WorldWideScience

Sample records for slc damping rings

  1. Kicker for the SLC electron damping ring

    International Nuclear Information System (INIS)

    Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.

    1987-01-01

    The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see

  2. Status of the SLC damping rings

    International Nuclear Information System (INIS)

    Hutton, A.M.; Davies-White, W.A.; Delahaye, J.P.

    1985-06-01

    Electron beams of full design energy 1.21 GeV and nearly full design intensity 4 x 10 10 particles/pulse (design 5 x 10 10 ) have been extracted from the Stanford Linac and successfully stored in the electron damping ring. Beams of less intensity have been extracted from the ring and reinjected into the Linac. The present intensity limits are not thought to be fundamental. The operating experience with the electron ring and the status of the construction of the positron ring will be discussed. 11 refs., 1 fig., 2 tabs

  3. Bunch length measurements in the SLC damping ring

    International Nuclear Information System (INIS)

    Decker, F.J.; Limberg, T.; Minty, M.; Ross, M.

    1993-05-01

    The synchrotron light of the SLC damping ring was used to measure the bunch length with a streak camera at different times in the damping cycle. There are bunch length oscillations after injection, different equilibrium length during the cycle due to rf manipulations to avoid microwave instability oscillations, and just before extraction there is a longitudinal phase space rotation (bunch muncher) to shorten the bunch length. Measurements under these different conditions are presented and compared with BPM pulse height signals. Calibration and adjustment issues and the connection of the streak camera to the SLC control system are also discussed

  4. Impedance calculations for the improved SLC damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Ng, C.K.

    1993-04-01

    A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs

  5. Bunch lengthening in the SLC [Stanford Linear Collider] damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1990-02-01

    A high level of current dependent bunch lengthening has been observed on the North damping ring of the Stanford Linear Collider (SLC). At currents of 3 x 10 10 this behavior does not appear to degrade the machine's performance significantly. However, at the higher currents that are envisioned for the future one fears that its performance could be greatly degraded due to the phenomenon of bunch lengthening. This was the motivation for the work described in this paper. In this paper we calculate the longitudinal impedance of the damping ring vacuum chamber. More specifically, in this paper we find the response function of the ring to a short Gaussian bunch, which we call the Green function wake. In addition, we try to estimate the relative importance of the different vacuum chamber objects, in order to see how we might reduce the ring impedance. This paper also describes bunch length measurements performed on the North damping ring. We use the Green function wake, discussed above, to compute the bunch lengthening. Then we compare these results with those obtained from the measurements. In addition, we calculate the current dependence of the tune distribution

  6. Design of the SLC damping ring to linac transport lines

    International Nuclear Information System (INIS)

    Fieguth, T.H.; Murray, J.J.

    1983-07-01

    The first and second order optics for the damping ring to linac transport line are designed to preserve the damped transverse emittance while simultaneously compressing the bunch length of the beam to that length required for reinjection into the linac. This design, including provisions for future control of beam polarization, is described

  7. The calculated longitudinal impedance of the SLC [Stanford Linear Collider] damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1988-05-01

    A high level of current dependent bunch lengthening has been observed in the north damping ring of the Stanford Linear Collider (SLC), indicating that the ring's impedance is very inductive. This level of bunch lengthening will limit the performance of the SLC. In order to study the problem of bunch lengthening in the damping ring and the possibility of reducing their inductance we compute, in this report, the longitudinal impedance of the damping ring vacuum chamber. More specifically we find the response function of the ring to a short gaussian bunch. This function will later be used as a driving term in the longitudinal equation of motion. We also identify the important inductive elements of the vacuum chamber and estimate their contribution to the total ring inductance. This information will be useful in assessing the effect of vacuum chamber modifications. 7 refs. , 8 figs., 1 tab

  8. Pulse shape adjustment for the SLC damping ring kickers

    International Nuclear Information System (INIS)

    Mattison, T.; Cassel, R.; Donaldson, A.; Fischer, H.; Gough, D.

    1991-05-01

    The difficulties with damping ring kickers that prevented operation of the SLAC Linear Collider in full multiple bunch mode have been overcome by shaping the current pulse to compensate for imperfections in the magnets. The risetime was improved by a peaking capacitor, with a tunable inductor to provide a locally flat pulse. The pulse was flattened by an adjustable droop inductor. Fine adjustment was provided by pulse forming line tuners driven by stepping motors. Further risetime improvement will be obtained by a saturating ferrite pulse sharpener. 4 refs., 3 figs

  9. An active feedback system to control synchrotron oscillations in the SLC Damping Rings

    International Nuclear Information System (INIS)

    Corredoura, P.L.; Pellegrin, J.L.; Schwarz, H.D.; Sheppard, J.C.

    1989-03-01

    Initially the SLC Damping Rings accomplished Robinson instability damping by operating the RF accelerating cavities slightly detuned. In order to be able to run the cavities tuned and achieve damping for Robinson instability and synchrotron oscillations at injection an active feedback system has been developed. This paper describes the theoretical basis for the feedback system and the development of the hardware. Extensive measurements of the loop response including stored beam were performed. Overall performance of the system is also reported. 3 refs., 6 figs

  10. Bunch lengthening calculations for the SLC [Stanford Linear Collider] damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Ruth, R.D.

    1989-03-01

    The problem of bunch lengthening in electron storage rings has been treated by many people, and there have been many experiments. In the typical experiment, the theory is used to determine the impedance of the ring. What has been lacking thus far, however, is a calculation of bunch lengthening that uses a carefully calculated ring impedance (or wakefield). In this paper we begin by finding the potential well distortion due to some very simple impedance models, in order to illustrate different types of bunch lengthening behavior. We then give a prescription for extending potential well calculations into the turbulent regime once the threshold is known. Then finally, using the wakefield calculated for the SLC damping rings, combined with the measured value of the threshold, we calculate bunch lengthening for the damping rings, and compare the results with the measurements. 9 refs., 6 figs

  11. Simulations of Bunch Precompression at High Currents in the SLC Damping Rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Minty, M.G.; Chao, A.W.

    2011-01-01

    In the Stanford Linear Collider (SLC) each beam, after leaving a damping ring, is compressed in the Ring-to-Linac (RTL) transfer line before entering the linear accelerator. At a bunch population of 4.0 x 10 10 particles, due to the limited energy acceptance of the RTL, approximately 15% of the beam has normally been lost. During the 1996 run, however, to eliminate this loss the bunch was partially precompressed in the damping ring, just before extraction; the beam loss in the RTL was reduced to almost zero. The operation and performance of precompression are presented by Minty et al. (1999). Also given is an analysis which, however, does not include the effects of the longitudinal wakefield on the beam dynamics. In this report we extend that analysis to include these effects.

  12. Ion effects in the SLC electron damping ring under exceptionally poor vacuum conditions

    International Nuclear Information System (INIS)

    Zimmermann, F.; Krejcik, P.; Minty, M.; Pritzkau, D.; Raubenheimer, T.; Ross, M.; Woodley, M.

    1997-10-01

    In 1996, due to a catastrophic kicker chamber failure in the SLC electron damping ring, the ring vacuum system was contamianted for several months. During this time, the vertical emittance of the beam extracted from the ring was increased by a large factor (4--20). The emittance slowly decreased as the vacuum pressure gradually improved. At the same time, an intermittent vertical instability was observed. Both the emittance blow-up and the instability behavior depended strongly on beam current, ring pressure, number of bunches in the ring (1 or 2), duty cycle, store time and betatron tunes. In this report, the authors describe the observations, and compare them with predictions from classical ion-trapping and ion-instability theories

  13. Operating experience with high beam currents and transient beam loading in the SLC damping rings

    International Nuclear Information System (INIS)

    Minty, M.G.; Akre, R.; Krejcik, P.; Siemann, R.H.

    1995-01-01

    During the 1994 SLC run the nominal operating intensity in the damping rings was raised from 3.5 x 10 10 to greater than 4 x 10 10 particles per bunch (ppb). Stricter regulation of rf system parameters was required to maintain stability of the rf system and particle beam. Improvements were made in the feedback loops which control the cavity amplitude and loading angles. Compensation for beam loading was also required to prevent klystron saturation during repetition rate changes. To minimize the effects of transient loading on the rf system, the gain of the direct rf feedback loop and the loading angles were optimized

  14. Calculations of emittance and damping time effects in the SLC damping rings

    International Nuclear Information System (INIS)

    Limberg, T.; Moshammer, H.; Raubenheimer, T.; Spencer, J.; Siemann, R.

    1992-03-01

    In a recent NDR machine experiment the transverse emittance was studied as a function of store time and tune. To explain the observed transverse emittance damping time constants, the magnetic measurement data of the longitudinal field of the bending magnets had to be taken into account. The variation of the transverse emittances with tune due to misalignments and the associated anomalous dispersion is studied as well as the effect of synchrobetatron coupling due to dispersion in the RF cavities

  15. Manufacture of fast-pulsed magnets for the SLC damping rings

    International Nuclear Information System (INIS)

    Cassel, R.; Gross, G.; Harvey, A.; Mattison, T.

    1992-01-01

    A second-generation fast kicker magnet (and its power supply) was designed by Fermilab for the SLC electron damping ring. The requirements were to inject and extract two bunches of electrons, with the following magnetic field specifications: Integral peak magnetic field = 0.021 T-m, Rise/fall time (0-100%) = 56.03 ns maximum, Flat-top duration = 61.62 ns. The flat-top does not imply a plateau, but two time-stable spots of equal magnitude, since the electron bunches are short (20 ps). Many of the early problems with these magnets have been studied intensely during the last two years, and substantial progress has been made. In particular, vacuum potting with room-temperature curing silicone rubber (RTV) has been refined to give reliable high-voltage service up to 18 kV/mm, and life-times of about a year despite stored beam intensities of 3 x 10 10 electrons/bunch at 120 pps

  16. TOSCA calculations and measurements for the SLAC SLC damping ring dipole magnet

    International Nuclear Information System (INIS)

    Early, R.A.; Cobb, J.K.

    1985-01-01

    The SLAC damping ring dipole magnet was originally designed with removable nose pieces at the ends. Recently, a set of magnetic measurements was taken of the vertical component of induction along the center of the magnet for four different pole-end configurations and several current settings. The three dimensional computer code TOSCA, which is currently installed on the National Magnetic Fusion Energy Computer Center's Cray X-MP, was used to computer field values for the four configurations at current settings near saturation. Comparisons were made for magnetic induction as well as effective magnetic lengths for the different configurations

  17. Damping rings for CLIC

    CERN Document Server

    Jowett, John M; Zimmermann, Frank; Owen, H

    2001-01-01

    The Compact Linear Colider (CLIC) is designed to operate at 3 TeV centre-of-mass energy with a total luminosity of 10^35 cm^-2 s^-1. The overall system design leads to extremely demanding requirements on the bunch trains injected into the main libac at frequency of 100 Hz. In particular, the emittances of the intense bunches have to be about an order of magnitude smaller than presently achieved. We describe our approach to finding a damping ring design capable of meeting these requirements. Besides lattice design, emittance and damping rate considerations, a number of scattering and instability effects have to be incorporated into the optimisation of parameters. Among these, intra-bem scattering and the electron cloud effect are two of the most significant.

  18. Energy dependence of the emittance of damping ring beams

    International Nuclear Information System (INIS)

    Stiening, R.

    1985-01-01

    The energy at which the SLC damping rings are operated was chosen to be 1.21 GeV. At the time that that specification was made, the repetition rate of the SLC was expected to be 180 Hz. It is now anticipated that the repetition rate during the initial year of operation of the SLC will be 120 Hz. The following curves which show the output emittance of the damping rings as a function of input emittance and energy suggest that there is a range of energies over which the rings can be operated without changing the SLC luminosity. It should be noted that in the era of polarized beams, the damping ring energy will be fixed at the design value on account of the spin precession required in the LTR and RTL transport lines. The SLC design output emittance of the damping rings is 3 x 10 -5 radian-meters. Because of space charge disruption and quantum emission downstream of the damping rings, much lower values than the design value may not have a large beneficial effect on the luminosity. 3 figures

  19. The electron damping ring for the SLAC Linear Collider

    International Nuclear Information System (INIS)

    Davies-White, W.; Hutton, A.; Harvey, A.

    1987-10-01

    A second damping ring to store and damp two electron bunches for the SLC project was constructed in 1985 and brought into operation early in 1986. Although generally similar to the damping ring (now used for positrons) constructed earlier, there are a number of design improvements and changes. The dipole magnetic field was raised to 2.1 T to improve damping. Sextupole fields were provided by separate permanent magnets, rather than being incorporated in the dipoles. The vacuum chambers, including the beam position monitors, were re-designed for lower longitudinal impedance. A new kicker was developed by Fermilab to handle the two electron bunches. Improvements were made to the dc septum magnet design. Several of the features are described in detail elsewhere. Where possible, the improvements were incorporated in an upgrade of the earlier damping ring

  20. Damping ring designs and issues

    International Nuclear Information System (INIS)

    Wolski, Andrzej; Decking, Winfried

    2003-01-01

    The luminosity performance of a future linear collider (LC) will depend critically on the performance of the damping rings. The design luminosities of the current LC proposals require rings with very short damping times, large acceptance, low equilibrium emittance and high beam intensity. We discuss the design strategies for lattices achieving the goals of dynamical stability, examine the challenges for alignment and coupling correction, and consider a variety of collective effects that threaten to limit beam quality. We put the design goals in context by referring to the experience of operating facilities, and outline the further research and development that is needed

  1. Energy spread in SLC linac with Landau damping

    International Nuclear Information System (INIS)

    Seeman, J.

    1984-01-01

    The possibility of using Landau damping to reduce the growth of the beam size due to transverse wake fields has been known for some time. Recently K. Bane has calculated the effects of Landau damping for the SLC. The energy spread is then slowly removed so that at the end of the linac it has returned to the SLC specification of less than +0.5%. The purpose of the energy spread is to reduce the resonant driving of the tail of the bunch by the head. In this note the expected energy spreads within the beam are tabulated at various positions along the linac for use by those people designing momentum dependent equipment and for those interested in Landau damping

  2. Study for ILC Damping Ring at KEKB

    Energy Technology Data Exchange (ETDEWEB)

    Flanagan, J.W.; Fukuma, H.; Kanazawa, K.I.; Koiso, H.; Masuzawa, M.; Ohmi, Kazuhito; Ohnishi, Y.; Oide, Katsunobu; Suetsugu, Y.; Tobiyama, M.; /KEK, Tsukuba; Pivi, M.; /SLAC

    2011-11-04

    ILC damping ring consists of very low emittance electron and positron storage rings. It is necessary for ILC damping ring to study electron cloud effects in such low emittance positron ring. We propose a low emittance operation of KEKB to study the effects.

  3. Beam dynamic issues in TESLA damping ring

    International Nuclear Information System (INIS)

    Shiltsev, V.

    1996-05-01

    In this paper we study general requirements on impedances of the linear collider TESLA damping ring design. Quantitative consideration is performed for 17-km long ''dog-bone'' ring. Beam dynamics in alternative options of 6.3 and 2.3-km long damping rings is briefly discussed. 5 refs., 2 tabs

  4. Lifetime measurement of ATF damping ring

    International Nuclear Information System (INIS)

    Okugi, T.; Hayano, H.; Kubo, K.; Naito, T.; Terunuma, N.; Urakawa, J.; Zimmermann, F.

    1998-06-01

    The purpose of the ATF damping ring is the development of technologies for producing a low emittance beam required in future linear colliders such as JLC. The lifetime of the damping ring is very short (typically a few minutes). It is limited by elastic beam-gas scattering along with a small dynamic aperture, and by single intra-beam scattering (Touschek effect). The Touschek lifetime strongly depends upon the charge density of the beam, especially, the size of the vertical emittance. In this paper, the authors report the results of beam lifetime measurements in the ATF damping ring and the estimation of the vertical emittance from these measurements

  5. Electron beam depolarization in a damping ring

    International Nuclear Information System (INIS)

    Minty, M.

    1993-04-01

    Depolarization of a polarized electron beam injected into a damping ring is analyzed by extending calculations conventionally applied to proton synchrotrons. Synchrotron radiation in an electron ring gives rise to both polarizing and depolarizing effects. In a damping ring, the beam is stored for a time much less than the time for self polarization. Spin flip radiation may therefore be neglected. Synchrotron radiation without spin flips, however, must be considered as the resonance strength depends on the vertical betatron oscillation amplitude which changes as the electron beam is radiation damped. An expression for the beam polarization at extraction is derived which takes into account radiation damping. The results are applied to the electron ring at the Stanford Linear Collider and are compared with numerical matrix formalisms

  6. Damping rates of the SRRC storage ring

    International Nuclear Information System (INIS)

    Hsu, K.T.; Kuo, C.C.; Lau, W.K.; Weng, W.T.

    1995-01-01

    The SRRC storage ring is a low emittance synchrotron radiation machine with nominal operation energy 1.3 GeV. The design damping time due to synchrotron radiation is 10.7, 14.4, 8.7 ms for the horizontal, vertical and longitudinal plane, respectively. The authors measured the real machine damping time as a function of bunch current, chromaticity, etc. To damp the transverse beam instability, especially in the vertical plane, they need to increase chromaticity to large positive value. The damping rates are much larger than the design values. Landau damping contribution in the longitudinal plane is quite large, especially in the multibunch mode. The estimated synchrotron tune spread from the Landau damping is in agreement with the measured coherent longitudinal coupled bunch oscillation amplitude

  7. Coherent Synchrotron Radiation effect in damping rings

    International Nuclear Information System (INIS)

    Raubenheimer, T

    2004-01-01

    Coherent Synchrotron Radiation (CSR) can play an important role by not only increasing the energy spread and emittance of a beam, but also leading to a potential instability. Previous studies of the CSR induced longitudinal instability were carried out for the CSR impedance due to dipole magnets. In this paper, the instability due to the CSR impedance from a wiggler is studied assuming a large wiggler parameter K. The primary consideration is a low frequency microwave-like instability in the damping rings of several linear collider projects. The threshold is determined by the instability with the longest possible wavelength

  8. Small horizontal emittance in the TESLA damping ring

    International Nuclear Information System (INIS)

    Decking, W.

    2001-01-01

    The present TESLA damping ring is designed for a normalized horizontal emittance of 8x10 -6 m. γ-γ collisions at the TESLA linear collider will benefit from a further decrease of the horizontal emittance. This paper reviews the processes which limit the horizontal emittance in the damping ring. Preliminary estimates on the smallest horizontal emittance for the present TESLA damping ring design as well as an ultimate limit of the emittance reachable with the TESLA damping ring concept will be given

  9. Coherent Instabilities of ILC Damping Ring

    Energy Technology Data Exchange (ETDEWEB)

    Heifets, S.; Stupakov, G.; Bane, K.; /SLAC

    2006-09-27

    The paper presents the first attempt to estimates the ILC damping ring impedance and compare thresholds of the classical instabilities for several designs initially proposed for the DR. The work was carried out in the spring of 2006. Since then the choice of the DR is narrowed. Nevertheless, the analysis described may be useful for the next iterations of the beam stability. Overall, the conventional instabilities will have little impact on the ring performance provided the careful design of the ring minimizes the impedance below acceptable level indicated above. The only exception is the transverse CB instability. The longitudinal CB is less demanding. However, even the transverse CB instability would have threshold current above nominal provided the aperture in the wigglers is increased from 8 mm to 16 mm. The microwave instability needs more studies. Nevertheless, we should remember that the ILC DR is different from existing high-current machines at least in two respects: absence of the beam-beam tune spread stabilizing beams in colliders, and unusual strict requirements for low emittance. That may cause new problems such as bunch emittance dilution due to high-frequency wakes (BPMs, grooves), etc. Even if such a possibility exists, it probably universal for all machines and ought be addressed in the design of vacuum components rather than have effect on the choice of the machine design.

  10. Impedance effects in the CLIC damping rings

    CERN Document Server

    Koukovini-Platia, E; Mounet, N; Rumolo, G; Salvant, B

    2011-01-01

    Due to the unprecedented brilliance of the beams, the performance of the Compact Linear Collider (CLIC) damping rings (DR) is affected by collective effects. Single bunch instability thresholds based on a broad-band resonator model and the associated coherent tune shifts have been evaluated with the HEADTAIL code. Simulations performed for positive and negative values of chromaticity showed that higher order bunch modes can be potentially dangerous for the beam stability. This study also includes the effects of high frequency resistive wall impedance due to different coatings applied on the chambers of the wigglers for e-cloud mitigation and/or ultra-low vacuum pressure. The impact of the resistive wall wake fields on the transverse impedance budget is finally discussed.

  11. Dynamic apeerture in damping rings with realistic wigglers

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Yunhai; /SLAC

    2005-05-04

    The International Linear Collider based on superconducting RF cavities requires the damping rings to have extremely small equilibrium emittance, huge circumference, fast damping time, and large acceptance. To achieve all of these requirements is a very challenging task. In this paper, we will present a systematic approach to designing the damping rings using simple cells and non-interlaced sextupoles. The designs of the damping rings with various circumferences and shapes, including dogbone, are presented. To model realistic wigglers, we have developed a new hybrid symplectic integrator for faster and accurate evaluation of dynamic aperture of the lattices.

  12. R and D status of the ATF damping ring

    International Nuclear Information System (INIS)

    Urakawa, Junji

    1994-01-01

    The KEK accelerator test facility (ATF) is under construction. This paper gives the status of the design studies, the various R and D works and the construction for the damping ring of the ATF. (author)

  13. Damping Ring R&D at CESR-TA

    Energy Technology Data Exchange (ETDEWEB)

    Rubin, David L. [Cornell Univ., Ithaca, NY (United States). Dept. of Physics

    2015-01-23

    Accelerators that collide high energy beams of matter and anti-matter are essential tools for the investigation of the fundamental constituents of matter, and the search for new forms of matter and energy. A “Linear Collider” is a machine that would bring high energy and very compact bunches of electrons and positrons (anti-electrons) into head-on collision. Such a machine would produce (among many other things) the newly discovered Higgs particle, enabling a detailed study of its properties. Among the most critical and challenging components of a linear collider are the damping rings that produce the very compact and intense beams of electrons and positrons that are to be accelerated into collision. Hot dilute particle beams are injected into the damping rings, where they are compressed and cooled. The size of the positron beam must be reduced more than a thousand fold in the damping ring, and this compression must be accomplished in a fraction of a second. The cold compact beams are then extracted from the damping ring and accelerated into collision at high energy. The proposed International Linear Collider (ILC), would require damping rings that routinely produce such cold, compact and intense beams. The goal of the Cornell study was a credible design for the damping rings for the ILC. Among the technical challenges of the damping rings; the development of instrumentation that can measure the properties of the very small beams in a very narrow window of time, and mitigation of the forces that can destabilize the beams and prevent adequate cooling, or worse lead to beam loss. One of the most pernicious destabilizing forces is due to the formation of clouds of electrons in the beam pipe. The electron cloud effect is a phenomenon in particle accelerators in which a high density of low energy electrons, build up inside the vacuum chamber. At the outset of the study, it was anticipated that electron cloud effects would limit the intensity of the positron ring

  14. Overview of collective effects in the NLC main damping rings

    International Nuclear Information System (INIS)

    Wolski, A.; Santis, S. de

    2002-01-01

    The present design for the NLC Main Damping Rings (MDRs) meets the specifications for acceptance and extracted emittance, in the limit of zero current. However, the relatively large bunch charge and moderate energy mean that a variety of collective effects can impact the beam dynamics, leading to loss of stability or increase of equilibrium emittance. These effects include intrabeam scattering, impedance from numerous sources, fast ion instability, and (in the positron ring) electron cloud. In this note, we survey the expected impact on damping ring performance from each of a number of collective effects, and discuss the priorities for future studies in this area

  15. Fast and reliable kicker magnets for the SLC damping rings

    International Nuclear Information System (INIS)

    Mattison, T.S.; Cassel, R.L.; Donaldson, A.R.; Gross, G.

    1995-01-01

    The design, construction, and operation of a kicker magnet with superior electromagnetic performance and greatly improved radiation tolerance is described. A short flux return of high mu ferrite improves the field strength and linearity with current, and novel metallic field-confining structures minimize the inductance. An 8-cell structure with capacitance integrated into each cell makes the magnet a nearly perfect transmission line. The capacitor dielectric is 1 cm thick alumina-loaded epoxy, processed to eliminate air voids, and cast in a multiple step procedure developed to circumvent epoxy shrinkage. The magnet operates with pulses of up to 40 kV and 3.2 kA at 120 Hz, with magnet transit times of less than 35 nsec and field rise and fall times of less than 60 nsec

  16. Longitudinal beam instability due to the ring impedance at KEK's accelerator test facility damping ring

    International Nuclear Information System (INIS)

    Kim, Eun-San

    2003-01-01

    This paper shows the results of a numerical study of the impedance in the Accelerator Test Facility damping ring. The longitudinal impedance in the damping ring is shown to be inductive. It is shown that the total impedance |Z || /n| is 0.23 Ω and the inductance is L = 14 nH. In the extremely low emittance beam of the damping ring, bunch lengthening is caused by both the effects of potential-well distortion and intra-beam scattering. In this paper, the bunch-lengthening due to the ring impedance is numerically investigated, and the result shows qualitative agreement with the result of an analysis performed using the bunch-length measurement. With the calculated longitudinal impedance, the instability threshold in the damping ring is estimated to be a bunch population of 3.3 x 10 10 by using both a Vlasov equation approach and a multi-particle tracking method.

  17. Recommendation for the Feasibility of more Compact LC Damping Rings

    CERN Document Server

    Pivi, M.T.F.; Demma, T.; Guiducci, S.; Suetsugu, Y.; Shibata, K.; Ohmi, K.; Dugan, G.; Palmer, M.; Crittenden, J.A.; Harkay, K.; Boon, L.; Furman, M.A.; Venturini, M.; Celata, C.; Malyshev, O.B.; Papaphilippou, I.

    2010-01-01

    As part of the international Linear Collider (ILC) collaboration, we have compared the electron cloud (EC) effect for different Damping Ring (DR) designs respectively with 6.4 km and 3.2 km circumference and investigated the feasibility of the shorter damping ring with respect to the electron cloud build-up and related beam instabilities. The studies for a 3.2 km ring were carried out with beam parameters of the ILC Low Power option. A reduced damping ring circumference has been proposed for the new ILC baseline design SB2009 and would allow considerable reduction of the number of components, wiggler magnets and costs. We discuss the impact of the proposed operation of the ILC at high repetition rate 10 Hz and address the necessary modifications for the DRs. We also briefly discuss the plans for future studies including the luminosity upgrade option with shorter bunch spacing, the evaluation of mitigation techniques and the integration of the CesrTA results into the Damping Ring design

  18. Recommendation for the Feasibility of more Compact LC Damping Rings

    International Nuclear Information System (INIS)

    Pivi, M.T.F.; Wang, L.; Demma, T.; Guiducci, S.; Suetsugu, Y.; Shibata, K.; Ohmi, K.; Dugan, G.; Palmer, M.; Crittenden, J.A.; Harkay, K.; Boon, L.; Furman, M.A.; Venturini, M.; Celata, C.; Malyshev, O.B.; Papaphilippou, I.

    2010-01-01

    As part of the international Linear Collider (ILC) collaboration, we have compared the electron cloud (EC) effect for different Damping Ring (DR) designs respectively with 6.4 km and 3.2 km circumference and investigated the feasibility of the shorter damping ring with respect to the electron cloud build-up and related beam instabilities. The studies for a 3.2 km ring were carried out with beam parameters of the ILC Low Power option. A reduced damping ring circumference has been proposed for the new ILC baseline design SB2009 (1) and would allow considerable reduction of the number of components, wiggler magnets and costs. We discuss the impact of the proposed operation of the ILC at high repetition rate 10 Hz and address the necessary modifications for the DRs. We also briefly discuss the plans for future studies including the luminosity upgrade option with shorter bunch spacing, the evaluation of mitigation techniques and the integration of the CesrTA results into the Damping Ring design.

  19. Damping of Resonantly Forced Density Waves in Dense Planetary Rings

    Science.gov (United States)

    Lehmann, Marius; Schmidt, Jürgen; Salo, Heikki

    2016-10-01

    We address the stability of resonantly forced density waves in dense planetary rings.Already by Goldreich and Tremaine (1978) it has been argued that density waves might be unstable, depending on the relationship between the ring's viscosity and the surface mass density. In the recent paper (Schmidt et al. 2016) we have pointed out that when - within a fluid description of the ring dynamics - the criterion for viscous overstability is satisfied, forced spiral density waves become unstable as well. In this case, linear theory fails to describe the damping.We apply the multiple scale formalism to derive a weakly nonlinear damping relation from a hydrodynamical model.This relation describes the resonant excitation and nonlinear viscous damping of spiral density waves in a vertically integrated fluid disk with density dependent transport coefficients. The model consistently predicts linear instability of density waves in a ring region where the conditions for viscous overstability are met. In this case, sufficiently far away from the Lindblad resonance, the surface mass density perturbation is predicted to saturate to a constant value due to nonlinear viscous damping. In general the model wave damping lengths depend on a set of input parameters, such as the distance to the threshold for viscous overstability and the ground state surface mass density.Our new model compares reasonably well with the streamline model for nonlinear density waves of Borderies et al. 1986.Deviations become substantial in the highly nonlinear regime, corresponding to strong satellite forcing.Nevertheless, we generally observe good or at least qualitative agreement between the wave amplitude profiles of both models. The streamline approach is superior at matching the total wave profile of waves observed in Saturn's rings, while our new damping relation is a comparably handy tool to gain insight in the evolution of the wave amplitude with distance from resonance, and the different regimes of

  20. Injection and Extraction Lines for the ILC Damping Rings

    International Nuclear Information System (INIS)

    Reichel, Ina

    2007-01-01

    The current design for the injection and extraction lines into and out of the ILC Damping Rings is presented as well as the design for the abort line. Due to changes of the geometric boundary conditions by other subsystems of the ILC, a modular approach has been used to be able to respond to recurring layout changes while reusing previously designed parts

  1. Sensitivity Analysis for the CLIC Damping Ring Inductive Adder

    CERN Document Server

    Holma, Janne

    2012-01-01

    The CLIC study is exploring the scheme for an electron-positron collider with high luminosity and a nominal centre-of-mass energy of 3 TeV. The CLIC pre-damping rings and damping rings will produce, through synchrotron radiation, ultra-low emittance beam with high bunch charge, necessary for the luminosity performance of the collider. To limit the beam emittance blow-up due to oscillations, the pulse generators for the damping ring kickers must provide extremely flat, high-voltage pulses. The specifications for the extraction kickers of the CLIC damping rings are particularly demanding: the flattop of the output pulse must be 160 ns duration, 12.5 kV and 250 A, with a combined ripple and droop of not more than ±0.02 %. An inductive adder allows the use of different modulation techniques and is therefore a very promising approach to meeting the specifications. PSpice has been utilised to carry out a sensitivity analysis of the predicted output pulse to the value of both individual and groups of circuit compon...

  2. Measurement of Resonance driving terms in the ATF Damping Ring

    CERN Document Server

    Tomás, R; Kuroda, S; Naito, T; Okugi, T; Urakawa, J; Zimmermann, F

    2008-01-01

    The measurement of resonance driving terms in the Damping Ring of the Accelerator Test Facility in KEK could help finding possible machine imperfections and even to optimize single particle stability through the minimization of non-linearities. The first experimental attempts of this enterprise are reported in this note.

  3. The short circumference damping ring design for the ILC

    CERN Document Server

    Korostelev, Maxim S; Kuriki, Masao; Kuroda, Shigeru; Naito, Takashi; Ross, Marc; Urakawa, Junji; Zimmermann, Frank

    2005-01-01

    The ILC damping ring tentative design is driven by the operational scenario of the main linac, the beam-dynamics demand of producing a stable and high-quality beam, the injection/extraction scheme and the kicker performance. In this paper, a short circumference damping ring design based on TME cells is described. The ring accommodates injection kickers which provide a flat top of 280 nsec and a 60 nsec rise and fall time and very fast strip-line kickers for beam extraction with a 2 nsec rise and fall time for 3-MHz operation. The potential impact of collective effects and the possible degradation of the dynamic aperture by nonlinear-wiggler fields are estimated.

  4. Superconducting wiggler magnets for beam-emittance damping rings

    CERN Document Server

    Schoerling, Daniel

    2012-01-01

    Ultra-low emittance beams with a high bunch charge are necessary for the luminosity performance of linear electron-positron colliders, such as the Compact Linear Collider (CLIC). An effective way to create ultra-low emittance beams with a high bunch charge is to use damping rings, or storage rings equipped with strong damping wiggler magnets. The remanent field of the permanent magnet materials and the ohmic losses in normal conductors limit the economically achievable pole field in accelerator magnets operated at around room temperature to below the magnetic saturation induction, which is 2.15 T for iron. In wiggler magnets, the pole field in the center of the gap is reduced further like the hyperbolic cosine of the ratio of the gap size and the period length multiplied by pi. Moreover, damping wiggler magnets require relatively large gaps because they have to accept the un-damped beam and to generate, at a small period length, a large magnetic flux density amplitude to effectively damp the beam emittance....

  5. Design for a practical, low-emittance damping ring

    International Nuclear Information System (INIS)

    Krejcik, P.

    1988-01-01

    The luminosity requirements for future high-energy linear colliders calls for very low emittances in the two beams. These low emittances can be achieved with damping rings, but, in order to reach the design goal of a factor 10 improvement over present day machines, great care must be taken in their design. This paper emphasizes the need to address simultaneously all of the factors which limit the operational emittance in the ring. Particularly since in standard designs there is a conflict between different design parameters which makes it difficult to extrapolate such designs to very low emittances. The approach chosen here is to resolve such conflicts by separating their design solutions. Wigglers are used predominantly in zero-dispersion regions to achieve the desired damping rate, whereas in the arcs high dispersion insertions are made in regions of zero curvature to allow for easier chromaticity control

  6. Intrabeam Scattering in the NLC Main Damping Rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej

    2006-01-01

    We use Bane's approximation to the Bjorken-Mtingwa theory of intrabeam scattering to calculate the emittance growth as a function of bunch charge in the KEK ATF. We find that our results are consistent with the experimental data. We then calculate the emittance growth in the NLC Main Damping Rings using the same formulae; we allow for some uncertainty in the ATF data by using two different values for the Coulomb log factor in the formulae for the emittance growth rates. We find that despite the IBS emittance growth, it should still be possible to achieve the specified transverse and longitudinal emittances in the NLC Main Damping Rings at the specified bunch charge

  7. Tolerances for the vertical emittance in damping rings

    International Nuclear Information System (INIS)

    Raubenheimer, T.O.

    1991-11-01

    Future damping rings for linear colliders will need to have very small vertical emittances. In the limit of low beam current, the vertical emittance is primarily determined by the vertical dispersion and the betatron coupling. In this paper, the contributions to these effects from random misalignments are calculated and tolerances are derived to limit the vertical emittance with a 95% confidence level. 10 refs., 5 figs

  8. Progress on low emittance tuning for the CLIC Damping Rings

    CERN Document Server

    Alabau-Gonzalvo, J; Papaphilippou, Y

    2014-01-01

    In the frame of the CLIC main Damping Ring a study on the sensitivity of the lattice to different sources of misalignment is presented. The minimum equilibrium emittance is simulated and analytically estimated under dipole and quadrupole rolls, and quadrupole and sextupole vertical offsets. The result of this study establishes alignment tolerances to preserve the vertical emittance below the design value (1 pmrad). Non-linear dynamics studies have been done to determine the dynamic aperture in the presence of misalignments.

  9. Optics design of Intrabeam Scattering dominated damping rings

    CERN Document Server

    Antoniou, Fanouria; Papaphilippou, Ioannis

    A e+/e- linear collider, the Compact Linear Collider (CLIC) is under design at CERN, aiming to explore the terascale particle physics regime. The collider has been optimized at 3 TeV center of mass energy and targets a luminosity of 1034 cm-2 s-1. In order to achieve this high luminosity, high intensity bunches with ultra low emittances, in all three planes, are required. The generation of ultra low emittance is achieved in the Damping Rings (DR) complex of the collider. The large input beam emittances, especially the ones coming from the positron source, and the requirement of ultra low emittance production in a fast repetition time of 20 ms, imply that the beam damping is done in two stages. Thus, a main-damping ring (DR) and a predamping ring (PDR) are needed, for each particle species. The high bunch brightness gives rise to several collective effects, with Intra-beam scattering (IBS) being the main limitation to the ultra-low emittance. This thesis elaborates the lattice design and non-linear optimizatio...

  10. Configuration Studies and Recommendations for the ILC Damping Rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej; Gao, Jie; Guiducci, Susanna

    2006-01-01

    We describe the results of studies comparing different options for the baseline configuration of the ILC damping rings. The principal configuration decisions apply to the circumference, beam energy, lattice type, and technology options for key components, including the injection/extraction kickers and the damping wigglers. To arrive at our recommended configuration, we performed detailed studies of a range of lattices representing a variety of different configuration options; these lattices are described in Chapter 2. The results of the various studies are reported in chapters covering issues of beam dynamics, technical subsystems, costs, and commissioning, reliability and upgrade ability. Our detailed recommendations for the baseline configuration are given in Chapter 7, where we also outline further research and development that is needed before a machine using our recommended configuration can be built and operated successfully. In the same chapter, we suggest possible alternatives to the baseline configuration

  11. Resistive Wall Instability in the NLC Main Damping Rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej

    2004-01-01

    We study transverse coupled-bunch instabilities driven by the resistive-wall impedance in the NLC Main Damping Rings. We compare the growth rates of the different modes predicted by a simple theory using a simplified lattice model with the results of a detailed simulation that includes variation of the beta functions and the actual fill structure of the machine. We find that the results of the analytical calculations are in reasonable agreement with the simulations. We include a simple model of a bunch-by-bunch feedback system in the simulation to show that the instabilities can be damped by a feedback system having parameters that are realistic, and possibly conservative. The noise level on the feedback system pick-up must be low, to avoid driving random bunch-to-bunch jitter above the specified limit of 10 percent of the vertical beam size

  12. Characterization of the International Linear Collider damping ring optics

    Science.gov (United States)

    Shanks, J.; Rubin, D. L.; Sagan, D.

    2014-10-01

    A method is presented for characterizing the emittance dilution and dynamic aperture for an arbitrary closed lattice that includes guide field magnet errors, multipole errors and misalignments. This method, developed and tested at the Cornell Electron Storage Ring Test Accelerator (CesrTA), has been applied to the damping ring lattice for the International Linear Collider (ILC). The effectiveness of beam based emittance tuning is limited by beam position monitor (BPM) measurement errors, number of corrector magnets and their placement, and correction algorithm. The specifications for damping ring magnet alignment, multipole errors, number of BPMs, and precision in BPM measurements are shown to be consistent with the required emittances and dynamic aperture. The methodology is then used to determine the minimum number of position monitors that is required to achieve the emittance targets, and how that minimum depends on the location of the BPMs. Similarly, the maximum tolerable multipole errors are evaluated. Finally, the robustness of each BPM configuration with respect to random failures is explored.

  13. High resolution upgrade of the ATF damping ring BPM system

    International Nuclear Information System (INIS)

    Terunuma, N.; Urakawa, J.; Frisch, J.; May, J.; McCormick, D.; Nelson, J.; Seryi, A.; Smith, T.; Woodley, M.; Briegel, C.; Dysert, R.

    2008-01-01

    A beam position monitor (BPM) upgrade at the KEK Accelerator Test Facility (ATF) damping ring has been accomplished in its first stage, carried out by a KEK/FNAL/SLAC collaboration under the umbrella of the global ILC R and D effort. The upgrade consists of a high resolution, high reproducibility read-out system, based on analog and digital downconversion techniques, digital signal processing, and also tests a new automatic gain error correction schema. The technical concept and realization, as well as preliminary results of beam studies are presented

  14. Conceptual Design of ILC Damping Ring Wiggler Straight Vacuum System

    International Nuclear Information System (INIS)

    Marks, S.; Kennedy, K.; Plate, D.; Schlueter, R.D.; Zisman, M.

    2007-01-01

    The positron and electron damping rings for the International Linear Collider will contain long straight sections consisting of twenty wiggler/quadrupole pairs. The wigglers will be based upon the CESR superconducting design. There are a number of challenges associated with the design of the wiggler straight vacuum system, in particular, the absorption of photon power generated by the wigglers. This paper will present the overall conceptual design of the wiggler straight vacuum system developed for the ILC Reference Design Report. Particular emphasis will be placed on photon power load calculations and the absorber design

  15. SLC kicker magnet limitations

    International Nuclear Information System (INIS)

    Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.

    1991-01-01

    The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance

  16. Preliminary Design of an Inductive Adder for CLIC Damping Rings

    CERN Document Server

    Holma, J

    2011-01-01

    The Compact Linear Collider (CLIC) study is exploring the scheme for an electron-positron collider with high luminosity and a nominal centre-of-mass energy of 3 TeV. The CLIC damping rings will produce ultra-low emittance beam, with high bunch charge, necessary for the luminosity performance of the collider. To limit the beam emittance blow-up due to oscillations, the pulse power modulators for the damping rings kickers must provide extremely flat, high-voltage, pulses: specifications call for a 160 ns duration flattop of 12.5 kV, 250 A, with a combined ripple and droop of not more than ±0.02 %. A solid-state modulator, the inductive adder, is a very promising approach to meeting the demanding specifications; this topology allows the use of both digital and analogue modulation. To effectively use modulation techniques to achieve such low ripple and droop requires an in-depth knowledge of the behaviour of the solid-state switching components and their gate drivers, as well as a good understanding of the overa...

  17. Pulse Power Modulator development for the CLIC Damping Ring Kickers

    CERN Document Server

    Holma, Janne

    2012-01-01

    The Compact Linear Collider (CLIC) study is exploring the scheme for an electron-positron collider with high luminosity (10-34 – 10-35 cm-2s-1) and a nominal centre-of-mass energy of 3 TeV: CLIC would complement LHC physics in the multi-TeV range. The CLIC design relies on Pre-Damping Rings (PDR) and Damping Rings (DR) to achieve the very low emittance, through synchrotron radiation, needed for the luminosity requirements of CLIC. To limit the beam emittance blow-up due to oscillations, the pulse power modulators for the DR kickers must provide extremely flat, high-voltage pulses: the 2 GHz specification called for a 160 ns duration flat-top of 12.5 kV, 250 A, with a combined ripple and droop of not more than ±0.02 %. In order to meet these demanding specifications, a combination of broadband impedance matching, optimized electrical circuit layout and advanced control techniques is required. A solid-state modulator, the inductive adder, is the most promising approach to meeting the demanding specifications...

  18. Proceedings of the SLAC/KEK linear collider workshop on damping ring

    International Nuclear Information System (INIS)

    Urakawa, J.; Yoshioka, M.

    1992-07-01

    Since the SLAC/KEK joint meeting was first held at SLAC in March 1987, we have had such a meeting annually with the present one the 6th. This meeting is planned to discuss the damping ring issue in particular. We have ever stressed the importance of study of damping rings and considered construction of a test damping ring as key issue for the ATF project, since we started construction of the ATF in 1987. In 1991 we had large-scale reconstruction of a building to make a shielded area where a 1.54 GeV injector linac for the ring is to be installed. (J.P.N.)

  19. Proceedings of the Workshop on the SLAC Damping Rings in the 21st Century (DR2000)

    CERN Document Server

    Nixon, R

    1998-01-01

    The purpose of the Workshop is to assess the status and needs of the Damping Rings for the era of PEP-II. The goal is to have the Rings perform to produce the specified beam parameters with an insignificant amount of downtime. We want to achieve this status by improving the Rings where necessary, not by increasing the maintenance effort. The things that we can act upon in the immediate future are largely engineering issues to improve the integrated availability of the damping rings.

  20. Proceedings of the Workshop on the SLAC Damping Rings in the 21st Century (DR2000)

    International Nuclear Information System (INIS)

    Nixon, Robbin

    1998-01-01

    The purpose of the Workshop is to assess the status and needs of the Damping Rings for the era of PEP-II. The goal is to have the Rings perform to produce the specified beam parameters with an insignificant amount of downtime. We want to achieve this status by improving the Rings where necessary, not by increasing the maintenance effort. The things that we can act upon in the immediate future are largely engineering issues to improve the integrated availability of the damping rings

  1. Electron Cloud Build Up and Instability in the CLIC Damping Rings

    CERN Document Server

    Rumolo, G; Papaphilippou, Y

    2008-01-01

    Electron cloud can be formed in the CLIC positron damping ring and cause intolerable tune shift and beam instability. Build up simulations with the Faktor2 code, developed at CERN, have been done to predict the cloud formation in the arcs and wigglers of the damping rings. HEADTAIL simulations have been used to study the effect of this electron cloud on the beam and assess the thresholds above which the electron cloud instability would set in.

  2. Parameter scan for the CLIC Damping rings under the infleunce of intrabeam scattering

    OpenAIRE

    Antoniou, F; Martini, M; Papaphilippou, Y; Vivoli, A

    2010-01-01

    Due to the high bunch density, the output emittances of the CLIC Damping Rings (DR) are strongly dominated by the effect of Intrabeam Scattering (IBS). In an attempt to optimize the ring design, the bench-marking of the multiparticle tracking code SIRE with the classical IBS formalisms and approximations is first considered. The scaling of the steady state emittances and IBS growth rates is also studied, with respect to several ring parameters including energy, bunch charge and wiggler charac...

  3. Parameter scan for the CLIC Damping rings under the infleunce of intrabeam scattering

    CERN Document Server

    Antoniou, F; Papaphilippou, Y; Vivoli, A

    2010-01-01

    Due to the high bunch density, the output emittances of the CLIC Damping Rings (DR) are strongly dominated by the effect of Intrabeam Scattering (IBS). In an attempt to optimize the ring design, the bench-marking of the multiparticle tracking code SIRE with the classical IBS formalisms and approximations is first considered. The scaling of the steady state emittances and IBS growth rates is also studied, with respect to several ring parameters including energy, bunch charge and wiggler characteristics.

  4. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  5. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  6. A Weakly Nonlinear Model for the Damping of Resonantly Forced Density Waves in Dense Planetary Rings

    Science.gov (United States)

    Lehmann, Marius; Schmidt, Jürgen; Salo, Heikki

    2016-10-01

    In this paper, we address the stability of resonantly forced density waves in dense planetary rings. Goldreich & Tremaine have already argued that density waves might be unstable, depending on the relationship between the ring’s viscosity and the surface mass density. In the recent paper Schmidt et al., we have pointed out that when—within a fluid description of the ring dynamics—the criterion for viscous overstability is satisfied, forced spiral density waves become unstable as well. In this case, linear theory fails to describe the damping, but nonlinearity of the underlying equations guarantees a finite amplitude and eventually a damping of the wave. We apply the multiple scale formalism to derive a weakly nonlinear damping relation from a hydrodynamical model. This relation describes the resonant excitation and nonlinear viscous damping of spiral density waves in a vertically integrated fluid disk with density dependent transport coefficients. The model consistently predicts density waves to be (linearly) unstable in a ring region where the conditions for viscous overstability are met. Sufficiently far away from the Lindblad resonance, the surface mass density perturbation is predicted to saturate to a constant value due to nonlinear viscous damping. The wave’s damping lengths of the model depend on certain input parameters, such as the distance to the threshold for viscous overstability in parameter space and the ground state surface mass density.

  7. Charged-particle incoherent-motion damping in storage rings by means of dissipative elements

    International Nuclear Information System (INIS)

    Derbenev, Ya.S.; Khejfets, S.A.

    1979-01-01

    In consecutive order a possibility of damping of beam incoherent oscillations in a storage ring was studied by means of an external dissipative system in a sufficient common case. It is shown, that a useful effect, as for the case of electron cooling, is one-particle effect of particle oscillations damping due to nonconservatism of its interaction with an external system. Each other mutual influence through the external system becomes significant with increasing beam density and results in the limitation to achievable damping decrements

  8. High frequency electromagnetic characterization of NEG properties for the CLIC damping rings

    CERN Document Server

    Koukovini-Platia, E; Zannini, C

    2014-01-01

    Coating materials will be used in the CLIC damping rings (DR) to suppress two-stream effects. In particular, NEG coating is necessary to suppress fast beam ion instabilities in the electron damping ring (EDR). The electromagnetic (EM) characterization of the material properties up to high frequencies is required for the impedance modeling of the CLIC DR components. The EM properties for frequencies of few GHz are determined with the waveguide method, based on a combination of experimental measurements of the complex transmission coefficient S21 and CST 3D EM simulations. The results obtained from a NEG-coated copper (Cu) waveguide are presented in this paper.

  9. Fundamental Design Principles of Linear Collider Damping Rings, with an Application to CLIC

    CERN Document Server

    Potier, J P

    2000-01-01

    Damping Rings for Linear Colliders have to produce very small normalised emittances at a high repetition rate. A previous paper presented analytical expressions for the equilibrium emittance of an arc cell as a function of the deflection angle per dipole. In addition, an expression for the lattice parameters providing the minimum emittance, and a strategy to stay close to this, were proposed. This analytical approach is extended to the detailed design of Damping Rings, taking into account the straight sections and the damping wigglers. Complete rings, including wiggler and injection insections, were modelled with the MAD [1] program, and their performance was found to be in good agreement with the analytical calculation. With such an approach it is shown that a Damping Ring corresponding to the Compact Linear Collider (CLIC) parameters at 0.5 and 1 TeV centre-of-mass energy, and tunable for two different sets of emittance and injection repetition rate, can be designed using the same ring layout.

  10. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  11. Investigation into electron cloud effects in the International Linear Collider positron damping ring

    Energy Technology Data Exchange (ETDEWEB)

    Crittenden, J. A.; Conway, J.; Dugan, G. F.; Palmer, M. A.; Rubin, D. L.; Shanks, J.; Sonnad, K. G.; Boon, L.; Harkay, K.; Ishibashi, T.; Furman, M. A.; Guiducci, S.; Pivi, M. T. F.; Wang, L.

    2014-03-01

    We report modeling results for electron cloud buildup and instability in the International Linear Collider positron damping ring. Updated optics, wiggler magnets, and vacuum chamber designs have recently been developed for the 5 GeV, 3.2-km racetrack layout. An analysis of the synchrotron radiation profile around the ring has been performed, including the effects of diffuse and specular photon scattering on the interior surfaces of the vacuum chamber. The results provide input to the cloud buildup simulations for the various magnetic field regions of the ring. The modeled cloud densities thus obtained are used in the instability threshold calculations. We conclude that the mitigation techniques employed in this model will suffice to allow operation of the damping ring at the design operational specifications

  12. Single-Bunch Instability Driven by the Electron Cloud Effect in the Positron Damping Ring of the International Linear Collider

    International Nuclear Information System (INIS)

    Pivi, Mauro; Raubenheimer, Tor O.; Ghalam, Ali; Harkay, Katherine; Ohmi, Kazuhito; Wanzenberg, Rainer; Wolski, Andrzej; Zimmermann, Frank

    2005-01-01

    Collective instabilities caused by the formation of an electron cloud (EC) are a potential limitation to the performances of the damping rings for a future linear collider. In this paper, we present recent simulation results for the electron cloud build-up in damping rings of different circumferences and discuss the single-bunch instabilities driven by the electron cloud

  13. Longitudinal Stability Study for the FACET-II e+ Damping Ring

    Energy Technology Data Exchange (ETDEWEB)

    Bane, Karl [SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2016-11-29

    This is an initial study of the longitudinal, single-bunch stability in the proposed FACET-II e+ damping ring. It is preliminary because, at present, only a few specific features of the vacuum chamber are known.

  14. The SLC control system - status and development

    International Nuclear Information System (INIS)

    Phinney, N.; Shoaee, H.

    1987-03-01

    The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development

  15. Intrabeam Scattering Studies for the ILC Damping Rings Using a NewMATLAB Code

    Energy Technology Data Exchange (ETDEWEB)

    Reichel, I.; Wolski, A.

    2006-06-21

    A new code to calculate the effects of intrabeam scattering (IBS) has been developed in MATLAB based on the approximation suggested by K. Bane. It interfaces with the Accelerator Toolbox but can also read in lattice functions from other codes. The code has been benchmarked against results from other codes for the ATF that use this approximation or do the calculation in a different way. The new code has been used to calculate the emittance growth due to intrabeam scattering for the lattices currently proposed for the ILC Damping Rings, as IBS is a concern, especially for the electron ring. A description of the code and its user interface, as well as results for the Damping Rings, will be presented.

  16. Intrabeam Scattering Studies for the ILC Damping Rings Using a New MATLAB Code

    International Nuclear Information System (INIS)

    Reichel, I.; Wolski, A.

    2006-01-01

    A new code to calculate the effects of intrabeam scattering (IBS) has been developed in MATLAB based on the approximation suggested by K. Bane. It interfaces with the Accelerator Toolbox but can also read in lattice functions from other codes. The code has been benchmarked against results from other codes for the ATF that use this approximation or do the calculation in a different way. The new code has been used to calculate the emittance growth due to intrabeam scattering for the lattices currently proposed for the ILC Damping Rings, as IBS is a concern, especially for the electron ring. A description of the code and its user interface, as well as results for the Damping Rings, will be presented

  17. A lattice with larger momentum compaction for the NLC main damping rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej; Raubenheimer, Tor O.; Woodley, Mark; Wu, Juhao

    2004-01-01

    Previous lattice designs for the Next Linear Collider Main Damping Rings [1] have met the specifications for equilibrium emittance, damping rate and dynamic aperture. Concerns about the effects of the damping wiggler on the beam dynamics [2] led to the aim of reducing the total length of the wiggler to a minimum consistent with the required damping rate, so high-field dipoles were used to provide a significant energy loss in the arcs. However, recent work has shown that the wiggler effects may not be as bad as previously feared. Furthermore, other studies have suggested the need for an increased momentum compaction (by roughly a factor of four) to raise the thresholds of various collective effects. We have therefore developed a new lattice design in which we increase the momentum compaction by reducing the field strength in the arc dipoles, compensating the loss in damping rate by increasing the length of the wiggler. The new lattice again meets the specifications for emittance, damping rate and dynamic aperture, while having the benefit of significantly higher thresholds for a number of instabilities

  18. Simulations of the Electron Cloud Build Up and Instabilities for Various ILC Damping Ring Configurations

    International Nuclear Information System (INIS)

    Pivi, Mauro; Raubenheimer, Tor O.; Wang, Lanfa; Ohmi, Kazuhito; Wanzenberg, Rainer; Wolski, Andrzej

    2007-01-01

    In the beam pipe of the positron damping ring of the International Linear Collider (ILC), an electron cloud may be first produced by photoelectrons and ionization of residual gases and then increased by the secondary emission process. This paper reports the assessment of electron cloud effects in a number of configuration options for the ILC baseline configuration. Careful estimates were made of the secondary electron yield (sometimes in the literature also referred as secondary emission yield SEY or (delta), with a peak value (delta) max ) threshold for electron cloud build-up, and the related single- and coupled-bunch instabilities, as a function of beam current and surface properties for a variety of optics designs. When the configuration for the ILC damping rings was chosen at the end of 2005, the results from these studies were important considerations. On the basis of the joint theoretical and experimental work, the baseline configuration currently specifies a pair of 6 km damping rings for the positron beam, to mitigate the effects of the electron cloud that could present difficulties in a single 6 km ring. However, since mitigation techniques are now estimated to be sufficiently mature, a reduced single 6-km circumference is presently under consideration so as to reduce costs

  19. Three bunch energy stabilization for the SLC injector

    International Nuclear Information System (INIS)

    Sheppard, J.C.; Almog, I.; Bambade, P.S.; Clendenin, J.E.; Jobe, R.K.; Phinney, N.; Shoaee, H.; Stiening, R.F.; Thompson, K.A.

    1986-09-01

    Slow feedback has been developed to control the energy and energy spread of the beams which are injected into the SLC damping rings. Within a single RF pulse, two bunches of electrons and one bunch of positrons are accelerated to an energy of 1.21 GeV in the injector of the SLC. The two electron bunches are deflected into the north damping ring while the positrons are targeted into the south ring. In order to fit into the acceptance of the rings, the composite energy deviation and energy spread of the beams must be less than 2% full width. Control of the beam energy characteristics is accomplished with a set of computer controlled feedback loops which monitor the parameters of the three bunches and make adjustments to the available RF energy, RF phasing, and RF timing. This paper presents an overview of the feedback algorithms and of the special hardware developments, and reports on the operational status of the processes

  20. Correction of vertical dispersion and betatron coupling for the CLIC damping ring

    CERN Document Server

    Korostelev, M S

    2006-01-01

    The sensitivity of the CLIC damping ring to various kinds of alignment errors has been studied. Without any correction, fairly small vertical misalignments of the quadrupoles and, in particular, the sextupoles, introduce unacceptable distortions of the closed orbit as well as intolerable spurious vertical dispersion and coupling due to the strong focusing optics of the damping ring. A sophisticated beam-based correction scheme has been developed to bring the design target emittances and the dynamic aperture back to the ideal value. The correction using dipolar correctors and several skew quadrupole correctors allows a minimization of the closed-orbit distortion, the cross-talk between vertical and horizontal closed orbits, the residual vertical dispersion and the betatron coupling.

  1. Design of the Injection and extraction system and related machine protection for the Clic Damping Rings

    CERN Document Server

    Apsimon, Robert; Barnes, Mike; Borburgh, Jan; Goddard, Brennan; Papaphilippou, Yannis; Uythoven, Jan

    2014-01-01

    Linear machines such as CLIC have relatively low rates of collision between bunches compared to their circular counterparts. In order to achieve the required luminosity, a very small spot size is envisaged at the interaction point, thus a low emittance beam is needed. Damping rings are essential for producing the low emittances needed for the CLIC main beam. It is crucial that the beams are injected and extracted from the damping rings in a stable and repeatable fashion to minimise emittance blow-up and beam jitter at the interaction point; both of these effects will deteriorate the luminosity at the interaction point. In this paper, the parameters and constraints of the injection and extraction systems are considered and the design of these systems is optimised within this parameter space. Related machine protection is considered in order to prevent damage from potential failure modes of the injection and extraction systems.

  2. Damping the e-p instability in the SNS accumulator ring

    Science.gov (United States)

    Evans, N. J.; Deibele, C.; Aleksandrov, A.; Xie, Z.

    2018-03-01

    A broadband, digital damper system for both transverse planes developed for the SNS accumulator ring has recently damped the first indications of the broadband 50-150 MHz e-p instability in a 1.2 MW neutron production beam. This paper presents details of the design and operation of the SNS damper system as well as results of active damping of the e-p instability in the SNS ring showing a reduction in power of betatron oscillation over the 10-300 MHz band of up to 70%. The spectral content of the beam during operation, with and without the damper system is presented and performance of the damper system is evaluated.

  3. Beam-based alignment at the KEK-ATF damping ring

    International Nuclear Information System (INIS)

    Woodley, Mark D.; Nelson, Janice; Ross, Marc; Turner, James; Wolski, A.; Kubo, Kiyoshi

    2004-01-01

    The damping rings of a future linear collider will have demanding alignment and stability requirements in order to achieve the low vertical emittance necessary for high luminosity. The Accelerator Test Facility (ATF) at KEK has successfully demonstrated the vertical emittance below 5 pm that is specified for the GLC/NLC Main Damping Rings. One contribution to this accomplishment has been the use of Beam Based Alignment (BBA) techniques. The mode of operation of the ATF presents particular challenges for BBA, and we describe here how we have deduced the offsets of the BPMs with respect to the quadrupoles. We also discuss a technique that allows for direct measurements of the beam-to-quad offsets

  4. Torsion of surface plate of the active support table for the ATF damping ring

    International Nuclear Information System (INIS)

    Takeuchi, Yasunori; Takeda, Shigeru; Kudo, Kikuo; Funahashi, Yoshisato; Kanazawa, Yasunori.

    1996-01-01

    Distortion of the surface plate of active support table was measured using precise tiltmeters. It is found that the surface plate is twisted when the temperature changes. The effect of this phenomenon is much smaller than the alignment tolerance of the ATF damping ring if the room temperature is controlled within 0.4degC. However, it is not negligible in the linear collider case. (author)

  5. Development of Stripline Kickers for Low Emittance Rings: Application to the Beam Extraction Kicker for CLIC Damping Rings

    CERN Document Server

    AUTHOR|(SzGeCERN)728476; Toral Fernandez, Fernando

    In the framework of the design study of Future Linear Colliders, the Compact Linear Collider (CLIC) aims for electron-positron collisions with high luminosity at a nominal centre-of-mass energy of 3 TeV. To achieve the luminosity requirements, Pre-Damping Rings (PDRs) and Damping Rings (DRs) are required: they reduce the beam emittance before the beam is accelerated in the main linac. Several injection and extraction systems are needed to inject and extract the beam from the PDRs and DRs. The work of this Thesis consists of the design, fabrication and laboratory tests of the first stripline kicker prototype for beam extraction from the CLIC DRs, although the methodology proposed can be extended to stripline kickers for any low emittance ring. The excellent field homogeneity required, as well as a good transmission of the high voltage pulse through the electrodes, has been achieved by choosing a novel electrode shape. With this new geometry, it has been possible to benefit from all the advantages that the most...

  6. Orbit monitoring in the SLC

    International Nuclear Information System (INIS)

    Sanchez-Chopitea, L.; Emma, P.; Van Olst, D.

    1991-05-01

    Beam orbits in the SLC are monitored in real time and the data is stored for future trend and correlation analysis. A background process acquires Beam Position Monitor (BPM) and Toroid data on a periodic basis and saves the general quantities such as orbit RMS and beam intensity in addition to the individual readings. Some of this data is archived by the SLC History Buffer facility and the rest is saved in files for later analysis. This has permitted the tracing of interaction point instabilities to specific devices as far away as the damping rings. In addition, the data is displayed for the operators both in summary and in full form. The different displays can be configured from the control consoles. 2 refs., 5 figs

  7. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  8. Global Optimization of Damping Ring Designs Using a Multi-Objective Evolutionary Algorithm

    CERN Document Server

    Emery, Louis

    2005-01-01

    Several damping ring designs for the International Linear Collider have been proposed recently. Some of the specifications, such as circumference and bunch train, are not fixed yet. Designers must make a choice anyway, select a geometry type (dog-bone or circular), an arc cell type (TME or FODO), and optimize linear and nonlinear part of the optics. The design process include straightforward steps (usually the linear optics), and some steps not so straightforward (when nonlinear optics optimization is affected by the linear optics). A first attempt at automating this process for the linear optics is reported. We first recognize that the optics is defined by just a few primary parameters (e.g., phase advance per cell) that determine the rest (e.g., quadrupole strength). In addition to the exact specification of circumference, equilibrium emittance and damping time there are some other quantities which could be optimized that may conflict with each other. A multiobjective genetic optimizer solves this problem b...

  9. Lattice design for an ILC damping ring with 3 km circumference

    International Nuclear Information System (INIS)

    Wolski, Andrzej

    2004-01-01

    We describe a simple lattice that meets the specifications for the damping times and horizontal and longitudinal emittances for the International Linear Collider (ILC) damping rings. The circumference of a little over 3 km leads to a bunch spacing of around 3 ns, which will require advances in kicker technology for injection and extraction. We present the lattice design, and initial results of studies of the acceptance and collective effects. With the high bunch charge and close spacing, the ion and electron cloud effects are expected to be severe; however, the simple structure of the lattice allows for easy variation of the circumference and bunch spacing, which may make it useful for future investigations

  10. DAMPE

    CERN Multimedia

    Chen, D

    The $\\textbf{DA}$rk $\\textbf{M}$atter $\\textbf{P}$article $\\textbf{E}$xplorer (DAMPE) experiment is a high-energy astroparticle physics satellite mission to search for Dark Matter signatures in space, study the cosmic ray spectrum and composition up to 100 TeV, and perform high-energy gamma astronomy. The launch is planned for end 2015, initially for 3 years, to compliment existing space missions FERMI, AMS and CALET.

  11. High Resolution BPM Upgrade for the ATF Damping Ring at KEK

    International Nuclear Information System (INIS)

    Eddy, N.; Briegel, C.; Fellenz, B.; Gianfelice-Wendt, E.; Prieto, P.; Rechenmacher, R.; Semenov, A.; Voy, D.; Wendt, M.; Zhang, D.; Terunuma, N.

    2011-01-01

    A beam position monitor (BPM) upgrade at the KEK Accelerator Test Facility (ATF) damping ring has been accomplished, carried out by a KEK/FNAL/SLAC collaboration under the umbrella of the global ILC R and D effort. The upgrade consists of a high resolution, high reproducibility read-out system, based on analog and digital down-conversion techniques, digital signal processing, and also implements a new automatic gain error correction schema. The technical concept and realization as well as results of beam studies are presented. The next generation of linear colliders require ultra-low vertical emittance of <2 pm-rad. The damping ring at the KEK Accelerator Test Facility (ATF) is designed to demonstrate this mission critical goal. A high resolution beam position monitor (BPM) system for the damping ring is one of the key tools for realizing this goal. The BPM system needs to provide two distnict measurements. First, a very high resolution (∼100-200nm) closed-orbit measurement which is averaged over many turns and realized with narrowband filter techniques - 'narrowband mode'. This is needed to monitor and steer the beam along an optimum orbit and to facilitate beam-based alignment to minimize non-linear field effects. Second, is the ability to make turn by turn (TBT) measurements to support optics studies and corrections necessary to achieve the design performance. As the TBT measurement necessitates a wider bandwidth, it is often referred to as 'wideband mode'. The BPM upgrade was initiated as a KEK/SLAC/FNAL collaboration in the frame of the Global Design Initiative of the International Linear Collider. The project was realized and completed using Japan-US funds with Fermilab as the core partner.

  12. Wigglers and single-particle dynamics in the NLC damping rings

    International Nuclear Information System (INIS)

    Venturini, Marco; Wolski, Andrzej; Dragt, Alex

    2003-01-01

    Wiggler insertions are expected to occupy a significant portion of the lattice of the Next Linear Collider (NLC) Main Damping Rings (MDR) and have a noticeable impact on the single-particle beam dynamics. Starting from a realistic 3D representation of the magnetic fields we calculate the transfer maps for the wigglers, accounting for linear and nonlinear effects, and we study the beam dynamics with particular attention paid to the Dynamic Aperture(DA). A DA reduction is observed but appears to remain within acceptable limits

  13. Achievement of ultra-low emittance beam in the ATF damping ring

    CERN Document Server

    Honda, Y; Araki, S; Bane, Karl Leopold Freitag; Brachmann, A; Frisch, J; Fukuda, M; Hasegawa, K; Hayano, H; Hendrickson, L; Higashi, Y; Higo, T; Hirano, K; Hirose, T; Iida, K; Imai, T; Inoue, Y; Karataev, P; Kubo, K; Kurihara, Y; Kuriki, M; Kuroda, R; Kuroda, S; Luo, X; Matsuda, M; McCormick, D; Muto, T; Nakajima, K; Nelson, J; Nomura, M; Ohashi, A; Okugi, T; Omori, T; Ross, M; Sakai, H; Sakai, I; Sasao, N; Smith, S; Suzuki, T; Takano, M; Takashi, N; Taniguchi, T; Terunuma, N; Toge, N; Turner, J; Urakawa, J; Vogel, V; Wolski, A; Woodley, M; Yamazaki, I; Yamazaki, Y; Yocky, J; Young, A; Zimmermann, Frank

    2003-01-01

    We report on the smallest vertical emittance achieved in single-bunch-mode operation of the ATF. The emittances were measured with a laser-wire beam-profile monitor installed in the damping ring. The bunch length and the momentum spread of the beam were also recorded under the same conditions. The smallest vertical rms emittance measured is 4 pm in the limit of zero current. It increases by a factor of 1.5 for a bunch intensity of 10^10 electrons. There are no discrepancies between the measured data and the calculations of intra-beam scattering.

  14. RF cavity R and D at LBNL for the NLC Damping Rings, FY2000/2001

    International Nuclear Information System (INIS)

    Rimmer, R.A.; Atkinson, D.; Corlett, J.N.; Koehler, G.; Li, D.; Hartman, N.; Rasson, J.; Saleh, T.; Weidenbach, W.

    2001-01-01

    This report contains a summary of the R and D activities at LBNL on RF cavities for the NLC damping rings during fiscal years 2000/2001. This work is a continuation of the NLC RF system R and D of the previous year [1]. These activities include the further optimization and fine tuning of the RF cavity design for both efficiency and damping of higher-order modes (HOMs). The cavity wall surface heating and stresses were reduced at the same time as the HOM damping was improved over previous designs. Final frequency tuning was performed using the high frequency electromagnetic analysis capability in ANSYS. The mechanical design and fabrication methods have been developed with the goals of lower stresses, fewer parts and simpler assembly compared to previous designs. This should result in substantial cost savings. The cavity ancillary components including the RF window, coupling box, HOM loads, and tuners have been studied in more detail. Other cavity options are discussed which might be desirable to either further lower the HOM impedance or increase the stored energy for reduced transient response. Superconducting designs and the use of external ''energy storage'' cavities are discussed. A section is included in which the calculation method is summarized and its accuracy assessed by comparisons with the laboratory measurements of the PEP-II cavity, including errors, and with the beam-sampled spectrum

  15. RF cavity R and D at LBNL for the NLC damping rings, FY1999

    International Nuclear Information System (INIS)

    Rimmer, R.A.; Corlett, J.N.; Koehler, G.; Li, D.; Hartman, N.; Rasson, J.; Saleh, T.

    1999-01-01

    This report contains a summary of the R and D activities at LBNL on RF cavities for the NLC damping rings during fiscal year19999. These activities include the optimization of the RF design for both efficiency and damping of higher-order (HOMs), by systematic study of the cavity profile, the effect of the beam pipe diameter, nosecone angle and gap, the cross section and position of the HOM damping waveguides and the coupler. The effect of the shape of the HOM waveguides and their intersection with the cavity wall on the local surface heating is also an important factor, since it determines the highest stresses in the cavity body. This was taken into account during the optimization so that the stresses could be reduced at the same time as the HOP damping was improved over previous designs. A new method of calculating the RF heating was employed, using a recently released high frequency electromagnetic element in ANSYS. This greatly facilitates the thermal and stress analysis of the design and fabrication methods have been developed with the goals of lower stresses, fewer parts and simpler assembly compared to previous designs. This should result in substantial cost savings. Preliminary designs are described for the cavity ancillary components including the RF window, HOM loads, and tuners. A preliminary manufacturing plan is included, with an initial estimate of the resource requirements. Other cavity options are discussed which might be desirable to either lower the R/Q, for reduced transient response, or lower the residual HOM impedance to reduce coupled-bunch growth rates further still

  16. Accelerator physics highlights in the 1997/98 SLC run

    International Nuclear Information System (INIS)

    Assmann, R.W.; Bane, K.L.F.; Barkow, T.

    1998-03-01

    The authors report various accelerator physics studies and improvements from the 1997/98 run at the Stanford Linear Collider (SLC). In particular, the authors discuss damping-ring lattice diagnostics, changes to the linac set up, fast control for linac rf phase stability, new emittance tuning strategies, wakefield reduction, modifications of the final-focus optics, longitudinal bunch shaping, and a novel spot-size control at the interaction point (IP)

  17. Damping spurious harmonic resonances in the APS storage ring beam chamber

    International Nuclear Information System (INIS)

    Kang, Y.

    1999-01-01

    The APS storage ring beam chamber has been storing the beam up to 100 mA successfully. However, in some beam chambers, spurious signals corrupted the BPM outputs. The cause of the unwanted signals was investigated, and it was found that transverse electric (TE) longitudinal harmonic resonances of the beam chamber were responsible. The beam chambers have small height in the area between the ovid beam chamber and the antechamber. The structure behaves like a ridge waveguide so that the cut-off frequency of the waveguide mode becomes lower. The pass-band then includes the frequency around 350 MHz that is important to the beam position monitors (BPMs). The spurious harmonic resonances are damped with two types of dampers to restore the useful signals of the BPMs; coaxial loop dampers and lossy ceramic slab loading are used

  18. Longitudinal Single-Bunch Instability in the ILC Damping Rings: Estimate of Current Threshold

    International Nuclear Information System (INIS)

    Venturini, Marco; Venturini, Marco

    2008-01-01

    Characterization of single-bunch instabilities in the International Linear Collider (ILC) damping rings (DRs) has been indicated as a high-priority activity toward completion of an engineering design. In this paper we report on a first estimate of the current thresholds for the instability using numerical and analytical models of the wake potentials associated with the various machine components. The numerical models were derived (upon appropriate scaling) from designs of the corresponding components installed in existing machines. The current thresholds for instabilities were determined by numerical solution of the Vlasov equation for the longitudinal dynamics. For the DR baseline lattice as of Feb. 2007 we find the critical current for instability to be safely above the design specifications leaving room for further optimization of the choice of the momentum compaction

  19. Particle-in-Cell Calculations of the Electron Cloud in the ILC Positron Damping Ring Wigglers

    International Nuclear Information System (INIS)

    Celata, C.M.; Furman, M.A.; Vay, J.-L.; Grote, D.P.

    2007-01-01

    The self-consistent code suite WARP-POSINST is being used to study electron cloud effects in the ILC positron damping ring wiggler. WARP is a parallelized, 3D particle-in-cell code which is fully self-consistent for all species. The POSINST models for the production of photoelectrons and secondary electrons are used to calculate electron creation. Mesh refinement and a moving reference frame for the calculation will be used to reduce the computer time needed by several orders of magnitude. We present preliminary results for cloud buildup showing 3D electron effects at the nulls of the vertical wiggler field. First results from a benchmark of WARP-POSINST vs. POSINST are also discussed

  20. Measurements of electron beam emittance in the Accelerator Test Facility damping ring operated in multibunch modes

    Directory of Open Access Journals (Sweden)

    Yosuke Honda

    2003-09-01

    Full Text Available We present the measurement results of electron beam emittance in the Accelerator Test Facility damping ring operated in multibunch modes. The measurements were carried out with an upgraded laser wire beam profile monitor. The monitor has now a vertical wire as well as a horizontal one and is able to make much faster measurements thanks to an increased effective laser power inside the cavity. The measured emittance shows no large bunch-to-bunch dependence in either the horizontal or vertical directions. The values of the vertical emittance are similar to those obtained in the single-bunch operation. The present results are an important step toward the realization of a high-energy linear collider.

  1. CESR Conversion Damping Ring Studies of Electron Cloud Instabilities (CESR-TA)

    International Nuclear Information System (INIS)

    Rubin, David L.; Palmer, Mark A.

    2011-01-01

    In the International Linear Collider, two linear accelerators will accelerate bunches of positrons and electrons to over a hundred billion electron volts and collide them in a central detector. In order to obtain useful collision rates, the bunches, each containing twenty billion particles, must be compressed to a cross section of a few nanometers by a few hundred nanometers. In order to prepare these ultra high density bunches, damping rings (DRs) are employed before the linear accelerators. The DRs take the high emittance bunches that are provided by the electron and positron sources and, through the process of radiation damping, squeeze them into ultra low emittance beams that are ready for the main linear accelerators. In the damping rings, a number of effects can prevent the successful preparation of the beams. In the electron ring, an effect known as the fast ion instability can lead to beam growth and, in the positron ring, the build-up of an electron cloud (EC), which interacts with the circulating bunches, can produce the same effect. EC build-up and the subsequent interaction of the cloud with the positron beam in the DR have been identified as major risks for the successful construction of a linear collider. The CESRTA research program at the Cornell Electron Storage Ring (CESR) was developed in order to study the build-up of the EC, the details of its impact on ultra low emittance beams, as well as methods to mitigate the impact of the cloud. In the DR, the EC forms when synchrotron photons radiated from the circulating beam strike the walls of the vacuum chamber, resulting in the emission of photoelectrons. These low energy electrons can be accelerated across the vacuum chamber by the electric field of the beam, and strike the walls, causing the emission of secondary electrons. The secondary electrons are subsequently accelerated into the walls yet again via the same mechanism. The result is that the EC can rapidly begin to fill the vacuum chamber. In

  2. CESR Conversion Damping Ring Studies of Electron Cloud Instabilities (CESR-TA)

    Energy Technology Data Exchange (ETDEWEB)

    Rubin, David L.; Palmer, Mark A.

    2011-08-02

    In the International Linear Collider, two linear accelerators will accelerate bunches of positrons and electrons to over a hundred billion electron volts and collide them in a central detector. In order to obtain useful collision rates, the bunches, each containing twenty billion particles, must be compressed to a cross section of a few nanometers by a few hundred nanometers. In order to prepare these ultra high density bunches, damping rings (DRs) are employed before the linear accelerators. The DRs take the high emittance bunches that are provided by the electron and positron sources and, through the process of radiation damping, squeeze them into ultra low emittance beams that are ready for the main linear accelerators. In the damping rings, a number of effects can prevent the successful preparation of the beams. In the electron ring, an effect known as the fast ion instability can lead to beam growth and, in the positron ring, the build-up of an electron cloud (EC), which interacts with the circulating bunches, can produce the same effect. EC build-up and the subsequent interaction of the cloud with the positron beam in the DR have been identified as major risks for the successful construction of a linear collider. The CESRTA research program at the Cornell Electron Storage Ring (CESR) was developed in order to study the build-up of the EC, the details of its impact on ultra low emittance beams, as well as methods to mitigate the impact of the cloud. In the DR, the EC forms when synchrotron photons radiated from the circulating beam strike the walls of the vacuum chamber, resulting in the emission of photoelectrons. These low energy electrons can be accelerated across the vacuum chamber by the electric field of the beam, and strike the walls, causing the emission of secondary electrons. The secondary electrons are subsequently accelerated into the walls yet again via the same mechanism. The result is that the EC can rapidly begin to fill the vacuum chamber. In

  3. A status report on the SLC program

    International Nuclear Information System (INIS)

    Prescott, C.Y.

    1985-09-01

    The SLC program is an accelerator experiment and a physics experiment. The progress in the accelerator experiment has been rapid, with injector and damping ring components working, conventional construction on schedule, and technical components in production. Accelerator studies will investigate beam-linac and beam-beam interactions, with application to the design of future linear colliders. The physics experiments start in 1987 to study Z 0 properties and to look for new physics effects. Detectors to fully exploit the potential physics are under construction

  4. Optics Design and Performance of an Ultra-Low Emittance Damping Ring for the Compact Linear Collider

    CERN Document Server

    Korostelev, M S

    2006-01-01

    A high-energy (0.5-3.0 TeV centre of mass) electron-positron Compact Linear Collider (CLIC) is being studied at CERN as a new physics facility. The design study has been optimized for 3 TeV centre-of-mass energy. Intense bunches injected into the main linac must have unprecedentedly small emittances to achieve the design luminosity 1035cm-2s-1 required for the physics experiments. The positron and electron bunch trains will be provided by the CLIC injection complex. This thesis describes an optics design and performance of a positron damping ring developed for producing such ultra-low emittance beam. The linear optics of the CLIC damping ring is optimized by taking into account the combined action of radiation damping, quantum excitation and intrabeam scattering. The required beam emittance is obtained by using a TME (Theoretical Minimum Emittance) lattice with compact arcs and short period wiggler magnets located in dispersionfree regions. The damping ring beam energy is chosen as 2.42 GeV. The lattice featu...

  5. Broadband feedback systems for the damping of coherent beam instabilities in the stretcher ring ELSA

    International Nuclear Information System (INIS)

    Roth, Andre

    2012-12-01

    At the Electron Stretcher Facility ELSA an upgrade of the internal beam current up to 200 mA would be desirable in order to increase the intensity of the extracted electron beam for the future experimental hadron physics program. However, such an upgrade is mainly limited by the excitation of coherent beam instabilities in the stretcher ring. As active counteraction, broadband bunch-by-bunch feedback-systems for the longitudinal, as well as for both transverse planes were installed. After detection of the motion of each of the 27 4 stored bunches via beam position monitors, the systems determine independent correction signals for each bunch using digital signal processors. The amplified correction signals are applied to the beam by means of broadband longitudinal and transverse kicker structures. The detailed setup, the commissioning procedure and measurement results of the damping performance of the systems are presented. In addition, the operation of the longitudinal system during the fast energy ramp of 4 GeV/s from 1.2 GeV to 3.2 GeV is investigated.

  6. ILC Damping Rings: Benefit of the Antechamber or: Antechamber vs. SEY

    International Nuclear Information System (INIS)

    Furman, M.A.

    2011-01-01

    We present simulation results of the build-up of the electron-cloud density n e for the two proposed ILC damping ring lattices, DC04 and DSB3, with particular attention to the potential benefit of an antechamber. We examine a field-free region and a dipole bending magnet, with or without an antechamber. We assume a secondary electronemission model for the chamber surface based on approximate fits to measured data for TiN, except that we let the peak value of the secondary emission yield (SEY), (delta) max , be a variable. We conclude that there is a critical value of (delta) max below which the antechamber provides a substantial benefit, roughly a factor ∼40 reduction in n e relative to the case in which max exceeds the critical value. We estimate the steady-state value of n e as a function of (delta) max , and thereby obtain the critical value of (delta) max for all cases considered. Thus, from the perspective of the electron-cloud effect, the inclusion of an antechamber in the design is justified only if (delta) max is below the critical value. The results presented here constitute a slight extension of those previously presented in March and September, 2010.

  7. High Frequency Effects of Impedances and Coatings in the CLIC Damping Rings

    CERN Document Server

    Koukovini Platia, Eirini; Rumolo, G

    The Compact Linear Collider (CLIC) is a 3 TeV eÅe¡ machine, currently under design at CERN, that targets to explore the terascale particle physics regime. The experiment requires a high luminosity of 2£1034 cm2 s¡1, which can be achieved with ultra low emittances delivered from the Damping Rings (DRs) complex. The high bunch brightness of the DRs gives rise to several collective effects that can limit the machine performance. Impedance studies during the design stage of the DR are of great importance to ensure safe operation under nominal parameters. As a first step, the transverse impedance model of the DRis built, accounting for the wholemachine. Beam dynamics simulations are performedwith HEADTAIL to investigate the effect on beam dynamics. For the correct impedancemodeling of the machine elements, knowledge of the material properties is essential up to hundreds of GHz, where the bunch spectrum extends. Specifically, Non Evaporable Getter (NEG) is a commonly used coating for good vacuumbut its properti...

  8. Chromatic correction in the SLC bunch length compressors

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.

    1991-06-01

    The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs

  9. Recent electron-cloud simulation results for the main damping rings of the NLC and TESLA linear colliders

    International Nuclear Information System (INIS)

    Pivi, M.; Raubenheimer, T.O.; Furman, M.A.

    2003-01-01

    In the beam pipe of the Main Damping Ring (MDR) of the Next Linear Collider (NLC), ionization of residual gases and secondary emission give rise to an electron-cloud which stabilizes to equilibrium after few bunch trains. In this paper, we present recent computer simulation results for the main features of the electron cloud at the NLC and preliminary simulation results for the TESLA main damping rings, obtained with the code POSINST that has been developed at LBNL, and lately in collaboration with SLAC, over the past 7 years. Possible remedies to mitigate the effect are also discussed. We have recently included the possibility to simulate different magnetic field configurations in our code including solenoid, quadrupole, sextupole and wiggler

  10. Calculation of Oil Film Thickness from Damping Coefficients for a Piston Ring in an Internal Combustion Engine

    DEFF Research Database (Denmark)

    Christiansen, Jens; Klit, Peder; Vølund, Anders

    2007-01-01

    engine. The basic idea is to use the fluid film damping coefficients to estimate the film thickness variation for a piston ring under cyclic varying load. Reynolds Equation is solved for a piston ring and the oil film thickness is determined. In this analysis hydrodynamic lubrication is assumed......In 1966 Jorgen W. Lund published an approach to find the dynamic coefficients of a journal bearing by a first order perturbation of the Reynold's equation. These coefficients made it possible to perform a rotor-bearing stability analysis for a statically loaded bearing. In the mid seventies Jorgen...

  11. Configuring the SLC linac for injection into PEP

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1989-01-01

    From time to time the normal SLC physics program is to be interrupted so that beam can be delivered to PEP. In order that the switch to PEP injection (and the switch back again) can be accomplished quickly and easily, the gun, the damping rings, the linac phase ramp, the energy profile of the linac klystrons for the scavenger bunch, and the entire positron production system are to be kept the same as in the SLC configuration. What mainly remains to be changed is the linac klystron profile for the leading two bunches - those going to PEP. The new klystron profile must be such that it leaves these two beams (1) with final energies that match that of the storage ring and (2) with final energy spectra that fit within the energy aperture of the PEP transfer line. The conditions that need to be met in order to achieve these two goals are discussed in this note. 1 ref., 2 figs

  12. Kicker thyratron experience from SLC

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

    1991-05-01

    The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

  13. Preliminary Design Study of a Pre-booster Damping Ring for the FCC e+e− Injector

    CERN Document Server

    Etisken, O; Papaphilippou, Y

    2017-01-01

    The aim of the FCC e+e− lepton collider is to collide particles in the energy range 40–175 GeV. The FCC e+e− injector complex needs to produce and transport high-intensity e+e− beams at a fast repetition rate of about 0.1 Hz to top up the collider at its collision energy. A basic parameter set exists for all collider energies, assuming a 10 GeV linac operating with a large number of bunches accumulating in the existing SPS, which serves as pre-accelerator and damping ring before the bunches are transferred to the high-energy booster. The purpose of this study is to provide the conceptual design of an alternative damping and accelerator ring, replacing the SPS in the current scheme. This ring will have an injection energy of around 6 GeV and an extraction energy of around 20 GeV. Apart from establishing the basic ring parameters, the final study will include the optics design and layout, and single particle linear and non-linear dynamics optimization, including magnetic and alignment error tolerances. ...

  14. Experience with the SLC permanent magnet multipoles

    International Nuclear Information System (INIS)

    Gross, G.; Spencer, J.

    1994-06-01

    Permanent magnets have been used in the SLC Damping Rings and their injection and extraction lines since 1985. Recent upgrades of the DR vacuum chambers provided an opportunity to check DR magnets prior to higher beam current operation. Several PM sextupoles downstream of the injection kickers in the electron ring had exceeded their thermal stabilization values of 80 degrees C and some showed serious mechanical deformations and radiation >1 R at contact. We discuss our observations, measurements and a few inexpensive modifications that should improve these magnets under such conditions. A new, block matching algorithm allowed us to use magnet blocks that had been considered unusable because of very different remament field strengths and easy axis errors

  15. Spin Tracking Studies for Beam Polarization Preservation in the NLC Main Damping Rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej; Bates, Daniel

    2004-01-01

    We report results from studies of spin dynamics in the NLC Main Damping. Our studies have been based on spin tracking particles through the lattice under a range of conditions. We find that there are a number of spin resonances close to the nominal operating energy of 1.98 GeV; however, the effects of the resonances are weak, and the widths are narrow. We do not expect that any significant depolarization of the beam will occur during the store time

  16. Recent luminosity improvements at the SLC

    International Nuclear Information System (INIS)

    Raimondi, P.; Usher, T.; Akre, R.

    1998-07-01

    The luminosity of the SLAC Linear Collider (SLC) has been increased by more than a factor of three during the 1997--98 run. Improved alignment and emittance tuning techniques throughout the accelerator resulted in minimal emittance growth from the damping rings to the final focus. In particular, a revised strategy for wakefield cancellation using precision beam size measurements at the entrance of the final focus proved effective for optimizing emittance. The final focus lattice was modified to provide stronger demagnification near the interaction point and to remove residual higher-order aberrations. Beam sizes as small as 1.5 by 0.65 microns were achieved at full beam intensity of 4 10 10 particles per pulse. With these parameters, the mutual focusing of the beams in collision becomes significant, resulting in a further increase in the luminosity. Recorded SLD event rates confirmed the theoretical calculations of the disruption enhancement which was typically 50 to 100%

  17. Injection envelope matching in storage rings

    International Nuclear Information System (INIS)

    Minty, M.G.; Spence, W.L.

    1995-05-01

    The shape and size of the transverse phase space injected into a storage ring can be deduced from turn-by-turn measurements of the transient behavior of the beam envelope in the ring. Envelope oscillations at 2 x the β-tron frequency indicate the presence of a β-mismatch, while envelope oscillations at the β-tron frequency are the signature of a dispersion function mismatch. Experiments in injection optimization using synchrotron radiation imaging of the beam and a fast-gated camera at the SLC damping rings are reported

  18. Operation and performance of bunch pre-compression for increased transmission at the SLC

    International Nuclear Information System (INIS)

    Minty, M.G.; Akre, R.; Decker, F.J.; Turner, J.

    1997-11-01

    As the beam currents at the SLC are increased, transverse aperture restrictions in the ring-to-linac transport line (RTL) become increasingly important. The RTL contains a bunch compressor which introduces a large energy variation across the bunch and hence a larger transverse beam size. Since 1994 the compressor amplitude has been operating at higher than design voltage. While advantageous for shaping the bunch distribution, this increased the bunch energy spread and therefore resulted in more beam loss. Moreover, due to current-dependent bunch lengthening in the damping ring, the higher the beam current, the more the current loss. To avoid such losses, the bunch length may be precompressed in the damping ring. Until recently, bunch precompression with high beam currents was not stable. In this paper the authors identify the reasons for the difficulties, describe the changes made to accommodate bunch precompression, and discuss performance aspects after implementation. The estimated increase in current at the interaction point is 15%

  19. Estimates of CSR Instability Thresholds for Various Storage Rings

    CERN Document Server

    Zimmermann, Frank

    2010-01-01

    We review the key predictions and conditions by several authors for the onset of longitudinal instabilities due to coherent synchrotron radiation (CSR), and evaluate them numerically for various storage rings, namely the KEKB High Energy Ring (HER) & Low Energy Ring (LER), SuperKEKB HER & LER, old and new designs of the SuperKEKB Damping Ring (DR), SuperB HER & LER, CLIC DR (2009 and 2010 design parameters), SLC DR, and ATF DR. We show that the theoretical uncertainty in the instability onset is at least at the level of 20-30% in bunch intensity. More importantly, we present some doubts about the general applicability for many of these storage rings of some commonly used formulae. To cast further light on these questions, an experiment at lower beam energy on the ATF Damping Ring is proposed.

  20. Wire Mesh Dampers for Semi-Floating Ring Bearings in Automotive Turbochargers: Measurements of Structural Stiffness and Damping Parameters

    Directory of Open Access Journals (Sweden)

    Keun Ryu

    2018-04-01

    Full Text Available The current work introduces a new semi-floating ring bearing (SFRB system developed for improving the rotordynamic and vibration performance of automotive turbochargers (TCs at extreme operation conditions, such as high temperature, severe external force excitation, and large rotor imbalance. The new bearing design replaces outer oil films, i.e., squeeze film dampers (SFDs, in TC SFRBs with wire mesh dampers (WMDs. This SFRB configuration integrating WMDs aims to implement reliable mechanical components, as an inexpensive and simple alternative to SFDs, with consistent and superior damping capability, as well as predictable forced performance. Since WMDs are in series with the inner oil films of SFRBs, experimentally determined force coefficients of WMDs are of great importance in the design process of TC rotor-bearing systems (RBSs. Presently, the measurements of applied static load and ensuing deflection determine the structural stiffnesses of the WMDs. The WMD damping parameters, including dissipated energy, loss factor, and dry friction coefficient, are estimated from the area of the distinctive local hysteresis loop of the load versus WMD displacement data recorded during consecutive loading-unloading cycles as a function of applied preload with a constant amplitude of motion. The changes in WMD loss factor and dry friction coefficient due to increases in preload are more significant for the WMDs with lower density. The present work shows, to date, the most comprehensive measurements of static load characteristics on the WMDs for application into small automotive TCs. More importantly, the extensive test measurements of WMD deflection versus increasing static loads will aid to anchor predictions of future computation model.

  1. Status of the SLC: Developments in Linear Collider physics

    International Nuclear Information System (INIS)

    Krejcik, P.

    1994-11-01

    This paper reviews the performance of the SLAC Linear Collider, both from the perspective of a machine delivering high luminosity polarized beams for physics, and as a test for future linear colliders. The development of the SLC taken place over a number of years and the steady improvements have been documented in previous review papers. As a review paper, the list references also serves as a bibliography, pointing to the work of the many people contributing to the upgrades and commissioning of the various SLC systems. The major upgrades for this present run have been an improved final focus optics, new low impedance vacuum chambers for the damping rings and improved polarization from the electron source. The performance of the SLC is driven to some extent by its unique 3-beam operation in which the linac accelerates both the electron and positron bunches for collision, as well as the electron bunch to produce the positrons. The special attention required to maintain stable operation in the face of the interactions caused by beam loading from the bunches will (fortunately exclamation point) not be an issue in future linear colliders. They will deal instead with the problems associated with handling long bunch trains

  2. Generation and acceleration of high intensity beams in the SLC injector

    International Nuclear Information System (INIS)

    Ross, M.C.; Browne, M.J.; Clendenin, J.E.; Jobe, R.K.; Seeman, J.T.; Sheppard, J.C.; Stiening, R.F.

    1985-04-01

    A new gun pulser and substantially increased focusing have been added to the first 100 m of the SLAC linac in order to provide a pair of intense electron bunches to the SLC damping ring. Each bunch from this injector must have 5 x 10 10 electrons, an invariant emittance γepsilon less than or equal to 1.8 x 10 -3 m-rad and the pair must have an energy spread of less than 2%. Wakefield instabilities present in earlier versions of this injector have been controlled by reducing the transverse beam dimension by a factor of 3

  3. Damping Ring Kickers

    Energy Technology Data Exchange (ETDEWEB)

    Bulos, Fatin [SLAC National Accelerator Lab., Menlo Park, CA (United States); Tomlin, Bill T. [SLAC National Accelerator Lab., Menlo Park, CA (United States); Weaver, J. [SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2014-03-04

    The principle of the design of these magnets was discussed in CN-72. Fig. 1 shows what the total system looks like. Such a system was completed last January and since then we have been evaluating its performance.

  4. Measurements of longitudinal phase space in the SLC linac

    International Nuclear Information System (INIS)

    Bane, K.; Adolphsen, C.; Lavine, T.L.; Ross, M.; Seeman, J.; Thompson, K.

    1990-05-01

    In the Stanford Linear Collider the beam leaves a damping ring and then enters the Ring-to-Linac (RTL) transfer line. In the RTL it is compressed in length by a factor of 10 by means of an rf section, with which a longitudinally correlated energy variation is induced in the beam, and a following beam line which has non-zero momentum compaction. The compressed beam then enters the linac proper. In this paper we describe three measurements of longitudinal properties of the beam in the SLC linac. We present measurements of single bunch beam loading, of the energy spectrum at the end of the linac, and of the linac bunch length. Since the results of all three measurements depend on the beam's longitudinal charge distribution in the linac they, in turn, also depend on the bunch lengthening that occurs in the damping rings, as well as on the behavior of the compressor. The results of the first two measurements, in addition, depend critically on the strength of the longitudinal wakefields in the linac. The results of these three measurements are compared with simulations. For these calculations, at any given current, the potential well distortion in the damping ring is first computed. The compression process is then simulated to obtain the longitudinal charge distribution in the linac. For the first two measurements this distribution is then convolved with the calculated longitudinal wake function of the SLAC linac in order to obtain the induced voltage. Finally, the induced voltage is combined with the effect of the linac rf wave to give the final energy spectrum. 8 refs., 5 figs

  5. Application of online modeling to the operation of SLC

    International Nuclear Information System (INIS)

    Woodley, M.D.; Sanchez-Chopitea, L.; Shoaee, H.

    1987-01-01

    Online computer models of first order beam optics have been developed for the commissioning, control and operation of the entire SLC including Damping Rings, Linac, Positron Return Line and Collider Arcs. A generalized online environment utilizing these models provides the capability for interactive selection of a desire optics configuration and for the study of its properties. Automated procedures have been developed which calculate and load beamline component set-points and which can scale magnet strengths to achieve desired beam properties for any Linac energy profile. Graphic displays facilitate comparison of design, desired and actual optical characteristics of the beamlines. Measured beam properties, such as beam emittance and dispersion, can be incorporated interactively into the models and used for beam matching and optimization of injection and extraction efficiencies and beam transmissions. The online optics modeling facility also serves as the foundation for many model-driven applications such as autosteering, calculation of beam launch parameters, emittance measurement and dispersion correction

  6. The energy stabilization for the SLC scavenger beam

    International Nuclear Information System (INIS)

    Hsu, I.; Browne, M.; Himel, T.; Humphrey, R.; Jobe, K.; Ross, M.; Pellegrin, J.L.; Seeman, J.

    1991-01-01

    The energy of the SLC scavenger beam which is used to produce positrons must be carefully maintained so that the beam can be transported through the collimators in the dispersive region of the extraction line which leads from the Linac to the positron target. A feedforward control loop has been developed to compensate the energy fluctuations due to the beam intensity fluctuations. The loop detects the beam intensities in the damping rings and then calculates how much energy needs to be compensated due to beam loading effects. The energy is corrected by adjusting the acceleration phases of two sets of klystrons right before the extraction. Because there is feedback loop using the same controls, their interaction needs to be carefully treated. This paper presents an overview of the feedforward algorithms

  7. The energy stabilization for the SLC scavenger beam

    International Nuclear Information System (INIS)

    Hsu, Ian; Browne, M.; Himel, T.; Humphrey, R.; Jobe, K.; Ross, M.; Pellegrin, J.L.; Seeman, J.

    1990-08-01

    The energy of the SLC scavenger beam which is used to produce positrons must be carefully maintained so that the beam can be transported through the collimators in the dispersive region of the extraction line which leads from the Linac to the positron target. A feedforward control loop has been developed to compensate the energy fluctuations due to the beam intensity fluctuations. The loop detects the beam intensities in the damping rings and then calculates how much energy needs to be compensated due to beam loading effects. The energy is corrected by adjusting the acceleration phases of two sets of klystrons right before the extraction. Because there is feedback loop using the same controls, their interaction needs to be carefully treated. This paper presents an overview of the feedforward algorithms. 3 figs

  8. Application of online modeling to the operation of SLC

    International Nuclear Information System (INIS)

    Woodley, M.D.; Sanchez-Chopitea, L.; Shoaee, H.

    1987-02-01

    Online computer models of first order beam optics have been developed for the commissioning, control and operation of the entire SLC including Damping Rings, Linac, Positron Return Line and Collider Arcs. A generalized online environment utilizing these models provides the capability for interactive selection of a desired optics configuration and for the study of its properties. Automated procedures have been developed which calculate and load beamline component set-points and which can scale magnet strengths to achieve desired beam properties for any Linac energy profile. Graphic displays facilitate comparison of design, desired and actual optical characteristics of the beamlines. Measured beam properties, such as beam emittance and dispersion, can be incorporated interactively into the models and used for beamline matching and optimization of injection and extraction efficiencies and beam transmission. The online optics modeling facility also serves as the foundation for many model-driven applications such as autosteering, calculation of beam launch parameters, emittance measurement and dispersion correction

  9. Emittance damping considerations for TESLA

    International Nuclear Information System (INIS)

    Floettmann, K.; Rossbach, J.

    1993-03-01

    Two schemes are considered to avoid very large damping rings for TESLA. The first (by K.F.) makes use of the linac tunnel to accomodate most of the damping 'ring' structure, which is, in fact, not a ring any more but a long linear structure with two small bends at each of its ends ('dog-bone'). The other scheme (by J.R.) is based on a positron (or electron, respectively) recycling scheme. It makes use of the specific TESLA property, that the full bunch train is much longer (240 km) than the linac length. The spent beams are recycled seven times after interaction, thus reducing the number of bunches to be stored in the damping ring by a factor of eight. Ultimately, this scheme can be used to operate TESLA in a storage ring mode ('storage linac'), with no damping ring at all. Finally, a combination of both schemes is considered. (orig.)

  10. Physics at the SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1990-11-01

    The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam

  11. SLAC-Linac-Collider (SLC) Project

    International Nuclear Information System (INIS)

    Wiedemann, H.

    1981-02-01

    The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system

  12. Broadband feedback systems for the damping of coherent beam instabilities in the stretcher ring ELSA; Breitbandige Feedback-Systeme zur Daempfung kohaerenter Strahlinstabilitaeten am Stretcherring ELSA

    Energy Technology Data Exchange (ETDEWEB)

    Roth, Andre

    2012-12-15

    At the Electron Stretcher Facility ELSA an upgrade of the internal beam current up to 200 mA would be desirable in order to increase the intensity of the extracted electron beam for the future experimental hadron physics program. However, such an upgrade is mainly limited by the excitation of coherent beam instabilities in the stretcher ring. As active counteraction, broadband bunch-by-bunch feedback-systems for the longitudinal, as well as for both transverse planes were installed. After detection of the motion of each of the 27 4 stored bunches via beam position monitors, the systems determine independent correction signals for each bunch using digital signal processors. The amplified correction signals are applied to the beam by means of broadband longitudinal and transverse kicker structures. The detailed setup, the commissioning procedure and measurement results of the damping performance of the systems are presented. In addition, the operation of the longitudinal system during the fast energy ramp of 4 GeV/s from 1.2 GeV to 3.2 GeV is investigated.

  13. Quadratic Damping

    Science.gov (United States)

    Fay, Temple H.

    2012-01-01

    Quadratic friction involves a discontinuous damping term in equations of motion in order that the frictional force always opposes the direction of the motion. Perhaps for this reason this topic is usually omitted from beginning texts in differential equations and physics. However, quadratic damping is more realistic than viscous damping in many…

  14. Pipe damping

    International Nuclear Information System (INIS)

    Ware, A.G.

    1985-01-01

    Studies are being conducted at the Idaho National Engineering Laboratory to determine whether an increase in the damping values used in seismic structural analyses of nuclear piping systems is justified. Increasing the allowable damping would allow fewer piping supports which could lead to safer, more reliable, and less costly piping systems. Test data from availble literature were examined to determine the important parameters contributing to piping system damping, and each was investigated in separate-effects tests. From the combined results a world pipe damping data bank was established and multiple regression analyses performed to assess the relative contributions of the various parameters. The program is being extended to determine damping applicable to higher frequency (33 to 100 Hz) fluid-induced loadings. The goals of the program are to establish a methodology for predicting piping system damping and to recommend revised guidelines for the damping values to be included in analyses

  15. Coulomb Damping

    Science.gov (United States)

    Fay, Temple H.

    2012-01-01

    Viscous damping is commonly discussed in beginning differential equations and physics texts but dry friction or Coulomb friction is not despite dry friction being encountered in many physical applications. One reason for avoiding this topic is that the equations involve a jump discontinuity in the damping term. In this article, we adopt an energy…

  16. SLC ir conceptual design

    International Nuclear Information System (INIS)

    Keller, L.P.

    1982-01-01

    Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment

  17. Essay: Bob Siemann-SLC Days at SLAC

    International Nuclear Information System (INIS)

    Raubenheimer, Tor O.

    2008-01-01

    Bob Siemann was a great experimentalist and an excellent teacher.We will greatly miss him. Bob came to SLAC in early 1991 to work on the Stanford Linear Collider (SLC). The SLC was a challenging accelerator which began operating in the late 1980's but still had numerous obstacles to be overcome years into operation. One of the compounding difficulties was making reproducible measurements, since the stability of the collider was poor and the diagnostics were insufficient. Bob dove into this challenge and helped design experiments and diagnostics that provided further clarity. I first got to know Bob while I was still a graduate student, trying to finish my thesis and performing some experimental studies on the SLC, which, at the time, was proving to be very difficult. Most of my expertise had been in beam theory and simulation. Dealing with the real issues of the accelerator was challenging. Bob helped me understand the difference between systematic and statistical errors, and separate operational issues from the fundamental physics. His way of teaching was not to provide an explanation but to ask enough questions so that I could find the answer on my own - this was the best way to learn. I later asked Bob to be a reader on my thesis. As in all things, he took this role extremely seriously. He read through the draft and marked every page to the point where I was regretting my decision. However, his questions again helped me understand my own work better and greatly improved my thesis. Bob was also the de facto leader of an effort focused on the damping rings and the bunch compressors. He was great to work with. He made people think for themselves and refused to simply provide answers. He also worked hard himself, expressing real interest and curiosity. After the studies of the SLC damping rings identified a sawtooth instability due to the vacuum chamber impedance as a source of many downstream fluctuations, Bob took charge of upgrading the rings. As part of this

  18. Review of SLC performance

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-08-01

    The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions

  19. Pipe damping

    International Nuclear Information System (INIS)

    Ware, A.G.; Arendts, J.G.

    1984-01-01

    A program has been developed to assess the available piping damping data, to generate additional data and conduct seperate effects tests, and to establish a plan for reporting and storing future test results into a data bank. This effort is providing some of the basis for developing higher allowable damping values for piping seismic analyses, which will potentially permit removal of a considerable number of piping supports, particularly snubbers. This in turn will lead to more flexible piping systems which will be less susceptible to thermal cracking, will be easier to maintain and inspect, as well as less costly

  20. Some uses of REPMM's in storage rings and colliders

    International Nuclear Information System (INIS)

    Spencer, J.E.

    1985-04-01

    Improvements for existing rings and techniques for building new rings composed entirely of passive, Rare Earth Permanent Magnet Multipoles (REPMM's) are considered using circular dipoles, quadrupoles and sextupoles. Over the past few years we have made such magnets using a single size SmCo 5 block with up to five easy-axis orientations. The final production scheme is modular in that magnets are built-up from quantized layers. All multipole layers are made in exactly the same way using algorithms differing only by the desired multipole symmetry. The method is simple, efficient and inexpensive and allows a ''do-it-yourself'' approach to constructing new magnetic elements. For rings these might include focusing optical klystrons, rotatable multipoles for diagnostics, correction or extraction, or possibly combined function systems for the unit cells. A high quality, low-beta, PMQ insertion which can change beta, tune and energy is described as well as the PMS's for the SD and SF elements of the North SLC damping ring. Because these sextupoles will be the first optical use of PM's in storage rings they are discussed in detail together with the advantages, problems and requirements of such applications. 8 refs., 4 figs

  1. SLC status and SLAC future plans

    International Nuclear Information System (INIS)

    Richter, B.

    1990-01-01

    In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high-energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of higher-energy linear colliders. SLAC has a major colliding-beam storage-ring program as well, including present rings and design studies on future high luminosity projects, but time constraints preclude a discussion of them. (author) 8 figs., 3 tabs

  2. Polarization at SLC

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1988-07-01

    The SLAC Linear Collider has been designed to readily accommodate polarized electron beams. Considerable effort has been made to implement a polarized source, a spin rotation system, and a system to monitor the beam polarization. Nearly all major components have been fabricated. At the current time, several source and polarimeter components have been installed. The installation and commissioning of the entire system will take place during available machine shutdown periods as the commissioning of SLC progresses. It is expected that a beam polarization of 45% will be achieved with no loss in luminosity. 13 refs., 15 figs

  3. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  4. Damping Wiggler Study at KEK-ATF

    CERN Document Server

    Naito, Takashi; Honda, Yosuke; Korostelev, Maxim S; Kubo, Kiyoshi; Kuriki, Masao; Kuroda, Shigeru; Muto, Toshiya; Nakamura, Norio; Ross, Marc; Sakai, Hiroshi; Terunuma, Nobuhiro; Urakawa, Junji; Zimmermann, Frank

    2005-01-01

    The effects by damping wiggler magnets have been studied at KEK-ATF. The damping ring of the KEK-ATF is a 1.3 GeV storage ring capable of producing ultra-low emittance electron beams. It is significant issue to realize fast damping in the damping ring. The tuning method with 4 sets of wiggler was investigated for the ultra-low emittance beam. The performance on the beam quality, which is related to the transverse (x and y) and the longitudinal (z and dp/p), has been measured by the SR monitor, the laser wire, the streak camera and the energy spread monitor at the extraction line. We report on the operation condition and the measurement results.

  5. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  6. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  7. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  8. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  9. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  10. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  11. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  12. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  13. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  14. Spin motion of electrons in the SLC linac

    International Nuclear Information System (INIS)

    Panofsky, W.K.H.

    1990-01-01

    It is generally expected that the depolarizing effects of the linear accelerator RF fields will be small. Recently Bill Atwood raised the question whether this conclusion is still correct in view of the fact that the particles in the SLC spend a larger fraction of their time at phase angles ''off crest'' due to BNS damping; since radial fields are in quadrature with the accelerating field this might imply that depolarizing effects are larger. On the other hand, because of the smaller emittance of the SLC relative to the earlier linac radial excursions would be smaller. The anticipation is therefore that the depolarizing effect will again be negligible but it might be worthwhile to update the early calculations of SLAC TN-63-97 revised in this paper

  15. Positron Options for the Linac-Ring LHeC

    CERN Document Server

    Zimmermann, F; Papaphilippou, Y; Schulte, D; Sievers, P; Rinolfi, L; Variola, A; Zomer, F; Braun, H H; Yakimenko, V; Bulyak, E V; Klein, M

    2012-01-01

    The full physics program of a future Large Hadron electron Collider (LHeC) [1] requires both pe+ and pe− collisions. For a pulsed 140-GeV or an ERL-based 60-GeV Linac-Ring LHeC this implies a challenging rate of, respectively, about 1.8 × 1015 or 4.4 × 1016 e+/s at the collision point, which is about 300 or 7000 times the rate previously obtained, at the SLAC Linear Collider (SLC). We consider providing this e+ rate through a combination of measures: (1) Reducing the required production rate from the e+ target through colliding e+ (and the LHC protons) several times before deceleration, by reusing the e+ over several acceleration/deceleration cycles, and by cooling them, e.g., with a compact tri-ring scheme or a conventional damping ring in the SPS tunnel. (2) Using an advanced target, e.g., W-granules, rotating wheel, slicedrod converter, or liquid metal jet, for converting gamma rays to e+. (3) Selecting the most powerful of several proposed gamma sources, namely Compton ERL, Compton storage ring, coher...

  16. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  17. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  18. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  19. Stanford: SLC back in action

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-05-15

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  20. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  1. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  2. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  3. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  4. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  5. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  6. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  7. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  8. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  9. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  10. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  11. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  12. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  13. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  14. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  15. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  16. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  17. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  18. Damped nonlinear Schrodinger equation

    International Nuclear Information System (INIS)

    Nicholson, D.R.; Goldman, M.V.

    1976-01-01

    High frequency electrostatic plasma oscillations described by the nonlinear Schrodinger equation in the presence of damping, collisional or Landau, are considered. At early times, Landau damping of an initial soliton profile results in a broader, but smaller amplitude soliton, while collisional damping reduces the soliton size everywhere; soliton speeds at early times are unchanged by either kind of damping. For collisional damping, soliton speeds are unchanged for all time

  19. Lessons learned from the SLC

    Energy Technology Data Exchange (ETDEWEB)

    Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center

    1998-07-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.

  20. Stanford: SLC back in action

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  1. Lessons learned from the SLC

    International Nuclear Information System (INIS)

    Phinney, N.

    1998-01-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider

  2. Next generation HOM-damping

    Science.gov (United States)

    Marhauser, Frank

    2017-06-01

    can push the envelope towards quasi HOM-free operation suited for next generation storage and collider rings. Geometrical end-cell shape alterations for the five-cell cavity with already efficient mode damping are discussed as a possibility to further lower specific high impedance modes. The findings are eventually put into relation with demanding impedance instability thresholds in future collider rings.

  3. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  4. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  5. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  6. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  7. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  8. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  9. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  10. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  11. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  12. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  13. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  14. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  15. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  16. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  17. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  18. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  19. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  20. The SLC polarized electron source

    International Nuclear Information System (INIS)

    Clendenin, J.E.

    1990-10-01

    A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs

  1. Magnetic Damping For Maglev

    Directory of Open Access Journals (Sweden)

    S. Zhu

    1998-01-01

    Full Text Available Magnetic damping is one of the important parameters that control the response and stability of maglev systems. An experimental study to measure magnetic damping directly is presented. A plate attached to a permanent magnet levitated on a rotating drum was tested to investigate the effect of various parameters, such as conductivity, gap, excitation frequency, and oscillation amplitude, on magnetic damping. The experimental technique is capable of measuring all of the magnetic damping coefficients, some of which cannot be measured indirectly.

  2. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  3. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  4. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  5. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  6. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  7. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  8. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  9. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  10. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  11. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  12. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  13. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  14. Power oscillation damping controller

    DEFF Research Database (Denmark)

    2012-01-01

    A power oscillation damping controller is provided for a power generation device such as a wind turbine device. The power oscillation damping controller receives an oscillation indicating signal indicative of a power oscillation in an electricity network and provides an oscillation damping control...

  15. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  16. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  17. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  18. The damped wave equation with unbounded damping

    Czech Academy of Sciences Publication Activity Database

    Freitas, P.; Siegl, Petr; Tretter, C.

    2018-01-01

    Roč. 264, č. 12 (2018), s. 7023-7054 ISSN 0022-0396 Institutional support: RVO:61389005 Keywords : damped wave equation * unbounded damping * essential spectrum * quadratic operator funciton with unbounded coefficients * Schrodinger operators with complex potentials Subject RIV: BE - Theoretical Physics OBOR OECD: Atomic, molecular and chemical physics (physics of atoms and molecules including collision, interaction with radiation, magnetic resonances, Mössbauer effect) Impact factor: 1.988, year: 2016

  19. External Coulomb-Friction Damping For Hydrostatic Bearings

    Science.gov (United States)

    Buckmann, Paul S.

    1992-01-01

    External friction device damps vibrations of shaft and hydrostatic ring bearing in which it turns. Does not rely on wear-prone facing surfaces. Hydrostatic bearing ring clamped in radially flexing support by side plates clamped against radial surfaces by spring-loaded bolts. Plates provide friction against radial motions of shaft.

  20. Damping in accelerators due to classical radiation

    International Nuclear Information System (INIS)

    Mills, F.E.

    1962-01-01

    The rates of change of the magnitudes of the adiabatic invariants is calculated in the case of a Hamiltonian system subjected to generalized non conservative forces. These results are applied to the case of the classical radiation of electrons in an accelerator or storage ring. The resulting expressions for the damping rates of three independent oscillation modes suggest structures which are damping in all three modes, while at the same time allowing 'strong focussing' and the attendant strong momentum compaction. (author)

  1. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  2. SLC status and NLC design and R and D

    International Nuclear Information System (INIS)

    Raubenheimer, T.O.

    1996-09-01

    In this paper, the authors will first review the status of the Stanford Linear Collider (SLC). In particular, they discuss the luminosity and performance issues and the accelerator studies that relate to future linear colliders. Next, they describe the present state of the Next Linear Collider (NLC) design and the ongoing R and D effort which is, in addition to the work at the SLC, supporting the design. This includes extensive ground motion measurements to verify the required stability, measurements of the dipole wakefields to verify the performance of the Damped-Detuned accelerator Structures (DDS), and tests of the rf structure BPMs that are needed to align the structure to the beam trajectory. It also includes the development and fabrication of the X-band structures, klystrons, and rf pulse compressors that are needed to accelerate the beams with gradients in excess of 50 MV/m. It should be noted that much of the material reported here is described in greater detail in other papers submitted to this conference and thus the appropriate references are included throughout. In addition, because of space limitations, they only briefly describe the design of the NLC and, instead, concentrate on the R and D that is supporting the design

  3. Damping in Timber Structures

    OpenAIRE

    Labonnote, Nathalie

    2012-01-01

    Key point to development of environmentally friendly timber structures, appropriate to urban ways of living, is the development of high-rise timber buildings. Comfort properties are nowadays one of the main limitations to tall timber buildings, and an enhanced knowledge on damping phenomena is therefore required, as well as improved prediction models for damping. The aim of this work has consequently been to estimate various damping quantities in timber structures. In particular, models h...

  4. SLC status and SLAC [Stanford Linear Accelerator Center] future plans

    International Nuclear Information System (INIS)

    Richter, B.

    1989-08-01

    In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of high-energy linear colliders. SLAC had a major colliding-beam storage-ring program as well, including present rings and design studies on future high-luminosity projects, but time constraints preclude a discussion of them. 8 figs., 3 tabs

  5. The damped wave equation with unbounded damping

    Science.gov (United States)

    Freitas, Pedro; Siegl, Petr; Tretter, Christiane

    2018-06-01

    We analyze new phenomena arising in linear damped wave equations on unbounded domains when the damping is allowed to become unbounded at infinity. We prove the generation of a contraction semigroup, study the relation between the spectra of the semigroup generator and the associated quadratic operator function, the convergence of non-real eigenvalues in the asymptotic regime of diverging damping on a subdomain, and we investigate the appearance of essential spectrum on the negative real axis. We further show that the presence of the latter prevents exponential estimates for the semigroup and turns out to be a robust effect that cannot be easily canceled by adding a positive potential. These analytic results are illustrated by examples.

  6. Decoherence and Landau-Damping

    Energy Technology Data Exchange (ETDEWEB)

    Ng, K.Y.; /Fermilab

    2005-12-01

    The terminologies, decoherence and Landau damping, are often used concerning the damping of a collective instability. This article revisits the difference and relation between decoherence and Landau damping. A model is given to demonstrate how Landau damping affects the rate of damping coming from decoherence.

  7. SLC Final Performance and Lessons

    International Nuclear Information System (INIS)

    Phinney, Nan

    2000-01-01

    The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined

  8. Fuel Assembly Damping Summary

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kanghee; Kang, Heungseok; Oh, Dongseok; Yoon, Kyungho; Kim, Hyungkyu; Kim, Jaeyong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-10-15

    This paper summary the fuel assembly damping data in air/in still water/under flow, released from foreign fuel vendors, compared our data with the published data. Some technical issues in fuel assembly damping measurement testing are also briefly discussed. Understanding of each fuel assembly damping mechanisms according to the surrounding medium and flow velocity can support the fuel design improvement in fuel assembly dynamics and structural integrity aspect. Because the upgraded requirements of the newly-developed advanced reactor system will demands to minimize fuel design margin in integrity evaluation, reduction in conservatism of fuel assembly damping can contribute to alleviate the fuel design margin for sure. Damping is an energy dissipation mechanism in a vibrating mechanical structure and prevents a resonant structure from having infinite vibration amplitudes. The sources of fuel assembly damping are various from support friction to flow contribution, and it can be increased by the viscosity or drag of surrounding fluid medium or the average velocity of water flowing. Fuel licensing requires fuel design evaluation in transient or accidental condition. Dynamic response analysis of fuel assembly is to show fuel integrity and requires information on assembly-wise damping in dry condition and under wet or water flowing condition. However, damping measurement test for the full-scale fuel assembly prototype is not easy to carry out because of the scale (fuel prototype, test facility), unsteadiness of test data (scattering, random sampling and processing), instrumentation under water flowing (water-proof response measurement), and noise. LWR fuel technology division in KAERI is preparing the infra structure for damping measurement test of full-scale fuel assembly, to support fuel industries and related research activities. Here is a preliminary summary of fuel assembly damping, published in the literature. Some technical issues in fuel assembly damping

  9. Secondary vertex detection at the SLC

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    The vertex topology of a high energy e + e - interaction contains a wealth of information. These interactions copiously produce the tau lepton and hadrons containing the c and b quarks; all these particles decay within a millimeter or so of the primary interaction point, giving these interactions a rich secondary vertex structure. With suitable detectors, one can hope to reconstruct these vertices and so tag events with tau's, c's and b's; measure lifetimes and mixing angles; and perhaps directly measure the flavor of c and b jets. The spatial resolution and track-pair resolution required of such detectors demand detector development, but several techniques, including solid state microstrip and CCD detectors, pressurized drift chambers, and holographic bubbble chambers look promising. Vertex detection in the colliding beam environment has already yielded a measurement of the tau lifetime. The SLC, with its micron-sized beam and one-centimeter sized beam pipe is uniquely suited for these studies. Compared to conventional storage rings, it offers a well-defined and minute primary interaction point, the possibility of locating a detector within a centimeter of the interaction (an order of magnitude improvement over LEP), negligibly thin beam pipes, and a repetition rate low enough to permit novel detectors and readout schemes. This report discusses the physics accessible with vertex detectors, depicts the physics environment at 100 GeV - particle multiplicities, momenta, angular correlations, and topologies of charm decays, sketches the elements of a vertex detector, and, through some model studies evaluates the spatial resolution and track-pair resolution requirements, and summarizes the detector technologies which seem most promising for vertex detection

  10. Landau Damping Revisited

    International Nuclear Information System (INIS)

    Rees, John; Chao, Alexander

    2008-01-01

    Landau damping, as the term is used in accelerator science, is a physical process in which an ensemble of harmonic oscillators--an accelerator beam, for example--that would otherwise be unstable is stabilized by a spread in the natural frequencies of the oscillators. This is a study of the most basic aspects of that process. It has two main goals: to gain a deeper insight into the mechanism of Landau damping and to find the coherent motion of the ensemble and thus the dependence of the total damping rate on the frequency spread

  11. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  12. Making electron beams for the SLC linac

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.

    1984-01-01

    A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table

  13. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient superconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  14. The polarized electron gun for the SLC

    International Nuclear Information System (INIS)

    Schultz, D.C.; Clendenin, J.; Frisch, J.; Hoyt, E.; Klaisner, L.; Woods, M.; Wright, D.; Zolotorev, M.

    1992-03-01

    A new polarized electron gun for use on the SLC at SLAC has been built and tested. It is a diode gun with a laser driven GaAs photocathode. It is designed to provide short (2ns) pulses of 10 A at 160 kV at 120 Hz. The design features of the gun and results from a testing program on a new and dedicated beam line are presented. Early results from operation on the SLC will also be shown

  15. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient supperconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  16. Survey of beam instrumentation used in SLC

    International Nuclear Information System (INIS)

    Ecklund, S.D.

    1991-03-01

    A survey of beam instruments used at SLAC in the SLC machine is presented. The basic utility and operation of each device is briefly described. The various beam instruments used at the Stanford Linear Collider (SLC), can be classified by the function they perform. Beam intensity, position and size are typical of the parameters of beam which are measured. Each type of parameter is important for adjusting or tuning the machine in order to achieve optimum performance. 39 refs

  17. DAMPs, ageing, and cancer: The 'DAMP Hypothesis'.

    Science.gov (United States)

    Huang, Jin; Xie, Yangchun; Sun, Xiaofang; Zeh, Herbert J; Kang, Rui; Lotze, Michael T; Tang, Daolin

    2015-11-01

    Ageing is a complex and multifactorial process characterized by the accumulation of many forms of damage at the molecular, cellular, and tissue level with advancing age. Ageing increases the risk of the onset of chronic inflammation-associated diseases such as cancer, diabetes, stroke, and neurodegenerative disease. In particular, ageing and cancer share some common origins and hallmarks such as genomic instability, epigenetic alteration, aberrant telomeres, inflammation and immune injury, reprogrammed metabolism, and degradation system impairment (including within the ubiquitin-proteasome system and the autophagic machinery). Recent advances indicate that damage-associated molecular pattern molecules (DAMPs) such as high mobility group box 1, histones, S100, and heat shock proteins play location-dependent roles inside and outside the cell. These provide interaction platforms at molecular levels linked to common hallmarks of ageing and cancer. They can act as inducers, sensors, and mediators of stress through individual plasma membrane receptors, intracellular recognition receptors (e.g., advanced glycosylation end product-specific receptors, AIM2-like receptors, RIG-I-like receptors, and NOD1-like receptors, and toll-like receptors), or following endocytic uptake. Thus, the DAMP Hypothesis is novel and complements other theories that explain the features of ageing. DAMPs represent ideal biomarkers of ageing and provide an attractive target for interventions in ageing and age-associated diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Ring Theory

    CERN Document Server

    Jara, Pascual; Torrecillas, Blas

    1988-01-01

    The papers in this proceedings volume are selected research papers in different areas of ring theory, including graded rings, differential operator rings, K-theory of noetherian rings, torsion theory, regular rings, cohomology of algebras, local cohomology of noncommutative rings. The book will be important for mathematicians active in research in ring theory.

  19. Extended Rayleigh Damping Model

    Directory of Open Access Journals (Sweden)

    Naohiro Nakamura

    2016-07-01

    Full Text Available In dynamic analysis, frequency domain analysis can be used if the entire structure is linear. However, time history analysis is generally used if nonlinear elements are present. Rayleigh damping has been widely used in time history response analysis. Many articles have reported the problems associated with this damping and suggested remedies. A basic problem is that the frequency area across which the damping ratio is almost constant is too narrow. If the area could be expanded while incurring only a small increase in computational cost, this would provide an appropriate remedy for this problem. In this study, a novel damping model capable of expanding the constant frequency area by more than five times was proposed based on the study of a causal damping model. This model was constructed by adding two terms to the Rayleigh damping model and can be applied to the linear elements in the time history analysis of a nonlinear structure. The accuracy and efficiency of the model were confirmed using example analyses.

  20. Low emittance electron storage rings

    Science.gov (United States)

    Levichev, E. B.

    2018-01-01

    Low-emittance electron (positron) beams are essential for synchrotron light sources, linear collider damping rings, and circular Crab Waist colliders. In this review, the principles and methods of emittance minimization are discussed, prospects for developing relativistic electron storage rings with small beam phase volume are assessed, and problems related to emittance minimization are examined together with their possible solutions. The special features and engineering implementation aspects of various facilities are briefly reviewed.

  1. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  2. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  3. SLAC modulator operation and reliability in the SLC Era

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Ashton, J.R.

    1992-06-01

    A discussion of the operation and reliability of the 244 modulators in the SLAC linac with an emphasis on the past three years of operation. The linac modulators were designed and built in the 60's, upgraded for the SLAC Linear Collider (SLC) in the mid 80s, and despite their age are still reliable accelerator components. The 60s modulator operated at 65 MW peak and 83 kW average power. The upgrade resulted in 150 MW peak output at an average power of 87 kW, a modest increase since the repetition rate was dropped from 360 to 120 Hz. In the present accelerator configuration, the Linac operates as a source of electrons and positrons to a single pass coillider. The classic collider is a storage ring filled with oppositely charged, counter-rotating particles which are allowed to collide until an accelerator fault occurs and the stored beams are aborted. A reasonable storage ring can store and collide particles for as long as eight hours with a 10 or 20 minute filling time. A single pass collider, + on the other hand, can only produce e - and e + collisions at whatever rate the source operates. To be effective the SLC must operate at 120 Hz with a very high degree of reliability and on a continuous basis. Fortunately, the linac has a modest excess of modulator/klystron systems which allows some measure of redundancy and hence some freedom from the constraint that all 244 modulator/klystrons operate simultaneously. Nonetheless, high importance is placed on modulator MTBF and MTRR or, in the parlance of reliability experts and accelerator physicists, availability. This is especially true of the modulators associated with the fundamental requirements of a collider such as injection, compression and positron production

  4. Measurement of the longitudinal parameters of an electron beam in a storage ring

    International Nuclear Information System (INIS)

    Krinsky, S.

    1989-01-01

    We discuss the determination of the longitudinal parameters of a bunched beam of electrons or positrons circulating in a storage ring. From the analysis of the beam current observed at a fixed azimuthal location, one can learn much about the longitudinal behavior. We present an elementary analysis of the time-dependence of the current. In particular, we discuss the determination of the average current, bunch length, synchrotron oscillation frequency, and the coherent synchrotron oscillation modes associated with longitudinal instabilities. A brief discussion is also given of the incoherent synchrotron oscillations, or Schottky noise. We review the electromagnetic field traveling with a charge in uniform motion, and introduce some of the most common devices used to detect this field: capacitive pick-up, stripline monitor, and DC beam current transformer. Our paper is organized as follows: We discuss the analysis of the time-dependence of the beam current. Then, the measurement of the current is considered. Finally, we describe some measurements of energy spread and bunch lengthening made recently at SLAC on the SLC damping ring. 12 refs., 6 figs

  5. Pipe damping studies

    International Nuclear Information System (INIS)

    Ware, A.G.

    1986-01-01

    The Idaho National Engineering Laboratory (INEL) is conducting a research program to assist the United States Nuclear Regulatory Commission (USNRC) in determining best-estimate damping values for use in the dynamic analysis of nuclear power plant piping systems. This paper describes four tasks in the program that were undertaken in FY-86. In the first task, tests were conducted on a 5-in. INEL laboratory piping system and data were analyzed from a 6-in. laboratory system at the ANCO Engineers facility to investigate the parameters influencing damping in the seismic frequency range. Further tests were conducted on 3- and 5-in. INEL laboratory piping systems as the second task to determine damping values representative of vibrations in the 33 to 100 Hz range, typical of hydrodynamic transients. In the third task a statistical evaluation of the available damping data was conduted to determine probability distributions suitable for use in probabilistic risk assessments (PRAs), and the final task evaluated damping data at high strain levels

  6. Process Damping Parameters

    International Nuclear Information System (INIS)

    Turner, Sam

    2011-01-01

    The phenomenon of process damping as a stabilising effect in milling has been encountered by machinists since milling and turning began. It is of great importance when milling aerospace alloys where maximum surface speed is limited by excessive tool wear and high speed stability lobes cannot be attained. Much of the established research into regenerative chatter and chatter avoidance has focussed on stability lobe theory with different analytical and time domain models developed to expand on the theory first developed by Trusty and Tobias. Process damping is a stabilising effect that occurs when the surface speed is low relative to the dominant natural frequency of the system and has been less successfully modelled and understood. Process damping is believed to be influenced by the interference of the relief face of the cutting tool with the waveform traced on the cut surface, with material properties and the relief geometry of the tool believed to be key factors governing performance. This study combines experimental trials with Finite Element (FE) simulation in an attempt to identify and understand the key factors influencing process damping performance in titanium milling. Rake angle, relief angle and chip thickness are the variables considered experimentally with the FE study looking at average radial and tangential forces and surface compressive stress. For the experimental study a technique is developed to identify the critical process damping wavelength as a means of measuring process damping performance. For the range of parameters studied, chip thickness is found to be the dominant factor with maximum stable parameters increased by a factor of 17 in the best case. Within the range studied, relief angle was found to have a lesser effect than expected whilst rake angle had an influence.

  7. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  8. Generalized fast feedback system in the SLC

    International Nuclear Information System (INIS)

    Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.

    1992-01-01

    A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine. (author)

  9. Generalized fast feedback system in the SLC

    International Nuclear Information System (INIS)

    Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.

    1991-11-01

    A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine

  10. Oscillation damping of chiral string loops

    International Nuclear Information System (INIS)

    Babichev, Eugeny; Dokuchaev, Vyacheslav

    2002-01-01

    Chiral cosmic string loops tend to the stationary (vorton) configuration due to energy loss into gravitational and electromagnetic radiation. We describe the asymptotic behavior of near stationary chiral loops and their fading to vortons. General limits on the gravitational and electromagnetic energy losses by near stationary chiral loops are found. For these loops we estimate the oscillation damping time. We present solvable examples of gravitational radiation energy loss by some chiral loop configurations. The analytical dependence of string energy with time is found in the case of the chiral ring with small amplitude radial oscillations

  11. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  12. RF phase distribution systems at the SLC

    International Nuclear Information System (INIS)

    Jobe, R.K.; Schwarz, H.D.

    1989-04-01

    Modern large linear accelerators require RF distribution systems with minimal phase drifts and errors. Through the use of existing RF coaxial waveguides, and additional installation of phase reference cables and monitoring equipment, stable RF distribution for the SLC has been achieved. This paper discusses the design and performance of SLAC systems, and some design considerations for future colliders. 6 refs., 4 figs

  13. Klystron control software in the SLC

    International Nuclear Information System (INIS)

    Jobe, R.K.; Thompson, K.; Phinney, N.

    1985-05-01

    Triggering, control, and monitoring of 240 high-power klystrons will be supported by the SLC control system this summer. The control software is distributed among a VAX host computer, a local microprocessor cluster, and a dedicated intelligent CAMAC module. The functions performed by these three components and the algorithms used are discussed

  14. Report on the SLC control system

    International Nuclear Information System (INIS)

    Phinney, N.

    1985-05-01

    The SLC control system is based on a VAX 11/780 Host computer with approximately 50 microprocessor clusters which provide distributed intelligence and control of all CAMAC interface modules. This paper will present an overview of the system including current status and a description of the software architecture and communication protocols. 8 refs

  15. STANFORD: Highly polarized SLC electron beams

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

  16. Damping of Coherent oscillations

    CERN Document Server

    Vos, L

    1996-01-01

    Damping of coherent oscillations by feedback is straightforward in principle. It has been a vital ingredient for the safe operation of accelerators since a long time. The increasing dimensions and beam intensities of the new generation of hadron colliders impose unprecedented demands on the performance of future systems. The arguments leading to the specification of a transverse feedback system for the CERN SPS in its role as LHC injector and the LHC collider itself are developped to illustrate this. The preservation of the transverse emittance is the guiding principle during this exercise keeping in mind the hostile environment which comprises: transverse impedance bent on developping coupled bunch instabilities, injection errors, unwanted transverse excitation, unavoidable tune spreads and noise in the damping loop.

  17. Dislocation damping during irradiation

    International Nuclear Information System (INIS)

    Burdett, C.F.; Rahmatalla, H.

    1977-01-01

    The results of Simpson et al (Simpson, H.M., Sosin, A., Johnston, D.F., Phys.Rev. B, 5:1393 (1972)) on the damping produced during electron irradiation of copper are re-examined and it is shown that they can be explained in terms of the model of Granato and Lucke (Granato, A., Lucke, K., J.Appl.Phys., 27:583,789 (1958)). (author)

  18. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  19. On Landau damping

    KAUST Repository

    Mouhot, Clément

    2011-09-01

    Going beyond the linearized study has been a longstanding problem in the theory of Landau damping. In this paper we establish exponential Landau damping in analytic regularity. The damping phenomenon is reinterpreted in terms of transfer of regularity between kinetic and spatial variables, rather than exchanges of energy; phase mixing is the driving mechanism. The analysis involves new families of analytic norms, measuring regularity by comparison with solutions of the free transport equation; new functional inequalities; a control of non-linear echoes; sharp "deflection" estimates; and a Newton approximation scheme. Our results hold for any potential no more singular than Coulomb or Newton interaction; the limit cases are included with specific technical effort. As a side result, the stability of homogeneous equilibria of the non-linear Vlasov equation is established under sharp assumptions. We point out the strong analogy with the KAM theory, and discuss physical implications. Finally, we extend these results to some Gevrey (non-analytic) distribution functions. © 2011 Institut Mittag-Leffler.

  20. Black rings

    International Nuclear Information System (INIS)

    Emparan, Roberto; Reall, Harvey S

    2006-01-01

    A black ring is a five-dimensional black hole with an event horizon of topology S 1 x S 2 . We provide an introduction to the description of black rings in general relativity and string theory. Novel aspects of the presentation include a new approach to constructing black ring coordinates and a critical review of black ring microscopics. (topical review)

  1. White Ring; White ring

    Energy Technology Data Exchange (ETDEWEB)

    Aoki, H.; Yuzawa, H. [Nikken Sekkei Ltd., Osaka (Japan)

    1998-01-05

    White Ring is a citizen`s gymnasium used for figure skating and short track speed skating games of 18th Winter Olympic Games in 1998. White Ring is composed of a main-arena and a sub-arena. For the main-arena with an area 41mtimes66m, an ice link can be made by disengaging the potable floor and by flowing brine in the bridged polystyrene pipes embedded in the concrete floor. Due to the fortunate groundwater in this site, well water is used for the outside air treatment energy in 63% during heating and in 35% during cooling. Ammonia is used as a cooling medium for refrigerating facility. For the heating of audience area in the large space, heat load from the outside is reduced by enhancing the heat insulation performance of the roof of arena. The audience seats are locally heated using heaters. For the White Ring, high quality environment is realized for games through various functions of the large-scale roof of the large space. Success of the big event was expected. 15 figs., 4 tabs.

  2. Damping measurements in flowing water

    Science.gov (United States)

    Coutu, A.; Seeley, C.; Monette, C.; Nennemann, B.; Marmont, H.

    2012-11-01

    Fluid-structure interaction (FSI), in the form of mass loading and damping, governs the dynamic response of water turbines, such as Francis turbines. Water added mass and damping are both critical quantities in evaluating the dynamic response of the turbine component. Although the effect of fluid added mass is well documented, fluid damping, a critical quantity to limit vibration amplitudes during service, and therefore to help avoiding possible failure of the turbines, has received much less attention in the literature. This paper presents an experimental investigation of damping due to FSI. The experimental setup, designed to create dynamic characteristics similar to the ones of Francis turbine blades is discussed, together with the experimental protocol and examples of measurements obtained. The paper concludes with the calculated damping values and a discussion on the impact of the observed damping behaviour on the response of hydraulic turbine blades to FSI.

  3. Damping measurements in flowing water

    International Nuclear Information System (INIS)

    Coutu, A; Monette, C; Nennemann, B; Marmont, H; Seeley, C

    2012-01-01

    Fluid-structure interaction (FSI), in the form of mass loading and damping, governs the dynamic response of water turbines, such as Francis turbines. Water added mass and damping are both critical quantities in evaluating the dynamic response of the turbine component. Although the effect of fluid added mass is well documented, fluid damping, a critical quantity to limit vibration amplitudes during service, and therefore to help avoiding possible failure of the turbines, has received much less attention in the literature. This paper presents an experimental investigation of damping due to FSI. The experimental setup, designed to create dynamic characteristics similar to the ones of Francis turbine blades is discussed, together with the experimental protocol and examples of measurements obtained. The paper concludes with the calculated damping values and a discussion on the impact of the observed damping behaviour on the response of hydraulic turbine blades to FSI.

  4. Design of the APS transverse and longitudinal damping system

    International Nuclear Information System (INIS)

    Sellyey, W.; Barr, D.; Kahana, E.; Votaw, A.

    1994-01-01

    The main sources of instabilities in the Advanced Photon Source (APS) storage ring are expected to be higher-order modes (HOMs) of the accelerating cavities and the resistive wall impedance of the small insertion devices beam tubes. Extensive efforts are being made to reduce the Qs of HOMs. The maximum operating current of the ring will be 300 mA. At this current, analysis of measurements on cavity prototypes shows that the transverse growth rates will be less than 500/sec above radiation damping. The longitudinal growth rate due to HOMs is predicted to never exceed the radiation damping of 213/sec. The largest transverse resistive wall growth rate is calculated to be 2720/sec when 54 evenly spaced rigid bunches are used to produce 300 mA. There will be 26 additional unstable modes. The sum of these growth rates is 17,163/sec. Thus, it is clear that an effective transverse damping system will be needed and that the strength of this damper will be dominated by the resistive wall modes. A longitudinal damper system will also be built. This will provide damping about 2/3 times that due to synchrotron radiation. The most serious disturbances which can initiate instabilities will take place at injection. Typically, each bunch in the ring will be accumulated by injecting 115 of the final charge five times. A standard mode of operation is used in this paper in which there will be 54 evenly spaced bunches around the ring. During the ring filling process, the highest growth rates will occur when the last fifth of a bunch is injected into the last bunch. The largest expected vertical excursion of 1/5 of a bunch is about 5 mm. Anything larger will cause the bunch to scrape in the insertion device sections

  5. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  6. SLC Energy Upgrade Program at SLAC

    International Nuclear Information System (INIS)

    Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.

    1985-03-01

    The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators

  7. SLC energy upgrade program at SLAC

    International Nuclear Information System (INIS)

    Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.

    1985-01-01

    The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators

  8. The SLC energy upgrade program at SLAC

    International Nuclear Information System (INIS)

    Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebaaqz, J.V.

    1985-01-01

    The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators

  9. Verification of the SLC wake potentials

    International Nuclear Information System (INIS)

    Bane, K.; Weiland, T.

    1983-01-01

    The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials

  10. The pulsed amplitude unit for the SLC

    International Nuclear Information System (INIS)

    Rolfe, J.; Browne, M.J.; Jobe, R.K.

    1987-02-01

    There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital Converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU is a part of the system that controls the output of Klystrons in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

  11. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-01-01

    The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986

  12. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-04-01

    The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

  13. The pulsed amplitude unit for the SLC

    International Nuclear Information System (INIS)

    Rolfe, J.; Browne, M.J.; Jobe, R.K.

    1987-01-01

    There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU at is as part of the system that controls the output of Klystorns in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

  14. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  15. Performance of the SLC polarized electron source with high polarization

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Alley, R.K.; Aoyagi, H.

    1993-04-01

    For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed

  16. The positron accumulator ring for the APS

    International Nuclear Information System (INIS)

    Crosbie, E.A.

    1989-01-01

    The Positron Accumulator Ring (PAR) is designed to accumulate and damp positrons from the 450-MeV linac during the 0.5-s cycle time of the injector synchrotron for the APS 7-GeV storage ring. During 0.4 s of each synchrotron cycle, up to 24 linac pulses are injected into the horizontal phase space of the PAR at a 60-Hz rate. Each injected pulse occupies about 1.3 of the circumference of the accumulator ring. After 0.1 s for longitudinal damping, the single accumulated bunch is transferred to one of the 353-MHz buckets of the injector synchrotron RF system. The bunch is accelerated to 7 GeV and transferred to the storage ring, while the PAR accumulates the next bunch of positrons. 2 refs., 3 figs., 2 tabs

  17. The positron accumulator ring for the APS

    International Nuclear Information System (INIS)

    Crosbie, E.A.

    1989-01-01

    The Positron Accumulator Ring (PAR) is designed to accumulate and damp positrons from the 450-MeV linac during the 0.5-s cycle time of the injector synchrotron for the APS 7-GeV storage ring. During 0.4 s of each synchrotron cycle, up to 24 linac pulses are injected into the horizontal phase space of the PAR at a 60-Hz rate. Each injected pulse occupies about 1/3 of the circumference of the accumulator ring. After 0.1 s for longitudinal damping, the single accumulated bunch is transferred to one of the 353-MHz buckets of the injector synchrotron RF system. The bunch is accelerated to 7 GeV and transferred to the storage ring, while the PAR accumulates the next bunch of positrons. 2 refs., 3 figs., 2 tabs

  18. Vortex rings

    CERN Document Server

    Akhmetov, D G

    2009-01-01

    This text on vortex rings covers their theoretical foundation, systematic investigations, and practical applications such as the extinction of fires at gushing oil wells. It pays special attention to the formation and motion of turbulent vortex rings.

  19. Drift chamber vertex detectors for SLC/LEP

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, K G

    1988-03-01

    Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.

  20. Reliability and lifetime predictions of SLC klystrons

    International Nuclear Information System (INIS)

    Allen, M.A.; Callin, R.S.; Fowkes, W.R.; Lee, T.G.; Vlieks, A.E.

    1989-01-01

    The energy upgrade of SLAC, with the first of the new 67 MW SLAC Linear Collider (SLC) klystrons, began over four years ago. Today there are over 200 of these klystrons in operation. As a result, there is a wealth of klystron performance and failure information that enables reasonable predictions to be made on life expectancy and reliability. Data from initial tests, follow-up tests and daily operation monitoring on the accelerator is stored for analysis. Presented here are life expectancy predictions with particular emphasis on cathode life. Also, based on this data, the authors will discuss some of the principal modes of failure. 3 refs., 2 figs., 1 tab

  1. Reliability and lifetime predictions of SLC klystrons

    International Nuclear Information System (INIS)

    Allen, M.A.; Callin, R.S.; Fowkes, W.R.; Lee, T.G.; Vlieks, A.E.

    1989-03-01

    The energy upgrade of SLAC, with the first of the new 67 MW SLAC Linear Collider (SLC) klystrons, began over four years ago. Today there are over 200 of these klystrons in operation. As a result, there is a wealth klystron performance and failure information that enables reasonable predictions to be made on life expectancy and reliability. Data from initial tests, follow-up tests and daily operation monitoring on the accelerator is stores for analysis. Presented here are life expectancy predictions with particular emphasis on cathode life. Also, based on this data, we will discuss some of the principal modes of failure. 3 refs., 2 figs

  2. Damping in LMFBR pipe systems

    International Nuclear Information System (INIS)

    Anderson, M.J.; Barta, D.A.; Lindquist, M.R.; Renkey, E.J.; Ryan, J.A.

    1983-06-01

    LMFBR pipe systems typically utilize a thicker insulation package than that used on water plant pipe systems. They are supported with special insulated pipe clamps. Mechanical snubbers are employed to resist seismic loads. Recent laboratory testing has indicated that these features provide significantly more damping than presently allowed by Regulatory Guide 1.61 for water plant pipe systems. This paper presents results of additional in-situ vibration tests conducted on FFTF pipe systems. Pipe damping values obtained at various excitation levels are presented. Effects of filtering data to provide damping values at discrete frequencies and the alternate use of a single equivalent modal damping value are discussed. These tests further confirm that damping in typical LMFBR pipe systems is larger than presently used in pipe design. Although some increase in damping occurred with increased excitation amplitude, the effect was not significant. Recommendations are made to use an increased damping value for both the OBE and DBE seismic events in design of LMFBR pipe systems

  3. Surge-damping vacuum valve

    International Nuclear Information System (INIS)

    Bullock, J.C.; Kelley, B.E.

    1977-01-01

    A valve for damping out flow surges in a vacuum system is described. The surge-damping mechanism consists of a slotted, spring-loaded disk adjacent to the valve's vacuum port (the flow passage to the vacuum roughing pump). Under flow surge conditions, the differential pressure forces the disk into a sealing engagement with the vacuum port, thereby restricting the gas flow path to narrow slots in the disk's periphery. The increased flow damps out the flow surge. When pressure is equalized on both sides of the valve, the spring load moves the disk away from the port to restore full flow conductance through the valve

  4. Test of very fast kicker for TESLA damping ring

    International Nuclear Information System (INIS)

    Grishanov, B.I.; Podgorny, F.V.; Shiltsev, V.D.

    1997-04-01

    We describe a very fast kicker with unique combination of high repetition rate and short pulse width. Constructionally, the device is a symmetrical counter traveling wave stripline kicker fed by semiconductor high-voltage pulse generator. Experimentally tested kicker has a full pulse width of about 7 ns, 1.4 MHz repetition rate and maximum kick strength of the order of 3 G·m. Recent achievements in high-voltage semiconductor field-effect transistors (FET) technology and goal-specific optimization of the kicker parameters allow many-fold increase of the strength, and the kicker can be very useful tool for bunch-by-bunch injection/extraction and other accelerator applications. 4 refs., 3 figs

  5. Determination of electroweak parameters at the SLC

    International Nuclear Information System (INIS)

    Torrence, E.

    1996-09-01

    We present an improved measurement of the left-right cross section asymmetry (A LR ) for Z 0 boson production by e + e - collisions. The measurement was performed at a center-of-mass energy of 91.28 GeV with the SLD detector at the SLAC Linear Collider (SLC) during the 1994-95 running period. The luminosity-weighted average polarization of the SLC electron beam during this run was measured to be (77.23 ± 0.52)%. Using a sample of 93,644 hadronic Z 0 decays, we measure the pole asymmetry A LR 0 to be 0.1512 ± 0.0042(stat.) ± 0.0011(syst.) which is equivalent to an effective weak mixing angle of sin 2 θ W eff = 0.23100 ± 0.00054(stat.) ± 0.00014(syst.). We also present a preliminary direct measurement of the Z 0 -lepton coupling asymmetries A e , A μ , and A τ extracted from the differential cross section observed in leptonic Z 0 decays. We combine these results with our previous A LR measurement to obtain a combined determination of the weak mixing angle sin 2 θ W eff = 0.23061 ± 0.00047

  6. Machine protection schemes for the SLC

    International Nuclear Information System (INIS)

    Ross, M.C.

    1991-01-01

    The beamline components of a linear collider must be protected from high power beams in a way that is both reliable and has a minimum impact on integrated luminosity. When an upstream accelerator component fault occurs, the machine protection system suppresses the appropriate beam pulses and restores them when the fault clears or is compensated for. If an unacceptable localized beam loss is detected, without an accompanying component fault that is a likely cause of the loss, the system must provide identical, lower rate (lower average power), beam pulses to be used for diagnosis. This must not be done at the expense of any upstream beam stabilization system since fault diagnosis and recovery may take some time. Since the SLC beam pulse sequence is a regenerative one, i.e. correct function on a given pulse requires that several preceding pulses have been successfully completed, beam pulse repetition rate limiting is not trivial. Smooth, rapid, recovery from this type of fault is very important and can have a significant impact on luminosity. This paper provides an overview of the beam suppression and repetition rate limiting schemes used at the SLC

  7. SL(C) 5 migration at CERN

    International Nuclear Information System (INIS)

    Schwickerath, Ulrich; Silva, Ricardo

    2010-01-01

    Most LCG sites are currently running on SL(C)4. However, this operating system is already rather old, and it is becoming difficult to get the required hardware drivers, to get the best out of recent hardware. A possible way out is the migration to SL(C)5 based systems where possible, in combination with virtualization methods. The former is typically possible for nodes where the software to run the services is available and tested, while the latter offers a possibility to make use of the new hardware platforms whilst maintaining operating system compatibility. Since autumn 2008, CERN has offered public interactive and batch worker nodes for evaluation to the experiments. For the Grid environment, access is granted by a dedicated CEs. The status of the evaluation, feedback received from the experiments and the status of the migration will be reviewed, and the status of virtualization of services at CERN will be reported. Beyond this, the migration to a new operating system also offers an excellent opportunity to upgrade the fabric infrastructure used to manage the servers.

  8. Luminosity Optimization Feedback in the SLC

    International Nuclear Information System (INIS)

    1999-01-01

    The luminosity optimization at the SLC has been limited by the precision with which one can measure the micron size beams at the Interaction Point. Ten independent tuning parameters must be adjusted. An automated application has been used to scan each parameter over a significant range and set the minimum beam size as measured with a beam-beam deflection scan. Measurement errors limited the accuracy of this procedure and degraded the resulting luminosity. A new luminosity optimization feedback system has been developed using novel dithering techniques to maximize the luminosity with respect to the 10 parameters, which are adjusted one at a time. Control devices are perturbed around nominal setpoints, while the averaged readout of a digitized luminosity monitor measurement is accumulated for each setting. Results are averaged over many pulses to achieve high precision and then fitted to determine the optimal setting. The dithering itself causes a small loss in luminosity, but the improved optimization is expected to significantly enhance the performance of the SLC. Commissioning results are reported

  9. The Duffing oscillator with damping

    DEFF Research Database (Denmark)

    Johannessen, Kim

    2015-01-01

    An analytical solution to the differential equation describing the Duffing oscillator with damping is presented. The damping term of the differential equation and the initial conditions satisfy an algebraic equation, and thus the solution is specific for this type of damping. The nonlinear term...... of the differential equation is allowed to be considerable compared to the linear term. The solution is expressed in terms of the Jacobi elliptic functions by including a parameter-dependent elliptic modulus. The analytical solution is compared to the numerical solution, and the agreement is found to be very good....... It is established that the period of oscillation is shorter compared to that of a linearized model but increasing with time and asymptotically approaching the period of oscillation of the linear damped model. An explicit expression for the period of oscillation has been derived, and it is found to be very accurate....

  10. Damping in aerospace composite materials

    Science.gov (United States)

    Agneni, A.; Balis Crema, L.; Castellani, A.

    Experimental results are presented on specimens of carbon and Kevlar fibers in epoxy resin, materials used in many aerospace structures (control surfaces and wings in aircraft, large antennas in spacecraft, etc.). Some experimental methods of estimating damping ratios are first reviewed, either in the time domain or in the frequency domain. Some damping factor estimates from experimental tests are then shown; in order to evaluate the effects of the aerospace environment, damping factors have been obtained in a typical range of temperature, namely between +120 C and -120 C, and in the pressure range from room pressure to 10 exp -6 torr. Finally, a theoretical approach for predicting the bounds of the damping coefficients is shown, and prediction data are compared with experimental results.

  11. Amplitude damping of vortex modes

    CSIR Research Space (South Africa)

    Dudley, Angela L

    2010-09-01

    Full Text Available An interferometer, mimicking an amplitude damping channel for vortex modes, is presented. Experimentally the action of the channel is in good agreement with that predicted theoretically. Since we can characterize the action of the channel on orbital...

  12. Vibration damping method and apparatus

    Science.gov (United States)

    Redmond, James M.; Barney, Patrick S.; Parker, Gordon G.; Smith, David A.

    1999-01-01

    The present invention provides vibration damping method and apparatus that can damp vibration in more than one direction without requiring disassembly, that can accommodate varying tool dimensions without requiring re-tuning, and that does not interfere with tool tip operations and cooling. The present invention provides active dampening by generating bending moments internal to a structure such as a boring bar to dampen vibration thereof.

  13. Damping Measurements of Plasma Modes

    Science.gov (United States)

    Anderegg, F.; Affolter, M.; Driscoll, C. F.

    2010-11-01

    For azimuthally symmetric plasma modes in a magnesium ion plasma, confined in a 3 Tesla Penning-Malmberg trap with a density of n ˜10^7cm-3, we measure a damping rate of 2s-1plasma column, alters the frequency of the mode from 16 KHz to 192 KHz. The oscillatory fluid displacement is small compared to the wavelength of the mode; in contrast, the fluid velocity, δvf, can be large compared to v. The real part of the frequency satisfies a linear dispersion relation. In long thin plasmas (α> 10) these modes are Trivelpiece-Gould (TG) modes, and for smaller values of α they are Dubin spheroidal modes. However the damping appears to be non-linear; initially large waves have weaker exponential damping, which is not yet understood. Recent theoryootnotetextM.W. Anderson and T.M. O'Neil, Phys. Plasmas 14, 112110 (2007). calculates the damping of TG modes expected from viscosity due to ion-ion collisions; but the measured damping, while having a similar temperature and density dependence, is about 40 times larger than calculated. This discrepancy might be due to an external damping mechanism.

  14. A damped detuned structure for the next linear collider

    International Nuclear Information System (INIS)

    Miller, R.H.; Adolphsen, C.; Bane, K.L.

    1996-09-01

    An X-band Damped Detuned Structure (DDS) for NLC has been fabricated as part of a collaboration between KEK and SLAC. The individual cells were diamond point machined and microwave tested at KEK. The cells were diffusion bonded at SLAC. The structure has been cold tested. The time dependence of the beam induced dipole wakefields have been measured with the SLC beam in the test station ASSET. The structure is designed so that the dipole modes have an approximately gaussian density distribution in the frequency domain. This gives an approximately gaussian decrease of the wakefields for short times (about 10 ns), which is produced by the interference among the 206 modes in the lowest dipole mode band of the 206 cell structure. Without damping, however, the wakefields then rise back to a level which is approximately equal to the expected incoherent level from the 206 modes. The damping is accomplished by means of 4 rectangular slots or manifolds (approximately 5 mm by 10 mm) equally spaced in azimuth around the structure and running the full length of the structure. These manifolds act as single mode rectangular waveguides for the lowest band dipole modes, but are cut off for the accelerating mode. The manifolds are coupled to every cell in the structure, except for 3 at each end, by means of radial slots. Each of the four manifolds will have the dipole mode frequencies traveling in both directions and so are terminated on both ends. The structure will be installed in the NLC Test Accelerator this fall

  15. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1991-12-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: Repetition rate; Sensitivity to orbit distortion; Stability/Automation; and Accelerator Development

  16. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1992-01-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)

  17. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.; California Univ., Berkeley

    1988-01-01

    One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

  18. Low-emittance Storage Rings

    CERN Document Server

    Wolski, Andrzej

    2014-01-01

    The effects of synchrotron radiation on particle motion in storage rings are discussed. In the absence of radiation, particle motion is symplectic, and the beam emittances are conserved. The inclusion of radiation effects in a classical approximation leads to emittance damping: expressions for the damping times are derived. Then, it is shown that quantum radiation effects lead to excitation of the beam emittances. General expressions for the equilibrium longitudinal and horizontal (natural) emittances are derived. The impact of lattice design on the natural emittance is discussed, with particular attention to the special cases of FODO-, achromat- and theoretical-minimum-emittance-style lattices. Finally, the effects of betatron coupling and vertical dispersion (generated by magnet alignment and lattice tuning errors) on the vertical emittance are considered.

  19. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

  20. Dispersive effects of transverse displacements of SLC Arc magnets

    International Nuclear Information System (INIS)

    Murray, J.J.; Fieguth, T.; Kheifets, S.

    1986-01-01

    The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method

  1. Robust Rudder Roll Damping Control

    DEFF Research Database (Denmark)

    Yang, C.

    The results of a systematic research to solve a specific ship motion control problem, simultaneous roll damping and course keeping using the rudder are presented in this thesis. The fundamental knowledge a priori is that rudder roll damping is highly sensitive to the model uncertainty, therefore H-infinity...... theory is used to deal with the problem. The necessary mathematical tools and the H-Infinity theory as the basis of controller design are presented in Chapter 2 and 3. The mu synthesis and the D-K iteration are introduced in Chapter 3. The ship dynamics and modeling technology are discussed in Chapter 4...

  2. The Microstructural Basis of Damping in High Damping Alloys

    Science.gov (United States)

    1989-09-01

    This transformation is diffusionless and is characterized by the cooperative movement of atoms in a given section of crystal. Removal of the stress...martensites. The cooperative movement of atoms causes large internal friction and high damping. The temperature range in which this transformation can

  3. An Integrated Enterprise Accelerator Database for the SLC Control System

    International Nuclear Information System (INIS)

    2002-01-01

    Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations

  4. ring system

    African Journals Online (AJOL)

    1,3,2-DIAZABORACYCLOALKANE. RING SYSTEM. Negussie Retta" and Robert H. Neilson. 'Department of Chemistry, Addis Ababa University, P.O. Box 1176, Addis Ababa, Ethiopia. Department of Chemistry, Texas Christian University.

  5. Planetary Rings

    Science.gov (United States)

    Nicholson, P. D.

    2001-11-01

    A revolution in the studies in planetary rings studies occurred in the period 1977--1981, with the serendipitous discovery of the narrow, dark rings of Uranus, the first Voyager images of the tenuous jovian ring system, and the many spectacular images returned during the twin Voyager flybys of Saturn. In subsequent years, ground-based stellar occultations, HST observations, and the Voyager flybys of Uranus (1986) and Neptune (1989), as well as a handful of Galileo images, provided much additional information. Along with the completely unsuspected wealth of detail these observations revealed came an unwelcome problem: are the rings ancient or are we privileged to live at a special time in history? The answer to this still-vexing question may lie in the complex gravitational interactions recent studies have revealed between the rings and their retinues of attendant satellites. Among the four known ring systems, we see elegant examples of Lindblad and corotation resonances (first invoked in the context of galactic disks), electromagnetic resonances, spiral density waves and bending waves, narrow ringlets which exhibit internal modes due to collective instabilities, sharp-edged gaps maintained via tidal torques from embedded moonlets, and tenuous dust belts created by meteoroid impact onto parent bodies. Perhaps most puzzling is Saturn's multi-stranded, clumpy F ring, which continues to defy a simple explanation 20 years after it was first glimpsed in grainy images taken by Pioneer 11. Voyager and HST images reveal a complex, probably chaotic, dynamical interaction between unseen parent bodies within this ring and its two shepherd satellites, Pandora and Prometheus. The work described here reflects contributions by Joe Burns, Jeff Cuzzi, Luke Dones, Dick French, Peter Goldreich, Colleen McGhee, Carolyn Porco, Mark Showalter, and Bruno Sicardy, as well as those of the author. This research has been supported by NASA's Planetary Geology and Geophysics program and the

  6. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  7. Rotational damping motion in nuclei

    International Nuclear Information System (INIS)

    Egido, J.L.; Faessler, A.

    1991-01-01

    The recently proposed model to explain the mechanism of the rotational motion damping in nuclei is exactly solved. When compared with the earlier approximative solution, we find significative differences in the low excitation energy limit (i.e. Γ μ 0 ). For the strength functions we find distributions going from the Wigner semicircle through gaussians to Breit-Wigner shapes. (orig.)

  8. Dampness in buildings and health

    DEFF Research Database (Denmark)

    Bornehag, Carl-Gustaf; Blomquist, G.; Gyntelberg, F.

    2001-01-01

    Several epidemiological investigations concerning indoor environments have indicated that "dampness" in buildings is associated to health effects such as respiratory symptoms, asthma and allergy The aim of the present interdisciplinary review is to evaluate this association as shown in the epidem...

  9. Nonlocal quasilinear damped differential inclusions

    Directory of Open Access Journals (Sweden)

    Mouffak Benchohra

    2002-01-01

    Full Text Available In this paper we investigate the existence of mild solutions to second order initial value problems for a class of damped differential inclusions with nonlocal conditions. By using suitable fixed point theorems, we study the case when the multivalued map has convex and nonconvex values.

  10. Damped Oscillator with Delta-Kicked Frequency

    Science.gov (United States)

    Manko, O. V.

    1996-01-01

    Exact solutions of the Schrodinger equation for quantum damped oscillator subject to frequency delta-kick describing squeezed states are obtained. The cases of strong, intermediate, and weak damping are investigated.

  11. Nuclear piping system damping data studies

    International Nuclear Information System (INIS)

    Ware, A.G.; Arendts, J.G.

    1985-01-01

    A programm has been conducted at the Idaho National Engineering Laboratory to study structural damping data for nuclear piping systems and to evaluate if changes in allowable damping values for structural seismic analyses are justified. The existing pipe damping data base was examined, from which a conclusion was made that there were several sets of data to support higher allowable values. The parameters which most influence pipe damping were identified and an analytical investigation demonstrated that increased damping would reduce the required number of seismic supports. A series of tests on several laboratory piping systems was used to determine the effect of various parameters such as types of supports, amplitude of vibration, frequency, insulation, and pressure on damping. A multiple regression analysis was used to statistically assess the influence of the various parameters on damping, and an international pipe damping data bank has been formed. (orig.)

  12. Heavy quark production at SLC and LEP

    International Nuclear Information System (INIS)

    Hearty, C.

    1990-06-01

    Experiments at SLC and LEP have made preliminary measurements of the relative partial widths of the c and b quarks. Using D* tagging, DELPHI has found R c bar c triple-bond/Γ c bar c/Γ hadr. = 0.162 ± 0.032 ± 0.031, in good agreement with the Standard Model value of 0.171. ALEPH has used semileptonic decays of charm to obtain 0.148 ± 0.044 -0.038 +0.045 . Three experiments have used semileptonic Β decays to measurement R b bar b: R b bar b = 0.23 ± 0.10 (Mark II), 0.218 ± 0.010 ± 0.021 (L3), and 0.220 ± 0.016 ± 0.024 (ALEPH). All agree well with the expected value of 0.217. The uncertainty in branching ratios of c and b hadrons is the largest systematic error in all of the results. Future LEP measurements of the branching ratios may reduce the errors. R b bar b will also be measured with different, and possibly lower, systematic errors by Mark II using impact parameter tagging

  13. SLC polarized beam source electron optics design

    International Nuclear Information System (INIS)

    Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.

    1991-05-01

    This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs

  14. Damping characteristics of reinforced concrete structures

    International Nuclear Information System (INIS)

    Hisano, M.; Nagashima, I.; Kawamura, S.

    1987-01-01

    Reinforced concrete structures in a nuclear power plant are not permitted to go far into the inelasticity generally, even when subjected to strong ground motion. Therefore it is important to evaluate the damping appropriately in linear and after cracking stage before yielding in the dynamic response analysis. Next three dampings are considered of reinforced concrete structures. 1) Internal damping in linear range material damping of concrete without cracks;2) Hysteretic damping in inelastic range material hysteretic damping of concrete due to cracking and yielding;3) Damping due to the energy dissipation into the ground. Among these damping material damping affects dynamic response of a nuclear power plant on hard rock site where damping due to energy dissipation into the ground is scarcely expected. However material damping in linear and slightly nonlinear range have only been assumed without enough experimental data. In this paper such damping is investigated experimentally by the shaking table tests of reinforced concrete box-walls which modeled roughly the outer wall structure of a P.W.R. type nuclear power plant

  15. Storage Rings

    International Nuclear Information System (INIS)

    Fischer, W.

    2010-01-01

    Storage rings are circular machines that store particle beams at a constant energy. Beams are stored in rings without acceleration for a number of reasons (Tab. 1). Storage rings are used in high-energy, nuclear, atomic, and molecular physics, as well as for experiments in chemistry, material and life sciences. Parameters for storage rings such as particle species, energy, beam intensity, beam size, and store time vary widely depending on the application. The beam must be injected into a storage ring but may not be extracted (Fig. 1). Accelerator rings such as synchrotrons are used as storage rings before and after acceleration. Particles stored in rings include electrons and positrons; muons; protons and anti-protons; neutrons; light and heavy, positive and negative, atomic ions of various charge states; molecular and cluster ions, and neutral polar molecules. Spin polarized beams of electrons, positrons, and protons were stored. The kinetic energy of the stored particles ranges from 10 -6 eV to 3.5 x 10 12 eV (LHC, 7 x 10 12 eV planned), the number of stored particles from one (ESR) to 1015 (ISR). To store beam in rings requires bending (dipoles) and transverse focusing (quadrupoles). Higher order multipoles are used to correct chromatic aberrations, to suppress instabilities, and to compensate for nonlinear field errors of dipoles and quadrupoles. Magnetic multipole functions can be combined in magnets. Beams are stored bunched with radio frequency systems, and unbunched. The magnetic lattice and radio frequency system are designed to ensure the stability of transverse and longitudinal motion. New technologies allow for better storage rings. With strong focusing the beam pipe dimensions became much smaller than previously possible. For a given circumference superconducting magnets make higher energies possible, and superconducting radio frequency systems allow for efficient replenishment of synchrotron radiation losses of large current electron or positron beams

  16. Transit-Time Damping, Landau Damping, and Perturbed Orbits

    Science.gov (United States)

    Simon, A.; Short, R. W.

    1997-11-01

    Transit-time damping(G.J. Morales and Y.C. Lee, Phys. Rev. Lett. 33), 1534 (1974).*^,*(P.A. Robinson, Phys. Fluids B 3), 545 (1991).** has traditionally been obtained by calculating the net energy gain of transiting electrons, of velocity v, to order E^2* in the amplitude of a localized electric field. This necessarily requires inclusion of the perturbed orbits in the equation of motion. A similar method has been used by others(D.R. Nicholson, Introduction to Plasma Theory) (Wiley, 1983).*^,*(E.M. Lifshitz and L.P. Pitaevskifi, Physical Kinetics) (Pergamon, 1981).** to obtain a ``physical'' picture of Landau damping in a nonlocalized field. The use of perturbed orbits seems odd since the original derivation of Landau (and that of Dawson) never went beyond a linear picture of the dynamics. We introduce a novel method that takes advantage of the time-reversal invariance of the Vlasov equation and requires only the unperturbed orbits to obtain the result. Obviously, there is much reduction in complexity. Application to finite slab geometry yields a simple expression for the damping rate. Equivalence to much more complicated results^2* is demonstrated. This method allows us to calculate damping in more complicated geometries and more complex electric fields, such as occur in SRS in filaments. See accompanying talk.(R.W. Short and A. Simon, this conference.) This work was supported by the U.S. DOE Office of Inertial Confinement Fusion under Co-op Agreement No. DE-FC03-92SF19460.

  17. Topological rings

    CERN Document Server

    Warner, S

    1993-01-01

    This text brings the reader to the frontiers of current research in topological rings. The exercises illustrate many results and theorems while a comprehensive bibliography is also included. The book is aimed at those readers acquainted with some very basic point-set topology and algebra, as normally presented in semester courses at the beginning graduate level or even at the advanced undergraduate level. Familiarity with Hausdorff, metric, compact and locally compact spaces and basic properties of continuous functions, also with groups, rings, fields, vector spaces and modules, and with Zorn''s Lemma, is also expected.

  18. Ring accelerators

    International Nuclear Information System (INIS)

    Gisler, G.; Faehl, R.

    1983-01-01

    We present two-dimensional simulations in (r-z) and r-theta) cylinderical geometries of imploding-liner-driven accelerators of rings of charged particles. We address issues of azimuthal and longitudinal stability of the rings. We discuss self-trapping designs in which beam injection and extraction is aided by means of external cusp fields. Our simulations are done with the 2-1/2-D particle-in-cell plasma simulation code CLINER, which combines collisionless, electromagnetic PIC capabilities with a quasi-MHD finite element package

  19. A Bacon Tone Ring on an Open-Back Banjo

    OpenAIRE

    Politzer, David

    2016-01-01

    Head taps on a new Goodtime banjo rim fitted with a reproduction Bacon Professional ff tone ring are contrasted with a new Goodtime, a 2002 Goodtime, and a 1999 Goodtime fitted with a 1/4′′ diameter brass ring. Conclusions: The 1/4" ring does what’s commonly imagined, the upgrades to the Goodtime over the years are not merely cosmetic, and the Bacon ring’s biggest effect is to damp head ringing and suppress high harmonics. Detailed comparisons of the new Goodtimes with and without the Bacon r...

  20. Development of new damping devices for piping

    International Nuclear Information System (INIS)

    Kobayashi, Hiroe

    1991-01-01

    An increase of the damping ratio is known to be very effective for the seismic design of a piping system. Increasing the damping ratio and reducing the seismic response of the piping system, the following three types of damping devices for piping systems are introduced: (1) visco-elastic damper, (2) elasto-plastic damper and (3) compact dynamic damper. The dynamic characteristics of these damping devices were investigated by the component test and the applicability of them to the piping system was confirmed by the vibration test using a three dimensional piping model. These damping devices are more effective than mechanical snubbers to reduce the vibration of the piping system. (author)

  1. Ring interferometry

    CERN Document Server

    Malykin, Grigorii B; Zhurov, Alexei

    2013-01-01

    This monograph is devoted to the creation of a comprehensive formalism for quantitative description of polarized modes' linear interaction in modern single-mode optic fibers. The theory of random connections between polarized modes, developed in the monograph, allows calculations of the zero shift deviations for a fiber ring interferometer. The monograph addresses also the

  2. The partially filled viscous ring damper.

    Science.gov (United States)

    Alfriend, K. T.

    1973-01-01

    The problem of a spinning satellite with a partially filled viscous ring damper is investigated. It is shown that there are two distinct modes of motion, the nutation-synchronous mode and spin-synchronous mode. From an approximate solution of the equations of motion a time constant is obtained for each mode. From a consideration of the fluid dynamics several methods are developed for determining the damping constant.

  3. Route Flap Damping Made Usable

    Science.gov (United States)

    Pelsser, Cristel; Maennel, Olaf; Mohapatra, Pradosh; Bush, Randy; Patel, Keyur

    The Border Gateway Protocol (BGP), the de facto inter-domain routing protocol of the Internet, is known to be noisy. The protocol has two main mechanisms to ameliorate this, MinRouteAdvertisementInterval (MRAI), and Route Flap Damping (RFD). MRAI deals with very short bursts on the order of a few to 30 seconds. RFD deals with longer bursts, minutes to hours. Unfortunately, RFD was found to severely penalize sites for being well-connected because topological richness amplifies the number of update messages exchanged. So most operators have disabled it. Through measurement, this paper explores the avenue of absolutely minimal change to code, and shows that a few RFD algorithmic constants and limits can be trivially modified, with the result being damping a non-trivial amount of long term churn without penalizing well-behaved prefixes' normal convergence process.

  4. Modelling of Dampers and Damping in Structures

    DEFF Research Database (Denmark)

    Høgsberg, Jan Riess

    2006-01-01

    and the maximum attainable damping are found by maximizing the expression for the damping ratio. The theory is formulated for linear damper models, but may also be applied for non-linear dampers in terms of equivalent linear parameters for stiffness and damping, respectively. The format of the expressions......, and thereby the damping, of flexible structures are generally described in terms of the dominant vibration modes. A system reduction technique, where the damped vibration mode is constructed as a linear combination of the undamped mode shape and the mode shape obtained by locking the damper, is applied....... This two-component representation leads to a simple solution for the modal damping representing the natural frequency and the associated damping ratio. It appears from numerical examples that this system reduction technique provides very accurate results. % Analytical expressions for the optimal tuning...

  5. Multiparticle phenomena and Landau damping

    International Nuclear Information System (INIS)

    Talman, R.

    1987-01-01

    The purpose of this paper is to survey various methods of studying multiparticle phenomena in accelerators. Both experimental and theoretical methods are described. An effort has been made to emphasize the intuitive and qualitative aspects rather than the detailed mathematics. Some of the terms or concepts to be explained are coherent and incoherent tunes, normal modes, Landau damping, beam-transfer functions, and feedback. These are all of daily importance in the interpretation of colliding-beam observations and the control of performance

  6. Sheath waves, non collisional dampings

    International Nuclear Information System (INIS)

    Marec, Jean Lucien Ernest

    1974-01-01

    When a metallic conductor is inserted into an ionised gas, an area of electron depletion is formed between the conductor and the plasma: the ionic sheath. Moreover, if the conductor is excited by an electric field, this ionic sheath plays an important role with respect to microwave properties. In this research thesis, the author addresses the range of frequencies smaller than the plasma frequency, and reports the study of resonance phenomena. After a presentation of the problem through a bibliographical study, the author recalls general characteristics of sheath wave propagation and of sheath resonances, and discusses the validity of different hypotheses (for example and among others, electrostatic approximations, cold plasma). Then, the author more particularly addresses theoretical problems related to non collisional dampings: brief bibliographical study, detailed presentation and description of the theoretical model, damping calculation methods. The author then justifies the design and performance of an experiment, indicates measurement methods used to determine plasma characteristics as well as other magnitudes which allow the description of mechanisms of propagation and damping of sheath waves. Experimental results are finally presented with respect to various parameters. The author discusses to which extent the chosen theoretical model is satisfying [fr

  7. The DAMPE silicon tungsten tracker

    CERN Document Server

    Gallo, Valentina; Asfandiyarov, R; Azzarello, P; Bernardini, P; Bertucci, B; Bolognini, A; Cadoux, F; Caprai, M; Domenjoz, M; Dong, Y; Duranti, M; Fan, R; Franco, M; Fusco, P; Gargano, F; Gong, K; Guo, D; Husi, C; Ionica, M; Lacalamita, N; Loparco, F; Marsella, G; Mazziotta, M N; Mongelli, M; Nardinocchi, A; Nicola, L; Pelleriti, G; Peng, W; Pohl, M; Postolache, V; Qiao, R; Surdo, A; Tykhonov, A; Vitillo, S; Wang, H; Weber, M; Wu, D; Wu, X; Zhang, F; De Mitri, I; La Marra, D

    2017-01-01

    The DArk Matter Particle Explorer (DAMPE) satellite has been successfully launched on the 17th December 2015. It is a powerful space detector designed for the identification of possible Dark Matter signatures thanks to its capability to detect electrons and photons with an unprecedented energy resolution in an energy range going from few GeV up to 10 TeV. Moreover, the DAMPE satellite will contribute to a better understanding of the propagation mechanisms of high energy cosmic rays measuring the nuclei flux up to 100 TeV. DAMPE is composed of four sub-detectors: a plastic strip scintillator, a silicon-tungsten tracker-converter (STK), a BGO imaging calorimeter and a neutron detector. The STK is made of twelve layers of single-sided AC-coupled silicon micro-strip detectors for a total silicon area of about 7 $m^2$ . To promote the conversion of incident photons into electron-positron pairs, tungsten foils are inserted into the supporting structure. In this document, a detailed description of the STK constructi...

  8. Foucault pendulum with eddy-current damping of the elliptical motion

    Science.gov (United States)

    Mastner, G.; Vokurka, V.; Maschek, M.; Vogt, E.; Kaufmann, H. P.

    1984-10-01

    A newly designed Foucault pendulum is described in which the mechanical Charron ring, used throughout in previous designs for damping of the elliptical motion of the pendulum, is replaced by an electromagnetic eddy-current brake, consisting of a permanent magnet attached to the bottom of the bob and a metallic ring. This damping device is very efficient, as it is self-aligning, symmetrical in the damping effect, and never wears out. The permanent magnet is also used, together with a coil assembly and an electronic circuitry, for the dipole-torque drive of the pendulum as well as for accurate stabilization of the amplitude of the swing. A latched time display, controlled by Hall probes activated by the magnet, is used to visualize the Foucault rotation. The pendulum system and its associated electronic circuitry are described in detail. The optimizing of the drive mode is discussed. Measurements of deviations from theoretical value of the Foucault rotation velocity made automatically in a continuous run show a reproducible accuracy of ±1% or better in individual 360° rotations during the summer months. The quality factor of the pendulum as mechanical resonator was measured as a function of the amplitude in the presence of the eddy-current damping ring.

  9. Structural Damping with Friction Beams

    Directory of Open Access Journals (Sweden)

    L. Gaul

    2008-01-01

    Full Text Available In the last several years, there has been increasing interest in the use of friction joints for enhancing damping in structures. The joints themselves are responsible for the major part of the energy dissipation in assembled structures. The dissipated work in a joint depends on both the applied normal force and the excitation force. For the case of a constant amplitude excitation force, there is an optimal normal force which maximizes the damping. A ‘passive’ approach would be employed in this instance. In most cases however, the excitation force, as well as the interface parameters such as the friction coefficient, normal pressure distribution, etc., are not constant. In these cases, a ‘semi-active’ approach, which implements an active varying normal force, is necessary. For the ‘passive’ and ‘semi-active’ approaches, the normal force has to be measured. Interestingly, since the normal force in a friction joint influences the local stiffness, the natural frequencies of the assembled structure can be tuned by adjusting the normal force. Experiments and simulations are performed for a simple laboratory structure consisting of two superposed beams with friction in the interface. Numerical simulation of the friction interface requires non-linear models. The response of the double beam system is simulated using a numerical algorithm programmed in MATLAB which models point-to-point friction with the Masing friction model. Numerical predictions and measurements of the double beam free vibration response are compared. A practical application is then described, in which a friction beam is used to damp the vibrations of the work piece table on a milling machine. The increased damping of the table reduces vibration amplitudes, which in turn results in enhanced surface quality of the machined parts, reduction in machine tool wear, and potentially higher feed rates. Optimal positioning of the friction beams is based on knowledge of the mode

  10. Mask locations in the SLC final focus region

    International Nuclear Information System (INIS)

    Cence, R.J.

    1983-01-01

    The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point

  11. Progress report on the SLAC Linear Collider

    International Nuclear Information System (INIS)

    Rees, J.

    1986-06-01

    The SLAC Linear Collider project (SLC) is reported as being near completion. The performance specifications are tabulated both for the initial form and for eventual goals. Various parts of the SLC are described and the status of their construction is reported, including the front end electron gun and booster, the linac, damping ring, positron source, SLC arcs, and conventional facilities. 5 refs., 12 figs

  12. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  13. The Mark II detector for the SLC

    International Nuclear Information System (INIS)

    Abrams, G.; Baden, A.R.; Boyer, J.; Butler, F.; Drell, P.S.; Fay, J.; Gidal, G.; Goldhaber, G.; Haggerty, J.; Harr, R.; Hearty, C.; Herrup, D.; Holmgren, S.O.; Jaffre, M.; Juricic, I.; Kadyk, J.A.; Kral, J.F.; Levi, M.E.; Lynch, G.R.; Richman, J.D.; Rouse, F.R.; Schaad, M.W.; Schmidke, W.B.; Schumm, B.A.; Trilling, G.H.; Wood, D.R.; Akerlof, C.; Bonvicini, G.; Chapman, J.; Chmeissani, M.; Frey, R.; Gero, E.; Hong, S.J.; Koska, W.; Nitz, D.; Petradza, M.; Thun, R.; Tschirhart, R.; Veltman, H.; Alexander, J.P.; Ballam, J.; Barklow, T.; Bartelt, J.; De Boer, W.; Boyarski, A.; Braune, K.; Bulos, F.; Burke, D.L.; Cords, D.; Coupal, D.P.; Destaebler, H.C.; Dorfan, J.M.; Feldman, G.J.; Fernandes, D.; Field, R.C.; Fordham, C.; Fujino, D.; Gan, K.K.; Glanzman, T.; Grosse-Wiesmann, P.; Hanson, G.; Hayes, K.; Himel, T.; Hutchinson, D.; Innes, W.R.; Jacobsen, R.G.; Jaros, J.A.; Jung, C.K.; Karlen, D.; Klein, S.R.; Koetke, D.; Komamiya, M.; Kowalski, L.A.; Kozanecki, W.; Lankford, A.J.; Larsen, R.R.; Lueth, V.; Mattison, T.; Moffeit, K.C.; Mueller, L.; Munger, C.T.; Nash, J.; Ong, R.A.; O'Shaughnessy, K.F.; Perl, J.; Perl, M.L.; Perrier, F.; Petersen, A.; Pitthan, R.; Riles, K.; Swartz, M.; Taylor, R.E.; Van Kooten, R.; Voruganti, P.; Weigend, A.; Woods, M.; Wormser, G.; Wright, R.; Alvarez, M.; Calvino, F.; Fernandez, E.; Ford, W.T.; Hinshaw, D.A.; Rankin, P.; Smith, J.G.; Wagner, S.R.; Weber, P.; White, S.L.; Averill, D.; Blockus, D.; Brabson, B.; Brom, J.M.; Murray, W.N.; Ogren, H.; Rust, D.R.; Snyder, A.; Yurko, M.; Barish, B.C.; Hawkes, C.M.; Hoenk, M.; Kuhlen, M.; Li, Z.; McKenna, J.A.; Milliken, B.D.; Nelson, M.E.; Peck, C.; Porter, F.C.; Soderstrom, E.; Stroynowski, R.; Weinstein, A.J.; Weir, A.J.; Wicklund, E.; Wolf, R.C.; Wu, D.Y.; Barnett, B.A.; Boswell, C.; Dauncey, P.; Drewer, D.C.; Harral, B.; Hylen, J.; Matthews, J.A.J.; Stoker, D.P.; Vejcik, S.; Breakstone, A.; Cence, R.J.; Gong, X.; Harris, F.A.; Koide, A.; Parker, S.I.; Green, A.; Lawrence Berkeley Lab., CA; California Univ., Berkeley

    1989-01-01

    The Mark II detector has been upgraded in preparation for its role as the first detector to take data at the Stanford Linear Collider. The new detector components include the central drift chamber, the time-of-flight system, the coil, the endcap electromagnetic calorimeters and the beam energy and luminosity measuring devices. There have also been improvements in detector hermeticity. All of the major components were installed for a test run at the PEP storage ring (√s=29 GeV) in 1985. This paper describes the upgraded detector, including its trigger and data acquisition systems, and gives performance figures for its components. Future improvements are also discussed. (orig.)

  14. Anisotropic damping of Timoshenko beam elements

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, M.H.

    2001-05-01

    This report contains a description of a structural damping model for Timoshenko beam elements used in the aeroelastic code HawC developed at Risoe for modeling wind turbines. The model has been developed to enable modeling of turbine blades which often have different damping characteristics for flapwise, edgewise and torsional vibrations. The structural damping forces acting on the beam element are modeled by viscous damping described by an element damping matrix. The composition of this matrix is based on the element mass and stiffness matrices. It is shown how the coefficients for the mass and stiffness contributions can be calibrated to give the desired modal damping in the complete model of a blade. (au)

  15. Fast cooling of bunches in compton storage rings*

    CERN Document Server

    Bulyak, E; Zimmermann, F

    2011-01-01

    We propose an enhancement of laser radiative cooling by utilizing laser pulses of small spatial and temporal dimensions, which interact only with a fraction of an electron bunch circulating in a storage ring. We studied the dynamics of such electron bunch when laser photons scatter off the electrons at a collision point placed in a section with nonzero dispersion. In this case of ‘asymmetric cooling’, the stationary energy spread is much smaller than under conditions of regular scattering where the laser spot size is larger than the electron beam; and the synchrotron oscillations are damped faster. Coherent oscillations of large amplitude may be damped within one synchrotron period, so that this method can support the rapid successive injection of many bunches in longitudinal phase space for stacking purposes. Results of extensive simulations are presented for the performance optimization of Compton gamma-ray sources and damping rings.

  16. History Data Facility in the SLC control system

    International Nuclear Information System (INIS)

    Johnson, R.G.; White, G.R.

    1991-10-01

    Two major enhancements to the SLC History Data Facility are described separately. First the internal design and procedures used for saving and using long term history data. Second the user interface, facilities and application of the History Data Comparisons sub-system, which is used for analyzing and correlating two or more accelerator device histories

  17. Review of lattice measurement techniques at the SLC

    International Nuclear Information System (INIS)

    Barklow, T.; Emma, P.; Krejcik, P.; Walker, N.

    1991-11-01

    A technique is described for reconstructing the first order transport matrix (R) for a given beam line. Emphasis is placed on the rigorous error analysis of the data, and the use of powerful statistical techniques to estimate unknown systematic errors. The application of the technique to the measurement and subsequent correction of the SLC Arcs is briefly described. 5 refs., 4 figs

  18. An Empirical Method for Particle Damping Design

    Directory of Open Access Journals (Sweden)

    Zhi Wei Xu

    2004-01-01

    Full Text Available Particle damping is an effective vibration suppression method. The purpose of this paper is to develop an empirical method for particle damping design based on extensive experiments on three structural objects – steel beam, bond arm and bond head stand. The relationships among several key parameters of structure/particles are obtained. Then the procedures with the use of particle damping are proposed to provide guidelines for practical applications. It is believed that the results presented in this paper would be helpful to effectively implement the particle damping for various structural systems for the purpose of vibration suppression.

  19. Phenomenology of chiral damping in noncentrosymmetric magnets

    KAUST Repository

    Akosa, Collins Ashu; Miron, Ioan Mihai; Gaudin, Gilles; Manchon, Aurelien

    2016-01-01

    A phenomenology of magnetic chiral damping is proposed in the context of magnetic materials lacking inversion symmetry. We show that the magnetic damping tensor acquires a component linear in magnetization gradient in the form of Lifshitz invariants. We propose different microscopic mechanisms that can produce such a damping in ferromagnetic metals, among which local spin pumping in the presence of an anomalous Hall effect and an effective “s-d” Dzyaloshinskii-Moriya antisymmetric exchange. The implication of this chiral damping in terms of domain-wall motion is investigated in the flow and creep regimes.

  20. Parametric Landau damping of space charge modes

    Energy Technology Data Exchange (ETDEWEB)

    Macridin, Alexandru [Fermilab; Burov, Alexey [Fermilab; Stern, Eric [Fermilab; Amundson, James [Fermilab; Spentzouris, Panagiotis [Fermilab

    2016-09-23

    Landau damping is the mechanism of plasma and beam stabilization; it arises through energy transfer from collective modes to the incoherent motion of resonant particles. Normally this resonance requires the resonant particle's frequency to match the collective mode frequency. We have identified an important new damping mechanism, parametric Landau damping, which is driven by the modulation of the mode-particle interaction. This opens new possibilities for stability control through manipulation of both particle and mode-particle coupling spectra. We demonstrate the existence of parametric Landau damping in a simulation of transverse coherent modes of bunched accelerator beams with space charge.

  1. Phenomenology of chiral damping in noncentrosymmetric magnets

    KAUST Repository

    Akosa, Collins Ashu

    2016-06-21

    A phenomenology of magnetic chiral damping is proposed in the context of magnetic materials lacking inversion symmetry. We show that the magnetic damping tensor acquires a component linear in magnetization gradient in the form of Lifshitz invariants. We propose different microscopic mechanisms that can produce such a damping in ferromagnetic metals, among which local spin pumping in the presence of an anomalous Hall effect and an effective “s-d” Dzyaloshinskii-Moriya antisymmetric exchange. The implication of this chiral damping in terms of domain-wall motion is investigated in the flow and creep regimes.

  2. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  3. Controllable damping of high-Q violin modes in fused silica suspension fibers

    Energy Technology Data Exchange (ETDEWEB)

    Dmitriev, A V; Mescheriakov, S D; Mitrofanov, V P [Faculty of Physics, Moscow State University, Moscow 119991 (Russian Federation); Tokmakov, K V, E-mail: dmitriev@hbar.phys.msu.r, E-mail: mitr@hbar.phys.msu.r [Present address: Department of Physics, SUPA, University of Strathclyde, Glasgow G4 0NG (United Kingdom)

    2010-01-21

    Fused silica fiber suspension of the test masses will be used in the interferometric gravitational wave detectors of the next generation. This allows a significant reduction of losses in the suspension and thermal noise associated with the suspension. Unfortunately, unwanted violin modes may be accidentally excited in the suspension fibers. The Q-factor of the violin modes also exceeds 10{sup 8}. They have a ring-down time that is too long and may complicate the stable control of the interferometer. Results of the investigation of a violin mode active damping system are described. An original sensor and actuator were especially developed to realize the effective coupling of a thin, optically transparent, non-conducting fused silica fiber with an electric circuit. The damping system allowed the changing of the violin mode's damping rate over a wide range.

  4. Controllable damping of high-Q violin modes in fused silica suspension fibers

    Science.gov (United States)

    Dmitriev, A. V.; Mescheriakov, S. D.; Tokmakov, K. V.; Mitrofanov, V. P.

    2010-01-01

    Fused silica fiber suspension of the test masses will be used in the interferometric gravitational wave detectors of the next generation. This allows a significant reduction of losses in the suspension and thermal noise associated with the suspension. Unfortunately, unwanted violin modes may be accidentally excited in the suspension fibers. The Q-factor of the violin modes also exceeds 108. They have a ring-down time that is too long and may complicate the stable control of the interferometer. Results of the investigation of a violin mode active damping system are described. An original sensor and actuator were especially developed to realize the effective coupling of a thin, optically transparent, non-conducting fused silica fiber with an electric circuit. The damping system allowed the changing of the violin mode's damping rate over a wide range.

  5. Controllable damping of high-Q violin modes in fused silica suspension fibers

    International Nuclear Information System (INIS)

    Dmitriev, A V; Mescheriakov, S D; Mitrofanov, V P; Tokmakov, K V

    2010-01-01

    Fused silica fiber suspension of the test masses will be used in the interferometric gravitational wave detectors of the next generation. This allows a significant reduction of losses in the suspension and thermal noise associated with the suspension. Unfortunately, unwanted violin modes may be accidentally excited in the suspension fibers. The Q-factor of the violin modes also exceeds 10 8 . They have a ring-down time that is too long and may complicate the stable control of the interferometer. Results of the investigation of a violin mode active damping system are described. An original sensor and actuator were especially developed to realize the effective coupling of a thin, optically transparent, non-conducting fused silica fiber with an electric circuit. The damping system allowed the changing of the violin mode's damping rate over a wide range.

  6. Influence of the Gilbert damping constant on the flux rise time of write head fields

    International Nuclear Information System (INIS)

    Ertl, Othmar; Schrefl, Thomas; Suess, Dieter; Schabes, Manfred E.

    2005-01-01

    Magnetic recording at fast data rates requires write heads with rapid rise times of the magnetic flux during the write process. We present three-dimensional (3D) micromagnetic finite element calculations of an entire ring head including 3D coil geometry during the writing of magnetic bits in granular media. The simulations demonstrate how input current profiles translate into magnetization processes in the head and which in turn generate the write head field. The flux rise time significantly depends on the Gilbert damping constant of the head material. Low damping causes incoherent magnetization processes, leading to long rise times and low head fields. High damping leads to coherent reversal of the magnetization in the head. As a consequence, the gap region can be quickly saturated which causes high head fields with short rise times

  7. Beam diagnostics and control for SLC

    International Nuclear Information System (INIS)

    Ross, M.C.

    1987-01-01

    Construction of the SLAC Linear Collider has posed some new problems in beam diagnostic device design. Typical beam sizes are small when compared with conventional storage rings, orbit tolerances are tighter and the pulsed nature of the machine means that signal to noise enhancement by averaging is not always possible. Thus the diagnostics must have high resolution, high absolute accuracy and must deliver data from a single puls. In practice the required performance level depends on the function and dynamics of a given region in the collider. In this paper, the authors review the major beam diagnostic system and then discuss the global data acquisition schemes. Because space is limited each system is described only in a very cursory fashion. More details may be found in the cited papers

  8. Experience with a high-brightness storage ring: the NSLS 750 MeV vuv ring

    International Nuclear Information System (INIS)

    Galayda, J.

    1984-01-01

    The NSLS vuv ring is the first implementation of the proposals of R. Chasman and G.K. Green for a synchrotron radiation source with enhanced brightness: its lattice is a series of achromatic bends with two zero-gradient dipoles each, giving small damped emittance; and these bends are connected by straight sections with zero dispersion to accommodate wigglers and undulators without degrading the radiation damping properties of the ring. The virtues of the Chasman-Green lattice, its small betatron and synchrotron emittances, may be understood with some generality; e.g. the electron γm 0 c 2 energy and the number of achromatic bends M sets a lower limit on the betatron emittance of e/sub x/ > 7.7 x 10 -13 γ 2 /M meter-radians. There is strong interest in extrapolation of this type of lattice to 6 GeV and to 32 achromatic bends. The subject of this report is the progress toward achieving performance in the vuv ring limited by the radiation damping parameters optimized in its design. 14 refs., 4 figs., 1 tab

  9. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  10. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Damping-off in forest nurseries

    Science.gov (United States)

    Carl Hartley

    1921-01-01

    Damping-off is the commonest English name for a symptomatic group of diseases affecting great numbers of plant species of widely separated phylogenetic groups. It is commonly used for any disease which results in the rapid decay of young succulent seedlings or soft cuttings. Young shoots from underground rootstocks may also be damped-off before they break through the...

  12. On Collisionless Damping of Ion Acoustic Waves

    DEFF Research Database (Denmark)

    Jensen, Vagn Orla; Petersen, P.I.

    1973-01-01

    Exact theoretical treatments show that the damping of ion acoustic waves in collisionless plasmas does not vanish when the derivative of the undisturbed distribution function at the phase velocity equals zero.......Exact theoretical treatments show that the damping of ion acoustic waves in collisionless plasmas does not vanish when the derivative of the undisturbed distribution function at the phase velocity equals zero....

  13. Identification of Damping from Structural Vibrations

    DEFF Research Database (Denmark)

    Bajric, Anela

    Reliable predictions of the dynamic loads and the lifetime of structures are influenced by the limited accuracy concerning the level of structural damping. The mechanisms of damping cannot be derived analytically from first principles, and in the design of structures the damping is therefore based...... on experience or estimated from measurements. This thesis consists of an extended summary and three papers which focus on enhanced methods for identification of damping from random struc-tural vibrations. The developed methods are validated by stochastic simulations, experimental data and full-scale measurements...... which are representative of the vibrations in small and large-scale structures. The first part of the thesis presents an automated procedure which is suitable for estimation of the natural frequencies and the modal damping ratios from random response of structures. The method can be incorporated within...

  14. Swing damped movement of suspended objects

    International Nuclear Information System (INIS)

    Jones, J.F.; Petterson, B.J.; Werner, J.C.

    1990-01-01

    Transportation of large objects such as nuclear waste shipping casks using overhead cranes can induce pendular motion of the object. Residual oscillation from transportation typically must be damped or allowed to decay before the next process can take place. By properly programming the acceleration of the transporting device (e.g., crane) an oscillation damped transport and swing free stop are obtainable. This report reviews the theory associated with formulating such oscillation damped trajectories for a simply suspended object (e.g., simple pendulum). In addition, the use of force servo damping to eliminate initial oscillation of simply suspended objects is discussed. This is often needed to provide a well defined initial state for the system prior to executing an oscillation damped move. Also included are descriptions of experiments using a CIMCORP XR6100 gantry robot and results from these experiments. Finally, sources of error resulting in small residual oscillations are identified and possible solutions presented

  15. A model of ATL ground motion for storage rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej; Walker, Nicholas J.

    2003-01-01

    Low emittance electron storage rings, such as those used in third generation light sources or linear collider damping rings, rely for their performance on highly stable alignment of the lattice components. Even if all vibration and environmental noise sources could be suppressed, diffusive ground motion will lead to orbit drift and emittance growth. Understanding such motion is important for predicting the performance of a planned accelerator and designing a correction system. A description (known as the ATL model) of ground motion over relatively long time scales has been developed and has become the standard for studies of the long straight beamlines in linear colliders. Here, we show how the model may be developed to include beamlines of any geometry. We apply the model to the NLC and TESLA damping rings, to compare their relative stability under different conditions

  16. Overview on methods for formulating explicit damping matrices for non-classically damped structures

    International Nuclear Information System (INIS)

    Xu, J.

    1998-04-01

    In computing the dynamic response of a connected system with multiple components having dissimilar damping characteristics, which is often referred to as nonclassically damped system such as nuclear power plant piping systems supported by stiff structures, one needs to define the system-level damping based upon the damping information of components. This is frequently done in practice using approximate methods expressed as composite modal damping with weighting functions. However, when the difference in damping among components is substantial, the composite modal damping may become inappropriate in the characterization of the damping behavior of such systems. In recent years, several new methods have emerged with the expectation that they could produce more exact system-level damping for a group of nonclassically damped structures which are comprised of components that possess classical modal damping. In this paper, an overview is presented to examine these methods in the light of their theoretical basis, the technical merits, and practical applications. To this end, a synthesis method is described, which was shown to reduce to the other methods in the literature

  17. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  19. Correlation plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.

    1991-05-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. A generalized interface allows the user to perform a wide variety of machine physics experiments without the need for specialized software. It has been used extensively during SLC commissioning and operation. The user may step one or two independent parameters such as magnet or feedback setpoints while measuring or calculating up to 160 others. Measured variables include all analog signals available to the control system as well as a variety of derived parameters such as beam size or emittance. Various fitting algorithms and display options are provided for data analysis. A software-callable interface is also provided. Applications based on this facility are used to phase klystrons, measure emittance and dispersion, minimize beam size at the interaction point and maintain beam collisions. 4 refs., 3 figs

  20. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  1. Beam based alignment of the SLC final focus sextupoles

    International Nuclear Information System (INIS)

    Emma, P.; Irwin, J.; Phinney, N.; Raimondi, P.; Toge, N.; Walker, N.J.; Ziemann, V.

    1993-05-01

    The strong demagnification inherent in final focus systems requires local cancellation of the resulting chromaticty. Strong sextupole pair separated by a -I transform are positioned π/2 in the betatron phase away from the Interaction Point (IP) in order to cancel chromatic aberrations primarily due to the final quadrupoles. Sextupole alignment is critical in order to provide orthogonal tuning of the chromaticty and, in the case of the SLC, to limit the third and higher order optical aberrations generated from misaligned and 'nested' horizontal and vertical sextupole pairs. Reported here is a novel technique for aligning the beam centroid to the sextupole centers, which uses measurements of the criticality dependent parameter - the beam size at the IP. Results for the SLC final focus sextupoles are presented, where a resolution of <50 μm is achieved

  2. First results from SLD with polarized electron beam at SLC

    International Nuclear Information System (INIS)

    Fero, M.J.

    1992-12-01

    The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005

  3. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  4. Beam dynamics in the SLC final focus system

    International Nuclear Information System (INIS)

    Bambade, P.S.

    1987-06-01

    The SLC luminosity is reached by colliding beams focused to about 2 μm transverse sizes. The Final Focus System (FFS) must enable, beyond its basic optical design, the detection and correction of errors accumulated in the system. In this paper, after summarizing the design, we review the sensitivity to such errors and the ability to correct them. The overall tuning strategy involves three phases: single beam spot minimization, steering the beams in collision and luminosity optimization with beam-beam effects

  5. Kayser-Fleischer Rings

    Science.gov (United States)

    ... Support Contacts Lab Tracker/Copper Calculator Stories Programs & Research ... About Everything you need to know about Wilson Disease Kayser-Fleischer Rings Definition Kayser-Fleischer Ring: Clinical sign. Brownish-yellow ring visible around the corneo- ...

  6. The SLD Cerenkov Ring Imaging Detector: Progress report

    International Nuclear Information System (INIS)

    Ashford, V.; Bienz, T.; Bird, F.

    1986-10-01

    We describe test beam results from a prototype Cerenkov Ring Imaging Detector (CRID) for the SLD experiment at the SLAC Linear Collider (SLC). The system includes both liquid and gas radiators, a long drift box containing gaseous TMAE and a proportional wire chamber with charge division readout. Measurements of the multiplicity and detection resolution of Cerenkov photons, from both radiators are presented. Various design aspects of a new engineering prototype, currently under construction, are discussed and recent R and D results relevant to this effort are reported

  7. Shape memory alloys as damping materials

    International Nuclear Information System (INIS)

    Humbeeck, J. van

    2000-01-01

    Shape memory alloys are gaining an increased interest as passive as well as active damping materials. This damping ability when applied in structural elements can lead to a better noise control, improved life time and even better performance of the envisaged tools. By passive damping, it is understood that the material converts a significant part of unwanted mechanical energy into heat. This mechanical energy can be a (resonance) vibration, impact loading or shock waves. This high damping capacity finds its origin in the thermoelastic martensitic phase due to the hysteretic mobility of martensite-variants or different phase interfaces. The damping capacity increases with increasing amplitude of the applied vibration or impact and is almost frequency independent. Special interest exists moreover for damping extreme large displacements by applying the mechanical hysteresis performed during pseudoelastic loading. This aspect is nowadays very strongly studied as a tool for protecting buildings against earthquakes in seismic active regions. Active damping can be obtained in hybrid composites by controlling the recovery stresses or strains of embedded shape memory alloy wires. This controls the internal energy fo a structure which allows controlled modal modification and tuning of the dynamical properties of structural elements. But also impact damage, acoustic radiation, dynamic shape control can be actively controlled. As a consequence improved fatigue-resistance, better performance and a longer lifetime of the structural elements can be obtained. (orig.)

  8. Precise system stabilization at SLC using dither techniques

    International Nuclear Information System (INIS)

    Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.

    1993-01-01

    A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation

  9. Damped button electrode for B-Factory BPM system

    Energy Technology Data Exchange (ETDEWEB)

    Shintake, T; Akasaka, N; Obina, T; Chin, Y H [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan)

    1996-08-01

    A new concept of damping of resonances in a button electrode has been proposed and tested in the BPM system for the B-Factory project at KEK (KEKB). Since a very high current beam has to be stored in the machine, even a small resonance in the ring will result in losing a beam due to multi-bunch instabilities. In a conventional button electrode used in BPMs, a TE110 mode resonance can be trapped in the gap between the electrode and the vacuum chamber. In order to damp this mode, the diameter of the electrode has been chosen to be small to increase the resonance frequency and to radiate the power into the beam pipe. In addition, an asymmetric structure is applied to extract the EM energy of the TE110 mode into the coaxial cable as the propagating TEM mode which has no cut-off frequency. Results of the computer simulations and tests with cold models are reported. The quality factor of the TE110 mode was small enough due to the radiation into the beam pipe even in the conventional electrode and the mode coupling effect due to the asymmetric shape was significant on a cavity-like TE111 mode. (author)

  10. AN N-BODY INTEGRATOR FOR GRAVITATING PLANETARY RINGS, AND THE OUTER EDGE OF SATURN'S B RING

    International Nuclear Information System (INIS)

    Hahn, Joseph M.; Spitale, Joseph N.

    2013-01-01

    A new symplectic N-body integrator is introduced, one designed to calculate the global 360° evolution of a self-gravitating planetary ring that is in orbit about an oblate planet. This freely available code is called epi i nt, and it is distinct from other such codes in its use of streamlines to calculate the effects of ring self-gravity. The great advantage of this approach is that the perturbing forces arise from smooth wires of ring matter rather than discreet particles, so there is very little gravitational scattering and so only a modest number of particles are needed to simulate, say, the scalloped edge of a resonantly confined ring or the propagation of spiral density waves. The code is applied to the outer edge of Saturn's B ring, and a comparison of Cassini measurements of the ring's forced response to simulations of Mimas's resonant perturbations reveals that the B ring's surface density at its outer edge is σ 0 = 195 ± 60 g cm –2 , which, if the same everywhere across the ring, would mean that the B ring's mass is about 90% of Mimas's mass. Cassini observations show that the B ring-edge has several free normal modes, which are long-lived disturbances of the ring-edge that are not driven by any known satellite resonances. Although the mechanism that excites or sustains these normal modes is unknown, we can plant such a disturbance at a simulated ring's edge and find that these modes persist without any damping for more than ∼10 5 orbits or ∼100 yr despite the simulated ring's viscosity ν s = 100 cm 2 s –1 . These simulations also indicate that impulsive disturbances at a ring can excite long-lived normal modes, which suggests that an impact in the recent past by perhaps a cloud of cometary debris might have excited these disturbances, which are quite common to many of Saturn's sharp-edged rings

  11. ASSOCIATIVE RINGS SOLVED AS LIE RINGS

    Directory of Open Access Journals (Sweden)

    M. B. Smirnov

    2011-01-01

    Full Text Available The paper has proved that an associative ring which is solvable of a n- class as a Lie ring has a nilpotent ideal of the nilpotent class not more than 3×10n–2  and a corresponding quotient ring satisfies an identity [[x1, x2, [x3, x4

  12. A Resonant Damping Study Using Piezoelectric Materials

    Science.gov (United States)

    Min, J. B.; Duffy, K. P.; Choi, B. B.; Morrison, C. R.; Jansen, R. H.; Provenza, A. J.

    2008-01-01

    Excessive vibration of turbomachinery blades causes high cycle fatigue (HCF) problems requiring damping treatments to mitigate vibration levels. Based on the technical challenges and requirements learned from previous turbomachinery blade research, a feasibility study of resonant damping control using shunted piezoelectric patches with passive and active control techniques has been conducted on cantilever beam specimens. Test results for the passive damping circuit show that the optimum resistive shunt circuit reduces the third bending resonant vibration by almost 50%, and the optimum inductive circuit reduces the vibration by 90%. In a separate test, active control reduced vibration by approximately 98%.

  13. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  14. Bursts of Coherent Synchrotron Radiation in Electron Storage Rings: a Dynamical Model

    Energy Technology Data Exchange (ETDEWEB)

    Venturini, Marco

    2002-09-17

    Evidence of coherent synchrotron radiation (CSR) has been reported recently at the electron storage rings of several light source facilities. The main features of the observations are (i) a radiation wavelength short compared to the nominal bunch length, and (ii) a coherent signal showing recurrent bursts of duration much shorter than the radiation damping time, but with spacing equal to a substantial fraction of the damping time. We present a model of beam longitudinal dynamics that reproduces these features.

  15. Resonant Electromagnetic Shunt Damping of Flexible Structures

    DEFF Research Database (Denmark)

    Høgsberg, Jan Becker

    2016-01-01

    Electromagnetic transducers convert mechanical energy to electrical energy and vice versa. Effective passive vibration damping of flexible structures can therefore be introduced by shunting with an accurately calibrated resonant electrical network thatcontains a capacitor to create the desired...

  16. Offline software for the DAMPE experiment

    Science.gov (United States)

    Wang, Chi; Liu, Dong; Wei, Yifeng; Zhang, Zhiyong; Zhang, Yunlong; Wang, Xiaolian; Xu, Zizong; Huang, Guangshun; Tykhonov, Andrii; Wu, Xin; Zang, Jingjing; Liu, Yang; Jiang, Wei; Wen, Sicheng; Wu, Jian; Chang, Jin

    2017-10-01

    A software system has been developed for the DArk Matter Particle Explorer (DAMPE) mission, a satellite-based experiment. The DAMPE software is mainly written in C++ and steered using a Python script. This article presents an overview of the DAMPE offline software, including the major architecture design and specific implementation for simulation, calibration and reconstruction. The whole system has been successfully applied to DAMPE data analysis. Some results obtained using the system, from simulation and beam test experiments, are presented. Supported by Chinese 973 Program (2010CB833002), the Strategic Priority Research Program on Space Science of the Chinese Academy of Science (CAS) (XDA04040202-4), the Joint Research Fund in Astronomy under cooperative agreement between the National Natural Science Foundation of China (NSFC) and CAS (U1531126) and 100 Talents Program of the Chinese Academy of Science

  17. Simplified Model of Nonlinear Landau Damping

    International Nuclear Information System (INIS)

    Yampolsky, N.A.; Fisch, N.J.

    2009-01-01

    The nonlinear interaction of a plasma wave with resonant electrons results in a plateau in the electron distribution function close to the phase velocity of the plasma wave. As a result, Landau damping of the plasma wave vanishes and the resonant frequency of the plasma wave downshifts. However, this simple picture is invalid when the external driving force changes the plasma wave fast enough so that the plateau cannot be fully developed. A new model to describe amplification of the plasma wave including the saturation of Landau damping and the nonlinear frequency shift is proposed. The proposed model takes into account the change of the plasma wave amplitude and describes saturation of the Landau damping rate in terms of a single fluid equation, which simplifies the description of the inherently kinetic nature of Landau damping. A proposed fluid model, incorporating these simplifications, is verified numerically using a kinetic Vlasov code.

  18. Damping of type III solar radio bursts

    International Nuclear Information System (INIS)

    Levin, B.N.

    1982-01-01

    The meter- and decameter-wavelength damping of type III bursts may be attributable to stabilization of the Langmuir-wave instability of the fast-electron streams through excitation of cyclotron-branch plasma waves

  19. Error-finding and error-correcting methods for the start-up of the SLC

    International Nuclear Information System (INIS)

    Lee, M.J.; Clearwater, S.H.; Kleban, S.D.; Selig, L.J.

    1987-02-01

    During the commissioning of an accelerator, storage ring, or beam transfer line, one of the important tasks of an accelertor physicist is to check the first-order optics of the beam line and to look for errors in the system. Conceptually, it is important to distinguish between techniques for finding the machine errors that are the cause of the problem and techniques for correcting the beam errors that are the result of the machine errors. In this paper we will limit our presentation to certain applications of these two methods for finding or correcting beam-focus errors and beam-kick errors that affect the profile and trajectory of the beam respectively. Many of these methods have been used successfully in the commissioning of SLC systems. In order not to waste expensive beam time we have developed and used a beam-line simulator to test the ideas that have not been tested experimentally. To save valuable physicist's time we have further automated the beam-kick error-finding procedures by adopting methods from the field of artificial intelligence to develop a prototype expert system. Our experience with this prototype has demonstrated the usefulness of expert systems in solving accelerator control problems. The expert system is able to find the same solutions as an expert physicist but in a more systematic fashion. The methods used in these procedures and some of the recent applications will be described in this paper

  20. Proceedings of Damping Volume 1 of 3

    Science.gov (United States)

    1993-06-01

    paper. This work will present a passive piezoelectric damping implementation on ASTREX, a large space structure. The motivation behind this research is...Presented at Damping 󈨡 San Francisco, CA February 24-26, 1993 Motivation "• Accurate design of precision structures "* Computer modelling - Design...14) (KI f(0)/Fl,.) FRom equations (3) and (6), Young’s modulus of rubber specimen is written as; L Ea-K (15) A E - EJ(I+ PS4 ) (16) NONRESONANT TEST

  1. Quantum damped oscillator I: Dissipation and resonances

    International Nuclear Information System (INIS)

    Chruscinski, Dariusz; Jurkowski, Jacek

    2006-01-01

    Quantization of a damped harmonic oscillator leads to so called Bateman's dual system. The corresponding Bateman's Hamiltonian, being a self-adjoint operator, displays the discrete family of complex eigenvalues. We show that they correspond to the poles of energy eigenvectors and the corresponding resolvent operator when continued to the complex energy plane. Therefore, the corresponding generalized eigenvectors may be interpreted as resonant states which are responsible for the irreversible quantum dynamics of a damped harmonic oscillator

  2. EVOLUTION OF A RING AROUND THE PLUTO–CHARON BINARY

    Energy Technology Data Exchange (ETDEWEB)

    Bromley, Benjamin C. [Department of Physics and Astronomy, University of Utah, 115 S 1400 E, Rm 201, Salt Lake City, UT 84112 (United States); Kenyon, Scott J., E-mail: bromley@physics.utah.edu, E-mail: skenyon@cfa.harvard.edu [Smithsonian Astrophysical Observatory, 60 Garden St., Cambridge, MA 02138 (United States)

    2015-08-10

    We consider the formation of satellites around the Pluto–Charon binary. An early collision between the two partners likely produced the binary and a narrow ring of debris, out of which arose the moons Styx, Nix, Kerberos, and Hydra. How the satellites emerged from the compact ring is uncertain. Here we show that a particle ring spreads from physical collisions and collective gravitational scattering, similar to migration. Around a binary, these processes take place in the reference frames of “most circular” orbits, akin to circular ones in a Keplerian potential. Ring particles damp to these orbits and avoid destructive collisions. Damping and diffusion also help particles survive dynamical instabilities driven by resonances with the binary. In some situations, particles become trapped near resonances that sweep outward with the tidal evolution of the Pluto–Charon binary. With simple models and numerical experiments, we show how the Pluto–Charon impact ring may have expanded into a broad disk, out of which grew the circumbinary moons. In some scenarios, the ring can spread well beyond the orbit of Hydra, the most distant moon, to form a handful of smaller satellites. If these small moons exist, New Horizons will find them.

  3. Approximation of the modal damping coefficients equivalent to material damping by harmonic excitation with ASKA

    International Nuclear Information System (INIS)

    Edme, R.

    1983-01-01

    If a dynamic response analysis (harmonic excitation) is carried out with the modal method, the modal damping coefficients must be approximated to match the structural damping. The program ASKA-Damping, which also supplies an error assessment of the approximation, was developed for this purpose. The modal method and the direct method are applied to a test example and their results compared. It is suggested that the ASKA manufacturers extend the spectral earthquake response analysis to take these modal damping coefficients into account so that the results become less conservative. (orig.) [de

  4. Electromagnetic damping of neutron star oscillations

    International Nuclear Information System (INIS)

    McDermott, P.N.; Savedoff, M.P.; Van Horn, H.M.; Zweibel, E.G.; Hansen, C.J.

    1984-01-01

    Nonradial pulsations of a neutron star with a strong dipole magnetic field cause emission of electromagnetic radiation. Here we compute the power radiated to vacuum by neutron star g-mode pulsations and by torsional oscillations of the neutron star crust. For the low-order quadrupole fluid g-modes we have considered, we find electromagnetic damping to be considerably more effective than gravitational radiation. For example, a 0.5 M/sub sun/ neutron star with a core temperature approx.10 7 K has a g 1 -mode period of 371 ms; for this mode were find the electromagnetic damping time to be tau/sub FM/approx.0.3 s, assuming the surface magnetic field strength of the neutron star to be B 0 approx.10 12 gauss. This is considerably less than the corresponding gravitational radiation time tau/sub GR/approx.3 x 10 17 yr. For dipole g-mode oscillations, there is no gravitational radiation, but electromagnetic damping and ohmic dissipation are efficient damping mechanisms. For dipole torsional oscillations, we find that electromagnetic damping again dominates, with tau/sub EM/approx.5 yr. Among the cases we have studied, quadrupole torsional oscillations appear to be dominated by gravitational radiation damping, with tau/sub GR/approx.10 4 yr, as compared with tau/sub EM/approx.2 x 10 7 yr

  5. Bryan's effect and anisotropic nonlinear damping

    Science.gov (United States)

    Joubert, Stephan V.; Shatalov, Michael Y.; Fay, Temple H.; Manzhirov, Alexander V.

    2018-03-01

    In 1890, G. H. Bryan discovered the following: "The vibration pattern of a revolving cylinder or bell revolves at a rate proportional to the inertial rotation rate of the cylinder or bell." We call this phenomenon Bryan's law or Bryan's effect. It is well known that any imperfections in a vibratory gyroscope (VG) affect Bryan's law and this affects the accuracy of the VG. Consequently, in this paper, we assume that all such imperfections are either minimised or eliminated by some known control method and that only damping is present within the VG. If the damping is isotropic (linear or nonlinear), then it has been recently demonstrated in this journal, using symbolic analysis, that Bryan's law remains invariant. However, it is known that linear anisotropic damping does affect Bryan's law. In this paper, we generalise Rayleigh's dissipation function so that anisotropic nonlinear damping may be introduced into the equations of motion. Using a mixture of numeric and symbolic analysis on the ODEs of motion of the VG, for anisotropic light nonlinear damping, we demonstrate (up to an approximate average), that Bryan's law is affected by any form of such damping, causing pattern drift, compromising the accuracy of the VG.

  6. Piping system damping data at higher frequencies

    International Nuclear Information System (INIS)

    Ware, A.G.

    1987-01-01

    Research has been performed at the Idaho National Engineering Laboratory (INEL) for the United States Nuclear Regulatory Commission (USNRC) to determine best-estimate damping values for dynamic analyses of nuclear piping systems excited in the 20 to 100 Hz frequency range. Vibrations in this frequency range are typical of fluid-induced transients, for which no formal pipe damping guidelines exist. The available data found in the open literature and the USNRC/INEL nuclear piping damping data bank were reviewed, and a series of tests on a straight 3-in. (76-mm) piping system and a 5-in. (127-mm) system with several bends and elbows were conducted as part of this research program. These two systems were supported with typical nuclear piping supports that could be changed from test to test during the series. The resulting damping values were ≥ those of the Pressure Vessel Research Committee (PVRC) proposal for unisulated piping. Extending the PVRC damping curve from 20 to 100 Hz at 3% of critical damping would give a satisfactory representation of the test data. This position has been endorsed by the PVRC Technical Committee on Piping Systems. 14 refs

  7. Stirling engine piston ring

    Science.gov (United States)

    Howarth, Roy B.

    1983-01-01

    A piston ring design for a Stirling engine wherein the contact pressure between the piston and the cylinder is maintained at a uniform level, independent of engine conditions through a balancing of the pressure exerted upon the ring's surface and thereby allowing the contact pressure on the ring to be predetermined through the use of a preloaded expander ring.

  8. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  9. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  10. Alternative loop rings

    CERN Document Server

    Goodaire, EG; Polcino Milies, C

    1996-01-01

    For the past ten years, alternative loop rings have intrigued mathematicians from a wide cross-section of modern algebra. As a consequence, the theory of alternative loop rings has grown tremendously. One of the main developments is the complete characterization of loops which have an alternative but not associative, loop ring. Furthermore, there is a very close relationship between the algebraic structures of loop rings and of group rings over 2-groups. Another major topic of research is the study of the unit loop of the integral loop ring. Here the interaction between loop rings and group ri

  11. Vortices trapped in discrete Josephson rings

    International Nuclear Information System (INIS)

    Van der Zanta, H.S.J.; Orlando, T.P.; Watanabe, Shinya; Strogatz, S.H.

    1994-01-01

    We report the first measurements of current- (I-V) characteristics of discrete rings of Josephson junctions. As I is increased, resonant steps appear in the I-V curve, due to phase-locking between a propagating, trapped vortex and the linear waves excited in its wake. Unexpectedly, the phase velocity of the linear waves, not the group velocity, is the physically important quantity and mode numbers outside the Brillouin zone are relevant. Our measurements show that away from the resonant steps, a single vortex can move in an environment with very little damping, making the discrete one-dimensional ring a well-defined model system for the study of ballistic and quantum vortex experiments. ((orig.))

  12. Vortices trapped in discrete Josephson rings

    Energy Technology Data Exchange (ETDEWEB)

    Van der Zanta, H.S.J. [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Orlando, T.P. [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Watanabe, Shinya [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Strogatz, S.H. [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)

    1994-12-01

    We report the first measurements of current- (I-V) characteristics of discrete rings of Josephson junctions. As I is increased, resonant steps appear in the I-V curve, due to phase-locking between a propagating, trapped vortex and the linear waves excited in its wake. Unexpectedly, the phase velocity of the linear waves, not the group velocity, is the physically important quantity and mode numbers outside the Brillouin zone are relevant. Our measurements show that away from the resonant steps, a single vortex can move in an environment with very little damping, making the discrete one-dimensional ring a well-defined model system for the study of ballistic and quantum vortex experiments. ((orig.)).

  13. Storage-ring FEL for the vuv

    International Nuclear Information System (INIS)

    Peterson, J.M.; Bisognano, J.J.; Garren, A.A.; Halbach, K.; Kim, K.J.; Sah, R.C.

    1984-09-01

    A free-electron laser for the vuv operating in a storage ring requires an electron beam of high density and low energy spread and a short wavelength, narrow-gap undulator. These conditions tend to produce longitudinal and transverse beam instabilities, excessive beam growth through multiple intrabeam scattering, and a short gas-scattering lifetime. Passing the beam only occasionally through the undulator in a by-pass straight section, as proposed by Murphy and Pellegrini, allows operation in a high-gain, single-pass mode and a long gas-scattering lifetime. Several storage ring designs have been considered to see how best to satisfy the several requirements. Each features a by-pass, a low-emittance lattice, and built-in wigglers for enhanced damping to counteract the intra-beam scattering. 15 references, 3 figures, 2 tables

  14. Modelling of Resonantly Forced Density Waves in Dense Planetary Rings

    Science.gov (United States)

    Lehmann, M.; Schmidt, J.; Salo, H.

    2014-04-01

    Density wave theory, originally proposed to explain the spiral structure of galactic disks, has been applied to explain parts of the complex sub-structure in Saturn's rings, such as the wavetrains excited at the inner Lindblad resonances (ILR) of various satellites. The linear theory for the excitation and damping of density waves in Saturn's rings is fairly well developed (e.g. Goldreich & Tremaine [1979]; Shu [1984]). However, it fails to describe certain aspects of the observed waves. The non-applicability of the linear theory is already indicated by the "cusplike" shape of many of the observed wave profiles. This is a typical nonlinear feature which is also present in overstability wavetrains (Schmidt & Salo [2003]; Latter & Ogilvie [2010]). In particular, it turns out that the detailed damping mechanism, as well as the role of different nonlinear effects on the propagation of density waves remain intransparent. First attemps are being made to investigate the excitation and propagation of nonlinear density waves within a hydrodynamical formalism, which is also the natural formalism for describing linear density waves. A simple weakly nonlinear model, derived from a multiple-scale expansion of the hydrodynamic equations, is presented. This model describes the damping of "free" spiral density waves in a vertically integrated fluid disk with density dependent transport coefficients, where the effects of the hydrodynamic nonlinearities are included. The model predicts that density waves are linearly unstable in a ring region where the conditions for viscous overstability are met, which translates to a steep dependence of the shear viscosity with respect to the disk's surface density. The possibility that this dependence could lead to a growth of density waves with increasing distance from the resonance, was already mentioned in Goldreich & Tremaine [1978]. Sufficiently far away from the ILR, the surface density perturbation caused by the wave, is predicted to

  15. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  16. A calorimeter software trigger for the Mark II detector at SLC [Stanford Linear Collider

    International Nuclear Information System (INIS)

    Briggs, D.; Glanzman, T.; Grosse-Wiesmann, P.; Tinsman, J.; Holmgren, S.; Schaad, M.W.

    1989-04-01

    A new FASTBUS-based calorimeter software trigger for the upgraded Mark II at the Stanford Linear Collider (SLC) is presented. The trigger requirements for SLC and a short description of the hardware used for this purpose are given, followed by a detailed description of the software. Some preliminary results are presented. 9 refs., 4 figs

  17. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  18. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  19. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  20. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.

    1987-03-01

    The polarimeters needed to monitor and measure electron beam polarization at the Stanford Linear Collider are discussed. Two types of polarimeters, are to be used. The first is based on the spin dependent elastic scattering of photons from high energy electrons. The second utilizes the spin dependence of elastic electron-electron scattering. The plans of the SLC polarization group to measure and monitor electron beam polarization are discussed. A brief discussion of the physics and the demands it imposes on beam polarization measurements is presented. The Compton polarimeter and the essential characteristics of two Moeller polarimeters are presented

  1. Review of weak mixing angle results at SLC and LEP

    International Nuclear Information System (INIS)

    Woods, M.

    1995-10-01

    In this paper, the authors review recent precise measurements of the weak mixing angle by the SLD experiment at SLC and by the ALEPH, DELPHI, L3, and OPAL experiments at LEP. If they assume that the Minimal Standard Model provides a complete description of the quark and lepton couplings to the Z boson, they find sin 2 θ W eff = 0.23143 ± 0.00028. If this assumption is relaxed to apply to lepton couplings only, they find sin 2 θ W eff = 0.23106 ± 0.00035. They compare these results with other precision electroweak tests

  2. Timing jitter measurements at the SLC electron source

    International Nuclear Information System (INIS)

    Sodja, J.; Browne, M.J.; Clendenin, J.E.

    1989-03-01

    The SLC thermionic gun and electron source produce a beam of up to 15 /times/ 10 10 /sub e//minus/ in a single S-band bunch. A 170 keV, 2 ns FWHM pulse out of the gun is compressed by means of two subharmonic buncher cavities followed by an S-band buncher and a standard SLAC accelerating section. Ceramic gaps in the beam pipe at the output of the gun allow a measure of the beam intensity and timing. A measurement at these gaps of the timing jitter, with a resolution of <10 ps, is described. 3 refs., 5 figs

  3. Recent improvements in the SLC positron system performance

    International Nuclear Information System (INIS)

    Krejcik, P.; Corbett, J.; Ecklund, S.; Emma, P.; Fieguth, T.; Helm, R.; Kulikov, A.; Limberg, T.; Moshammer, H.; Ross, M.; Siemann, R.; Spence, W.; Woodley, M.

    1992-03-01

    The positron system is very specific to the SLC in that the positrons are accelerated in the same linac as the electrons that produce them and the electrons with which they collide. Some of the difficulties in tuning this system to peak performance are thus unlikely to be encountered in future linear colliders, but many of the lessons learned in beam matching are useful for future machines. The design and commissioning of this system has been previously reported so we only briefly describe the major subsystems before detailing the tuning and diagnostics involved in optimizing the performance of the overall system

  4. The completed design of the SLC Final Focus System

    International Nuclear Information System (INIS)

    Murray, J.J.; Brown, K.L.; Fieguth, T.

    1987-02-01

    The design of the SLC Final Focus System has evolved from its initial conceptual design into its final form. This final design is described including a review of the critical decisions influencing the adoption of particular features. The creation of a feasible design has required that these decisions be tempered by practical considerations such as site constraints, correction of optical errors caused by imperfections, and accommodations requested by engineers and particle detector physicists. As this is the first such system to be built, it is hoped that the experience gained will be useful for the design of future systems

  5. Multi-channel pulser for the SLC thermionic electron source

    International Nuclear Information System (INIS)

    Browne, M.J.; Clendenin, J.E.; Corredoura, P.L.; Jobe, R.K.; Koontz, R.F.; Sodja, J.

    1985-01-01

    A new pulser developed for the SLC thermionic gun has been operational since September 1984. It consists of two planar triode amplifiers with a common output triode driving the gun cathode to produce two independent pulses of up to 9A with a 3 nsec FWHM pulse width. Three long-pulse amplifiers are also connected to the cathode to produce pulses with widths controllable between 100 nsec and 1.6 μsec. Each amplifier has independent timing and amplitude control through a fiber optic link to the high voltage plane of the gun cathode-grid structure. The pulser and its operating characteristics are described. 15 refs., 3 figs

  6. Some experiences from the commissioning program of the SLC arcs

    International Nuclear Information System (INIS)

    Fischer, G.E.; Brown, K.L.; Bulos, F.; Fieguth, T.; Hutton, A.; Murray, J.J.; Toge, N.; Weng, W.T.; Wiedemann, H.

    1987-01-01

    The SLC Arc System is designed to transport beams of electrons and positrons from the end of the SLAC Linac to the beginning of the Final Focus System where they are made to collide head on. To minimize phase space dilution caused by quantum processes in the synchrotron radiation energy loss mechanism, the bending radii are large (279 m) and very high gradient (n = 32824) AG cells are arranged in trains of low dispersion, terrain following achromats. First experiences in operating a system of over 900 magnets, each with beam position monitors and corrector magnet movers, spanning 9000 feet, are described

  7. Beam position monitor readout and control in the SLC linac

    International Nuclear Information System (INIS)

    Bogart, J.; Phinney, N.; Ross, M.; Yaffe, D.

    1985-04-01

    A beam position monitoring system has been implemented in the first third of the SLC linac which provides a complete scan of the trajectory on a single beam pulse. The data is collected from the local micro-computers and viewed with an updating display at a console or passed on to application programs. The system must operate with interlaced beams so the scans are also interlaced, providing each user with the ability to select the beam, the update rate, and the attenuation level in the digitizing hardware. In addition each user calibrates the hardware for his beam. A description of the system architecture will be presented. 6 refs., 4 figs

  8. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  9. Dampness in buildings and health. Building characteristics as predictors for dampness in 8681 Swedish dwellings

    DEFF Research Database (Denmark)

    Hagerhed, L.; Bornehag, Carl-Gustaf; Sundell, Jan

    2002-01-01

    Questionnaire data on 8681 dwellings included in the Swedish study "Dampness in Buildings and Health" have been analysed for associations between dampness indicators, perceptions of indoor air quality and building characteristics such as time of construction, type of ventilation and type of found......Questionnaire data on 8681 dwellings included in the Swedish study "Dampness in Buildings and Health" have been analysed for associations between dampness indicators, perceptions of indoor air quality and building characteristics such as time of construction, type of ventilation and type...... of "Dry air" in 17.3 and 33.7% respectively. Older buildings and the use of natural ventilation were associated with increased frequency of dampness indicators as well as to increased frequencies of complaints on bad indoor air quality....

  10. Numerical studies of shear damped composite beams using a constrained damping layer

    DEFF Research Database (Denmark)

    Kristensen, R.F.; Nielsen, Kim Lau; Mikkelsen, Lars Pilgaard

    2008-01-01

    Composite beams containing one or more damping layers are studied numerically. The work is based on a semi-analytical model using a Timoshenko beam theory and a full 2D finite element model. The material system analysed, is inspired by a train wagon suspension system used in a EUREKA project Sigma......!1841. For the material system, the study shows that the effect of the damping layer is strongly influenced by the presence of a stiff constraining layer, that enforces large shear strain amplitudes. The thickness of the damping rubber layer itself has only a minor influence on the overall damping....... In addition, a large influence of ill positioned cuts in the damping layer is observed....

  11. Unwrapped phase inversion with an exponential damping

    KAUST Repository

    Choi, Yun Seok

    2015-07-28

    Full-waveform inversion (FWI) suffers from the phase wrapping (cycle skipping) problem when the frequency of data is not low enough. Unless we obtain a good initial velocity model, the phase wrapping problem in FWI causes a result corresponding to a local minimum, usually far away from the true solution, especially at depth. Thus, we have developed an inversion algorithm based on a space-domain unwrapped phase, and we also used exponential damping to mitigate the nonlinearity associated with the reflections. We construct the 2D phase residual map, which usually contains the wrapping discontinuities, especially if the model is complex and the frequency is high. We then unwrap the phase map and remove these cycle-based jumps. However, if the phase map has several residues, the unwrapping process becomes very complicated. We apply a strong exponential damping to the wavefield to eliminate much of the residues in the phase map, thus making the unwrapping process simple. We finally invert the unwrapped phases using the back-propagation algorithm to calculate the gradient. We progressively reduce the damping factor to obtain a high-resolution image. Numerical examples determined that the unwrapped phase inversion with a strong exponential damping generated convergent long-wavelength updates without low-frequency information. This model can be used as a good starting model for a subsequent inversion with a reduced damping, eventually leading to conventional waveform inversion.

  12. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  13. Coupled-bunch instabilities in the APS ring

    International Nuclear Information System (INIS)

    Emery, L.

    1991-01-01

    A study of coupled bunch instabilities for the APS storage ring is presented. The instabilities are driven by the higher-order modes of the fifteen 352-MHz single-cell RF cavities. These modes are modeled using the 2-D cavity program URMEL. The program ZAP is then used to estimate the growth time of the instabilities for an equally-spaced bunch pattern. The cavity modes most responsible for the instabilities will be singles out for damping. 7 refs., 5 tabs

  14. Investigation of longitudinal dynamic in laser electron storage ring

    Energy Technology Data Exchange (ETDEWEB)

    Karnaukhov, I.; Zelinsky, A. E-mail: zelinsky@kipt.kharkov.ua; Telegin, Yu

    2001-09-01

    Longitudinal dynamic of electron beam due to radiation damping and quantum fluctuations in the storage ring with a laser-electron interaction section (Compton scattering) is investigated. This investigation was carried out by numerical simulations using the Monte Carlo method. The dependence of the steady-state energy spread of electron beam due to the Compton back scattering of photons on the electron beam energy and photon flash density were obtained. Simulation findings are compared with the analytical estimations by Z. Huang.

  15. Investigation of longitudinal dynamic in laser electron storage ring

    CERN Document Server

    Karnaukhov, I; Telegin, Yu P

    2001-01-01

    Longitudinal dynamic of electron beam due to radiation damping and quantum fluctuations in the storage ring with a laser-electron interaction section (Compton scattering) is investigated. This investigation was carried out by numerical simulations using the Monte Carlo method. The dependence of the steady-state energy spread of electron beam due to the Compton back scattering of photons on the electron beam energy and photon flash density were obtained. Simulation findings are compared with the analytical estimations by Z. Huang.

  16. Damping in heat exchanger tube bundles. A review

    International Nuclear Information System (INIS)

    Iqbal, Qamar; Khushnood, Shahab; Ghalban, Ali Roheim El; Sheikh, Nadeem Ahmed; Malik, Muhammad Afzaal; Arastu, Asif

    2007-01-01

    Damping is a major concern in the design and operation of tube bundles with loosely supported tubes in baffles for process shell and tube heat exchangers and steam generators which are used in nuclear, process and power generation industries. System damping has a strong influence on the amplitude of vibration. Damping depends upon the mechanical properties of the tube material, geometry of intermediate supports and the physical properties of shell-side fluid. Type of tube motion, number of supports, tube frequency, vibration amplitude, tube mass or diameter, side loads, support thickness, higher modes, shell-side temperature etc., affect damping in tube bundles. The importance of damping is further highlighted due to current trend of larger exchangers with increased shell-side velocities in modern units. Various damping mechanisms have been identified (Friction damping, Viscous damping, Squeeze film damping, Support damping. Two-Phase damping, and very recent-Thermal damping), which affect the performance of process exchangers and steam generators with respect to flow induced vibration design, including standard design guidelines. Damping in two-phase flow is very complex and highly void fraction, and flow-regime dependent. The current paper focuses on the various known damping mechanisms subjected to both single and two-phase cross-flow in process heat exchangers and steam generators and formulates the design guidelines for safer design. (author)

  17. Subsidence of the pit slab at SLC experimental hall

    International Nuclear Information System (INIS)

    Inaba, J.; Himeno, Yoichi; Katsura, Yutaka

    1992-01-01

    Detectors installed at particle accelerator facilities are quite heavy, weighing thousands of tons. On the other hand, ground subsidence caused by the installation of a detector adversely affects the beam line alignment of the collider. It becomes, therefore, very important to figure out the expected amount of ground settlement by means of adequate evaluation methods in advance. At Stanford Linear Accelerator Center (SLAC), a 1700 mT (metric tons) Mark II detector was replaced with a 4000 mT SLD detector in Stanford Linear Collider (SLC). The exchange started in December 1990 and lasted until March 1991, and the amount of ground settlement was measured by SLAC during that period. We performed simulation studies to evaluate the subsidence of the pit slab using several analysis methods. Parameters used for the analyses were decided based on the information of the SLC structure and the ground conditions at the SLAC area. The objective of this study is to verify the applicability of several simulation methods by comparing the analytical results with the actual subsidence data obtained by SLAC

  18. Nuclear power plant piping damping parametric effects

    International Nuclear Information System (INIS)

    Ware, A.G.

    1983-01-01

    The NRC and EG and G Idaho are engaged in programs to evaluate piping-system damping, in order to provide realistic and less conservative values to be used in seismic analyses. To generate revised guidelines, solidly based on technical data, new experimental data need to be generated and assessed, and the parameters which influence piping-system damping need to be quantitatively identified. This paper presents the current state-of-the-art knowledge in the United States on parameters which influence piping-system damping. Examples of inconsistencies in the data and areas of uncertainty are explained. A discussion of programs by EG and G Idaho and other organizations to evaluate various effects are included, and both short-and long-range goals of the program are outlined

  19. Radiation damping in focusing-dominated systems

    International Nuclear Information System (INIS)

    Huang, Zhirong; Chen, Pisin; Ruth, R.D.

    1995-01-01

    A quasi-classical method is developed to calculate the radiation damping of a relativistic particle in a straight, continuous focusing system. In one limiting case where the pitch angle of the particle θ p is much larger than the radiation opening angle 1/γ, the radiation power spectrum is similar to synchrotron radiation and the relative damping rate of the transverse action is proportional to the relative energy loss rate. In the other limiting case where θ p much-lt 1/γ, the radiation is dipole in nature and the relative damping rate of the transverse action is energy-independent and is much faster than the relative energy rate. Quantum excitation to the transverse action is absent in this focusing channel. These results can be extended to bent systems provided that the focusing field dominates over the bending field

  20. Damping of wind turbine tower vibrations

    DEFF Research Database (Denmark)

    Brodersen, Mark Laier; Pedersen, Mikkel Melters

    Damping of wind turbine vibrations by supplemental dampers is a key ingredient for the continuous use of monopiles as support for offshore wind turbines. The present thesis consists of an extended summary with four parts and appended papers [P1-P4] concerning novel strategies for damping of tower...... dominated vibrations.The first part of the thesis presents the theoretical framework for implementation of supplemental dampers in wind turbines. It is demonstrated that the feasibility of installing dampers at the bottom of the tower is significantly increased when placing passive or semiactive dampers...... in a stroke amplifying brace, which amplifies the displacement across the damper and thus reduces the desired level of damper force. For optimal damping of the two lowest tower modes, a novel toggle-brace concept for amplifying the bending deformation of the tower is presented. Numerical examples illustrate...

  1. Minimum wakefield achievable by waveguide damped cavity

    International Nuclear Information System (INIS)

    Lin, X.E.; Kroll, N.M.

    1995-01-01

    The authors use an equivalent circuit to model a waveguide damped cavity. Both exponentially damped and persistent (decay t -3/2 ) components of the wakefield are derived from this model. The result shows that for a cavity with resonant frequency a fixed interval above waveguide cutoff, the persistent wakefield amplitude is inversely proportional to the external Q value of the damped mode. The competition of the two terms results in an optimal Q value, which gives a minimum wakefield as a function of the distance behind the source particle. The minimum wakefield increases when the resonant frequency approaches the waveguide cutoff. The results agree very well with computer simulation on a real cavity-waveguide system

  2. Damping coherent phase oscillations by means of path-length modulation

    International Nuclear Information System (INIS)

    Rees, J.R.

    1978-06-01

    Multi-bunch storage rings and synchrotrons are typically plagued by a tendency for the bunches to indulge in unstable coherent phase oscillations engendered by their electromagnetic interactions with the vacuum chamber. In many machines feedback systems have been used successfully to damp these oscillations using a signal proportional to the coherent phase motion or the concomitant energy motion to control an auxiliary longitudinal electric field. The purpose of this note is to describe an alternative feedback system which, using the same kind of a signal, modulates the path length of the orbit of the reference particle (the synchronous particle in the absence of coherent phase oscillations) in such a way as to damp coherent oscillations. 2 refs., 1 fig

  3. Quantization of the damped harmonic oscillator revisited

    Energy Technology Data Exchange (ETDEWEB)

    Baldiotti, M.C., E-mail: baldiott@fma.if.usp.b [Instituto de Fisica, Universidade de Sao Paulo, Caixa Postal 66318-CEP, 05315-970 Sao Paulo, S.P. (Brazil); Fresneda, R., E-mail: fresneda@gmail.co [Instituto de Fisica, Universidade de Sao Paulo, Caixa Postal 66318-CEP, 05315-970 Sao Paulo, S.P. (Brazil); Gitman, D.M., E-mail: gitman@dfn.if.usp.b [Instituto de Fisica, Universidade de Sao Paulo, Caixa Postal 66318-CEP, 05315-970 Sao Paulo, S.P. (Brazil)

    2011-04-11

    We return to the description of the damped harmonic oscillator with an assessment of previous works, in particular the Bateman-Caldirola-Kanai model and a new model proposed by one of the authors. We argue the latter has better high energy behavior and is connected to existing open-systems approaches. - Highlights: We prove the local equivalence of two damped harmonic oscillator models. We find different high energy behaviors between the two models. Based on the local equivalence, we make a simple construction of the coherent states.

  4. Quantization of the damped harmonic oscillator revisited

    International Nuclear Information System (INIS)

    Baldiotti, M.C.; Fresneda, R.; Gitman, D.M.

    2011-01-01

    We return to the description of the damped harmonic oscillator with an assessment of previous works, in particular the Bateman-Caldirola-Kanai model and a new model proposed by one of the authors. We argue the latter has better high energy behavior and is connected to existing open-systems approaches. - Highlights: → We prove the local equivalence of two damped harmonic oscillator models. → We find different high energy behaviors between the two models. → Based on the local equivalence, we make a simple construction of the coherent states.

  5. Variable stiffness and damping MR isolator

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, X Z; Wang, X Y; Li, W H; Kostidis, K [University of Wollongong, School of Mechanical, Materials and Mechatronic Engineering, NSW 2522 (Australia)], E-mail: weihuali@uow.edu.au

    2009-02-01

    This paper presents the development of a magnetorheological (MR) fluid-based variable stiffness and damping isolator for vibration suppressions. The MR fluid isolator used a sole MR control unit to achieve the variable stiffness and damping in stepless and relative large scope. A mathematical model of the isolator was derived, and a prototype of the MR fluid isolator was fabricated and its dynamic behavior was measured in vibration under various applied magnetic fields. The parameters of the model under various magnetic fields were identified and the dynamic performances of isolator were evaluated.

  6. Modulated Langmuir waves and nonlinear Landau damping

    International Nuclear Information System (INIS)

    Yajima, Nobuo; Oikawa, Masayuki; Satsuma, Junkichi; Namba, Chusei.

    1975-01-01

    The nonlinear Schroedinger euqation with an integral term, iusub(t)+P/2.usub(xx)+Q/u/ 2 u+RP∫sub(-infinity)sup(infinity)[/u(x',t)/ 2 /(x-x')]dx'u=0, which describes modulated Langmuir waves with the nonlinear Landau damping effect, is solved by numerical calculations. Especially, the effects of nonlinear Landau damping on solitary wave solutions are studied. For both cases, PQ>0 and PQ<0, the results show that the solitary waves deform in an asymmetric way changing its velocity. (auth.)

  7. Damping of multispan heat exchanger tubes. Pt. 1: in gases

    International Nuclear Information System (INIS)

    Pettigrew, M.J.; Goyder, H.G.D.; Qiao, Z.L.; Axisa, F.

    1986-07-01

    Flow-induced vibration analyses of heat exchanger tubes require the knowledge of damping. This paper treats the question of damping on multispan heat exchanger tubes in air and gases. The different energy dissipation mechanisms that contribute to tube damping are discussed. The available experimental data are reviewed and analysed. We find that the main damping mechanism in gases is friction between tube and tube-supports. Damping is strongly related to tube-support thickness. Damping values are recommended for design purposes. This study is interesting in the nuclear industry for it often uses heat exchangers

  8. Comparative Research on Characteristics of the Isolation Systems with Dry Friction Damping and with Vicious Damping under Base Excitation

    Science.gov (United States)

    Hou, Junfang; jing, Min; Zhang, Weihua; Lu, Yahui; He, Haiwen

    2017-12-01

    As for the isolation problem of electronic equipments on vehicle, the vibration response characteristics of dry friction damping isolation system under base displacement excitation was analyzed in theory by harmonic balance method, and the displacement response was compared between the isolation systems with dry friction damping and vicious damping separately. The results show that the isolation system with small dry friction damping can’t meet the demands of displacement reduction close to the natural frequency, and it can realize full-frequency vibration isolation by improving dry friction damping when the lock frequency passes beyond the resonance frequency band. The results imply that the damping mechanism of dry friction isolator can’t be described only by dry friction damping, and the composite damping with dry friction and vicious damping is more appropriate.

  9. Closed-form eigensolutions of nonviscously, nonproportionally damped systems based on continuous damping sensitivity

    Science.gov (United States)

    Lázaro, Mario

    2018-01-01

    In this paper, nonviscous, nonproportional, vibrating structures are considered. Nonviscously damped systems are characterized by dissipative mechanisms which depend on the history of the response velocities via hereditary kernel functions. Solutions of the free motion equation lead to a nonlinear eigenvalue problem involving mass, stiffness and damping matrices. Viscoelasticity leads to a frequency dependence of this latter. In this work, a novel closed-form expression to estimate complex eigenvalues is derived. The key point is to consider the damping model as perturbed by a continuous fictitious parameter. Assuming then the eigensolutions as function of this parameter, the computation of the eigenvalues sensitivity leads to an ordinary differential equation, from whose solution arises the proposed analytical formula. The resulting expression explicitly depends on the viscoelasticity (frequency derivatives of the damping function), the nonproportionality (influence of the modal damping matrix off-diagonal terms). Eigenvectors are obtained using existing methods requiring only the corresponding eigenvalue. The method is validated using a numerical example which compares proposed with exact ones and with those determined from the linear first order approximation in terms of the damping matrix. Frequency response functions are also plotted showing that the proposed approach is valid even for moderately or highly damped systems.

  10. Rings in drugs.

    Science.gov (United States)

    Taylor, Richard D; MacCoss, Malcolm; Lawson, Alastair D G

    2014-07-24

    We have analyzed the rings, ring systems, and frameworks in drugs listed in the FDA Orange Book to understand the frequency, timelines, molecular property space, and the application of these rings in different therapeutic areas and target classes. This analysis shows that there are only 351 ring systems and 1197 frameworks in drugs that came onto the market before 2013. Furthermore, on average six new ring systems enter drug space each year and approximately 28% of new drugs contain a new ring system. Moreover, it is very unusual for a drug to contain more than one new ring system and the majority of the most frequently used ring systems (83%) were first used in drugs developed prior to 1983. These observations give insight into the chemical novelty of drugs and potentially efficient ways to assess compound libraries and develop compounds from hit identification to lead optimization and beyond.

  11. Birth Control Ring

    Science.gov (United States)

    ... Health Food & Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español Birth Control Ring KidsHealth / For Teens / Birth Control Ring What's ...

  12. Damping of coherent oscillations in intense ion beams

    International Nuclear Information System (INIS)

    Karpov, Ivan

    2017-01-01

    Transverse decoherence of a displaced ion bunch is an important phenomenon in synchrotrons and storage rings. An offset can be caused by an injection error after the bunch-to-bucket transfer between synchrotrons or by an externally generated kick. Decoherence results in a transverse emittance blowup, which can cause particle losses and a beam quality degradation. To prevent the beam blowup, a transverse feedback system (TFS) can be used. The damping time should be shorter than the characteristic decoherence time, which can be strongly affected by the interplay of different intensity effects (e.g., space charge and impedances). This thesis describes the development of the analytical models that explain decoherence and emittance growth with chromaticity, space charge, and image charges within the first synchrotron period. The pulsed response function including intensity effects was derived from the model for beam transfer functions. For a coasting beam, the two- dimensional model shows that space charge slows down and above intensity threshold suppresses decoherence. These predictions were confirmed by particle tracking simulations with self-consistent space charge fields. Additionally, halo buildup and losses during decoherence were observed in simulations. These effects were successfully interpreted using a non self-consistent particle-core model. The two-dimensional model was extended to the bunched beams. The simulation results reproduce the analytical predictions. The intensity threshold of decoherence suppression is higher in comparison to a coasting beam, image charges can restore decoherence. In the present work dedicated experiments were performed in the SIS18 synchrotron at GSI Darmstadt and the results were compared with simulations and analytical predictions. The contribution of nonlinearities and image charges is negligible while chromaticity and space charge dominate decoherence. To study the damping efficiency of TFS, a comprehensive TFS module was

  13. Damping of coherent oscillations in intense ion beams

    Energy Technology Data Exchange (ETDEWEB)

    Karpov, Ivan

    2017-02-06

    Transverse decoherence of a displaced ion bunch is an important phenomenon in synchrotrons and storage rings. An offset can be caused by an injection error after the bunch-to-bucket transfer between synchrotrons or by an externally generated kick. Decoherence results in a transverse emittance blowup, which can cause particle losses and a beam quality degradation. To prevent the beam blowup, a transverse feedback system (TFS) can be used. The damping time should be shorter than the characteristic decoherence time, which can be strongly affected by the interplay of different intensity effects (e.g., space charge and impedances). This thesis describes the development of the analytical models that explain decoherence and emittance growth with chromaticity, space charge, and image charges within the first synchrotron period. The pulsed response function including intensity effects was derived from the model for beam transfer functions. For a coasting beam, the two- dimensional model shows that space charge slows down and above intensity threshold suppresses decoherence. These predictions were confirmed by particle tracking simulations with self-consistent space charge fields. Additionally, halo buildup and losses during decoherence were observed in simulations. These effects were successfully interpreted using a non self-consistent particle-core model. The two-dimensional model was extended to the bunched beams. The simulation results reproduce the analytical predictions. The intensity threshold of decoherence suppression is higher in comparison to a coasting beam, image charges can restore decoherence. In the present work dedicated experiments were performed in the SIS18 synchrotron at GSI Darmstadt and the results were compared with simulations and analytical predictions. The contribution of nonlinearities and image charges is negligible while chromaticity and space charge dominate decoherence. To study the damping efficiency of TFS, a comprehensive TFS module was

  14. Groups, rings, modules

    CERN Document Server

    Auslander, Maurice

    2014-01-01

    This classic monograph is geared toward advanced undergraduates and graduate students. The treatment presupposes some familiarity with sets, groups, rings, and vector spaces. The four-part approach begins with examinations of sets and maps, monoids and groups, categories, and rings. The second part explores unique factorization domains, general module theory, semisimple rings and modules, and Artinian rings. Part three's topics include localization and tensor products, principal ideal domains, and applications of fundamental theorem. The fourth and final part covers algebraic field extensions

  15. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  16. Dry friction damping couple at high frequencies

    Czech Academy of Sciences Publication Activity Database

    Půst, Ladislav; Pešek, Luděk; Košina, Jan; Radolfová, Alena

    2014-01-01

    Roč. 8, č. 1 (2014), s. 91-100 ISSN 1802-680X Institutional support: RVO:61388998 Keywords : dry friction * damping * high frequencies Subject RIV: BI - Acoustics http://www.kme.zcu.cz/acm/acm/article/view/239/265

  17. Chiral damping of magnetic domain walls

    KAUST Repository

    Jué , Emilie; Safeer, C.  K.; Drouard, Marc; Lopez, Alexandre; Balint, Paul; Buda-Prejbeanu, Liliana; Boulle, Olivier; Auffret, Stephane; Schuhl, Alain; Manchon, Aurelien; Miron, Ioan Mihai; Gaudin, Gilles

    2015-01-01

    Structural symmetry breaking in magnetic materials is responsible for the existence of multiferroics1, current-induced spin–orbit torques2, 3, 4, 5, 6, 7 and some topological magnetic structures8, 9, 10, 11, 12. In this Letter we report that the structural inversion asymmetry (SIA) gives rise to a chiral damping mechanism, which is evidenced by measuring the field-driven domain-wall (DW) motion in perpendicularly magnetized asymmetric Pt/Co/Pt trilayers. The DW dynamics associated with the chiral damping and those with Dzyaloshinskii–Moriya interaction (DMI) exhibit identical spatial symmetry13, 14, 15, 16, 17, 18, 19. However, both scenarios are differentiated by their time reversal properties: whereas DMI is a conservative effect that can be modelled by an effective field, the chiral damping is purely dissipative and has no influence on the equilibrium magnetic texture. When the DW motion is modulated by an in-plane magnetic field, it reveals the structure of the internal fields experienced by the DWs, allowing one to distinguish the physical mechanism. The chiral damping enriches the spectrum of physical phenomena engendered by the SIA, and is essential for conceiving DW and skyrmion devices owing to its coexistence with DMI (ref. 20).

  18. Piezoelectric RL shunt damping of flexible structures

    DEFF Research Database (Denmark)

    Høgsberg, Jan Becker; Krenk, Steen

    2015-01-01

    in the present analysis is based on equal damping of the two modes associated with the resonant vibration form of the structure. An important result of the presented calibration procedure is the explicit inclusion of a quasi-static contribution from the non-resonant vibration modes of the structure via a single...

  19. Stiffness and damping in mechanical design

    National Research Council Canada - National Science Library

    Rivin, Eugene I

    1999-01-01

    ... important conceptual issues are stiffness of mechanical structures and their components and damping in mechanical systems sensitive to and/or generating vibrations. Stiffness and strength are the most important criteria for many mechanical designs. However, although there are hundreds of books on various aspects of strength, and strength issues ar...

  20. Chiral damping of magnetic domain walls

    KAUST Repository

    Jué, Emilie

    2015-12-21

    Structural symmetry breaking in magnetic materials is responsible for the existence of multiferroics1, current-induced spin–orbit torques2, 3, 4, 5, 6, 7 and some topological magnetic structures8, 9, 10, 11, 12. In this Letter we report that the structural inversion asymmetry (SIA) gives rise to a chiral damping mechanism, which is evidenced by measuring the field-driven domain-wall (DW) motion in perpendicularly magnetized asymmetric Pt/Co/Pt trilayers. The DW dynamics associated with the chiral damping and those with Dzyaloshinskii–Moriya interaction (DMI) exhibit identical spatial symmetry13, 14, 15, 16, 17, 18, 19. However, both scenarios are differentiated by their time reversal properties: whereas DMI is a conservative effect that can be modelled by an effective field, the chiral damping is purely dissipative and has no influence on the equilibrium magnetic texture. When the DW motion is modulated by an in-plane magnetic field, it reveals the structure of the internal fields experienced by the DWs, allowing one to distinguish the physical mechanism. The chiral damping enriches the spectrum of physical phenomena engendered by the SIA, and is essential for conceiving DW and skyrmion devices owing to its coexistence with DMI (ref. 20).

  1. Active damping based on decoupled collocated control

    NARCIS (Netherlands)

    Holterman, J.; de Vries, Theodorus J.A.; Auer, Frank; Gardonio, P.; Rafaely, B.

    2002-01-01

    High-precision machines typically suffer from small but persistent vibrations. As it is difficult to damp these vibrations by passive means, research at the Drebbel Institute at the University of Twente is aimed at the development of an active structural element that can be used for vibration

  2. BNS damping of beam breakup instability

    International Nuclear Information System (INIS)

    Stupakov, G.V.

    1997-08-01

    The author studies BNS damping of the beam breakup instability in a simple model assuming a constant beam energy, flat bunch distribution, and a smooth transverse focusing. The model allows an analytic solution for a constant and linear wake functions. Scaling dimensionless parameters are derived and the beam dynamics is illustrated for the range of parameters relevant to the Stanford Linear Collider

  3. The DAMPE silicon–tungsten tracker

    Energy Technology Data Exchange (ETDEWEB)

    Azzarello, P., E-mail: philipp.azzarello@unige.ch [Département de Physique Nucléaire et Corpusculaire, University of Geneva, Geneva (Switzerland); Ambrosi, G. [Istituto Nazionale di Fisica Nucleare Sezione di Perugia, Perugia (Italy); Asfandiyarov, R. [Département de Physique Nucléaire et Corpusculaire, University of Geneva, Geneva (Switzerland); Bernardini, P. [Dipartimento di Matematica e Fisica “E. De Giorgi”, Università del Salento, Lecce (Italy); Istituto Nazionale di Fisica Nucleare Sezione di Lecce, Lecce (Italy); Bertucci, B.; Bolognini, A. [Istituto Nazionale di Fisica Nucleare Sezione di Perugia, Perugia (Italy); Dipartimento di Fisica e Geologia, Università di Perugia, Perugia (Italy); Cadoux, F. [Département de Physique Nucléaire et Corpusculaire, University of Geneva, Geneva (Switzerland); Caprai, M. [Istituto Nazionale di Fisica Nucleare Sezione di Perugia, Perugia (Italy); De Mitri, I. [Dipartimento di Matematica e Fisica “E. De Giorgi”, Università del Salento, Lecce (Italy); Istituto Nazionale di Fisica Nucleare Sezione di Lecce, Lecce (Italy); Domenjoz, M. [Département de Physique Nucléaire et Corpusculaire, University of Geneva, Geneva (Switzerland); Dong, Y. [Institute of High Energy Physics, Chinese Academy of Sciences, Beijing (China); Duranti, M. [Istituto Nazionale di Fisica Nucleare Sezione di Perugia, Perugia (Italy); Dipartimento di Fisica e Geologia, Università di Perugia, Perugia (Italy); Fan, R. [Institute of High Energy Physics, Chinese Academy of Sciences, Beijing (China); and others

    2016-09-21

    The DArk Matter Particle Explorer (DAMPE) is a spaceborne astroparticle physics experiment, launched on 17 December 2015. DAMPE will identify possible dark matter signatures by detecting electrons and photons in the 5 GeV–10 TeV energy range. It will also measure the flux of nuclei up to 100 TeV, for the study of the high energy cosmic ray origin and propagation mechanisms. DAMPE is composed of four sub-detectors: a plastic strip scintillator, a silicon–tungsten tracker–converter (STK), a BGO imaging calorimeter and a neutron detector. The STK is composed of six tracking planes of 2 orthogonal layers of single-sided micro-strip detectors, for a total detector surface of ca. 7 m{sup 2}. The STK has been extensively tested for space qualification. Also, numerous beam tests at CERN have been done to study particle detection at silicon module level, and at full detector level. After description of the DAMPE payload and its scientific mission, we will describe the STK characteristics and assembly. We will then focus on some results of single ladder performance tests done with particle beams at CERN.

  4. Damping of liquid sloshing by foams

    Science.gov (United States)

    Sauret, A.; Boulogne, F.; Cappello, J.; Dressaire, E.; Stone, H. A.

    2015-02-01

    When a container is set in motion, the free surface of the liquid starts to oscillate or slosh. Such effects can be observed when a glass of water is handled carelessly and the fluid sloshes or even spills over the rims of the container. However, beer does not slosh as readily as water, which suggests that foam could be used to damp sloshing. In this work, we study experimentally the effect on sloshing of a liquid foam placed on top of a liquid bath. We generate a monodisperse two-dimensional liquid foam in a rectangular container and track the motion of the foam. The influence of the foam on the sloshing dynamics is experimentally characterized: only a few layers of bubbles are sufficient to significantly damp the oscillations. We rationalize our experimental findings with a model that describes the foam contribution to the damping coefficient through viscous dissipation on the walls of the container. Then we extend our study to confined three-dimensional liquid foam and observe that the behavior of 2D and confined 3D systems are very similar. Thus, we conclude that only the bubbles close to the walls have a significant impact on the dissipation of energy. The possibility to damp liquid sloshing using foam is promising in numerous industrial applications such as the transport of liquefied gas in tankers or for propellants in rocket engines.

  5. Nuclear power plant piping damping parametric effects

    International Nuclear Information System (INIS)

    Ware, A.G.

    1983-01-01

    The present NRC guidelines for structural damping to be used in the dynamic stress analyses of nuclear power plant piping systems are generally considered to be overly conservative. As a result, plant designers have in many instances used a considerable number of seismic supports to keep stresses calculated by large scale piping computer codes below the allowable limits. In response to this problem, the NRC and EG and G Idaho are engaged in programs to evaluate piping system damping, in order to provide more realistic and less conservative values to be used in seismic analyses. To generate revised guidelines, solidly based on technical data, new experimental data need to be generated and assessed, and the parameters which influence piping system damping need to be quantitatively identified. This paper presents the current state-of-the-art knowledge in the United States on parameters which influence piping system damping. Examples of inconsistencies in the data and areas of uncertainty are explained. A discussion of programs by EG and G Idaho and other organizations to evaluate various effects is included, and both short and long range goals of the program are outlined

  6. Factors controlling superelastic damping capacity of SMAs

    Czech Academy of Sciences Publication Activity Database

    Heller, Luděk; Šittner, Petr; Pilch, Jan; Landa, Michal

    2009-01-01

    Roč. 18, 5-6 (2009), 603-611 ISSN 1059-9495 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z20760514 Keywords : shape memory alloys * superelastic damping * thermomechanical testing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.592, year: 2009

  7. Structural dynamic modification using additive damping

    Indian Academy of Sciences (India)

    elements, FEM and perturbation methods for reanalysis or structural dynamic modification ... to a system changes its mass, stiffness and damping. Thus ... due to the phase difference between stress ' and strain or 'a И E1 З iE2 for direct strain.

  8. Spatial Damping of Linear Compressional Magnetoacoustic Waves ...

    Indian Academy of Sciences (India)

    The uncertainty in the radiative relaxation time, how- ever, does .... For spatial damping, we take ω to be real and k to be complex as kR +ikI . The disper- ... bances may travel up in the solar atmosphere through the magnetic field lines that are.

  9. A review of experimental soil-structure interaction damping

    International Nuclear Information System (INIS)

    Tsai, N.C.

    1981-01-01

    In soil-structure interaction analysis, the foundation soil is usually represented by impedance springs and dampers. The impedance damping includes the effect of both the material damping and the radiation damping. Because the impedance theory normally assumes a rigid structural base and an elastic bond between the soil and structure, it is generally held that the radiation damping has been overestimated by the theory. There are some published information on the dynamic tests of footings and structures that allow direct or indirect assessments of the validity of the analytical radiation damping. An overview of such information is presented here. Based on these limited test data, it is concluded that for horizontal soil-structure interaction analysis the analytical radiation damping alone is sufficient to represent the combined material and radiation damping in the field. On the other hand, for vertical analysis it appears that the theory may have overestimated the radiation damping and certain reduction is recommended. (orig.)

  10. Damped time advance methods for particles and EM fields

    International Nuclear Information System (INIS)

    Friedman, A.; Ambrosiano, J.J.; Boyd, J.K.; Brandon, S.T.; Nielsen, D.E. Jr.; Rambo, P.W.

    1990-01-01

    Recent developments in the application of damped time advance methods to plasma simulations include the synthesis of implicit and explicit ''adjustably damped'' second order accurate methods for particle motion and electromagnetic field propagation. This paper discusses this method

  11. Exponential decay for solutions to semilinear damped wave equation

    KAUST Repository

    Gerbi, Sté phane; Said-Houari, Belkacem

    2011-01-01

    This paper is concerned with decay estimate of solutions to the semilinear wave equation with strong damping in a bounded domain. Intro- ducing an appropriate Lyapunov function, we prove that when the damping is linear, we can find initial data

  12. Beam-based alignment technique for the SLC [Stanford Linear Collider] linac

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.

    1989-03-01

    Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs

  13. Isochronous 180 degree turns for the SLC positron system

    International Nuclear Information System (INIS)

    Helm, R.H.; Clendenin, J.E.; Ecklund, S.D.; Kulikov, A.V.; Pitthan, R.

    1991-05-01

    The design of the compact, achromatic, second order isochronous 180 degrees turn for the SLC positron transport system will be described. Design criteria require an energy range of 200±20 MeV, energy acceptance of ±5%, transverse admittance of 25π mm-mr, and minimal lengthening of the 3 to 4 mm (rms) positron bunch. The devices had to fit within a maximum height or width of about 10 ft. Optics specifications and theoretical performance are presented and compared to experimental results based on streak camera measurements of bunch length immediately after the first isochronous turn (200 MeV) and positron beam energy spread after S-band acceleration to 1.15 GeV. 5 refs., 7 figs

  14. CATER: An onlne problem tracking facility for SLC

    International Nuclear Information System (INIS)

    Sass, R.C.; Shoaee, H.

    1993-05-01

    An online facility has been developed for SLC to organize and simplify the management of all problems encountered in the operation of the accelerator. CATER (Computer Aided Trouble Entry and Reporting) may be used to make the initial entry of a problem, to enter one or more solutions to a problem, to modify or closeout a problem, to generate a variety of pre-defined reports giving status and statistical summaries, and to allow anyone to browse the database. All phases of CATER can take place on the operator console, workstations, or on any ANSI compatible terminal. The user interface is designed around a menu driven windowed environment with a large amount of context sensitive help information to alleviate the need for consulting user documentation. Currently, the CATER database contains information on more than 30,000 problems entered since it went online in January of 1988. The features of the software and some implementation details will be presented

  15. CATER: An online problem tracking facility for SLC

    International Nuclear Information System (INIS)

    Sass, R.C.; Shoaee, H.

    1993-01-01

    An online facility has been developed for SLC to organize and simplify the management of all problems encountered in the operation of the accelerator. CATER (Computer Aided Trouble Entry and Reporting) may be used to make the initial entry of a problem, to enter one or more solutions to a problem, to modify or closeout a problem, to generate a variety of pre-defined reports giving status and statistical summaries, and to allow anyone to browse the database. All phases of CATER can take place on the operator console, workstations, or on any ANSI compatible terminal. The user interface is designed around a menu driven windowed environment with a large amount of context sensitive help information to alleviate the need for consulting user documentation. Currently, the CATER database contains information on more than 30,000 problems entered since it went online in January of 1988. The features of the software and some implementation details will be presented

  16. Wakefield effects in the SLC beam delivery system

    International Nuclear Information System (INIS)

    Napoly, O.

    1996-06-01

    Wakefield effects occurring in the SLC after the LI28 emittance measurement station could be responsible for part of all of the observed discrepancy between the expected vertical spot sizes at the IP and the measured ones. The strongest wakefields are generated by the parts of the beam chamber which are the closest to the beam, like collimators. In this note we review the effect of the following wakefield sources: geometric wakefields from final focus fixed and movable collimators, geometric and resistive wakefields from linac collimators jaws, resistive wakefields from the beam pipe at the sextupole and final transformer locations. We mostly concentrate on the transverse dipole and quadrupole wakefield effects, although the longitudinal wakefields are briefly studied at the end. We limit ourselves to the vertical beam dynamics and to the lowest (mainly linear) order of the wakefield expansion with respect to the beam offset, which excludes the near wall effect on the beam. (author)

  17. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-08-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  18. High voltage processing of the SLC polarized electron gun

    International Nuclear Information System (INIS)

    Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.

    1993-04-01

    The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described

  19. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-01-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  20. Correlation Plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.; Clark, S.

    1991-11-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. This generalized interface allows the user to perform a range of operations or machine physics experiments without the need for any specialized analysis software. The user may step one or more independent parameters, such as magnet or feedback setpoints, while measuring or calculating up to 160 other parameters. Measured variables include all analog signals available to the control system, as well as calculated parameters such as beam size, luminosity, or emittance. Various fitting algorithms and display options are provided. A software-callable interface has been provided so that a host of applications can call this package for analysis and display. Such applications regularly phase klystrons, measure emittance and dispersion, minimize beam size, and maintain beam collisions at the interaction point. 4 refs., 5 figs

  1. Correlation Plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sachez-Chopitea, L.; Clark, S.

    1992-01-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. This generalized interface allows the user to perform a range of operations or machine physics experiments without the need for any specialized analysis software. The user may step one or more independent parameters, such as magnet or feedback set points, while measuring or calculating up to 160 other parameters. Measured variables include all analog signals available to the control system, as well as calculated parameters such as beam size, luminosity, or emittance. Various fitting algorithms and display options are provided. A software-callable interface has been provided so that a host of applications can call this package for analysis and display. Such applications regularly phase klystrons, measure emittance and dispersion, minimize beam size, and maintain beam collisions at the interaction point. (author)

  2. Global tuning knobs for the SLC final focus

    International Nuclear Information System (INIS)

    Walker, N.J.; Irwin, J.; Woodley, M.

    1993-04-01

    The beam phase space at the exit of a given transport line generally depends on the incoming beam conditions, and thus in order to adjust the beam parameters at the exit of the line requires a prior knowledge of the initial beam parameters. The same is generally true for final focus systems. A tuning algorithm for β matching the SLC final focus is reported here in which no prior knowledge of the exact incoming phase space is required. Only a single beam size diagnostic located at either the interaction point (IP) or an image of the IP is required, together with a knowledge of the linear lattice from the quadrupoles to the tuning point. The algorithm is presented within the Lie Algebra framework. Although the algorithm is presented here is specific to linear collider final focus systems, the technique is generally applicable to any beamline

  3. Importance of high order momentum terms in SLC optics

    International Nuclear Information System (INIS)

    Kozanecki, W.

    1985-01-01

    The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab

  4. Onset of chaos in Josephson junctions with intermediate damping

    International Nuclear Information System (INIS)

    Yao, X.; Wu, J.Z.; Ting, C.S.

    1990-01-01

    By use of the analytical solution of the Stewart-McCumber equation including quadratic damping and dc bias, the Melnikov method has been extended to the parameter regions of intermediate damping and dc bias for the Josephson junctions with quadratic damping and with linear damping and cosφ term. The comparison between the thresholds predicted by the Melnikov method and that derived from numerical simulation has been studied. In addition, the validity conditions for the Melnikov threshold are also discussed

  5. Preliminary Study on the Damping Effect of a Lateral Damping Buffer under a Debris Flow Load

    Directory of Open Access Journals (Sweden)

    Zheng Lu

    2017-02-01

    Full Text Available Simulating the impact of debris flows on structures and exploring the feasibility of applying energy dissipation devices or shock isolators to reduce the damage caused by debris flows can make great contribution to the design of disaster prevention structures. In this paper, we propose a new type of device, a lateral damping buffer, to reduce the vulnerability of building structures to debris flows. This lateral damping buffer has two mechanisms of damage mitigation: when debris flows impact on a building, it acts as a buffer, and when the structure vibrates due to the impact, it acts as a shock absorber, which can reduce the maximum acceleration response and subsequent vibration respectively. To study the effectiveness of such a lateral damping buffer, an impact test is conducted, which mainly involves a lateral damping buffer attached to a two-degree-of-freedom structure under a simulated debris flow load. To enable the numerical study, the equation of motion of the structure along with the lateral damping buffer is derived. A subsequent parametric study is performed to optimize the lateral damping buffer. Finally, a practical design procedure is also provided.

  6. Vibration and Damping Analysis of Composite Fiber Reinforced Wind Blade with Viscoelastic Damping Control

    Directory of Open Access Journals (Sweden)

    Tai-Hong Cheng

    2015-01-01

    Full Text Available Composite materials are increasingly used in wind blade because of their superior mechanical properties such as high strength-to-weight and stiffness-to-weight ratio. This paper presents vibration and damping analysis of fiberreinforced composite wind turbine blade with viscoelastic damping treatment. The finite element method based on full layerwise displacement theory was employed to analyze the damping, natural frequency, and modal loss factor of composite shell structure. The lamination angle was considered in mathematical modeling. The curved geometry, transverse shear, and normal strains were exactly considered in present layerwise shell model, which can depict the zig-zag in-plane and out-of-plane displacements. The frequency response functions of curved composite shell structure and wind blade were calculated. The results show that the damping ratio of viscoelastic layer is found to be very sensitive to determination of magnitude of composite structures. The frequency response functions with variety of thickness of damping layer were investigated. Moreover, the natural frequency, modal loss factor, and mode shapes of composite fiber reinforced wind blade with viscoelastic damping control were calculated.

  7. Active and passive damping based on piezoelectric elements -controllability issues-

    NARCIS (Netherlands)

    Holterman, J.; de Vries, Theodorus J.A.; van Amerongen, J.; Jonker, Jan B.; Jonker, J.B.

    2001-01-01

    Piezoelectric elements are widely used for damping micro-vibrations in mechanical structures. Active damping can be realised robustly by means of collocated actuator-sensor-pairs, controlled so as to extract vibration energy. Excellent damping performance is possible as long as sufficient

  8. Dispersion of guided modes in two-dimensional split ring lattices

    DEFF Research Database (Denmark)

    Hansen, Per Lunnemann; Koenderink, A. Femius

    2014-01-01

    . This method takes into account all retarded electrodynamic interactions as well as radiation damping self-consistently. As illustration, we analyze the dispersion of plasmon nanorod lattices, and of 2D split ring resonator lattices. Plasmon nanorod lattices support transverse and longitudinal in...

  9. Synthesis/literature review for determining structural layer coefficients (SLC) of bases.

    Science.gov (United States)

    2014-12-01

    FDOTs current method of determining a base material structural layer coefficient (SLC) is detailed in the : Materials Manual, Chapter 2.1, Structural Layer Coefficients for Flexible Pavement Base Materials. : Currently, any new base material not a...

  10. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI

  11. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  12. Beam determination of quadrupole misalignments and beam position monitor biases in the SLC linac

    International Nuclear Information System (INIS)

    Lavine, T.L.; Seeman, J.T.; Atwood, W.B.; Himel, T.M.; Petersen, A.; Adolphsen, C.E.

    1988-09-01

    Misalignments of magnetic quadrupoles and biases in beam position monitors (BPMs) in the Stanford Linear Collider (SLC) linac can lead to a situation in which the beam is off-center in the disk-loaded waveguide accelerator structure. The off-center beam produces wakefields which can limit SLC performance by causing unacceptably large emittance growth. We present a general method for determining quadrupole misalignments and BPM biases in the SLC linac by using beam trajectory measurements. The method utilizes both electron and positron beams on opposite rf cycles in the same linac lattice to determine simultaneously magnetic quadrupole misalignments and BPM biases. The two-beam trajectory data may be acquired without interrupting SLC colliding beam operations. 2 refs., 5 figs

  13. S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

    Directory of Open Access Journals (Sweden)

    Pingting Liu

    2017-01-01

    Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

  14. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  15. Damping Estimation of Friction Systems in Random Vibrations

    DEFF Research Database (Denmark)

    Friis, Tobias; Katsanos, Evangelos; Amador, Sandro

    Friction is one of the most efficient and economical mechanisms to reduce vibrations in structural mechanics. However, the estimation of the equivalent linear damping of the friction damped systems in experimental modal analysis and operational modal analysis can be adversely affected by several...... assumptions regarding the definition of the linear damping and the identification methods or may be lacking a meaningful interpretation of the damping. Along these lines, this project focuses on assessing the potential to estimate efficiently the equivalent linear damping of friction systems in random...

  16. Token Ring Project

    Directory of Open Access Journals (Sweden)

    Adela Ionescu

    2007-01-01

    Full Text Available Ring topology is a simple configuration used to connect processes that communicate among themselves. A number of network standards such as token ring, token bus, and FDDI are based on the ring connectivity. This article will develop an implementation of a ring of processes that communicate among themselves via pipe links. The processes are nodes in the ring. Each process reads from its standard input and writes in its standard output. N-1 process redirects the its standard output to a standard input of the process through a pipe. When the ring-structure is designed, the project can be extended to simulate networks or to implement algorithms for mutual exclusion

  17. DAMPING OF SUBSYNCHRONOUS MODES OF OSCILLATIONS

    Directory of Open Access Journals (Sweden)

    JAGADEESH PASUPULETI

    2006-06-01

    Full Text Available The IEEE bench mark model 2 series compensated system is considered for analysis. It consists of single machine supplying power to infinite bus through two parallel lines one of which is series compensated. The mechanical system considered consists of six mass, viz, high pressure turbine, intermediate pressure turbine, two low pressure turbines, generator and an exciter. The excitation system considered is IEEE type 1 with saturation. The auxiliary controls considered to damp the unstable subsynchronous modes of oscillations are Power System Stabilizer (PSS and Static var Compensator (SVC. The different cases of power system stabilizer and reactive power controls are adapted to study the effectiveness of damping these unstable subsynchronous modes of oscillations.

  18. Damping of Crank–Nicolson error oscillations

    DEFF Research Database (Denmark)

    Britz, Dieter; Østerby, Ole; Strutwolf, J.

    2003-01-01

    The Crank–Nicolson (CN) simulation method has an oscillatory response to sharp initial transients. The technique is convenient but the oscillations make it less popular. Several ways of damping the oscillations in two types of electrochemical computations are investigated. For a simple one......-dimensional system with an initial singularity, subdivision of the first time interval into a number of equal subintervals (the Pearson method) works rather well, and so does division with exponentially increasing subintervals, where however an optimum expansion parameter must be found. This method can...... be computationally more expensive with some systems. The simple device of starting with one backward implicit (BI, or Laasonen) step does damp the oscillations, but not always sufficiently. For electrochemical microdisk simulations which are two-dimensional in space and using CN, the use of a first BI step is much...

  19. Relativity damps OPEP in nuclear matter

    International Nuclear Information System (INIS)

    Banerjee, M.K.

    1998-06-01

    Using a relativistic Dirac-Brueckner analysis the OPEP contribution to the ground state energy of nuclear matter is studied. In the study the pion is derivative-coupled. The author finds that the role of the tensor force in the saturation mechanism is substantially reduced compared to its dominant role in a usual nonrelativistic treatment. He shows that the damping of derivative-coupled OPEP is actually due to the decrease of M * /M with increasing density. He points out that if derivative-coupled OPEP is the preferred form of nuclear effective lagrangian nonrelativistic treatment of nuclear matter is in trouble. Lacking the notion of M * it cannot replicate the damping. He suggests an examination of the feasibility of using pseudoscalar coupled πN interaction before reaching a final conclusion about nonrelativistic treatment of nuclear matter

  20. Damping system immersed in a fluid

    International Nuclear Information System (INIS)

    1980-01-01

    The invention relates to a damping system which is immersed in a fluid and allows slow motion, while opposing fast motion of a mobile or deformable system immersed in a fluid. Nuclear reactors utilize fabricated assemblies immmersed in the spent fuel storage pool to support the fuel elements placed in the pool, e.g., when refueling the reactor. These fabricated assemblies must be held in position, relative to the concrete walls of the pool, so as to allow slow deformation of the assemblies due to thermal expansion, while curbing fast motion, e.g., earthquake-induced motion. Such fast motion due to earthquakes might be the cause of resonance phenomena involving the fuel storage rack structure and the pool walls, should the rack structure and pool walls have the same resonant frequency. In the event of an earthquake, the damping system would provide for fast curbing of structure motion to prevent uncontrolled deformation which might result in breaks and destruction [fr

  1. Barotropic FRW cosmologies with Chiellini damping

    Energy Technology Data Exchange (ETDEWEB)

    Rosu, Haret C., E-mail: hcr@ipicyt.edu.mx [IPICyT, Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la presa San José 2055, Col. Lomas 4a Sección, 78216 San Luis Potosí, SLP (Mexico); Mancas, Stefan C., E-mail: stefan.mancas@erau.edu [Department of Mathematics, Embry–Riddle Aeronautical University, Daytona Beach, FL 32114-3900 (United States); Chen, Pisin, E-mail: pisinchen@phys.ntu.edu.tw [Leung Center for Cosmology and Particle Astrophysics (LeCosPA) and Department of Physics, National Taiwan University, Taipei 10617, Taiwan (China)

    2015-05-08

    It is known that barotropic FRW equations written in the conformal time variable can be reduced to simple linear equations for an exponential function involving the conformal Hubble rate. Here, we show that an interesting class of barotropic universes can be obtained in the linear limit of a special type of nonlinear dissipative Ermakov–Pinney equations with the nonlinear dissipation built from Chiellini's integrability condition. These cosmologies, which evolutionary are similar to the standard ones, correspond to barotropic fluids with adiabatic indices rescaled by a particular factor and have amplitudes of the scale factors inverse proportional to the adiabatic index. - Highlights: • Chiellini-damped Ermakov–Pinney equations are used in barotropic FRW cosmological context. • Chiellini-damped scale factors of the barotropic FRW universes are introduced. • These scale factors are similar to the undamped ones.

  2. WAKEFIELD DAMPING FOR THE CLIC CRAB CAVITY

    CERN Document Server

    Ambattu, P; Dexter, A; Carter, R; Khan, V; Jones, R; Dolgashev, V

    2009-01-01

    A crab cavity is required in the CLIC to allow effective head-on collision of bunches at the IP. A high operating frequency is preferred as the deflection voltage required for a given rotation angle and the RF phase tolerance for a crab cavity are inversely proportional to the operating frequency. The short bunch spacing of the CLIC scheme and the high sensitivity of the crab cavity to dipole kicks demand very high damping of the inter-bunch wakes, the major contributor to the luminosity loss of colliding bunches. This paper investigates the nature of the wakefields in the CLIC crab cavity and the possibility of using various damping schemes to suppress them effectively.

  3. System Reduction and Damping of Flexible Structures

    DEFF Research Database (Denmark)

    Høgsberg, Jan Riess; Krenk, Steen

    2007-01-01

    An increasing number of flexible structures such as cable-stayed bridges, pedestrian bridges and high-rise buildings are fitted with local dampers to mitigate vibration problems. In principle the effect of local dampers can be analyzed by use of complex modes, e.g. in conjunction with an averaging...... technique for local linearization of the damper characteristics. However, the complex mode shapes and frequencies depend on the magnitude of the damper and therefore are less suitable for design of the damper system. An efficient alternative consists in the use of a two-component representation...... of the damped modes of the structure. The idea is to represent the damped mode as a linear combination of the modes that occur in two distinctly different situations representing extreme conditions: the mode shape of the structure without the damper(s), and the mode shape of the structure, when the damper...

  4. Token ring technology report

    CERN Document Server

    2013-01-01

    Please note this is a Short Discount publication. This report provides an overview of the IBM Token-Ring technology and products built by IBM and compatible vendors. It consists of two sections: 1. A summary of the design trade-offs for the IBM Token-Ring. 2. A summary of the products of the major token-ring compatible vendors broken down by adapters and components, wiring systems, testing, and new chip technology.

  5. Radioactive gold ring dermatitis

    International Nuclear Information System (INIS)

    Miller, R.A.; Aldrich, J.E.

    1990-01-01

    A superficial squamous cell carcinoma developed in a woman who wore a radioactive gold ring for more than 30 years. Only part of the ring was radioactive. Radiation dose measurements indicated that the dose to basal skin layer was 2.4 Gy (240 rad) per week. If it is assumed that the woman continually wore her wedding ring for 37 years since purchase, she would have received a maximum dose of approximately 4600 Gy

  6. Transverse Periodic Beam Loading Effects in a Storage Ring

    International Nuclear Information System (INIS)

    Thompson, J.R.; Byrd, J.M.

    2009-01-01

    Uneven beam fill patterns in storage rings, such as gaps in the fill patterns, leads to periodic, or transient loading of the modes of the RF cavities. We show that an analogous effect can occur in the loading of a dipole cavity mode when the beam passes off the electrical center of the cavity mode. Although this effect is small, it results in a variation of the transverse offset of the beam along the bunch train. For ultralow emittance beams, such as optimized third generation light sources and damping rings, this effect results in a larger projected emittance of the beam compared with the single bunch emittance. The effect is particularly strong for the case when a strong dipole mode has been purposely added to the ring, such as a deflecting, or 'crab' cavity. We derive an approximate analytic solution for the variation of the beam-induced deflecting voltage along the bunch train.

  7. Electron Cloud Mitigation in the Spallation Neutron Source Ring

    International Nuclear Information System (INIS)

    Wei, J.; Blaskiewicz, Michael; Brodowski, J.; Cameron, P.; Davino, Daniele; Fedotov, A.; He, P.; Hseuh, H.; Lee, Y.Y.; Ludewig, H.; Meng, W.; Raparia, D.; Tuozzolo, J.; Zhang, S.Y.; Catalan-Lasheras, N.; Macek, R.J.; Furman, Miguel A.; Aleksandrov, A.; Cousineau, S.; Danilov, V.; Henderson, S.

    2008-01-01

    The Spallation Neutron Source (SNS) accumulator ring is designed to accumulate, via H - injection, protons of 2 MW beam power at 1 GeV kinetic energy at a repetition rate of 60 Hz [1]. At such beam intensity, electron-cloud is expected to be one of the intensity-limiting mechanisms that complicate ring operations. This paper summarizes mitigation strategy adopted in the design, both in suppressing electron-cloud formation and in enhancing Landau damping, including tapered magnetic field and monitoring system for the collection of stripped electrons at injection, TiN coated beam chamber for suppression of the secondary yield, clearing electrodes dedicated for the injection region and parasitic on BPMs around the ring, solenoid windings in the collimation region, and planning of vacuum systems for beam scrubbing upon operation

  8. Electron-cloud mitigation in the spallation neutron source ring

    International Nuclear Information System (INIS)

    Wei, J.; Blaskiewicz, M.; Brodowski, J.; Cameron, P.; Davino, D.; Fedotov, A.; He, P.; Hseuh, H.; Lee, Y.Y.; Meng, W.; Raparia, D.; Tuozzolo, J.; Zhang, S.Y.; Danilov, V.; Henderson, S.; Furman, M.; Pivi, M.; Macek, R.

    2003-01-01

    The Spallation Neutron Source (SNS) accumulator ring is designed to accumulate, via H- injection, protons of 2 MW beam power at 1 GeV kinetic energy at a repetition rate of 60 Hz [1]. At such beam intensity, electron cloud is expected to be one of the intensity-limiting mechanisms that complicate ring operations. This paper summarizes mitigation strategy adopted in the design, both in suppressing electron-cloud formation and in enhancing Landau damping, including tapered magnetic field and monitoring system for the collection of stripped electrons at injection, TiN coated beam chamber for suppression of the secondary yield, clearing electrodes dedicated for the injection region and parasitic on BPMs around the ring, solenoid windings in the collimation region, and planning of vacuum systems for beam scrubbing upon operation

  9. Size effect related to damping caused by water submersion

    International Nuclear Information System (INIS)

    Dong, R.G.

    1981-01-01

    An important effect of water submersion on the dynamic response of a structure is the increase in effective damping. The dynamic response of submerged structures is of interest in the nuclear power industry for reasons of operational safety during seismic and other dynamic excitations. In this paper, the added damping contribution that results from the viscosity of water and the dependence of the contribution on structural size are examined. Other factors considered are the applicable range of viscous damping with respect to displacement amplitude and, as far as damping is concerned, how far neighboring members must be from each other to respond as if in open water. An expression is derived for relating the damping value to structural size. Estimated added-damping values for representative fuel elements, fuel bundles, and main steam-pressure-relief-valve lines are given based on our derived expression for added damping

  10. Tuned mass absorbers on damped structures under random load

    DEFF Research Database (Denmark)

    Krenk, Steen; Høgsberg, Jan Becker

    2008-01-01

    the mass ratio alone, and the damping can be determined subsequently. Only approximate results are available for the influence of damping in the original structure, typically in the form of series expansions. In the present paper it is demonstrated that for typical mass ratios in the order of a few percent......A substantial literature exists on the optimal choice of parameters of a tuned mass absorber on a structure excited by a force or by ground acceleration with random characteristics in the form of white noise. In the absence of structural damping the optimal frequency tuning is determined from...... for the response variance of a structure with initial damping in terms of the mass ratio and both damping ratios. Within this format the optimal tuning of the absorber turns out to be independent of the structural damping, and a simple explicit expression is obtained for the equivalent total damping....

  11. Single bunch beam breakup in linacs and BNS damping

    International Nuclear Information System (INIS)

    Toyomasu, Takanori

    1991-12-01

    We study a single-bunch beam breakup (BBU) problem by a macro-particle model. We consider both the BBU solution and the Landau damping solution which includes the Balakin-Novokhatsky-Smirnov (BNS) damping. In the BBU solution, we get an analytic solution which includes both the Chao-Richter-Yao solution and the two-particle model solution and which agrees well with simulation. The solution can also be used in a multi-bunch case. In the Landau damping solution, we can be see the mechanism of Landau damping formally and can get some insights into BNS damping. We confirm that a two-particle model criterion for BNS damping is a good one. We expect that the two-particle model criterion is represented by the first order interaction in Landau damping solution of a macro-particle model. (author)

  12. A review of damping of two-phase flows

    International Nuclear Information System (INIS)

    Hara, Fumio

    1993-01-01

    Damping of two-phase flows has been recognized as one of the most unknown parameters in analyzing vibrational characteristics of structures subjected to two-phase flows since it seems to be influenced by many physical parameters involved in the physics of dynamic energy dissipation of a vibrating structure, for example, liquid viscosity, surface tension, flow velocity, mass ratio, frequency, void fraction, flow regime and so forth. This paper deals with a review of scientific works done to date on the damping of two phase flows and discussions about what has been clarified and what has not been known to us, or what kinds of research are needed about two-phase flow damping. The emphasis is put on the definition of two-phase fluid damping, damping measurement techniques, damping characteristics in relation to two phase flow configurations, and damping generation mechanisms

  13. Power Oscillations Damping in DC Microgrids

    DEFF Research Database (Denmark)

    Hamzeh, Mohsen; Ghafouri, Mohsen; Karimi, Houshang

    2016-01-01

    This paper proposes a new control strategy for damping of power oscillations in a multi-source dc microgrid. A parallel combination of a fuel cell (FC), a photovoltaic (PV) system and a supercapacitor (SC) are used as a hybrid power conversion system (HPCS). The SC compensates for the slow transi...... of the proposed control scheme is verified using hardware-in-the-loop (HIL) simulations carried out in OPAL-RT technologies....

  14. Multibunch resistive wall instability damping with feedback

    International Nuclear Information System (INIS)

    Zhabitskij, V.M.; Korenev, I.L.; Yudin, L.A.

    1992-01-01

    The theory of multibunch transverse resistive wall instability damping with feedback is development. The system of coupling equations is obtained for description of bunched beam motion. The general solution and eigen frequencies are found. But for two bunches or multi bunches the tune splitting is found. The band of the tune splitting is calculated. The influence of the tune splitting on the damper system stability is discussed. 14 refs

  15. Physics of quantum rings

    International Nuclear Information System (INIS)

    Fomin, Vladimir M.

    2014-01-01

    Presents the new class of materials of quantum rings. Provides an elemental basis for low-cost high-performance devices promising for electronics, optoelectronics, spintronics and quantum information processing. Explains the physical properties of quantum rings to cover a gap in scientific literature. Presents the application of most advanced nanoengineering and nanocharacterization techniques. This book deals with a new class of materials, quantum rings. Innovative recent advances in experimental and theoretical physics of quantum rings are based on the most advanced state-of-the-art fabrication and characterization techniques as well as theoretical methods. The experimental efforts allow to obtain a new class of semiconductor quantum rings formed by capping self-organized quantum dots grown by molecular beam epitaxy. Novel optical and magnetic properties of quantum rings are associated with non-trivial topologies at the nanoscale. An adequate characterization of quantum rings is possible on the basis of modern characterization methods of nanostructures, such as Scanning Tunneling Microscopy. A high level of complexity is demonstrated to be needed for a dedicated theoretical model to adequately represent the specific features of quantum rings. The findings presented in this book contribute to develop low-cost high-performance electronic, spintronic, optoelectronic and information processing devices based on quantum rings.

  16. Metallic materials for mechanical damping capacity applications

    Science.gov (United States)

    Crăciun, R. C.; Stanciu, S.; Cimpoeșu, R.; (Dragoș Ursanu, A. I.; Manole, V.; Paraschiv, P.; Chicet, D. L.

    2016-08-01

    Some metallic materials exhibit good damping capacity of mechanical energy into thermal energy. This property along with the others metallic characteristics make this materials interesting for a big number of applications. These materials can be used as bumpers in different applications including automotive field. Beside grey cast iron and shape memory alloys few new metallic materials are presented for the supposition of high damping capacity. We analyze the causes that increase the internal friction of some metallic materials and possibilities to enhance this property through different mechanical, physical or chemical methods. Shape memory alloys, especially those based on copper, present a different damping capacity on martensite, austenite or transition state. In the transformation range M ↔A, which in case of copper base shape memory alloys is quite large, the metallic intelligent materials present a high internal friction, almost comparable with natural rubber behavior that can transform mechanical energy into thermal energy till a certain value of the external solicitation. These materials can be used as noise or small vibrations bumpers or even as shock absorbers in automotive industry.

  17. Collisional damping rates for plasma waves

    Energy Technology Data Exchange (ETDEWEB)

    Tigik, S. F., E-mail: sabrina.tigik@ufrgs.br; Ziebell, L. F., E-mail: luiz.ziebell@ufrgs.br [Instituto de Física, Universidade Federal do Rio Grande do Sul, 91501-970 Porto Alegre, Rio Grande do Sul (Brazil); Yoon, P. H., E-mail: yoonp@umd.edu [Institute for Physical Science and Technology, University of Maryland, College Park, Maryland 20742 (United States); School of Space Research, Kyung Hee University, Yongin, Gyeonggi 446-701 (Korea, Republic of)

    2016-06-15

    The distinction between the plasma dynamics dominated by collisional transport versus collective processes has never been rigorously addressed until recently. A recent paper [P. H. Yoon et al., Phys. Rev. E 93, 033203 (2016)] formulates for the first time, a unified kinetic theory in which collective processes and collisional dynamics are systematically incorporated from first principles. One of the outcomes of such a formalism is the rigorous derivation of collisional damping rates for Langmuir and ion-acoustic waves, which can be contrasted to the heuristic customary approach. However, the results are given only in formal mathematical expressions. The present brief communication numerically evaluates the rigorous collisional damping rates by considering the case of plasma particles with Maxwellian velocity distribution function so as to assess the consequence of the rigorous formalism in a quantitative manner. Comparison with the heuristic (“Spitzer”) formula shows that the accurate damping rates are much lower in magnitude than the conventional expression, which implies that the traditional approach over-estimates the importance of attenuation of plasma waves by collisional relaxation process. Such a finding may have a wide applicability ranging from laboratory to space and astrophysical plasmas.

  18. Limitations of modal analysis of damped structures

    International Nuclear Information System (INIS)

    Krapf, K.G.; Woelfel, H.

    1983-01-01

    Quite recently discrete spring-damper elements are increasingly used for the low-tuned supports of nuclear power-plant buildings and equipment (reactor building, turbine-fundaments etc.) to reduce the vibration response due to the dynamic load cases earthquake and airplane crash. Because of this development, it is to be investigated whether the usual modal analysis method is applicable within the design process or should be changed respectively replaced in special cases. The paper contributes to this discussion by demonstrating and valuing the discrepancies in the different ways for the implementation of damping. Different methods for uncoupling (energy weighting, reduction to Rayleigh-damping) are compared with the solution of the coupled equations of motion. In particular vertical vibrations of a spring-damper-supported building on foundation (including ground springs) are examined using a two-degree-of-freedom-system. The results of coupled and (by force) uncoupled methods are interpreted concerning free vibration by comparison of the damping of natural vibrations, natural frequencies and natural mode shapes. The effect on the forced vibrations is shown by floor response spectra to an earthquake accelerogram. (orig./HP)

  19. Landau damping in trapped Bose condensed gases

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, B; Zaremba, E [Department of Physics, Queen' s University, Kingston, ON K7L 3N6 (Canada)

    2003-07-01

    We study Landau damping in dilute Bose-Einstein condensed gases in both spherical and prolate ellipsoidal harmonic traps. We solve the Bogoliubov equations for the mode spectrum in both of these cases, and calculate the damping by summing over transitions between excited quasiparticle states. The results for the spherical case are compared to those obtained in the Hartree-Fock (HF) approximation, where the excitations take on a single-particle character, and excellent agreement between the two approaches is found. We have also taken the semiclassical limit of the HF approximation and obtain a novel expression for the Landau damping rate involving the time-dependent self-diffusion function of the thermal cloud. As a final approach, we study the decay of a condensate mode by making use of dynamical simulations in which both the condensate and thermal cloud are evolved explicitly as a function of time. A detailed comparison of all these methods over a wide range of sample sizes and trap geometries is presented.

  20. First Results from the DAMPE Mission

    CERN Multimedia

    CERN. Geneva

    2018-01-01

    DAMPE (DArk Matter Particle Explorer) is a satellite mission of the Chinese Academy of Sciences (CAS) dedicated to high energy cosmic ray detections. Since its successful launch on December 17th, 2015 a large amount of cosmic ray data has been collected. With relatively large acceptance, DAMPE is designed to detect electrons (and positrons) up to 10 TeV with unprecedented energy resolution to search for new features in the cosmic ray electron plus positron (CRE) spectrum. It will also study cosmic ray nuclei up to 100 TeV with good precision, which will bring new input to the study of their still unknown origin and their propagation through the Galaxy. In this talk, the DAMPE mission will be introduced, together with some details of the construction and on-ground calibration of the detector subsystems. The in-orbit detector commissioning, calibration and operation will be described. First data analysis results, including the recently published CRE spectrum from 25 GeV to 4.6 TeV based on the data collected i...