipe even in the conventional electrode and the mode coupling effect due to the asymmetric shape was significant on a cavity-like TE111 mode. (author)
Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem
2016-11-01
Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.
CESR-c Performance of a Wiggler-Dominated Storage Ring
Temnykh, Alexander
2005-01-01
CESR-c operates now as a Wiggler-Dominated Storage Ring extending the lowest operating energy to 1.5GeV/beam. To improve beam stability at low energy, 12 super-ferric wiggler magnets with total length of 15m and 2.1T maximum field were installed in the ring. They cause ~90% of total beam radiation lost and increase radiation damping rate by factor 10 from ~3 to 40 Hz. However, the field of the wiggler magnets not only initiates the radiation, but potentially affects beam dynamics. The latter was an issue of a great concern from the planning the CESR-c project. In this paper we describe general performance of CESR-c and report the results of an experimental study on some aspects of beam dynamics. Comparisons are made between the experimental data and the model prediction. We find that all parameters, which are critically dependent on wigglers, such as beam properties and ring nonlinearity, are in good agreement with those calculated from the model. This validates the ring and wiggler models and justifies our d...
Finding beam focus errors automatically
International Nuclear Information System (INIS)
Lee, M.J.; Clearwater, S.H.; Kleban, S.D.
1987-01-01
An automated method for finding beam focus errors using an optimization program called COMFORT-PLUS. The steps involved in finding the correction factors using COMFORT-PLUS has been used to find the beam focus errors for two damping rings at the SLAC Linear Collider. The program is to be used as an off-line program to analyze actual measured data for any SLC system. A limitation on the application of this procedure is found to be that it depends on the magnitude of the machine errors. Another is that the program is not totally automated since the user must decide a priori where to look for errors
International Nuclear Information System (INIS)
Watanabe, S.; Strogatz, S.H.; van der Zant, H.S.J.; Orlando, T.P.
1995-01-01
We analyze the damped driven discrete sine-Gordon equation. For underdamped, highly discrete systems, we show that whirling periodic solutions undergo parametric instabilities at certain drive strengths. The theory predicts novel resonant steps in the current-voltage characteristics of discrete Josephson rings, occurring in the return path of the subgap region. We have observed these steps experimentally in a ring of 8 underdamped junctions. An unusual prediction, verified experimentally, is that such steps occur even if there are no vortices in the ring. Numerical simulations indicate that complex spatiotemporal behavior occurs past the onset of instability
Energy Technology Data Exchange (ETDEWEB)
Roth, Andre
2012-12-15
At the Electron Stretcher Facility ELSA an upgrade of the internal beam current up to 200 mA would be desirable in order to increase the intensity of the extracted electron beam for the future experimental hadron physics program. However, such an upgrade is mainly limited by the excitation of coherent beam instabilities in the stretcher ring. As active counteraction, broadband bunch-by-bunch feedback-systems for the longitudinal, as well as for both transverse planes were installed. After detection of the motion of each of the 27 4 stored bunches via beam position monitors, the systems determine independent correction signals for each bunch using digital signal processors. The amplified correction signals are applied to the beam by means of broadband longitudinal and transverse kicker structures. The detailed setup, the commissioning procedure and measurement results of the damping performance of the systems are presented. In addition, the operation of the longitudinal system during the fast energy ramp of 4 GeV/s from 1.2 GeV to 3.2 GeV is investigated.
Progress on PEP-II injection R ampersand D
International Nuclear Information System (INIS)
Bloom, E.; Bulos, F.; Fieguth, T.; Godfrey, G.; Loew, G.; Miller, R.
1993-06-01
The R ampersand D program described in this paper focuses on an improvement of the SLAC linac designed to extract and study a 9 GeV electron beam under stringent control of energy, energy spread, emittance, optical parameters, and timing. The extraction system begins with an on-axis pulsed magnet, followed by a magnetic lattice and diagnostic equipment required for the measurement and optimization of the above beam qualities. Design, construction, and installation of this system is the first step in the development of the overall PEP-II e ± injection system. This system is required to fill 1658 bunches of 9 GeV electrons (0.99A stored) and 3.1 GeV positrons (2.14A stored) in two separate rings in a total of about 6 minutes from zero ring current (i.e., full-fill mode, 0 to 100%) or in about 3 minutes from 80% ring current (i.e., topping-off mode, 80 to 100%). This unprecedented rate of filling can be met by a judicious use of the SLC linac, damping rings, and positron source
Progress on PEP-II injection R ampersand D
International Nuclear Information System (INIS)
Bloom, E.; Bulos, F.; Fieguth, T.; Godfrey, G.; Loew, G.; Miller, R.
1993-01-01
The R ampersand D program described in this paper focuses on an improvement of the SLAC linac designed to extract and study a 9 GeV electron beam under stringent control of energy, energy spread, emittance, optical parameters, and timing. The extraction system begins with an on-axis pulsed magnet, followed by a magnetic lattice and diagnostic equipment required for the measurement and optimization of the above beam qualities. Design, construction, and installation of this system is the first step in the development of the overall PEP-II e ± injection system. This system is required to fill 1658 bunches of 9 GeV electrons (0.99A stored) and 3.1 GeV positrons (2.14A stored) in two separate rings in a total of about 6 minutes from zero ring current (i.e., full-fill mode, 0 to 100%) or in about 3 minutes from 80% ring current (i.e., topping-off mode, 80 to 100%). This unprecedented rate of filling can be met by a judicious use of the SLC linac, damping rings, and positron source
International Nuclear Information System (INIS)
Swartz, M.L.
1988-07-01
The SLAC Linear Collider has been designed to readily accommodate polarized electron beams. Considerable effort has been made to implement a polarized source, a spin rotation system, and a system to monitor the beam polarization. Nearly all major components have been fabricated. At the current time, several source and polarimeter components have been installed. The installation and commissioning of the entire system will take place during available machine shutdown periods as the commissioning of SLC progresses. It is expected that a beam polarization of 45% will be achieved with no loss in luminosity. 13 refs., 15 figs
SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.
Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A
2016-11-01
Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.
Nuclear piping system damping data studies
International Nuclear Information System (INIS)
Ware, A.G.; Arendts, J.G.
1985-01-01
A programm has been conducted at the Idaho National Engineering Laboratory to study structural damping data for nuclear piping systems and to evaluate if changes in allowable damping values for structural seismic analyses are justified. The existing pipe damping data base was examined, from which a conclusion was made that there were several sets of data to support higher allowable values. The parameters which most influence pipe damping were identified and an analytical investigation demonstrated that increased damping would reduce the required number of seismic supports. A series of tests on several laboratory piping systems was used to determine the effect of various parameters such as types of supports, amplitude of vibration, frequency, insulation, and pressure on damping. A multiple regression analysis was used to statistically assess the influence of the various parameters on damping, and an international pipe damping data bank has been formed. (orig.)
Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome
O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.
2016-01-01
Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter
SLC26A4 mutations are associated with a specific inner ear malformation.
Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa
2007-03-01
Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.
International Nuclear Information System (INIS)
Jendrzejczyk, J.A.; Chen, S.S.; Zhu, S.; Mangra, D.; Smith, R.K.
1993-05-01
To avoid unacceptable vibration of the storage ring quadrupoles, and to ensure that the established vibration criteria are satisfied, the philosophy from inception of the APS has been (1) to locate and design the machine to minimize motion of the storage ring basemat and, (2) following construction, to monitor machine operation and user experiments to ensure that vibration sources are not introduced. This report addresses the design of the storage ring girder support assemblies, and, specifically, the effect of the pedestal/floor interface on the dynamic characteristics (i.e., resonant frequencies, damping, and mode shape)
SLC Final Performance and Lessons
International Nuclear Information System (INIS)
Phinney, Nan
2000-01-01
The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined
Damping measurements in flowing water
Coutu, A.; Seeley, C.; Monette, C.; Nennemann, B.; Marmont, H.
2012-11-01
Fluid-structure interaction (FSI), in the form of mass loading and damping, governs the dynamic response of water turbines, such as Francis turbines. Water added mass and damping are both critical quantities in evaluating the dynamic response of the turbine component. Although the effect of fluid added mass is well documented, fluid damping, a critical quantity to limit vibration amplitudes during service, and therefore to help avoiding possible failure of the turbines, has received much less attention in the literature. This paper presents an experimental investigation of damping due to FSI. The experimental setup, designed to create dynamic characteristics similar to the ones of Francis turbine blades is discussed, together with the experimental protocol and examples of measurements obtained. The paper concludes with the calculated damping values and a discussion on the impact of the observed damping behaviour on the response of hydraulic turbine blades to FSI.
Damping measurements in flowing water
International Nuclear Information System (INIS)
Coutu, A; Monette, C; Nennemann, B; Marmont, H; Seeley, C
2012-01-01
Fluid-structure interaction (FSI), in the form of mass loading and damping, governs the dynamic response of water turbines, such as Francis turbines. Water added mass and damping are both critical quantities in evaluating the dynamic response of the turbine component. Although the effect of fluid added mass is well documented, fluid damping, a critical quantity to limit vibration amplitudes during service, and therefore to help avoiding possible failure of the turbines, has received much less attention in the literature. This paper presents an experimental investigation of damping due to FSI. The experimental setup, designed to create dynamic characteristics similar to the ones of Francis turbine blades is discussed, together with the experimental protocol and examples of measurements obtained. The paper concludes with the calculated damping values and a discussion on the impact of the observed damping behaviour on the response of hydraulic turbine blades to FSI.
Transit-Time Damping, Landau Damping, and Perturbed Orbits
Simon, A.; Short, R. W.
1997-11-01
Transit-time damping(G.J. Morales and Y.C. Lee, Phys. Rev. Lett. 33), 1534 (1974).*^,*(P.A. Robinson, Phys. Fluids B 3), 545 (1991).** has traditionally been obtained by calculating the net energy gain of transiting electrons, of velocity v, to order E^2* in the amplitude of a localized electric field. This necessarily requires inclusion of the perturbed orbits in the equation of motion. A similar method has been used by others(D.R. Nicholson, Introduction to Plasma Theory) (Wiley, 1983).*^,*(E.M. Lifshitz and L.P. Pitaevskifi, Physical Kinetics) (Pergamon, 1981).** to obtain a ``physical'' picture of Landau damping in a nonlocalized field. The use of perturbed orbits seems odd since the original derivation of Landau (and that of Dawson) never went beyond a linear picture of the dynamics. We introduce a novel method that takes advantage of the time-reversal invariance of the Vlasov equation and requires only the unperturbed orbits to obtain the result. Obviously, there is much reduction in complexity. Application to finite slab geometry yields a simple expression for the damping rate. Equivalence to much more complicated results^2* is demonstrated. This method allows us to calculate damping in more complicated geometries and more complex electric fields, such as occur in SRS in filaments. See accompanying talk.(R.W. Short and A. Simon, this conference.) This work was supported by the U.S. DOE Office of Inertial Confinement Fusion under Co-op Agreement No. DE-FC03-92SF19460.
Labonnote, Nathalie
2012-01-01
Key point to development of environmentally friendly timber structures, appropriate to urban ways of living, is the development of high-rise timber buildings. Comfort properties are nowadays one of the main limitations to tall timber buildings, and an enhanced knowledge on damping phenomena is therefore required, as well as improved prediction models for damping. The aim of this work has consequently been to estimate various damping quantities in timber structures. In particular, models h...
Directory of Open Access Journals (Sweden)
Tai-Hong Cheng
2015-01-01
Full Text Available Composite materials are increasingly used in wind blade because of their superior mechanical properties such as high strength-to-weight and stiffness-to-weight ratio. This paper presents vibration and damping analysis of fiberreinforced composite wind turbine blade with viscoelastic damping treatment. The finite element method based on full layerwise displacement theory was employed to analyze the damping, natural frequency, and modal loss factor of composite shell structure. The lamination angle was considered in mathematical modeling. The curved geometry, transverse shear, and normal strains were exactly considered in present layerwise shell model, which can depict the zig-zag in-plane and out-of-plane displacements. The frequency response functions of curved composite shell structure and wind blade were calculated. The results show that the damping ratio of viscoelastic layer is found to be very sensitive to determination of magnitude of composite structures. The frequency response functions with variety of thickness of damping layer were investigated. Moreover, the natural frequency, modal loss factor, and mode shapes of composite fiber reinforced wind blade with viscoelastic damping control were calculated.
FEL radiation power available in electron storage rings
International Nuclear Information System (INIS)
Miyahara, Yoshikazu
1994-01-01
FEL radiation power available in electron storage rings was studied in the small signal regime in considering the increase of the energy spread of the electron beam caused by the FEL interaction and the decrease of the FEL gain with the increase of the energy spread in addition to the radiation damping and the quantum excitation. All these effects were considered separately, and combined with FEL power equations. The radiation power available was expressed explicitly with the parameters of the storage ring, the wiggler and the mirrors. The transient process of FEL lasing is simulated with the power equations. A rough estimation is made of the radiation power available by the FEL at different beam energies, and optimization of FEL parameters for a higher radiation power is discussed. ((orig.))
Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya
2016-04-01
While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.
Transverse Periodic Beam Loading Effects in a Storage Ring
International Nuclear Information System (INIS)
Thompson, J.R.; Byrd, J.M.
2009-01-01
Uneven beam fill patterns in storage rings, such as gaps in the fill patterns, leads to periodic, or transient loading of the modes of the RF cavities. We show that an analogous effect can occur in the loading of a dipole cavity mode when the beam passes off the electrical center of the cavity mode. Although this effect is small, it results in a variation of the transverse offset of the beam along the bunch train. For ultralow emittance beams, such as optimized third generation light sources and damping rings, this effect results in a larger projected emittance of the beam compared with the single bunch emittance. The effect is particularly strong for the case when a strong dipole mode has been purposely added to the ring, such as a deflecting, or 'crab' cavity. We derive an approximate analytic solution for the variation of the beam-induced deflecting voltage along the bunch train.
Report on the SLC control system
International Nuclear Information System (INIS)
Phinney, N.
1985-05-01
The SLC control system is based on a VAX 11/780 Host computer with approximately 50 microprocessor clusters which provide distributed intelligence and control of all CAMAC interface modules. This paper will present an overview of the system including current status and a description of the software architecture and communication protocols. 8 refs
Klystron control software in the SLC
International Nuclear Information System (INIS)
Jobe, R.K.; Thompson, K.; Phinney, N.
1985-05-01
Triggering, control, and monitoring of 240 high-power klystrons will be supported by the SLC control system this summer. The control software is distributed among a VAX host computer, a local microprocessor cluster, and a dedicated intelligent CAMAC module. The functions performed by these three components and the algorithms used are discussed
International Nuclear Information System (INIS)
Turner, Sam
2011-01-01
The phenomenon of process damping as a stabilising effect in milling has been encountered by machinists since milling and turning began. It is of great importance when milling aerospace alloys where maximum surface speed is limited by excessive tool wear and high speed stability lobes cannot be attained. Much of the established research into regenerative chatter and chatter avoidance has focussed on stability lobe theory with different analytical and time domain models developed to expand on the theory first developed by Trusty and Tobias. Process damping is a stabilising effect that occurs when the surface speed is low relative to the dominant natural frequency of the system and has been less successfully modelled and understood. Process damping is believed to be influenced by the interference of the relief face of the cutting tool with the waveform traced on the cut surface, with material properties and the relief geometry of the tool believed to be key factors governing performance. This study combines experimental trials with Finite Element (FE) simulation in an attempt to identify and understand the key factors influencing process damping performance in titanium milling. Rake angle, relief angle and chip thickness are the variables considered experimentally with the FE study looking at average radial and tangential forces and surface compressive stress. For the experimental study a technique is developed to identify the critical process damping wavelength as a means of measuring process damping performance. For the range of parameters studied, chip thickness is found to be the dominant factor with maximum stable parameters increased by a factor of 17 in the best case. Within the range studied, relief angle was found to have a lesser effect than expected whilst rake angle had an influence.
SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation
DEFF Research Database (Denmark)
Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N
2011-01-01
The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...
SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.
Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S
2017-04-01
A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through
Anisotropic damping of Timoshenko beam elements
Energy Technology Data Exchange (ETDEWEB)
Hansen, M.H.
2001-05-01
This report contains a description of a structural damping model for Timoshenko beam elements used in the aeroelastic code HawC developed at Risoe for modeling wind turbines. The model has been developed to enable modeling of turbine blades which often have different damping characteristics for flapwise, edgewise and torsional vibrations. The structural damping forces acting on the beam element are modeled by viscous damping described by an element damping matrix. The composition of this matrix is based on the element mass and stiffness matrices. It is shown how the coefficients for the mass and stiffness contributions can be calibrated to give the desired modal damping in the complete model of a blade. (au)
Hou, Junfang; jing, Min; Zhang, Weihua; Lu, Yahui; He, Haiwen
2017-12-01
As for the isolation problem of electronic equipments on vehicle, the vibration response characteristics of dry friction damping isolation system under base displacement excitation was analyzed in theory by harmonic balance method, and the displacement response was compared between the isolation systems with dry friction damping and vicious damping separately. The results show that the isolation system with small dry friction damping can’t meet the demands of displacement reduction close to the natural frequency, and it can realize full-frequency vibration isolation by improving dry friction damping when the lock frequency passes beyond the resonance frequency band. The results imply that the damping mechanism of dry friction isolator can’t be described only by dry friction damping, and the composite damping with dry friction and vicious damping is more appropriate.
Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko
2014-09-18
SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Hagerhed, L.; Bornehag, Carl-Gustaf; Sundell, Jan
2002-01-01
Questionnaire data on 8681 dwellings included in the Swedish study "Dampness in Buildings and Health" have been analysed for associations between dampness indicators, perceptions of indoor air quality and building characteristics such as time of construction, type of ventilation and type of found......Questionnaire data on 8681 dwellings included in the Swedish study "Dampness in Buildings and Health" have been analysed for associations between dampness indicators, perceptions of indoor air quality and building characteristics such as time of construction, type of ventilation and type...... of "Dry air" in 17.3 and 33.7% respectively. Older buildings and the use of natural ventilation were associated with increased frequency of dampness indicators as well as to increased frequencies of complaints on bad indoor air quality....
Wire breakage in SLC wire profile monitors
International Nuclear Information System (INIS)
Field, C.; McCormick, D.; Raimondi, P.; Ross, M.
1998-05-01
Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures
International Nuclear Information System (INIS)
Schwickerath, Ulrich; Silva, Ricardo
2010-01-01
Most LCG sites are currently running on SL(C)4. However, this operating system is already rather old, and it is becoming difficult to get the required hardware drivers, to get the best out of recent hardware. A possible way out is the migration to SL(C)5 based systems where possible, in combination with virtualization methods. The former is typically possible for nodes where the software to run the services is available and tested, while the latter offers a possibility to make use of the new hardware platforms whilst maintaining operating system compatibility. Since autumn 2008, CERN has offered public interactive and batch worker nodes for evaluation to the experiments. For the Grid environment, access is granted by a dedicated CEs. The status of the evaluation, feedback received from the experiments and the status of the migration will be reviewed, and the status of virtualization of services at CERN will be reported. Beyond this, the migration to a new operating system also offers an excellent opportunity to upgrade the fabric infrastructure used to manage the servers.
Luminosity Optimization Feedback in the SLC
International Nuclear Information System (INIS)
1999-01-01
The luminosity optimization at the SLC has been limited by the precision with which one can measure the micron size beams at the Interaction Point. Ten independent tuning parameters must be adjusted. An automated application has been used to scan each parameter over a significant range and set the minimum beam size as measured with a beam-beam deflection scan. Measurement errors limited the accuracy of this procedure and degraded the resulting luminosity. A new luminosity optimization feedback system has been developed using novel dithering techniques to maximize the luminosity with respect to the 10 parameters, which are adjusted one at a time. Control devices are perturbed around nominal setpoints, while the averaged readout of a digitized luminosity monitor measurement is accumulated for each setting. Results are averaged over many pulses to achieve high precision and then fitted to determine the optimal setting. The dithering itself causes a small loss in luminosity, but the improved optimization is expected to significantly enhance the performance of the SLC. Commissioning results are reported
International Nuclear Information System (INIS)
Edme, R.
1983-01-01
If a dynamic response analysis (harmonic excitation) is carried out with the modal method, the modal damping coefficients must be approximated to match the structural damping. The program ASKA-Damping, which also supplies an error assessment of the approximation, was developed for this purpose. The modal method and the direct method are applied to a test example and their results compared. It is suggested that the ASKA manufacturers extend the spectral earthquake response analysis to take these modal damping coefficients into account so that the results become less conservative. (orig.) [de
International Nuclear Information System (INIS)
Phuoc, Le Minh; Lee, Suk Han; Kim, Hun Mo; Martinet, Philippe
2008-01-01
Robot inverse kinematics based on Jacobian inversion encounters critical issues of kinematic singularities. In this paper, several techniques based on damped least squares are proposed to lead robot pass through kinematic singularities without excessive joint velocities. Unlike other work in which the same damping factor is used for all singular vectors, this paper proposes a different damping coefficient for each singular vector based on corresponding singular value of the Jacobian. Moreover, a continuous distribution of damping factor following Gaussian function guarantees the continuous in joint velocities. A genetic algorithm is utilized to search for the best maximum damping factor and singular region, which used to require ad hoc searching in other works. As a result, end effector tracking error, which is inherited from damped least squares by introducing damping factors, is minimized. The effectiveness of our approach is compared with other methods in both non-redundant robot and redundant robot
Energy Technology Data Exchange (ETDEWEB)
Phuoc, Le Minh; Lee, Suk Han; Kim, Hun Mo [Sungkyunkwan University, Suwon (Korea, Republic of); Martinet, Philippe [Blaise Pascal University, Clermont-Ferrand Cedex (France)
2008-07-15
Robot inverse kinematics based on Jacobian inversion encounters critical issues of kinematic singularities. In this paper, several techniques based on damped least squares are proposed to lead robot pass through kinematic singularities without excessive joint velocities. Unlike other work in which the same damping factor is used for all singular vectors, this paper proposes a different damping coefficient for each singular vector based on corresponding singular value of the Jacobian. Moreover, a continuous distribution of damping factor following Gaussian function guarantees the continuous in joint velocities. A genetic algorithm is utilized to search for the best maximum damping factor and singular region, which used to require ad hoc searching in other works. As a result, end effector tracking error, which is inherited from damped least squares by introducing damping factors, is minimized. The effectiveness of our approach is compared with other methods in both non-redundant robot and redundant robot
Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis
Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.
2010-01-01
Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853
Directory of Open Access Journals (Sweden)
Sofia Blazevic
Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.
Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Ming LEI
2012-01-01
Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.
S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model
Directory of Open Access Journals (Sweden)
Pingting Liu
2017-01-01
Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.
The renal urate transporter SLC17A1 locus: confirmation of association with gout.
Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2012-04-27
Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.
ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production
Directory of Open Access Journals (Sweden)
Etienne Masle-Farquhar
2017-05-01
Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.
Investigation of longitudinal dynamic in laser electron storage ring
Energy Technology Data Exchange (ETDEWEB)
Karnaukhov, I.; Zelinsky, A. E-mail: zelinsky@kipt.kharkov.ua; Telegin, Yu
2001-09-01
Longitudinal dynamic of electron beam due to radiation damping and quantum fluctuations in the storage ring with a laser-electron interaction section (Compton scattering) is investigated. This investigation was carried out by numerical simulations using the Monte Carlo method. The dependence of the steady-state energy spread of electron beam due to the Compton back scattering of photons on the electron beam energy and photon flash density were obtained. Simulation findings are compared with the analytical estimations by Z. Huang.
Investigation of longitudinal dynamic in laser electron storage ring
Karnaukhov, I; Telegin, Yu P
2001-01-01
Longitudinal dynamic of electron beam due to radiation damping and quantum fluctuations in the storage ring with a laser-electron interaction section (Compton scattering) is investigated. This investigation was carried out by numerical simulations using the Monte Carlo method. The dependence of the steady-state energy spread of electron beam due to the Compton back scattering of photons on the electron beam energy and photon flash density were obtained. Simulation findings are compared with the analytical estimations by Z. Huang.
Damping Measurements of Plasma Modes
Anderegg, F.; Affolter, M.; Driscoll, C. F.
2010-11-01
For azimuthally symmetric plasma modes in a magnesium ion plasma, confined in a 3 Tesla Penning-Malmberg trap with a density of n ˜10^7cm-3, we measure a damping rate of 2s-1plasma column, alters the frequency of the mode from 16 KHz to 192 KHz. The oscillatory fluid displacement is small compared to the wavelength of the mode; in contrast, the fluid velocity, δvf, can be large compared to v. The real part of the frequency satisfies a linear dispersion relation. In long thin plasmas (α> 10) these modes are Trivelpiece-Gould (TG) modes, and for smaller values of α they are Dubin spheroidal modes. However the damping appears to be non-linear; initially large waves have weaker exponential damping, which is not yet understood. Recent theoryootnotetextM.W. Anderson and T.M. O'Neil, Phys. Plasmas 14, 112110 (2007). calculates the damping of TG modes expected from viscosity due to ion-ion collisions; but the measured damping, while having a similar temperature and density dependence, is about 40 times larger than calculated. This discrepancy might be due to an external damping mechanism.
Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells
Directory of Open Access Journals (Sweden)
Kayo Ikeda
2017-11-01
Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter
Secondary vertex detection at the SLC
International Nuclear Information System (INIS)
Anon.
1982-01-01
The vertex topology of a high energy e + e - interaction contains a wealth of information. These interactions copiously produce the tau lepton and hadrons containing the c and b quarks; all these particles decay within a millimeter or so of the primary interaction point, giving these interactions a rich secondary vertex structure. With suitable detectors, one can hope to reconstruct these vertices and so tag events with tau's, c's and b's; measure lifetimes and mixing angles; and perhaps directly measure the flavor of c and b jets. The spatial resolution and track-pair resolution required of such detectors demand detector development, but several techniques, including solid state microstrip and CCD detectors, pressurized drift chambers, and holographic bubbble chambers look promising. Vertex detection in the colliding beam environment has already yielded a measurement of the tau lifetime. The SLC, with its micron-sized beam and one-centimeter sized beam pipe is uniquely suited for these studies. Compared to conventional storage rings, it offers a well-defined and minute primary interaction point, the possibility of locating a detector within a centimeter of the interaction (an order of magnitude improvement over LEP), negligibly thin beam pipes, and a repetition rate low enough to permit novel detectors and readout schemes. This report discusses the physics accessible with vertex detectors, depicts the physics environment at 100 GeV - particle multiplicities, momenta, angular correlations, and topologies of charm decays, sketches the elements of a vertex detector, and, through some model studies evaluates the spatial resolution and track-pair resolution requirements, and summarizes the detector technologies which seem most promising for vertex detection
Damping in heat exchanger tube bundles. A review
International Nuclear Information System (INIS)
Iqbal, Qamar; Khushnood, Shahab; Ghalban, Ali Roheim El; Sheikh, Nadeem Ahmed; Malik, Muhammad Afzaal; Arastu, Asif
2007-01-01
Damping is a major concern in the design and operation of tube bundles with loosely supported tubes in baffles for process shell and tube heat exchangers and steam generators which are used in nuclear, process and power generation industries. System damping has a strong influence on the amplitude of vibration. Damping depends upon the mechanical properties of the tube material, geometry of intermediate supports and the physical properties of shell-side fluid. Type of tube motion, number of supports, tube frequency, vibration amplitude, tube mass or diameter, side loads, support thickness, higher modes, shell-side temperature etc., affect damping in tube bundles. The importance of damping is further highlighted due to current trend of larger exchangers with increased shell-side velocities in modern units. Various damping mechanisms have been identified (Friction damping, Viscous damping, Squeeze film damping, Support damping. Two-Phase damping, and very recent-Thermal damping), which affect the performance of process exchangers and steam generators with respect to flow induced vibration design, including standard design guidelines. Damping in two-phase flow is very complex and highly void fraction, and flow-regime dependent. The current paper focuses on the various known damping mechanisms subjected to both single and two-phase cross-flow in process heat exchangers and steam generators and formulates the design guidelines for safer design. (author)
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-09-30
Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and
Directory of Open Access Journals (Sweden)
Yan Xiaofei
2011-09-01
Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was
DAMPs, ageing, and cancer: The 'DAMP Hypothesis'.
Huang, Jin; Xie, Yangchun; Sun, Xiaofang; Zeh, Herbert J; Kang, Rui; Lotze, Michael T; Tang, Daolin
2015-11-01
Ageing is a complex and multifactorial process characterized by the accumulation of many forms of damage at the molecular, cellular, and tissue level with advancing age. Ageing increases the risk of the onset of chronic inflammation-associated diseases such as cancer, diabetes, stroke, and neurodegenerative disease. In particular, ageing and cancer share some common origins and hallmarks such as genomic instability, epigenetic alteration, aberrant telomeres, inflammation and immune injury, reprogrammed metabolism, and degradation system impairment (including within the ubiquitin-proteasome system and the autophagic machinery). Recent advances indicate that damage-associated molecular pattern molecules (DAMPs) such as high mobility group box 1, histones, S100, and heat shock proteins play location-dependent roles inside and outside the cell. These provide interaction platforms at molecular levels linked to common hallmarks of ageing and cancer. They can act as inducers, sensors, and mediators of stress through individual plasma membrane receptors, intracellular recognition receptors (e.g., advanced glycosylation end product-specific receptors, AIM2-like receptors, RIG-I-like receptors, and NOD1-like receptors, and toll-like receptors), or following endocytic uptake. Thus, the DAMP Hypothesis is novel and complements other theories that explain the features of ageing. DAMPs represent ideal biomarkers of ageing and provide an attractive target for interventions in ageing and age-associated diseases. Copyright © 2014 Elsevier B.V. All rights reserved.
Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.
Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel
2013-12-05
Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
The role of SLC2A1 in early onset and childhood absence epilepsies
DEFF Research Database (Denmark)
Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg
2013-01-01
Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...
International Nuclear Information System (INIS)
Ware, A.G.; Arendts, J.G.
1984-01-01
A program has been developed to assess the available piping damping data, to generate additional data and conduct seperate effects tests, and to establish a plan for reporting and storing future test results into a data bank. This effort is providing some of the basis for developing higher allowable damping values for piping seismic analyses, which will potentially permit removal of a considerable number of piping supports, particularly snubbers. This in turn will lead to more flexible piping systems which will be less susceptible to thermal cracking, will be easier to maintain and inspect, as well as less costly
Directory of Open Access Journals (Sweden)
Zhao Jiandong
2012-05-01
Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.
Correlation plot facility in the SLC control system
International Nuclear Information System (INIS)
Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.
1991-05-01
The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. A generalized interface allows the user to perform a wide variety of machine physics experiments without the need for specialized software. It has been used extensively during SLC commissioning and operation. The user may step one or two independent parameters such as magnet or feedback setpoints while measuring or calculating up to 160 others. Measured variables include all analog signals available to the control system as well as a variety of derived parameters such as beam size or emittance. Various fitting algorithms and display options are provided for data analysis. A software-callable interface is also provided. Applications based on this facility are used to phase klystrons, measure emittance and dispersion, minimize beam size at the interaction point and maintain beam collisions. 4 refs., 3 figs
An Effective Gap Filtering Method for Landsat ETM+ SLC-Off Data
Directory of Open Access Journals (Sweden)
Seulki Lee
2016-01-01
Full Text Available The Landsat 7 Enhanced Thematic Mapper Plus (ETM+ scan line corrector (SLC failed on 31 May 2003, causing the SLC to turn off. Many gap-filled products were developed and deployed to combat this situation. The majority of these products used a primary image taken by the SLC when functioning properly in an attempt to correct SLC-off images. However, temporal atmospheric elements could not be reliably reflected using a primary image, and therefore the corrected image was not viable for use by monitoring systems. To bypass this limitation, this study has developed the Gap Interpolation and Filtering (GIF method that relies on one-dimensional interpolation filtering to conveniently recover pixels within a single image at a high level of accuracy without borrowing from images acquired at a different time or by another sensor. The GIF method was compared to two other methods—Global Linear Histogram Match (GLHM, and the Local Linear Histogram Match (LLHM—both developed by National Aeronautics and Space Administration (NASA and United States Geological Survey (USGS to determine its accuracy. The GIF method accuracy was found superior in land, sea, and cloud imaging. In particular, its sea and cloud images returned Root Mean Square Error (RMSE values close to or less than 1. We expect the GIF method developed in this research to be of invaluable aid to monitoring systems that depend heavily on Landsat imagery.
Waves in Saturn's rings probed by radio occultation
International Nuclear Information System (INIS)
Rosen, P.A.
1989-01-01
Thirty wave features, observed in 3.6 and 13 cm-wavelength optical depth profiles of Saturn's rings obtained by Voyager 1 radio occultation, are analyzed individually and comparatively. Many are the signature of spiral density waves and bending waves excited by gravitational resonances with Saturn's satellites. A new technique for locating waveform extrema, which fits a sinusoid to each half cycle of wave data, quantifies the wavelength variation across a feature. Fitting dispersion models to the derived wavelengths provides new estimates of ambient surface mass density σ in each wave region. For fourteen weak density waves in Ring A, modelling of the waveform near resonance with linear density wave theory gives independent estimates of σ, as well as reliable estimates of resonance location. Measurements of wave amplitude damping give an upper bound for ring thickness 2H, where H is the ring scale height. In the wave regions studied, Rings A, B, and C have 30 approx-lt σ approx-lt 70, σ approx-gt 65, and σ ∼ 1 g/cm 2 , respectively. Mass loading estimates from waveform modelling are 20 to 40% larger than dispersion-derived values, suggesting accumulation of mass in the wave regions. The average offset of derived wave location from theoretical resonance is about 1 km. Model waveforms of overlapping waves excited by the satellites Janus and Epimethenus agree well with observed morphologies in the linear region near resonance. In Ring C, dispersion analysis indicates that the most prominent wave feature, previously unidentified, is a one-armed spiral wave
Machine protection schemes for the SLC
International Nuclear Information System (INIS)
Ross, M.C.
1991-01-01
The beamline components of a linear collider must be protected from high power beams in a way that is both reliable and has a minimum impact on integrated luminosity. When an upstream accelerator component fault occurs, the machine protection system suppresses the appropriate beam pulses and restores them when the fault clears or is compensated for. If an unacceptable localized beam loss is detected, without an accompanying component fault that is a likely cause of the loss, the system must provide identical, lower rate (lower average power), beam pulses to be used for diagnosis. This must not be done at the expense of any upstream beam stabilization system since fault diagnosis and recovery may take some time. Since the SLC beam pulse sequence is a regenerative one, i.e. correct function on a given pulse requires that several preceding pulses have been successfully completed, beam pulse repetition rate limiting is not trivial. Smooth, rapid, recovery from this type of fault is very important and can have a significant impact on luminosity. This paper provides an overview of the beam suppression and repetition rate limiting schemes used at the SLC
International Nuclear Information System (INIS)
Prabhu Gaunkar, N.; Bouda, N. R. Y.; Nlebedim, I. C.; Hadimani, R. L.; Mina, M.; Jiles, D. C.; Bulu, I.; Ganesan, K.; Song, Y. Q.
2015-01-01
This work presents investigations and detailed analysis of ringing in a non-resonant pulsed nuclear magnetic resonance (NMR) circuit. Ringing is a commonly observed phenomenon in high power switching circuits. The oscillations described as ringing impede measurements in pulsed NMR systems. It is therefore desirable that those oscillations decay fast. It is often assumed that one of the causes behind ringing is the role of the magnetic core used in the antenna (acting as an inductive load). We will demonstrate that an LRC subcircuit is also set-up due to the inductive load and needs to be considered due to its parasitic effects. It is observed that the parasitics associated with the inductive load become important at certain frequencies. The output response can be related to the response of an under-damped circuit and to the magnetic core material. This research work demonstrates and discusses ways of controlling ringing by considering interrelationships between different contributing factors
Energy Technology Data Exchange (ETDEWEB)
Prabhu Gaunkar, N., E-mail: neelampg@iastate.edu; Bouda, N. R. Y.; Nlebedim, I. C.; Hadimani, R. L.; Mina, M.; Jiles, D. C. [Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50011 (United States); Bulu, I.; Ganesan, K.; Song, Y. Q. [Schlumberger-Doll Research, Cambridge, Massachusetts 02139 (United States)
2015-05-07
This work presents investigations and detailed analysis of ringing in a non-resonant pulsed nuclear magnetic resonance (NMR) circuit. Ringing is a commonly observed phenomenon in high power switching circuits. The oscillations described as ringing impede measurements in pulsed NMR systems. It is therefore desirable that those oscillations decay fast. It is often assumed that one of the causes behind ringing is the role of the magnetic core used in the antenna (acting as an inductive load). We will demonstrate that an LRC subcircuit is also set-up due to the inductive load and needs to be considered due to its parasitic effects. It is observed that the parasitics associated with the inductive load become important at certain frequencies. The output response can be related to the response of an under-damped circuit and to the magnetic core material. This research work demonstrates and discusses ways of controlling ringing by considering interrelationships between different contributing factors.
Modelling of Dampers and Damping in Structures
DEFF Research Database (Denmark)
Høgsberg, Jan Riess
2006-01-01
and the maximum attainable damping are found by maximizing the expression for the damping ratio. The theory is formulated for linear damper models, but may also be applied for non-linear dampers in terms of equivalent linear parameters for stiffness and damping, respectively. The format of the expressions......, and thereby the damping, of flexible structures are generally described in terms of the dominant vibration modes. A system reduction technique, where the damped vibration mode is constructed as a linear combination of the undamped mode shape and the mode shape obtained by locking the damper, is applied....... This two-component representation leads to a simple solution for the modal damping representing the natural frequency and the associated damping ratio. It appears from numerical examples that this system reduction technique provides very accurate results. % Analytical expressions for the optimal tuning...
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Performance of the SRRC storage ring and wiggler commissioning
International Nuclear Information System (INIS)
Kuo, C.C.; Hsu, K.T.; Luo, G.H.
1995-01-01
A 1.3 GeV synchrotron radiation storage ring at SRRC has been operated for more than a year since October 1993. Starting from April 1994, the machine has been open to the user community. In February 1995, the authors installed a wiggler magnet of 1.8 tesla 25-pole in the ring and successfully commissioned. The machine was scheduled for the users' runs from the middle of April this year. The authors describe the performance of the machine without wiggler magnet system and then report the wiggler effects on the beam dynamics of the storage ring, e.g., tune shift, beta-beating, orbit change, nonlinear dynamics effect, etc. Some measurements are compared with the model prediction and agreement between them was fairly good. Possible actions to minimize wiggler effects have been taken, such as orbit correction as a function wiggler gap change. The machine improvement projects, such as longitudinal and transverse damping systems as well as orbit stability feedback system are under construction and will be in use soon
International Nuclear Information System (INIS)
Bullock, J.C.; Kelley, B.E.
1977-01-01
A valve for damping out flow surges in a vacuum system is described. The surge-damping mechanism consists of a slotted, spring-loaded disk adjacent to the valve's vacuum port (the flow passage to the vacuum roughing pump). Under flow surge conditions, the differential pressure forces the disk into a sealing engagement with the vacuum port, thereby restricting the gas flow path to narrow slots in the disk's periphery. The increased flow damps out the flow surge. When pressure is equalized on both sides of the valve, the spring load moves the disk away from the port to restore full flow conductance through the valve
A calorimeter software trigger for the Mark II detector at SLC [Stanford Linear Collider
International Nuclear Information System (INIS)
Briggs, D.; Glanzman, T.; Grosse-Wiesmann, P.; Tinsman, J.; Holmgren, S.; Schaad, M.W.
1989-04-01
A new FASTBUS-based calorimeter software trigger for the upgraded Mark II at the Stanford Linear Collider (SLC) is presented. The trigger requirements for SLC and a short description of the hardware used for this purpose are given, followed by a detailed description of the software. Some preliminary results are presented. 9 refs., 4 figs
Damping in aerospace composite materials
Agneni, A.; Balis Crema, L.; Castellani, A.
Experimental results are presented on specimens of carbon and Kevlar fibers in epoxy resin, materials used in many aerospace structures (control surfaces and wings in aircraft, large antennas in spacecraft, etc.). Some experimental methods of estimating damping ratios are first reviewed, either in the time domain or in the frequency domain. Some damping factor estimates from experimental tests are then shown; in order to evaluate the effects of the aerospace environment, damping factors have been obtained in a typical range of temperature, namely between +120 C and -120 C, and in the pressure range from room pressure to 10 exp -6 torr. Finally, a theoretical approach for predicting the bounds of the damping coefficients is shown, and prediction data are compared with experimental results.
Analyses of SLC13A5-epilepsy patients reveal perturbations of TCA cycle.
Bainbridge, Matthew N; Cooney, Erin; Miller, Marcus; Kennedy, Adam D; Wulff, Jacob E; Donti, Taraka; Jhangiani, Shalini N; Gibbs, Richard A; Elsea, Sarah H; Porter, Brenda E; Graham, Brett H
2017-08-01
To interrogate the metabolic profile of five subjects from three families with rare, nonsense and missense mutations in SLC13A5 and Early Infantile Epileptic Encephalopathies (EIEE) characterized by severe, neonatal onset seizures, psychomotor retardation and global developmental delay. Mass spectrometry of plasma, CSF and urine was used to identify consistently dysregulated analytes in our subjects. Distinctive elevations of citrate and dysregulation of citric acid cycle intermediates, supporting the hypothesis that loss of SLC13A5 function alters tricarboxylic acid cycle (TCA) metabolism and may disrupt metabolic compartmentation in the brain. Our results indicate that analysis of plasma citrate and other TCA analytes in SLC13A5 deficient patients define a diagnostic metabolic signature that can aid in diagnosing children with this disease. Copyright © 2017 Elsevier Inc. All rights reserved.
Investigation of SLC6A4 gene expression in autism spectrum disorders
Directory of Open Access Journals (Sweden)
Elif Funda Şener
2015-06-01
Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169
Directory of Open Access Journals (Sweden)
Raymond E. Lai
2018-04-01
Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport
Preliminary Study on the Damping Effect of a Lateral Damping Buffer under a Debris Flow Load
Directory of Open Access Journals (Sweden)
Zheng Lu
2017-02-01
Full Text Available Simulating the impact of debris flows on structures and exploring the feasibility of applying energy dissipation devices or shock isolators to reduce the damage caused by debris flows can make great contribution to the design of disaster prevention structures. In this paper, we propose a new type of device, a lateral damping buffer, to reduce the vulnerability of building structures to debris flows. This lateral damping buffer has two mechanisms of damage mitigation: when debris flows impact on a building, it acts as a buffer, and when the structure vibrates due to the impact, it acts as a shock absorber, which can reduce the maximum acceleration response and subsequent vibration respectively. To study the effectiveness of such a lateral damping buffer, an impact test is conducted, which mainly involves a lateral damping buffer attached to a two-degree-of-freedom structure under a simulated debris flow load. To enable the numerical study, the equation of motion of the structure along with the lateral damping buffer is derived. A subsequent parametric study is performed to optimize the lateral damping buffer. Finally, a practical design procedure is also provided.
The Injection System of the INFN-SuperB Factory Project: Preliminary Design
Energy Technology Data Exchange (ETDEWEB)
Boni, Roberto; /INFN, Rome; Guiducci, Susanna; /INFN, Rome; Preger, Miro; /INFN, Rome; Raimondi, Pantaleo; /INFN, Rome; Chance, Antoine; /Saclay; Dadoun, Olivier; /Orsay, LAL; Poirier, Freddy; /Orsay, LAL; Variola, Alessandro; /Orsay, LAL; Seeman, John; /SLAC
2012-07-05
The ultra high luminosity B-factory (SuperB) project of INFN requires a high performance and reliable injection system, providing electrons at 4 GeV and positrons at 7 GeV, to fulfil the very tight requirements of the collider. Due to the short beam lifetime, continuous injection of electron and positron bunches in both LER and HER rings is necessary to maintain an high average luminosity. Polarized electrons are required for experiments and must be delivered by the injection system, due to the beam lifetime shorter than the ring polarization build-up: they will be produced by means of a SLAC-SLC polarized gun. The emittance and the energy spread of the e{sup -}/e{sup +} beams are reduced in a 1 GeV Damping Ring (DR) before injection in the main rings. Two schemes for positron production are under study, one with e{sup -}/e{sup +} conversion at low energy (< 1 Gev) and one with conversion at 6 GeV and a recirculation line to bring the positrons back to the DR. Acceleration through the Linac is provided by a 2856 MHz RF system made of travelling wave (TW), room temperature accelerating structures.
Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R
2017-06-07
The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.
Directory of Open Access Journals (Sweden)
J. Noelia Dufay
2017-06-01
Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.
Bounce-harmonic Landau Damping of Plasma Waves
Anderegg, Francois
2015-11-01
We present measurement of plasma wave damping, spanning the temperature regimes of direct Landau damping, bounce-harmonic Landau damping, inter-species drag damping, and viscous damping. Direct Landau damping is dominant at high temperatures, but becomes negligible as v vph / 5 . The measurements are conducted in trapped pure ion plasmas contained in Penning-Malmberg trap, with wave-coherent LIF diagnostics of particle velocities. Our focus is on bounce harmonics damping, controlled by an applied ``squeeze'' potential, which generates harmonics in the wave potential and in the particle dynamics. A particle moving in z experiences a non-sinusoidal mode potential caused by the squeeze, producing high spatial harmonics with lower phase velocity. These harmonics are Landau damped even when the mode phase velocity vph is large compared to the thermal velocity v , since the nth harmonic is resonant with a particle bouncing at velocity vb =vph / n . Here we increase the bounce harmonics through applied squeeze potential; but some harmonics are always present in finite length systems. For our centered squeeze geometry, theory shows that only odd harmonics are generated, and predicts the Landau damping rate from vph / n . Experimentally, the squeeze potential increases the wave damping and reduces its frequency. The frequency shift occurs because the squeeze potential reduces the number of particle where the mode velocity is the largest, therefore reducing the mode frequency. We observe an increase in the damping proportional to Vs2,and a frequency reduction proportional to Vs , in quantitative agreement with theory. Wave-coherent laser induced fluorescence allows direct observation of bounce resonances on the particle distribution, here predominantly at vph / 3 . A clear increase of the bounce harmonics is visible on the particle distribution when the squeeze potential is applied. Supported by NSF Grant PHY-1414570, and DOE Grants DE-SC0002451 and DE-SC0008693.
Computer-aided studies of the ALS 500 MHz storage ring cavity
International Nuclear Information System (INIS)
Lo, C.C.; Taylor, B.
1989-03-01
The design of the ALS storage ring 500 MHz cavity has been modeled with Mafia and Urmel codes. The effects of the holes cut for the drive port, the higher order mode damping port, the probe port and tuner plunger were modeled with the Mafia codes. The frequency dependence on the shape and spacing of the nose cones and the general shape of the cavity were modeled with Urmel codes. 9 refs., 7 figs., 1 tab
Beam based alignment of the SLC final focus sextupoles
International Nuclear Information System (INIS)
Emma, P.; Irwin, J.; Phinney, N.; Raimondi, P.; Toge, N.; Walker, N.J.; Ziemann, V.
1993-05-01
The strong demagnification inherent in final focus systems requires local cancellation of the resulting chromaticty. Strong sextupole pair separated by a -I transform are positioned π/2 in the betatron phase away from the Interaction Point (IP) in order to cancel chromatic aberrations primarily due to the final quadrupoles. Sextupole alignment is critical in order to provide orthogonal tuning of the chromaticty and, in the case of the SLC, to limit the third and higher order optical aberrations generated from misaligned and 'nested' horizontal and vertical sextupole pairs. Reported here is a novel technique for aligning the beam centroid to the sextupole centers, which uses measurements of the criticality dependent parameter - the beam size at the IP. Results for the SLC final focus sextupoles are presented, where a resolution of <50 μm is achieved
Feedback to suppress beam instabilities in future proton rings
International Nuclear Information System (INIS)
Lambertson, G.R.
1985-05-01
Criteria for the design of feedback systems to suppress coherent beam instabilities are presented. These address starting amplitudes, diffusion from noise during damping or long storage, and choice of kicker. As a model for future accelerators, specifications of the proposed 20 TeV SSC are used to calculate parameters of systems to control expected instabilities. A scenario and hardware to stabilize the transverse mode-coupling instability is examined. The scale of the systems is large but not out of scale with the large ring. 9 refs., 4 tabs
International Nuclear Information System (INIS)
Shibata, H.; Ito, A.; Tanaka, K.; Niino, T.; Gotoh, N.
1981-01-01
Generally, damping phenomena of structures and equipments is caused by very complex energy dissipation. Especially, as piping systems are composed of many components, it is very difficult to evaluate damping characteristics of its system theoretically. On the other hand, the damping value for aseismic design of nuclear power plants is very important design factor to decide seismic response loads of structures, equipments and piping systems. The very extensive studies titled SDREP (Seismic Damping Ratio Evaluation Program) were performed to establish proper damping values for seismic design of piping as a joint work among a university, electric companies and plant makers. In SDREP, various systematic vibration tests were conducted to investigate factors which may contribute to damping characteristics of piping systems and to supplement the data of the pre-operating tests. This study is related to the component damping characteristics tests of that program. The object of this study is to clarify damping characteristics and mechanism of hanger supports used in piping systems, and to establish the evaluation technique of dispersing energy at hanger support points and its effect to the total damping ability of piping system. (orig./WL)
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
Identification of Damping from Structural Vibrations
DEFF Research Database (Denmark)
Bajric, Anela
Reliable predictions of the dynamic loads and the lifetime of structures are influenced by the limited accuracy concerning the level of structural damping. The mechanisms of damping cannot be derived analytically from first principles, and in the design of structures the damping is therefore based...... on experience or estimated from measurements. This thesis consists of an extended summary and three papers which focus on enhanced methods for identification of damping from random struc-tural vibrations. The developed methods are validated by stochastic simulations, experimental data and full-scale measurements...... which are representative of the vibrations in small and large-scale structures. The first part of the thesis presents an automated procedure which is suitable for estimation of the natural frequencies and the modal damping ratios from random response of structures. The method can be incorporated within...
Mouhot, Clément
2011-09-01
Going beyond the linearized study has been a longstanding problem in the theory of Landau damping. In this paper we establish exponential Landau damping in analytic regularity. The damping phenomenon is reinterpreted in terms of transfer of regularity between kinetic and spatial variables, rather than exchanges of energy; phase mixing is the driving mechanism. The analysis involves new families of analytic norms, measuring regularity by comparison with solutions of the free transport equation; new functional inequalities; a control of non-linear echoes; sharp "deflection" estimates; and a Newton approximation scheme. Our results hold for any potential no more singular than Coulomb or Newton interaction; the limit cases are included with specific technical effort. As a side result, the stability of homogeneous equilibria of the non-linear Vlasov equation is established under sharp assumptions. We point out the strong analogy with the KAM theory, and discuss physical implications. Finally, we extend these results to some Gevrey (non-analytic) distribution functions. © 2011 Institut Mittag-Leffler.
Shape memory alloys as damping materials
International Nuclear Information System (INIS)
Humbeeck, J. van
2000-01-01
Shape memory alloys are gaining an increased interest as passive as well as active damping materials. This damping ability when applied in structural elements can lead to a better noise control, improved life time and even better performance of the envisaged tools. By passive damping, it is understood that the material converts a significant part of unwanted mechanical energy into heat. This mechanical energy can be a (resonance) vibration, impact loading or shock waves. This high damping capacity finds its origin in the thermoelastic martensitic phase due to the hysteretic mobility of martensite-variants or different phase interfaces. The damping capacity increases with increasing amplitude of the applied vibration or impact and is almost frequency independent. Special interest exists moreover for damping extreme large displacements by applying the mechanical hysteresis performed during pseudoelastic loading. This aspect is nowadays very strongly studied as a tool for protecting buildings against earthquakes in seismic active regions. Active damping can be obtained in hybrid composites by controlling the recovery stresses or strains of embedded shape memory alloy wires. This controls the internal energy fo a structure which allows controlled modal modification and tuning of the dynamical properties of structural elements. But also impact damage, acoustic radiation, dynamic shape control can be actively controlled. As a consequence improved fatigue-resistance, better performance and a longer lifetime of the structural elements can be obtained. (orig.)
Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger
2012-11-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.
Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.
Directory of Open Access Journals (Sweden)
Deborah Cook
2008-09-01
Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.
Development of new damping devices for piping
International Nuclear Information System (INIS)
Kobayashi, Hiroe
1991-01-01
An increase of the damping ratio is known to be very effective for the seismic design of a piping system. Increasing the damping ratio and reducing the seismic response of the piping system, the following three types of damping devices for piping systems are introduced: (1) visco-elastic damper, (2) elasto-plastic damper and (3) compact dynamic damper. The dynamic characteristics of these damping devices were investigated by the component test and the applicability of them to the piping system was confirmed by the vibration test using a three dimensional piping model. These damping devices are more effective than mechanical snubbers to reduce the vibration of the piping system. (author)
Directory of Open Access Journals (Sweden)
Olha Hurba
Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Bryan's effect and anisotropic nonlinear damping
Joubert, Stephan V.; Shatalov, Michael Y.; Fay, Temple H.; Manzhirov, Alexander V.
2018-03-01
In 1890, G. H. Bryan discovered the following: "The vibration pattern of a revolving cylinder or bell revolves at a rate proportional to the inertial rotation rate of the cylinder or bell." We call this phenomenon Bryan's law or Bryan's effect. It is well known that any imperfections in a vibratory gyroscope (VG) affect Bryan's law and this affects the accuracy of the VG. Consequently, in this paper, we assume that all such imperfections are either minimised or eliminated by some known control method and that only damping is present within the VG. If the damping is isotropic (linear or nonlinear), then it has been recently demonstrated in this journal, using symbolic analysis, that Bryan's law remains invariant. However, it is known that linear anisotropic damping does affect Bryan's law. In this paper, we generalise Rayleigh's dissipation function so that anisotropic nonlinear damping may be introduced into the equations of motion. Using a mixture of numeric and symbolic analysis on the ODEs of motion of the VG, for anisotropic light nonlinear damping, we demonstrate (up to an approximate average), that Bryan's law is affected by any form of such damping, causing pattern drift, compromising the accuracy of the VG.
SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.
Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten
2015-12-03
SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Emery, L.
1993-01-01
A method of determining the deQing requirement of individual cavity higher-order modes (HOM) for a multi-cavity RF system is presented and applied to the APS ring. Since HOM resonator frequency values are to some degree uncertain, the HOM frequencies should be regarded as random variables in predicting the stability of the coupled bunch beam modes. A Monte Carlo simulation provides a histogram of the growth rates from which one obtains an estimate of the probability of instability. The damping of each HOM type is determined such that the damping effort is economized, i.e. no single HOM dominates the specified growth rate histogram
A review of experimental soil-structure interaction damping
International Nuclear Information System (INIS)
Tsai, N.C.
1981-01-01
In soil-structure interaction analysis, the foundation soil is usually represented by impedance springs and dampers. The impedance damping includes the effect of both the material damping and the radiation damping. Because the impedance theory normally assumes a rigid structural base and an elastic bond between the soil and structure, it is generally held that the radiation damping has been overestimated by the theory. There are some published information on the dynamic tests of footings and structures that allow direct or indirect assessments of the validity of the analytical radiation damping. An overview of such information is presented here. Based on these limited test data, it is concluded that for horizontal soil-structure interaction analysis the analytical radiation damping alone is sufficient to represent the combined material and radiation damping in the field. On the other hand, for vertical analysis it appears that the theory may have overestimated the radiation damping and certain reduction is recommended. (orig.)
Verification of the SLC wake potentials
International Nuclear Information System (INIS)
Bane, K.; Weiland, T.
1983-01-01
The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
DEFF Research Database (Denmark)
Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...
Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2011-12-01
Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.
Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters
Directory of Open Access Journals (Sweden)
Markus Grube
2018-04-01
Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.
SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland
Directory of Open Access Journals (Sweden)
Hassen Hadj-Kacem
2010-01-01
Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.
The Duffing oscillator with damping
DEFF Research Database (Denmark)
Johannessen, Kim
2015-01-01
An analytical solution to the differential equation describing the Duffing oscillator with damping is presented. The damping term of the differential equation and the initial conditions satisfy an algebraic equation, and thus the solution is specific for this type of damping. The nonlinear term...... of the differential equation is allowed to be considerable compared to the linear term. The solution is expressed in terms of the Jacobi elliptic functions by including a parameter-dependent elliptic modulus. The analytical solution is compared to the numerical solution, and the agreement is found to be very good....... It is established that the period of oscillation is shorter compared to that of a linearized model but increasing with time and asymptotically approaching the period of oscillation of the linear damped model. An explicit expression for the period of oscillation has been derived, and it is found to be very accurate....
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families
Directory of Open Access Journals (Sweden)
Hemant Kulkarni
2016-01-01
Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.
Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.
Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang
2017-07-01
Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.
RF phase distribution systems at the SLC
International Nuclear Information System (INIS)
Jobe, R.K.; Schwarz, H.D.
1989-04-01
Modern large linear accelerators require RF distribution systems with minimal phase drifts and errors. Through the use of existing RF coaxial waveguides, and additional installation of phase reference cables and monitoring equipment, stable RF distribution for the SLC has been achieved. This paper discusses the design and performance of SLAC systems, and some design considerations for future colliders. 6 refs., 4 figs
Swing damped movement of suspended objects
International Nuclear Information System (INIS)
Jones, J.F.; Petterson, B.J.; Werner, J.C.
1990-01-01
Transportation of large objects such as nuclear waste shipping casks using overhead cranes can induce pendular motion of the object. Residual oscillation from transportation typically must be damped or allowed to decay before the next process can take place. By properly programming the acceleration of the transporting device (e.g., crane) an oscillation damped transport and swing free stop are obtainable. This report reviews the theory associated with formulating such oscillation damped trajectories for a simply suspended object (e.g., simple pendulum). In addition, the use of force servo damping to eliminate initial oscillation of simply suspended objects is discussed. This is often needed to provide a well defined initial state for the system prior to executing an oscillation damped move. Also included are descriptions of experiments using a CIMCORP XR6100 gantry robot and results from these experiments. Finally, sources of error resulting in small residual oscillations are identified and possible solutions presented
Solid state high power amplifier for driving the SLC injector klystron
International Nuclear Information System (INIS)
Judkins, J.G.; Clendenin, J.E.; Schwarz, H.D.
1985-03-01
The SLC injector klystron rf drive is now provided by a recently developed solid-state amplifier. The high gain of the amplifier permits the use of a fast low-power electronic phase shifter. Thus the SLC computer control system can be used to shift the phase of the high-power rf rapidly during the fill time of the injector accelerator section. These rapid phase shifts are used to introduce a phase-energy relationship in the accelerated electron pulse in conjunction with the operation of the injector bunch compressor. The amplifier, the method of controlling the rf phase, and the operational characteristics of the system are described. 5 refs., 4 figs
First results from SLD with polarized electron beam at SLC
International Nuclear Information System (INIS)
Fero, M.J.
1992-12-01
The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005
A review of damping of two-phase flows
International Nuclear Information System (INIS)
Hara, Fumio
1993-01-01
Damping of two-phase flows has been recognized as one of the most unknown parameters in analyzing vibrational characteristics of structures subjected to two-phase flows since it seems to be influenced by many physical parameters involved in the physics of dynamic energy dissipation of a vibrating structure, for example, liquid viscosity, surface tension, flow velocity, mass ratio, frequency, void fraction, flow regime and so forth. This paper deals with a review of scientific works done to date on the damping of two phase flows and discussions about what has been clarified and what has not been known to us, or what kinds of research are needed about two-phase flow damping. The emphasis is put on the definition of two-phase fluid damping, damping measurement techniques, damping characteristics in relation to two phase flow configurations, and damping generation mechanisms
Spin physics with polarized electrons at the SLC [Stanford Linear Collider
International Nuclear Information System (INIS)
Moffeit, K.C.
1990-11-01
The Stanford Linear Collider was designed to accommodate polarized electron beams. A gallium arsenide-based photon emission source will provide a beam of longitudinally polarized electrons of about 40 percent polarization. A system of bend magnets and a superconducting solenoid will be used to rotate the spins so that the polarization is preserved while the 1.21 GeV electrons are stored in the damping ring. Another set of bend magnets and two superconducting solenoids orient the spin vectors so that longitudinal polarization of the electrons is achieved at the collision point with the unpolarized positions. A system to monitor the polarization based on Moeller and Compton scattering will be used. Spin physics with longitudinally polarized electrons uses the measurement of the left-right asymmetry to provide tests of the Standard Model. The uncertainty in the measurement is precise enough to be sensitive to the effects of particles which can not be produced directly in the machines we have today. 5 refs
Non-Linear Slosh Damping Model Development and Validation
Yang, H. Q.; West, Jeff
2015-01-01
Propellant tank slosh dynamics are typically represented by a mechanical model of spring mass damper. This mechanical model is then included in the equation of motion of the entire vehicle for Guidance, Navigation and Control (GN&C) analysis. For a partially-filled smooth wall propellant tank, the critical damping based on classical empirical correlation is as low as 0.05%. Due to this low value of damping, propellant slosh is potential sources of disturbance critical to the stability of launch and space vehicles. It is postulated that the commonly quoted slosh damping is valid only under the linear regime where the slosh amplitude is small. With the increase of slosh amplitude, the critical damping value should also increase. If this nonlinearity can be verified and validated, the slosh stability margin can be significantly improved, and the level of conservatism maintained in the GN&C analysis can be lessened. The purpose of this study is to explore and to quantify the dependence of slosh damping with slosh amplitude. Accurately predicting the extremely low damping value of a smooth wall tank is very challenging for any Computational Fluid Dynamics (CFD) tool. One must resolve thin boundary layers near the wall and limit numerical damping to minimum. This computational study demonstrates that with proper grid resolution, CFD can indeed accurately predict the low damping physics from smooth walls under the linear regime. Comparisons of extracted damping values with experimental data for different tank sizes show very good agreements. Numerical simulations confirm that slosh damping is indeed a function of slosh amplitude. When slosh amplitude is low, the damping ratio is essentially constant, which is consistent with the empirical correlation. Once the amplitude reaches a critical value, the damping ratio becomes a linearly increasing function of the slosh amplitude. A follow-on experiment validated the developed nonlinear damping relationship. This discovery can
Damping Estimation of Friction Systems in Random Vibrations
DEFF Research Database (Denmark)
Friis, Tobias; Katsanos, Evangelos; Amador, Sandro
Friction is one of the most efficient and economical mechanisms to reduce vibrations in structural mechanics. However, the estimation of the equivalent linear damping of the friction damped systems in experimental modal analysis and operational modal analysis can be adversely affected by several...... assumptions regarding the definition of the linear damping and the identification methods or may be lacking a meaningful interpretation of the damping. Along these lines, this project focuses on assessing the potential to estimate efficiently the equivalent linear damping of friction systems in random...
SLC energy upgrade program at SLAC
International Nuclear Information System (INIS)
Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.
1985-01-01
The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators
SLC Energy Upgrade Program at SLAC
International Nuclear Information System (INIS)
Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.
1985-03-01
The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators
Determination of electroweak parameters at the SLC
International Nuclear Information System (INIS)
Torrence, E.
1996-09-01
We present an improved measurement of the left-right cross section asymmetry (A LR ) for Z 0 boson production by e + e - collisions. The measurement was performed at a center-of-mass energy of 91.28 GeV with the SLD detector at the SLAC Linear Collider (SLC) during the 1994-95 running period. The luminosity-weighted average polarization of the SLC electron beam during this run was measured to be (77.23 ± 0.52)%. Using a sample of 93,644 hadronic Z 0 decays, we measure the pole asymmetry A LR 0 to be 0.1512 ± 0.0042(stat.) ± 0.0011(syst.) which is equivalent to an effective weak mixing angle of sin 2 θ W eff = 0.23100 ± 0.00054(stat.) ± 0.00014(syst.). We also present a preliminary direct measurement of the Z 0 -lepton coupling asymmetries A e , A μ , and A τ extracted from the differential cross section observed in leptonic Z 0 decays. We combine these results with our previous A LR measurement to obtain a combined determination of the weak mixing angle sin 2 θ W eff = 0.23061 ± 0.00047
International Nuclear Information System (INIS)
Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi
2009-01-01
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Energy Technology Data Exchange (ETDEWEB)
Bulos, Fatin [SLAC National Accelerator Lab., Menlo Park, CA (United States); Tomlin, Bill T. [SLAC National Accelerator Lab., Menlo Park, CA (United States); Weaver, J. [SLAC National Accelerator Lab., Menlo Park, CA (United States)
2014-03-04
The principle of the design of these magnets was discussed in CN-72. Fig. 1 shows what the total system looks like. Such a system was completed last January and since then we have been evaluating its performance.
Non-Linear Dynamics of Saturn's Rings
Esposito, L. W.
2016-12-01
Non-linear processes can explain why Saturn's rings are so active and dynamic. Ring systems differ from simple linear systems in two significant ways: 1. They are systems of granular material: where particle-to-particle collisions dominate; thus a kinetic, not a fluid description needed. Stresses are strikingly inhomogeneous and fluctuations are large compared to equilibrium. 2. They are strongly forced by resonances: which drive a non-linear response, that push the system across thresholds that lead to persistent states. Some of this non-linearity is captured in a simple Predator-Prey Model: Periodic forcing from the moon causes streamline crowding; This damps the relative velocity. About a quarter phase later, the aggregates stir the system to higher relative velocity and the limit cycle repeats each orbit, with relative velocity ranging from nearly zero to a multiple of the orbit average. Summary of Halo Results: A predator-prey model for ring dynamics produces transient structures like `straw' that can explain the halo morphology and spectroscopy: Cyclic velocity changes cause perturbed regions to reach higher collision speeds at some orbital phases, which preferentially removes small regolith particles; surrounding particles diffuse back too slowly to erase the effect: this gives the halo morphology; this requires energetic collisions (v ≈ 10m/sec, with throw distances about 200km, implying objects of scale R ≈ 20km).Transform to Duffing Eqn : With the coordinate transformation, z = M2/3, the Predator-Prey equations can be combined to form a single second-order differential equation with harmonic resonance forcing.Ring dynamics and history implications: Moon-triggered clumping explains both small and large particles at resonances. We calculate the stationary size distribution using a cell-to-cell mapping procedure that converts the phase-plane trajectories to a Markov chain. Approximating it as an asymmetric random walk with reflecting boundaries
Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.
Rao, Suryadevara S; Hildebrand, David
2009-10-01
The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.
Damped Oscillator with Delta-Kicked Frequency
Manko, O. V.
1996-01-01
Exact solutions of the Schrodinger equation for quantum damped oscillator subject to frequency delta-kick describing squeezed states are obtained. The cases of strong, intermediate, and weak damping are investigated.
Phenomenology of chiral damping in noncentrosymmetric magnets
Akosa, Collins Ashu; Miron, Ioan Mihai; Gaudin, Gilles; Manchon, Aurelien
2016-01-01
A phenomenology of magnetic chiral damping is proposed in the context of magnetic materials lacking inversion symmetry. We show that the magnetic damping tensor acquires a component linear in magnetization gradient in the form of Lifshitz invariants. We propose different microscopic mechanisms that can produce such a damping in ferromagnetic metals, among which local spin pumping in the presence of an anomalous Hall effect and an effective “s-d” Dzyaloshinskii-Moriya antisymmetric exchange. The implication of this chiral damping in terms of domain-wall motion is investigated in the flow and creep regimes.
Phenomenology of chiral damping in noncentrosymmetric magnets
Akosa, Collins Ashu
2016-06-21
A phenomenology of magnetic chiral damping is proposed in the context of magnetic materials lacking inversion symmetry. We show that the magnetic damping tensor acquires a component linear in magnetization gradient in the form of Lifshitz invariants. We propose different microscopic mechanisms that can produce such a damping in ferromagnetic metals, among which local spin pumping in the presence of an anomalous Hall effect and an effective “s-d” Dzyaloshinskii-Moriya antisymmetric exchange. The implication of this chiral damping in terms of domain-wall motion is investigated in the flow and creep regimes.
Allergy and respiratory health effects of dampness and dampness-related agents in schools and homes
DEFF Research Database (Denmark)
Holst, G; Høst, A; Doekes, G
2016-01-01
was identified based on technical inspection and bedroom dampness on parents' self-report. Classroom and bedroom dust was analysed for seven microbial components. Skin-prick-testing determined atopic sensitisation. Lung function was expressed as z-scores for forced expiratory volume in one second (zFEV1...... ), forced vital capacity (zFVC) and the ratio zFEV1 /zFVC using GLI-2012-prediction-equations. The parents reported children's allergies, airway symptoms and doctor-diagnosed asthma. High classroom dampness, but not bedroom dampness, was negatively associated with zFEV1 (β-coef. -0.71; 95%CI -1.17 - -0...... (ETS) decreased zFEV1 (β-coef. -0.22; 95%CI -0.42- -0.02) and zFEV1 /zFVC-ratio (β-coef. -0.26; 95%CI -0.44 - -0.07) and increased upper airway symptoms (OR1.66; 95%CI 1.03-2.66). In conclusion, dampness in classrooms may have adverse respiratory health effects in pupils, but microbial agents...
Magnon damping in two-dimensional Heisenberg ferromagnetic system
International Nuclear Information System (INIS)
Cheng, T.-M.; Li Lin; Ze Xianyu
2006-01-01
A magnon-phonon interaction model is set up for a two-dimensional insulating ferromagnetic system. By using Matsubara function theory we have studied the magnon damping -I m Σ* (1) (k->) and calculated the magnon damping -I m Σ* (1) (k->) curve on the main symmetric point and line in the Brillouin zone for various parameters in the system. It is concluded that at the boundary of Brillouin zone there is a strong magnon damping. However, the magnon damping is very weak on the zone of small wave vector and the magnon damping reaches maximal value at very low temperature. The contributions of longitudinal phonon and transverse phonon on the magnon damping are compared and the influences of various parameters are also discussed
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-05-09
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.
Dynamic characteristics of a novel damped outrigger system
Tan, Ping; Fang, Chuangjie; Zhou, Fulin
2014-06-01
This paper presents exact analytical solutions for a novel damped outrigger system, in which viscous dampers are vertically installed between perimeter columns and the core of a high-rise building. An improved analytical model is developed by modeling the effect of the damped outrigger as a general rotational spring acting on a Bernoulli-Euler beam. The equivalent rotational spring stiffness incorporating the combined effects of dampers and axial stiffness of perimeter columns is derived. The dynamic stiffness method (DSM) is applied to formulate the governing equation of the damped outrigger system. The accuracy and efficiency are verified in comparison with those obtained from compatibility equations and boundary equations. Parametric analysis of three non-dimensional factors is conducted to evaluate the influences of various factors, such as the stiffness ratio of the core to the beam, position of the damped outrigger, and the installed damping coefficient. Results show that the modal damping ratio is significantly influenced by the stiffness ratio of the core to the column, and is more sensitive to damping than the position of the damped outrigger. The proposed analytical model in combination with DSM can be extended to the study of structures with more outriggers.
Directory of Open Access Journals (Sweden)
André Bordinassi Medina
2017-04-01
Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.
Non-Linear Dynamics of Saturn’s Rings
Esposito, Larry W.
2015-11-01
Non-linear processes can explain why Saturn’s rings are so active and dynamic. Ring systems differ from simple linear systems in two significant ways: 1. They are systems of granular material: where particle-to-particle collisions dominate; thus a kinetic, not a fluid description needed. We find that stresses are strikingly inhomogeneous and fluctuations are large compared to equilibrium. 2. They are strongly forced by resonances: which drive a non-linear response, pushing the system across thresholds that lead to persistent states.Some of this non-linearity is captured in a simple Predator-Prey Model: Periodic forcing from the moon causes streamline crowding; This damps the relative velocity, and allows aggregates to grow. About a quarter phase later, the aggregates stir the system to higher relative velocity and the limit cycle repeats each orbit.Summary of Halo Results: A predator-prey model for ring dynamics produces transient structures like ‘straw’ that can explain the halo structure and spectroscopy: This requires energetic collisions (v ≈ 10m/sec, with throw distances about 200km, implying objects of scale R ≈ 20km).Transform to Duffing Eqn : With the coordinate transformation, z = M2/3, the Predator-Prey equations can be combined to form a single second-order differential equation with harmonic resonance forcing.Ring dynamics and history implications: Moon-triggered clumping at perturbed regions in Saturn’s rings creates both high velocity dispersion and large aggregates at these distances, explaining both small and large particles observed there. We calculate the stationary size distribution using a cell-to-cell mapping procedure that converts the phase-plane trajectories to a Markov chain. Approximating the Markov chain as an asymmetric random walk with reflecting boundaries allows us to determine the power law index from results of numerical simulations in the tidal environment surrounding Saturn. Aggregates can explain many dynamic aspects
Electromagnetic damping of neutron star oscillations
International Nuclear Information System (INIS)
McDermott, P.N.; Savedoff, M.P.; Van Horn, H.M.; Zweibel, E.G.; Hansen, C.J.
1984-01-01
Nonradial pulsations of a neutron star with a strong dipole magnetic field cause emission of electromagnetic radiation. Here we compute the power radiated to vacuum by neutron star g-mode pulsations and by torsional oscillations of the neutron star crust. For the low-order quadrupole fluid g-modes we have considered, we find electromagnetic damping to be considerably more effective than gravitational radiation. For example, a 0.5 M/sub sun/ neutron star with a core temperature approx.10 7 K has a g 1 -mode period of 371 ms; for this mode were find the electromagnetic damping time to be tau/sub FM/approx.0.3 s, assuming the surface magnetic field strength of the neutron star to be B 0 approx.10 12 gauss. This is considerably less than the corresponding gravitational radiation time tau/sub GR/approx.3 x 10 17 yr. For dipole g-mode oscillations, there is no gravitational radiation, but electromagnetic damping and ohmic dissipation are efficient damping mechanisms. For dipole torsional oscillations, we find that electromagnetic damping again dominates, with tau/sub EM/approx.5 yr. Among the cases we have studied, quadrupole torsional oscillations appear to be dominated by gravitational radiation damping, with tau/sub GR/approx.10 4 yr, as compared with tau/sub EM/approx.2 x 10 7 yr
Single-Particle Dynamics in Electron Storage Rings with Extremely Low Emittance
Energy Technology Data Exchange (ETDEWEB)
Cai, Yunhai; /SLAC
2011-05-31
Electron storage rings are widely used for high luminosity colliders, damping rings in high-energy linear colliders, and synchrotron light sources. They have become essential facilities to study high-energy physics and material and medical sciences. To further increase the luminosity of colliders or the brightness of synchrotron light sources, the beam emittance is being continually pushed downward, recently to the nanometer region. In the next decade, another order of reduction is expected. This requirement of ultra-low emittance presents many design challenges in beam dynamics, including better analysis of maps and improvement of dynamic apertures. To meet these challenges, we have refined transfer maps of common elements in storage rings and developed a new method to compute the resonance driving terms as they are built up along a beamline. The method is successfully applied to a design of PEP-X as a future light source with 100-pm emittance. As a result, we discovered many unexpected cancelations of the fourth-order resonance terms driven by sextupoles within an achromat.
History Data Facility in the SLC control system
International Nuclear Information System (INIS)
Johnson, R.G.; White, G.R.
1991-10-01
Two major enhancements to the SLC History Data Facility are described separately. First the internal design and procedures used for saving and using long term history data. Second the user interface, facilities and application of the History Data Comparisons sub-system, which is used for analyzing and correlating two or more accelerator device histories
Mistry, Divya; Wise, Roger P; Dickerson, Julie A
2017-01-01
Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be
Beam loading in high-energy storage rings
International Nuclear Information System (INIS)
Wilson, P.B.
1974-06-01
The analysis of beam loading in the RF systems of high-energy storage rings (for example, the PEP e/sup /minus//e/sup +/ ring) is complicated by the fact that the time, T/sub b/, between the passage of successive bunches is comparable to the cavity filling time, T/sub b/. In this paper, beam loading expressions are first summarized for the usual case in which T/sub b/ /much lt/ T/sub f/. The theory of phase oscillations in the heavily-beam-loaded case is considered, and the dependence of the synchrotron frequency and damping constant for the oscillations on beam current and cavity tuning is calculated. Expressions for beam loading are then derived which are valid for any value of the ratio T/sub b//T/sub f/. It is shown that, for the proposed PEP e/sup /minus//e/sup +/ ring parameters, the klystron power required is increased by about 3% over that calculated using the standard beam loading expressions. Finally, the analysis is extended to take into account the additional losses associated with the excitation of higher-order cavity modes. A rough numerical estimate is made of the loss enhancement to be expected for PEP RF system. It is concluded that this loss enhancement might be substantial unless appropriate measures are taken in the design and tuning of the accelerating structure
Energy Technology Data Exchange (ETDEWEB)
Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2009-11-20
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae
2014-04-01
Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.
Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.
Dai, Dong-Wei; Lu, Qiong; Wang, Lai-Xing; Zhao, Wen-Yuan; Cao, Yi-Qun; Li, Ya-Nan; Han, Guo-Sheng; Liu, Jian-Min; Yue, Zhi-Jian
2013-10-14
MiR-106a is frequently down-regulated in various types of human cancer. However the underlying mechanism of miR-106a involved in glioma remains elusive. The association of miR-106a with glioma grade and patient survival was analyzed. The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a-mediated cell glycolysis and proliferation. Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. SLC2A3 was identified as a core target of miR-106a in GBM cells. Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. In addition, for each biological process we identified ontology-associated transcripts that significantly correlated with SLC2A3 expression. Finally, the expression of SLC2A3 largely abrogated miR-106a-mediated cell proliferation and glucose uptake in GBM cells. Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM.
An Empirical Method for Particle Damping Design
Directory of Open Access Journals (Sweden)
Zhi Wei Xu
2004-01-01
Full Text Available Particle damping is an effective vibration suppression method. The purpose of this paper is to develop an empirical method for particle damping design based on extensive experiments on three structural objects – steel beam, bond arm and bond head stand. The relationships among several key parameters of structure/particles are obtained. Then the procedures with the use of particle damping are proposed to provide guidelines for practical applications. It is believed that the results presented in this paper would be helpful to effectively implement the particle damping for various structural systems for the purpose of vibration suppression.
Parametric Landau damping of space charge modes
Energy Technology Data Exchange (ETDEWEB)
Macridin, Alexandru [Fermilab; Burov, Alexey [Fermilab; Stern, Eric [Fermilab; Amundson, James [Fermilab; Spentzouris, Panagiotis [Fermilab
2016-09-23
Landau damping is the mechanism of plasma and beam stabilization; it arises through energy transfer from collective modes to the incoherent motion of resonant particles. Normally this resonance requires the resonant particle's frequency to match the collective mode frequency. We have identified an important new damping mechanism, parametric Landau damping, which is driven by the modulation of the mode-particle interaction. This opens new possibilities for stability control through manipulation of both particle and mode-particle coupling spectra. We demonstrate the existence of parametric Landau damping in a simulation of transverse coherent modes of bunched accelerator beams with space charge.
Stochastic orbital migration of small bodies in Saturn's rings
Rein, H.; Papaloizou, J. C. B.
2010-12-01
Many small moonlets that create propeller structures have been found in Saturn's rings by the Cassini spacecraft. We study the dynamical evolution of such 20-50 m sized bodies, which are embedded in Saturn's rings. We estimate the importance of various interaction processes with the ring particles on the moonlet's eccentricity and semi-major axis analytically. For low ring surface densities, the main effects on the evolution of the eccentricity and the semi-major axis are found to be caused by collisions and the gravitational interaction with particles in the vicinity of the moonlet. For high surface densities, the gravitational interaction with self-gravity wakes becomes important. We also perform realistic three-dimensional, collisional N-body simulations with up to a quarter of a million particles. A new set of pseudo shear periodic boundary conditions is used, which reduces the computational costs by an order of magnitude compared to previous studies. Our analytic estimates are confirmed to within a factor of two. On short timescales the evolution is always dominated by stochastic effects caused by collisions and gravitational interaction with self-gravitating ring particles. These result in a random walk of the moonlet's semi-major axis. The eccentricity of the moonlet quickly reaches an equilibrium value owing to collisional damping. The average change in semi-major axis of the moonlet after 100 orbital periods is 10-100m. This translates to an offset in the azimuthal direction of several hundred kilometres. We expect that such a shift is easily observable. Two movies are only available in electronic form at http://www.aanda.org
Response of APS storage ring basemat to ambient vibration
International Nuclear Information System (INIS)
Jendrzejczyk, J.A.; Wambsganss, M.W.; Smith, R.K.
1992-08-01
The storage ring of the Advanced Photon Source (APS) facility at Argonne is very sensitive to vibration. Large vibration amplitudes would result in degraded machine performance. Because the storage ring assembly is supported on the storage ring basemat, the dynamics of the basemat are critical to successful operation. Before construction began, a survey of site ground vibration indicated that the site was acceptable from a vibration standpoint. When construction of the linear accelerator (Linac) floor slab and shielding walls was completed, dynamic-response measurements were conducted. The slab/wall system showed attenuation of soilborne vibrations in the horizontal directions, but an amplification (approximately a factor of 1.5) of vertical vibration at a frequency of 7.7 Hz. Vibration response of the slab/wall system at all other frequencies showed attenuation of soilborne vibrations. Dynamic-response measurements were also conducted on an incomplete section of the storage ring basemat. Although this section was not prototypical, results were similar to those of the Linac floor in the horizontal direction, showing large damping and attenuation of horizontal soilborne vibrations. While the basemat followed the soil vibration in the vertical direction, no large amplification was observed. However, measured vertical amplitudes on the basemat were a function of location, indicating a modal response. A series of vibration response measurements was conducted on a completed section of the storage ring basemat/tunnel adjacent and to the west of the Early Assembly Area (EAA) on May 21, 1992, and is the subject of this report
Process Damping and Cutting Tool Geometry in Machining
Taylor, C. M.; Sims, N. D.; Turner, S.
2011-12-01
Regenerative vibration, or chatter, limits the performance of machining processes. Consequences of chatter include tool wear and poor machined surface finish. Process damping by tool-workpiece contact can reduce chatter effects and improve productivity. Process damping occurs when the flank (also known as the relief face) of the cutting tool makes contact with waves on the workpiece surface, created by chatter motion. Tool edge features can act to increase the damping effect. This paper examines how a tool's edge condition combines with the relief angle to affect process damping. An analytical model of cutting with chatter leads to a two-section curve describing how process damped vibration amplitude changes with surface speed for radiussed tools. The tool edge dominates the process damping effect at the lowest surface speeds, with the flank dominating at higher speeds. A similar curve is then proposed regarding tools with worn edges. Experimental data supports the notion of the two-section curve. A rule of thumb is proposed which could be useful to machine operators, regarding tool wear and process damping. The question is addressed, should a tool of a given geometry, used for a given application, be considered as sharp, radiussed or worn regarding process damping.
Process Damping and Cutting Tool Geometry in Machining
International Nuclear Information System (INIS)
Taylor, C M; Sims, N D; Turner, S
2011-01-01
Regenerative vibration, or chatter, limits the performance of machining processes. Consequences of chatter include tool wear and poor machined surface finish. Process damping by tool-workpiece contact can reduce chatter effects and improve productivity. Process damping occurs when the flank (also known as the relief face) of the cutting tool makes contact with waves on the workpiece surface, created by chatter motion. Tool edge features can act to increase the damping effect. This paper examines how a tool's edge condition combines with the relief angle to affect process damping. An analytical model of cutting with chatter leads to a two-section curve describing how process damped vibration amplitude changes with surface speed for radiussed tools. The tool edge dominates the process damping effect at the lowest surface speeds, with the flank dominating at higher speeds. A similar curve is then proposed regarding tools with worn edges. Experimental data supports the notion of the two-section curve. A rule of thumb is proposed which could be useful to machine operators, regarding tool wear and process damping. The question is addressed, should a tool of a given geometry, used for a given application, be considered as sharp, radiussed or worn regarding process damping.
Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A
2018-02-09
Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Fadlilah, D. R.; Fajar, M. N.; Aini, A. N.; Haqqiqi, R. I.; Wirawan, P. R.; Endarko
2018-04-01
The synthesized carbon from bones of chicken, cow, and fish with the calcination temperature at 450 and 600°C have been successfully fabricated for counter electrode in the Super Low-Cost Solar Cell (SLC-LC) based the structure of Dye-Sensitized Solar Cells (DSSC). The main proposed study was to fabricate SLC-SC and investigate the influence of the synthesized carbon from animal’s bone for counter electrode towards to photovoltaic performance of SLC-SC. X-Ray Diffraction and UV-Vis was used to characterize the phase and the optical properties of TiO2 as photoanode in SLC-SC. Meanwhile, the morphology and particle size distribution of the synthesized carbon in counter electrodes were investigated by Scanning Electron Microscopy (SEM) and Particle Size Analyzer (PSA). The results showed that the TiO2 has anatase phase with the absorption wavelength of 300 to 550 nm. The calcination temperature for synthesizing of carbon could affect morphology and particle size distribution. The increasing temperature gave the effect more dense in morphology and increased the particle size of carbon in the counter electrode. Changes in morphology and particle size of carbon give effect to the performance of the SLC-SC where the increased morphology’s compact and particle size make decreased in the performance of the SLC-SC.
Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus
2008-01-01
Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801
Damping Identification of Bridges Under Nonstationary Ambient Vibration
Directory of Open Access Journals (Sweden)
Sunjoong Kim
2017-12-01
Full Text Available This research focuses on identifying the damping ratio of bridges using nonstationary ambient vibration data. The damping ratios of bridges in service have generally been identified using operational modal analysis (OMA based on a stationary white noise assumption for input signals. However, most bridges are generally subjected to nonstationary excitations while in service, and this violation of the basic assumption can lead to uncertainties in damping identification. To deal with nonstationarity, an amplitude-modulating function was calculated from measured responses to eliminate global trends caused by nonstationary input. A natural excitation technique (NExT-eigensystem realization algorithm (ERA was applied to estimate the damping ratio for a stationarized process. To improve the accuracy of OMA-based damping estimates, a comparative analysis was performed between an extracted stationary process and nonstationary data to assess the effect of eliminating nonstationarity. The mean value and standard deviation of the damping ratio for the first vertical mode decreased after signal stationarization. Keywords: Damping, Operational modal analysis, Traffic-induced vibration, Nonstationary, Signal stationarization, Amplitude-modulating, Bridge, Cable-stayed, Suspension
Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia
2018-01-01
The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412
Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying
2017-04-01
The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.
Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification
Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús
2014-01-01
Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463
Damping-off in forest nurseries
Carl Hartley
1921-01-01
Damping-off is the commonest English name for a symptomatic group of diseases affecting great numbers of plant species of widely separated phylogenetic groups. It is commonly used for any disease which results in the rapid decay of young succulent seedlings or soft cuttings. Young shoots from underground rootstocks may also be damped-off before they break through the...
Darlow, M. S.; Smalley, A. J.
1977-01-01
A test rig designed to measure stiffness and damping of elastomer cartridges under a rotating load excitation is described. The test rig employs rotating unbalance in a rotor which runs to 60,000 RPM as the excitation mechanism. A variable resonant mass is supported on elastomer elements and the dynamic characteristics are determined from measurements of input and output acceleration. Five different cartridges are considered: three of these are buttons cartridges having buttons located in pairs, with 120 between each pair. Two of the cartridges consist of 360 elastomer rings with rectangular cross-sections. Dynamic stiffness and damping are measured for each cartridge and compared with predictions at different frequencies and different strains.
Directory of Open Access Journals (Sweden)
Boaz Nash
2006-03-01
Full Text Available Linear dynamics in a storage ring can be described by the one-turn map matrix. In the case of a resonance where two of the eigenvalues of this matrix are degenerate, a coupling perturbation causes a mixing of the uncoupled eigenvectors. A perturbation formalism is developed to find eigenvalues and eigenvectors of the one-turn map near such a linear resonance. Damping and diffusion due to synchrotron radiation can be obtained by integrating their effects over one turn, and the coupled eigenvectors can be used to find the coupled damping and diffusion coefficients. Expressions for the coupled equilibrium emittances and beam distribution moments are then derived. In addition to the conventional instabilities at the sum, integer, and half-integer resonances, it is found that the coupling can cause an instability through antidamping near a sum resonance even when the symplectic dynamics are stable. As one application of this formalism, the case of linear synchrobetatron coupling is analyzed where the coupling is caused by dispersion in the rf cavity, or by a crab cavity. Explicit closed-form expressions for the sum/difference resonances are given along with the integer/half-integer resonances. The integer and half-integer resonances caused by coupling require particular care. We find an example of this with the case of a crab cavity for the integer resonance of the synchrotron tune. Whether or not there is an instability is determined by the value of the horizontal betatron tune, a unique feature of these coupling-caused integer or half-integer resonances. Finally, the coupled damping and diffusion coefficients along with the equilibrium invariants and projected emittances are plotted as a function of the betatron and synchrotron tunes for an example storage ring based on PEP-II.
Precision electroweak physics with the SLD/SLC: The left-right polarization asymmetry
International Nuclear Information System (INIS)
Rowson, P.C.
1994-12-01
Following a brief review of a commonly used general framework for the analysis of radiative corrections and possible new physics, the recent precision results from the SLD/SLC are discussed and used to test the standard electroweak model. In the 1993 SLD/SLC run, the SLD recorded 50,000 Z events produced by the collision of longitudinally polarized electrons on unpolarized positrons at a center-of-mass energy of 91.26 GeV. The luminosity-weighted average polarization of the SLC electron beam was (63.0 ± 1.1)%. We measure the left-right cross-section asymmetry in Z boson production, A LR , to be 0.1628 ± 0.0071 (stat) ± 0.0028 (syst) which determines the effective weak mixing angle to be sin 2 θ W eff = 0.2292 ± 0.0009 (stat) ± 0.0004 (syst). When averaged with our 1992 result, we obtain sin 2 θ W eff = 0.2294 ± 0. 0010. This result differs from analogous LEP results at the level of about 2.5 σ. The world averages of electroweak data are comfortably in agreement with the standard model
Directory of Open Access Journals (Sweden)
Nabanita Chatterjee
2011-01-01
Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.
Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.
Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David
2014-04-01
Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.
Piping system damping data at higher frequencies
International Nuclear Information System (INIS)
Ware, A.G.
1987-01-01
Research has been performed at the Idaho National Engineering Laboratory (INEL) for the United States Nuclear Regulatory Commission (USNRC) to determine best-estimate damping values for dynamic analyses of nuclear piping systems excited in the 20 to 100 Hz frequency range. Vibrations in this frequency range are typical of fluid-induced transients, for which no formal pipe damping guidelines exist. The available data found in the open literature and the USNRC/INEL nuclear piping damping data bank were reviewed, and a series of tests on a straight 3-in. (76-mm) piping system and a 5-in. (127-mm) system with several bends and elbows were conducted as part of this research program. These two systems were supported with typical nuclear piping supports that could be changed from test to test during the series. The resulting damping values were ≥ those of the Pressure Vessel Research Committee (PVRC) proposal for unisulated piping. Extending the PVRC damping curve from 20 to 100 Hz at 3% of critical damping would give a satisfactory representation of the test data. This position has been endorsed by the PVRC Technical Committee on Piping Systems. 14 refs
Energy Technology Data Exchange (ETDEWEB)
Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others
1995-12-10
The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.