WorldWideScience

Sample records for skin conductance responses

  1. The framing effect and skin conductance responses

    Directory of Open Access Journals (Sweden)

    Patrick eRing

    2015-08-01

    Full Text Available Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and finally to reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e. decision-processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e. whether emotional processes influence JDM or vice versa.

  2. The framing effect and skin conductance responses.

    Science.gov (United States)

    Ring, Patrick

    2015-01-01

    Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and to finally reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM) on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e., decision processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs) while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e., whether emotional processes influence JDM or vice versa.

  3. Skin conductance response to the pain of others predicts later costly helping.

    Directory of Open Access Journals (Sweden)

    Grit Hein

    Full Text Available People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our results show that the strength of empathy-related vicarious skin conductance responses predicts later costly helping. Moreover, the higher the match between SCR magnitudes during the observation of pain in others and SCR magnitude during self pain, the more likely a person is to engage in costly helping. We conclude that prosocial motivation is fostered by the strength of the vicarious autonomic response as well as its match with first-hand autonomic experience.

  4. A DESIGN FRAMEWORK FOR HUMAN EMOTION RECOGNITION USING ELECTROCARDIOGRAM AND SKIN CONDUCTANCE RESPONSE SIGNALS

    Directory of Open Access Journals (Sweden)

    KHAIRUN NISA’ MINHAD

    2017-11-01

    Full Text Available Identification of human emotional state while driving a vehicle can help in understanding the human behaviour. Based on this identification, a response system can be developed in order to mitigate the impact that may be resulted from the behavioural changes. However, the adaptation of emotions to the environment at most scenarios is subjective to an individual’s perspective. Many factors, mainly cultural and geography, gender, age, life style and history, level of education and professional status, can affect the detection of human emotional affective states. This work investigated sympathetic responses toward human emotions defined by using electrocardiography (ECG and skin conductance response (SCR signals recorded simultaneously. This work aimed to recognize ECG and SCR patterns of the investigated emotions measured using selected sensor. A pilot study was conducted to evaluate the proposed framework. Initial results demonstrated the importance of suitability of the stimuli used to evoke the emotions and high opportunity for the ECG and SCR signals to be used in the automotive real-time emotion recognition systems.

  5. Analysis of skin conductance response during evaluation of preferences for cosmetic products

    Science.gov (United States)

    Ohira, Hideki; Hirao, Naoyasu

    2015-01-01

    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings. PMID:25709593

  6. Are We Afraid of Different Categories of Stimuli in Identical Ways? Evidence from Skin Conductance Responses

    Science.gov (United States)

    Yang, Jiongjiong

    2013-01-01

    Studies have shown that emotional pictures attract more attention than neutral pictures, and pictures of living stimuli have similar advantage in driving attention (vs. nonliving). However, factors of emotion, category and picture context are usually mixed so that whether living and nonliving categories elicit different skin conductance (SC) responses, in both conscious and unconscious conditions, remains to be clarified. In this study, participants were presented with negative and neutral pictures denoting different living and nonliving concepts in conscious (Experiments 1 and 2) and unconscious conditions (40ms, Experiment 3) when their SC responses were measured. The picture context was manipulated in Experiments 2 and 3 as half including human-related information. In three experiments, the emotional levels of different categories were matched in different and identical cohorts of participants. The results showed that living pictures in a negative, high-arousing dimension elicited stronger SC responses than nonliving pictures. When nonhuman animals and inanimate objects were compared, the increased SC responses to animals was obtained only for negative pictures without human contexts in the conscious condition, but regardless of human context in the unconscious condition. These results suggested that contextual information and level of conscious awareness are important to modulate the animate advantage in emotional processing. PMID:24039879

  7. Skin Conductance Responses and Neural Activations During Fear Conditioning and Extinction Recall Across Anxiety Disorders.

    Science.gov (United States)

    Marin, Marie-France; Zsido, Rachel G; Song, Huijin; Lasko, Natasha B; Killgore, William D S; Rauch, Scott L; Simon, Naomi M; Milad, Mohammed R

    2017-06-01

    The fear conditioning and extinction neurocircuitry has been extensively studied in healthy and clinical populations, with a particular focus on posttraumatic stress disorder. Despite significant overlap of symptoms between posttraumatic stress disorder and anxiety disorders, the latter has received less attention. Given that dysregulated fear levels characterize anxiety disorders, examining the neural correlates of fear and extinction learning may shed light on the pathogenesis of underlying anxiety disorders. To investigate the psychophysiological and neural correlates of fear conditioning and extinction recall in anxiety disorders and to document how these features differ as a function of multiple diagnoses or anxiety severity. This investigation was a cross-sectional, case-control, functional magnetic resonance imaging study at an academic medical center. Participants were healthy controls and individuals with at least 1 of the following anxiety disorders: generalized anxiety disorder, social anxiety disorder, specific phobia, and panic disorder. The study dates were between March 2013 and May 2015. Two-day fear conditioning and extinction paradigm. Skin conductance responses, blood oxygenation level-dependent responses, trait anxiety scores from the State Trait Anxiety Inventory-Trait Form, and functional connectivity. This study included 21 healthy controls (10 women) and 61 individuals with anxiety disorders (36 women). P values reported for the neuroimaging results are all familywise error corrected. Skin conductance responses during extinction recall did not differ between individuals with anxiety disorders and healthy controls (ηp2 = 0.001, P = .79), where ηp2 is partial eta squared. The anxiety group had lower activation of the ventromedial prefrontal cortex (vmPFC) during extinction recall (ηp2 = 0.178, P = .02). A similar hypoactive pattern was found during early conditioning (ηp2 = 0.106, P = .009). The vmPFC hypoactivation

  8. Skin Conductance Response in ICU patients with various stressors: a case series

    NARCIS (Netherlands)

    Tjan, D.H.T.; Schellaars, R.; Volders, J.; Weda, J.; Johnson, M.T.; Lubberding, M.; Dijk, E.O.; Ouwerkerk, M.; Van Zanten, A.R.H.

    2012-01-01

    Measuring stress levels in the ICU is not well defined and lacks reliable and valid methods of detection. ICU patients experience different kinds of stress like pain, dyspnoea, anxiety and general discomfort. Skin conductance has recently been shown to be a promising physiological indicator of pain

  9. Testing a linear time invariant model for skin conductance responses by intraneural recording and stimulation.

    Science.gov (United States)

    Gerster, Samuel; Namer, Barbara; Elam, Mikael; Bach, Dominik R

    2018-02-01

    Skin conductance responses (SCR) are increasingly analyzed with model-based approaches that assume a linear and time-invariant (LTI) mapping from sudomotor nerve (SN) activity to observed SCR. These LTI assumptions have previously been validated indirectly, by quantifying how much variance in SCR elicited by sensory stimulation is explained under an LTI model. This approach, however, collapses sources of variability in the nervous and effector organ systems. Here, we directly focus on the SN/SCR mapping by harnessing two invasive methods. In an intraneural recording experiment, we simultaneously track SN activity and SCR. This allows assessing the SN/SCR relationship but possibly suffers from interfering activity of non-SN sympathetic fibers. In an intraneural stimulation experiment under regional anesthesia, such influences are removed. In this stimulation experiment, about 95% of SCR variance is explained under LTI assumptions when stimulation frequency is below 0.6 Hz. At higher frequencies, nonlinearities occur. In the intraneural recording experiment, explained SCR variance is lower, possibly indicating interference from non-SN fibers, but higher than in our previous indirect tests. We conclude that LTI systems may not only be a useful approximation but in fact a rather accurate description of biophysical reality in the SN/SCR system, under conditions of low baseline activity and sporadic external stimuli. Intraneural stimulation under regional anesthesia is the most sensitive method to address this question. © 2017 The Authors. Psychophysiology published by Wiley Periodicals, Inc. on behalf of Society for Psychophysiological Research.

  10. Comparison of blood volume pulse and skin conductance responses to mental and affective stimuli at different anatomical sites

    International Nuclear Information System (INIS)

    Kushki, Azadeh; Fairley, Jillian; Merja, Satyam; King, Gillian; Chau, Tom

    2011-01-01

    Measurements of blood volume pulse (BVP) and skin conductance are commonly used as indications of psychological arousal in affective computing and human–machine interfaces. To date, palmar surfaces remain the primary site for these measurements. Placement of sensors on palmar surfaces, however, is undesirable when recordings are fraught with motion and pressure artifacts. These artifacts are frequent when the human participant has involuntary movements as in hyperkinetic cerebral palsy. This motivates the use of alternative measurement sites. The present study examined the correlation between measurements of blood volume pulse and skin conductance obtained from three different sites on the body (fingers, toes and ear for BVP; fingers, toes and arch of the foot for skin conductance) in response to cognitive and affective stimuli. The results of this pilot study indicated significant inter-site correlation among signal features derived from different sites, with the exception of BVP amplitude, the number of electrodermal reactions and the slope of the electrodermal activity response. We attribute these differences in part to inter-site discrepancies in local skin conditions, such as skin temperature. Despite these differences, significant changes from baseline were present in the responses to the cognitive and affective stimuli at non-palmar sites, suggesting that these sites may provide viable signal measurements for use in affective computing and human–machine interface applications

  11. Associations between Language Development and Skin Conductance Responses to Faces and Eye Gaze in Children with Autism Spectrum Disorder

    Science.gov (United States)

    Stagg, Steven D.; Davis, Robert; Heaton, Pamela

    2013-01-01

    Attention to social stimuli is associated with language development, and arousal is associated with the increased viewing of stimuli. We investigated whether skin conductance responses (SCRs) are associated with language development in autism spectrum disorder (ASD): a population that shows abnormalities in both attention to others and language…

  12. Implicit Recognition of Familiar and Unfamiliar Faces in Schizophrenia: A Study of the Skin Conductance Response in Familiarity Disorders

    Directory of Open Access Journals (Sweden)

    Aurely Ameller

    2017-09-01

    Full Text Available ObjectiveFamiliarity is a subjective sensation that contributes to person recognition. This process is described as an emotion-based memory-trace of previous meetings and could be disrupted in schizophrenia. Consequently, familiarity disorders could be involved in the impaired social interactions observed in patients with schizophrenia. Previous studies have primarily focused on famous people recognition. Our aim was to identify underlying features, such as emotional disturbances, that may contribute to familiarity disorders in schizophrenia. We hypothesize that patients with familiarity disorders will exhibit a lack of familiarity that could be detected by a flattened skin conductance response (SCR.MethodThe SCR was recorded to test the hypothesis that emotional reactivity disturbances occur in patients with schizophrenia during the categorization of specific familiar, famous and unknown faces as male or female. Forty-eight subjects were divided into the following 3 matched groups with 16 subjects per group: control subjects, schizophrenic people with familiarity disorder, and schizophrenic people without familiarity disorders.ResultsEmotional arousal is reflected by the skin conductance measures. The control subjects and the patients without familiarity disorders experienced a differential emotional response to the specific familiar faces compared with that to the unknown faces. Nevertheless, overall, the schizophrenic patients without familiarity disorders showed a weaker response across conditions compared with the control subjects. In contrast, the patients with familiarity disorders did not show any significant differences in their emotional response to the faces, regardless of the condition.ConclusionOnly patients with familiarity disorders fail to exhibit a difference in emotional response between familiar and non-familiar faces. These patients likely emotionally process familiar faces similarly to unknown faces. Hence, the lower

  13. The Relative Utility of Skin Resistance and Skin Conductance

    National Research Council Canada - National Science Library

    Barland, Gordon

    1990-01-01

    The effectiveness of two circuits (constant current = skin resistance; constant voltage = skin conductance) used for measuring electrodermal activity during a psychophysiological detection of deception...

  14. Problem gamblers are hyposensitive to wins: an analysis of skin conductance responses during actual gambling on electronic gaming machines.

    Science.gov (United States)

    Lole, Lisa; Gonsalvez, Craig J; Barry, Robert J; Blaszczynski, Alex

    2014-06-01

    Physiological arousal is purportedly a key determinant in the development and maintenance of gambling behaviors, with problem gambling conceptualized in terms of abnormal autonomic responses. Theoretical conceptualizations of problem gambling are discordant regarding the nature of deficit in this disorder; some accounts posit that problem gamblers are hypersensitive to reward, and others that they are hyposensitive to reward and/or punishment. Previous research examining phasic electrodermal responses in gamblers has been limited to laboratory settings, and reactions to real gaming situations need to be examined. Skin conductance responses (SCRs) to losses, wins, and losses disguised as wins (LDWs) were recorded from 15 problem gamblers (PGs) and 15 nonproblem gamblers (NPGs) while they wagered their own money during electronic gaming machine play. PGs demonstrated significantly reduced SCRs to reward. SCRs to losses and LDWs did not differ for either PGs or NPGs. This hyposensitivity to wins may reflect abnormalities in incentive processing, and may represent a potential biological marker for problem gambling. Copyright © 2014 Society for Psychophysiological Research.

  15. Endogenous salivary α-amylase does not interact with skin conductance response during fear extinction in posttraumatic stress disorder.

    Science.gov (United States)

    Zuj, Daniel V; Palmer, Matthew A; Malhi, Gin S; Bryant, Richard A; Felmingham, Kim L

    2018-04-01

    Posttraumatic Stress Disorder (PTSD) is associated with elevated noradrenergic signaling, which has an impact on emotional learning and memory. Fear extinction is thought to underlie the processes of exposure therapy, however the relationship between noradrenaline and extinction in PTSD is unclear. Participants with PTSD (n = 21), trauma-exposure without PTSD (TC; n = 36), and non-trauma-exposed controls (NTC; n = 27) completed a fear conditioning and extinction paradigm, and conditioned fear was indexed by skin conductance response (SCR). Salivary α-amylase (sAA) collected at baseline and immediately post-fear acquisition was used as an index of noradrenaline, and we examined whether sAA in response to fear acquisition was a moderator between fear extinction and PTSD symptoms. While there was a significant increase in sAA from baseline to post-fear acquisition, this was not modulated by group. Compared to TC and NTC, the PTSD group displayed a slower decline in SCRs during early extinction, which generalized across stimulus type, and was not moderated by sAA. These findings suggest that the relationship between fear extinction and PTSD symptoms does not change as a function of sAA levels; however previous research suggests other processes of fear learning may be associated with noradrenergic activity in PTSD. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  16. The insular cortex: relationship to skin conductance responses to facial expression of emotion in temporal lobe epilepsy.

    Science.gov (United States)

    Banks, Sarah J; Bellerose, Jenny; Douglas, Danielle; Jones-Gotman, Marilyn

    2014-03-01

    The insula plays an important role both in emotion processing and in the generation of epileptic seizures. In the current study we examined thickness of insular cortices and bilateral skin conductance responses (SCR) in healthy subjects in addition to a small number of patients with temporal lobe epilepsy. SCR measures arousal and is used to assess non-conscious responses to emotional stimuli. We used two emotion tasks, one explicitly about emotion and the other implicit. The explicit task required judgments about emotions being expressed in photographs of faces, while the implicit one required judgments about the age of the people in the photographs. Patients and healthy differed in labeling neutral faces, but not other emotions. They also differed in their SCR to emotions, though the profile depended on which hand the recordings were from. Finally, we found relationships between the thickness of the insula and SCR to each task: in the healthy group the thickness of the left insula was related to SCR to the emotion-labeling task; in the patient group it was between the thickness of the right insula and SCR in the age-labeling task. These patterns were evident only for the right hand recordings, thus underscoring the importance of bilateral recordings.

  17. Do intensity ratings and skin conductance responses reliably discriminate between different stimulus intensities in experimentally induced pain?

    Science.gov (United States)

    Breimhorst, Markus; Sandrock, Stephan; Fechir, Marcel; Hausenblas, Nadine; Geber, Christian; Birklein, Frank

    2011-01-01

    The present study addresses the question whether pain-intensity ratings and skin conductance responses (SCRs) are able to detect different intensities of phasic painful stimuli and to determine the reliability of this discrimination. For this purpose, 42 healthy participants of both genders were assigned to either electrical, mechanical, or laser heat-pain stimulation (each n = 14). A whole range of single brief painful stimuli were delivered on the right volar forearm of the dominant hand in a randomized order. Pain-intensity ratings and SCRs were analyzed. Using generalizability theory, individual and gender differences were the main contributors to the variability of both intensity ratings and SCRs. Most importantly, we showed that pain-intensity ratings are a reliable measure for the discrimination of different pain stimulus intensities in the applied modalities. The reliability of SCR was adequate when mechanical and heat stimuli were tested but failed for the discrimination of electrical stimuli. Further studies are needed to reveal the reason for this lack of accuracy for SCRs when applying electrical pain stimuli. Our study could help researchers to better understand the relationship between pain and activation of the sympathetic nervous system. Pain researchers are furthermore encouraged to consider individual and gender differences when measuring pain intensity and the concomitant SCRs in experimental settings. Copyright © 2011 American Pain Society. Published by Elsevier Inc. All rights reserved.

  18. Autonomic responses to heat pain: Heart rate, skin conductance, and their relation to verbal ratings and stimulus intensity.

    Science.gov (United States)

    Loggia, Marco L; Juneau, Mylène; Bushnell, M Catherine

    2011-03-01

    In human pain experiments, as well as in clinical settings, subjects are often asked to assess pain using scales (eg, numeric rating scales). Although most subjects have little difficulty in using these tools, some lack the necessary basic cognitive or motor skills (eg, paralyzed patients). Thus, the identification of appropriate nonverbal measures of pain has significant clinical relevance. In this study, we assessed heart rate (HR), skin conductance (SC), and verbal ratings in 39 healthy male subjects during the application of twelve 6-s heat stimuli of different intensities on the subjects' left forearm. Both HR and SC increased with more intense painful stimulation. However, HR but not SC, significantly correlated with pain ratings at the group level, suggesting that HR may be a better predictor of between-subject differences in pain than is SC. Conversely, changes in SC better predicted variations in ratings within a given individual, suggesting that it is more sensitive to relative changes in perception. The differences in findings derived from between- and within-subject analyses may result from greater within-subject variability in HR. We conclude that at least for male subjects, HR provides a better predictor of pain perception than SC, but that data should be averaged over several stimulus presentations to achieve consistent results. Nevertheless, variability among studies, and the indication that gender of both the subject and experimenter could influence autonomic results, lead us to advise caution in using autonomic or any other surrogate measures to infer pain in individuals who cannot adequately report their perception. Skin conductance is more sensitive to detect within-subject perceptual changes, but heart rate appears to better predict pain ratings at the group level. Copyright © 2010 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  19. Conducted healing to treat large skin wounds.

    Science.gov (United States)

    Salgado, M I; Petroianu, A; Alberti, L R; Burgarelli, G L; Barbosa, A J A

    2013-01-01

    Improvement of the healing process to provide better aesthetical and functional results continues to be a surgical challenge. This study compared the treatment of skin wounds by means of conducted healing (an original method of treatment by secondary healing) and by the use of autogenous skin grafts. Two skin segments, one on each side of the dorsum,were removed from 17 rabbits. The side that served as a graft donor site was left open as to undergo conducted healing (A)and was submitted only to debridement and local care with dressings. The skin removed from the side mentioned above was implanted as a graft (B) to cover the wound on the other side. Thus, each animal received the two types of treatment on its dorsum (A and B). The rabbits were divided into two groups according to the size of the wounds: Group 1 - A and B (4 cm2)and Group 2 - A and B (25 cm2). The healing time was 19 days for Group 1 and 35 days for Group 2. The final macro- and microscopic aspects of the healing process were analysed comparatively among all subgroups. The presence of inflammatory cells, epidermal cysts and of giant cells was evaluated. No macro- or microscopic differences were observed while comparing the wounds that underwent conducted healing and those in which grafting was employed, although the wounds submitted to conducted healing healed more rapidly. Conducted wound healing was effective for the treatment of skin wounds. Celsius.

  20. Heart rate and skin conductance responses to taste, taste novelty, and the (dis)confirmation of expectations

    NARCIS (Netherlands)

    Verastegui-Tena, Luz; Trijp, van Hans; Piqueras-Fiszman, Betina

    2018-01-01

    It is unclear whether the responses of the autonomic nervous system (ANS) can measure how people respond to food. Results focused on emotional responses are contradictory; therefore, the focus has shifted to other components of emotion, such as appraisals. The aim of this study was, therefore, to

  1. Callous-unemotional, impulsive-irresponsible, and grandiose-manipulative traits: Distinct associations with heart rate, skin conductance, and startle responses to violent and erotic scenes.

    Science.gov (United States)

    Fanti, Kostas A; Kyranides, Melina N; Georgiou, Giorgos; Petridou, Maria; Colins, Olivier F; Tuvblad, Catherine; Andershed, Henrik

    2017-05-01

    The present study aimed to examine whether callous-unemotional, grandiose-manipulative, and impulsive-irresponsible dimensions of psychopathy are differentially related to various affective and physiological measures, assessed at baseline and in response to violent and erotic movie scenes. Data were collected from young adults (N = 101) at differential risk for psychopathic traits. Findings from regression analyses revealed a unique predictive contribution of grandiose-manipulative traits in particular to higher ratings of positive valence for violent scenes. Callous-unemotional traits were uniquely associated with lower levels of sympathy toward victims and lower ratings of fear and sadness during violent scenes. All three psychopathy dimensions and the total psychopathy scale showed negative zero-order correlations with heart rate at baseline, but regression analyses revealed that only grandiose manipulation was uniquely predictive of lower baseline heart rate. Grandiose manipulation was also significantly associated with lower baseline skin conductance. Regarding autonomic activity, findings resulted in a unique negative association between grandiose manipulation and heart rate activity in response to violent scenes. In contrast, the impulsive-irresponsible dimension was positively related with heart rate activity to violent scenes. Finally, findings revealed that only callous-unemotional traits were negatively associated with startle potentiation in response to violent scenes. No associations during erotic scenes were identified. These findings point to unique associations between the three assessed dimensions of psychopathy with physiological measures, indicating that grandiose manipulation is associated with hypoarousal, impulsive irresponsibility with hyperarousal, and callous-unemotional traits with low emotional and fear responses to violent scenes. © 2017 Society for Psychophysiological Research.

  2. Sympathetic skin response evoked by laser skin stimulation

    OpenAIRE

    Rossi, P.; Truini, A.; Serrao, M.; Iannetti, G. D.; Parisi, L.; Pozzessere, G.; Cruccu, G.

    2002-01-01

    The objective of this study was to evoke sympathetic skin responses (SSRs) in healthy subjects using laser stimulation and to compare these responses with those induced by conventional electrical stimuli. Twenty healthy subjects were investigated. SSRs were obtained using electrical and laser stimuli delivered to the wrist controlateral to the recording site. The sympathetic sudomotor conduction velocity (SSFCV) was measured in 8 subjects by simultaneously recording the SSR from the hand and ...

  3. Responsible conduct of research

    CERN Document Server

    Shamoo, Adil E

    2015-01-01

    Since the early 2000s, the field of Responsible Conduct of Research has become widely recognized as essential to scientific education, investigation, and training. At present, research institutions with public funding are expected to have some minimal training and education in RCR for their graduate students, fellows and trainees. These institutions also are expected to have a system in place for investigating and reporting misconduct in research or violations of regulations in research with human subjects, or in their applications to federal agencies for funding. Public scrutiny of the conduct of scientific researchers remains high. Media reports of misconduct scandals, biased research, violations of human research ethics rules, and moral controversies in research occur on a weekly basis. Since the 2009 publication of the 2nd edition of Shamoo and Resnik's Responsible Conduct of Research, there has been a vast expansion in the information, knowledge, methods, and diagnosis of problems related to RCR and the ...

  4. State of hydration and electrical conductance of ichthyotic skin

    OpenAIRE

    A B Gupta; Manisha Bhattacharya; B Haldar

    1990-01-01

    Dry skin of twelve subjects suffering from ichthyosis vulgaris and the efficacy of a moisturiser-Cotaryl were quantitatively assessed by measuring the skin surface hydration and high frequency (3.5 MHz) electrical conductance of skin. The state of hydration and conductance of ichthyotic skin were 86.9 + 24.6 and 11.0 + 5.7 micro-mho respectively, being much less-compared to 132. 0 + 5.3 and 72.5 + 54.0 micro-mho ofnormal subjects. The moisturiser increased the state of hydration and also the ...

  5. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    Directory of Open Access Journals (Sweden)

    Ilona eCroy

    2013-09-01

    Full Text Available Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of evoked disgust as well as responses of the autonomic nervous system (heart rate, skin conductance level, systolic blood pressure were recorded and the effect of stimulus labeling and of repeated presentation was analyzed. Ratings suggested that disgust could be evoked through all senses; they were highest for visual stimuli. However, autonomic reaction towards disgusting stimuli differed according to the channel of presentation. In contrast to the other, olfactory disgust stimuli provoked a strong decrease of systolic blood pressure. Additionally, labeling enhanced disgust ratings and autonomic reaction for olfactory and tactile, but not for visual and auditory stimuli. Repeated presentation indicated that participant’s disgust rating diminishes to all but olfactory disgust stimuli. Taken together we argue that the sensory channel through which a disgust reaction is evoked matters.

  6. Modelling the effect of hydration on skin conductivity.

    Science.gov (United States)

    Davies, L; Chappell, P; Melvin, T

    2017-08-01

    Electrical signals are recorded from and sent into the body via the skin in a number of applications. In practice, skin is often hydrated with liquids having different conductivities so a model was produced in order to determine the relationship between skin impedance and conductivity. A model representing the skin was subjected to a variety of electrical signals. The parts of the model representing the stratum corneum were given different conductivities to represent different levels of hydration. The overall impedance and conductivity of the cells did not vary at frequencies below 40 kHz. Above 40 kHz, levels of increased conductivity caused the overall impedance to decrease. The variation in impedance with conductivity between 5 and 50 mSm -1 can be modelled quadratically while variation in impedance with conductivity between 5 and 5000 mSm -1 can be modelled with a double exponential decay. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Problematic internet users' skin conductance and anxiety increase after exposure to the internet.

    Science.gov (United States)

    Romano, Michela; Roaro, Alessandra; Re, Federica; Osborne, Lisa A; Truzoli, Roberto; Reed, Phil

    2017-12-01

    To examine the impact of cessation of an internet session on skin conductance responses and anxiety of higher and lower problem internet users, in order to explore possible physiological withdrawal effects. Participants were measured in terms of their skin conductance before (15min), during (15min), and after (15min) an internet session, and completed self-report measures of state anxiety and problematic internet use. Higher, but not lower, problem users showed increased skin conductance after internet use was stopped, relative to before their internet session. Higher problem users' GSR scores increased, as the time from internet cessation became longer. Higher problem users also showed increased levels of anxiety, following their internet session, which correlated with their skin conductance scores. These results suggest that, following termination of an internet session, withdrawal-like effects are seen, both psychologically and physiologically. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Comparison of skin responses from macroscopic and microscopic UV challenges

    Science.gov (United States)

    Seo, InSeok; Bargo, Paulo R.; Chu, Melissa; Ruvolo, Eduardo; Kollias, Nikiforos

    2011-03-01

    The minimal erythema dose induced by solar-simulated radiation is a useful measure of UV sensitivity of skin. Most skin phototests have been conducted by projecting a flat field of UV radiation onto the skin in an area greater than 15 cm × 15 cm with an increment of radiation doses. In this study, we investigated the responses of human skin to solar-simulated radiation of different field sizes. Twelve human subjects of skin phototype I-IV were exposed to solar-simulated radiation (SSR) on their upper inner arm or on their lower back with a series of doses in increments of 20% in order to determine the threshold dose to induce a minimal perceptible erythema response (MED). Each dose was delivered with a liquid light guide (8 mm diameter on the back or 6 mm on the upper inner arm) and with quartz optical fibers of 200 μm diameter. The resulting skin responses were evaluated visually and investigated with a reflectance confocal microscope and imaging. The erythema response to the microscopic challenge was always diffuse with no clear boundaries extending to several times the exposed site diameter at doses greater than 2 MED. The skin returned to normal appearance from the microscopic challenge after two weeks of exposure while change in appearance for the larger areas persisted for several weeks to months. This new modality of testing provides the possibility to study skin at the microscopic level with a rapid recovery following challenge.

  9. The Development of Skin Conductance Fear Conditioning in Children from Ages 3 to 8 Years

    Science.gov (United States)

    Gao, Yu; Raine, Adrian; Venables, Peter H.; Dawson, Michael E.; Mednick, Sarnoff A.

    2010-01-01

    Although fear conditioning is an important psychological construct implicated in behavioral and emotional problems, little is known about how it develops in early childhood. Using a differential, partial reinforcement conditioning paradigm, this longitudinal study assessed skin conductance conditioned responses in 200 children at ages 3, 4, 5, 6,…

  10. Measures of skin conductance and heart rate in alcoholic men and women during memory performance

    Directory of Open Access Journals (Sweden)

    Kayle S. Sawyer

    2015-05-01

    Full Text Available We examined abnormalities in physiological responses to emotional stimuli associated with long-term chronic alcoholism. Skin conductance responses (SCR and heart rate (HR responses were measured in 32 abstinent alcoholic (ALC and 30 healthy nonalcoholic (NC men and women undergoing an emotional memory task in an MRI scanner. The task required participants to remember the identity of two emotionally-valenced faces presented at the onset of each trial during functional magnetic resonance imaging (fMRI scanning. After viewing the faces, participants saw a distractor image (an alcoholic beverage, nonalcoholic beverage, or scrambled image followed by a single probe face. The task was to decide whether the probe face matched one of the two encoded faces. Skin conductance measurements (before and after the encoded faces, distractor, and probe were obtained from electrodes on the index and middle fingers on the left hand. HR measurements (beats per minute before and after the encoded faces, distractor, and probe were obtained by a pulse oximeter placed on the little finger on the left hand. We expected that, relative to NC participants, the ALC participants would show reduced SCR and HR responses to the face stimuli, and that we would identify greater reactivity to the alcoholic beverage stimuli than to the distractor stimuli unrelated to alcohol. While the beverage type did not differentiate the groups, the ALC group did have reduced skin conductance and HR responses to elements of the task, as compared to the NC group.

  11. Monitoring of skin conductance to assess postoperative pain intensity.

    Science.gov (United States)

    Ledowski, T; Bromilow, J; Paech, M J; Storm, H; Hacking, R; Schug, S A

    2006-12-01

    Pain is known to alter the electrogalvanic properties of the skin. The aim of this pilot study was to investigate the influence of postoperative pain on skin conductance (SC) readings. After obtaining ethical approval and written informed consent, 25 postoperative patients were asked to quantify their level of pain on a numeric rating scale (NRS, 0-10) at different time points in the recovery room. As a parameter of SC, the number of fluctuations within the mean SC per second (NFSC) was recorded. Simultaneously, the NRS was obtained from patients by a different observer who was blinded to the NFSC values. Data from 110 readings of 25 patients (14 female, 11 male; 21-67 yr) were included. NFSC showed a significant correlation with the NRS (r=0.625; P3 on the NRS was predicted with sensitivity of 89% and specificity of 74%. The severity of postoperative pain significantly influences SC. Using cut-off values, NFSC may prove a useful tool for pain assessment in the postoperative period.

  12. Skin Conductance Level Reactivity Moderates the Association Between Harsh Parenting and Growth in Child Externalizing Behavior

    OpenAIRE

    Erath, Stephen A.; El-Sheikh, Mona; Hinnant, J. Benjamin; Cummings, E. Mark

    2011-01-01

    Skin conductance level reactivity (SCLR) was examined as a moderator of the association between harsh parenting at age 8 years and growth in child externalizing behavior from age 8 to age 10 (N = 251). Mothers and fathers provided reports of harsh parenting and their children’s externalizing behavior; children also provided reports of harsh parenting. SCLR was assessed in response to a socioemotional stress task and a problem-solving challenge task. Latent growth modeling revealed that boys w...

  13. Harsh Parenting and Child Externalizing Behavior: Skin Conductance Level Reactivity as a Moderator

    OpenAIRE

    Erath, Stephen A.; El-Sheikh, Mona; Cummings, E. Mark

    2009-01-01

    Skin conductance level reactivity (SCLR) was examined as a moderator of the association between harsh parenting and child externalizing behavior. Participants were 251 boys and girls (8–9 years). Mothers and fathers provided reports of harsh parenting and their children’s externalizing behavior; children also provided reports of harsh parenting. SCLR was assessed in response to a socioemotional stress task and a problem-solving challenge task. Regression analyses revealed that the association...

  14. Thermoregulatory responses to skin wetting during prolonged treadmill running.

    Science.gov (United States)

    Bassett, D R; Nagle, F J; Mookerjee, S; Darr, K C; Ng, A V; Voss, S G; Napp, J P

    1987-02-01

    We examined the physiological responses to skin wetting during a 120-min level treadmill run to assess whether skin wetting would reduce the dehydration and the increase in core temperature associated with prolonged exercise. Testing was conducted in an environmental chamber (T = 29.5 degrees C, wind velocity = 3 m X sec-1) under two different humidity conditions (33 or 66% relative humidity). Ten male subjects performed two runs in each humidity condition; one served as a control run. The other included spraying the body with 50 ml of water (T = 29.5 degrees C) every 10 min. Spraying had no effect on rectal temperature (Tre), heart rate, oxygen consumption, perceived exertion, sweat loss, or percent change in plasma volume in both the humid and the dry conditions. Spraying produced a significant reduction in mean skin temperature (Tsk), which increased the (Tre - Tsk) gradient. At the same time, overall skin conductance (K) was decreased, presumably as a result of cutaneous vasoconstriction due to the low Tsk. Since heat transfer from the body's core to the skin is expressed by the equation: heat transfer = K X (Tre - Tsk) the spraying had no effect on heat transfer away from the core, and Tre remained unchanged.

  15. Skin bank development and critical incident response.

    Science.gov (United States)

    Hamilton, Kellie T; Herson, Marisa R

    2011-05-01

    The Donor Tissue Bank of Victoria (DTBV), situated in Melbourne, Australia developed a skin banking program in 1994. It remains Australia's only operational skin bank, processing cryopreserved human cadaveric skin for the treatment of burns. The demand for allograft skin in Australia has steadily increased since the development of the program. The bank has been involved in the provision of skin for a number of critical incidences or disasters both in Australia and overseas. Demand always exceeds supply, and in the absence of other local skin banks, the DTBV has needed to develop strategies to enable increased provision of allograft skin nationally.

  16. Sleep deprived and sweating it out: the effects of total sleep deprivation on skin conductance reactivity to psychosocial stress.

    Science.gov (United States)

    Liu, Jean C J; Verhulst, Silvan; Massar, Stijn A A; Chee, Michael W L

    2015-01-01

    We examined how sleep deprivation alters physiological responses to psychosocial stress by evaluating changes in skin conductance. Between-subjects design with one group allocated to 24 h of total sleep deprivation and the other to rested wakefulness. The study took place in a research laboratory. Participants were 40 healthy young adults recruited from a university. Sleep deprivation and feedback. Electrodermal activity was monitored while participants completed a difficult perceptual task with false feedback. All participants showed increased skin conductance levels following stress. However, compared to well-rested participants, sleep deprived participants showed higher skin conductance reactivity with increasing stress levels. Our results suggest that sleep deprivation augments allostatic responses to increasing psychosocial stress. Consequentially, we propose sleep loss as a risk factor that can influence the pathogenic effects of stress. © 2014 Associated Professional Sleep Societies, LLC.

  17. Can the Hydroxyapatite-Coated Skin-Penetrating Abutment for Bone Conduction Hearing Implants Integrate with the Surrounding Skin?

    Science.gov (United States)

    van Hoof, Marc; Wigren, Stina; Duimel, Hans; Savelkoul, Paul H M; Flynn, Mark; Stokroos, Robert Jan

    2015-01-01

    Percutaneous implants, such as bone conduction hearing implants, suffer from complications that include inflammation of the surrounding skin. A sealed skin-abutment interface can prevent the ingress of bacteria, which should reduce the occurrence of peri-abutment dermatitis. It was hypothesized that a hydroxyapatite (HA)-coated abutment in conjunction with soft tissue preservation surgery should enable integration with the adjacent skin. Previous research has confirmed that integration is never achieved with as-machined titanium abutments. Here, we investigate, in vivo, if skin integration is achievable in patients using a HA-coated abutment. One titanium abutment (control) and one HA-coated abutment (case) together with the surrounding skin were surgically retrieved from two patients who had a medical indication for this procedure. Histological sections of the skin were investigated using light microscopy. The abutment was qualitatively analyzed using scanning electron microscopy. The titanium abutment only had a partial and thin layer of attached amorphous biological material. The HA-coated abutment was almost fully covered by a pronounced thick layer of organized skin, composed of different interconnected structural layers. Proof-of-principle evidence that the HA-coated abutment can achieve integration with the surrounding skin was presented for the first time.

  18. Radiation response of skin in young and old rats

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W. (Churchill Hospital, Oxford (UK))

    1982-11-01

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation.

  19. The radiation response of skin in young and old rats

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1982-01-01

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation. (author)

  20. Sympathetic skin responses in patients with hyperthyroidism.

    Science.gov (United States)

    Gozke, E; Ozyurt, Z; Dortcan, N; Ore, O; Kocer, A; Ozer, E

    2007-01-01

    The aim of this study was to investigate the disorders of sympathetic nervous system in patients with hyperthyroidism using sympathetic skin response (SSR). Twenty-two newly diagnosed cases with hyperthyroidism were included in the study. The results were compared with those of 20 healthy controls. SSR was recorded with the contralateral electrical stimulation of the median nerve (of the upper extremities) and tibial nerve (of the lower extremities) with active electrodes placed on palms and soles and reference electrodes attached on the dorsal aspects of hands and feet. Ages of the cases with hyperthyroidism and controls ranged between 15-65 years (mean: 46.7 +/- 15.0 years) and 24-62 years (mean: 39.6 +/- 9.8 years) respectively (p > 0.05). In all the control subjects SSR could be obtained, while from the lower extremities of 4 cases with hyperthyroidism (18.0%) SSR could not be elicited. Mean SSR latencies of lower extremities were found significantly longer than control group (p nervous system involvement in cases with hyperthyroidism.

  1. Origins of variation in conducted vasomotor responses

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Welsh, Donald G.; Holstein-Rathlou, Niels-Henrik

    2015-01-01

    , the efficacy of conducted responses varies significantly between different initiating stimuli within the same vascular bed as well as between different vascular beds following the same stimulus. The differences have stimulated proposals of different mechanisms to account for the experimentally observed...... variation. Using a computational approach that allows for introduction of structural and electrophysiological heterogeneity, we systematically tested variations in both arteriolar electrophysiology and modes of stimuli. Within the same vessel, our simulations show that conduction efficacy is influenced...

  2. [Skin cell response after jellyfish sting].

    Science.gov (United States)

    Adamicová, Katarína; Výbohová, Desanka; Fetisovová, Želmíra; Nováková, Elena; Mellová, Yvetta

    2016-01-01

    Jellyfish burning is not commonly part of the professional finding in the central Europe health care laboratory. Holiday seaside tourism includes different and unusual presentations of diseases for our worklplaces. Sea water-sports and leisure is commonly connected with jellyfish burning and changes in the skin, that are not precisely described. Authors focused their research on detection of morphological and quantitative changes of some inflammatory cells in the skin biopsy of a 59-years-old woman ten days after a jellyfish stinging. Because of a comparison of findings the biopsy was performed in the skin with lesional and nonlesional skin. Both excisions of the skin were tested by imunohistochemical methods to detect CD68, CD163, CD30, CD4, CD3, CD8, CD20 a CD1a, to detect histiocytes, as well as several clones of lymphocytes and Langerhans cells (antigen presenting cells of skin), CD 117, toluidin blue and chloracetase esterase to detect mastocytes and neutrophils. Material was tested by immunofluorescent methods to detect IgA, IgM, IgG, C3, C4, albumin and fibrinogen. Representative view-fields were documented by microscope photocamera Leica DFC 420 C. Registered photos from both samples of the skin were processed by morphometrical analysis by the Vision Assistant software. A student t-test was used for statistical analysis of reached results. Mean values of individual found cells in the sample with lesion and without lesion were as follows: CD117 -2.64/0.37, CD68-6.86/1.63, CD163-3.13/2.23, CD30-1.36/0.02, CD4-3.51/0.32, CD8-8.22/0.50, CD3-10.69/0.66, CD20-0.56/0.66, CD1a-7.97/0.47 respectively. Generally mild elevation of eosinofils in lesional skin was detected. Increased values of tested cells seen in excision from lesional skin when compared with nonlesional ones were statistically significant in eight case at the level p = 0.033 to 0.001. A not statistically significant difference was found only in the group of CD163+ histiocytes. Authors detected numbers

  3. Motives of Socially Responsible Business Conduct

    NARCIS (Netherlands)

    Graafland, J.J.; Kaptein, M.; Mazereeuw V/d Duijn Schouten, C.

    2010-01-01

    The social and ecological challenges that governments face have raised their interest in socially responsible business conduct (SRBC). In this article we analyze the motives of executives to perform SRBC. We distinguish three types of motives: financial, ethical and altruistic motives. We test the

  4. Control of the skin scarring response

    Directory of Open Access Journals (Sweden)

    Lydia M. Ferreira

    2009-09-01

    Full Text Available There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, it is fundamental to understand the control mechanism exerted by the interaction and synergism of both systems, cutaneous nervous and central nervous, via hypothalamus hypophysis-adrenal axis, a relevant subject, but hardly ever explored. The present study reviews the neuro-immune-endocrine physiology of the skin responsible for its multiple functions and the extreme disturbances of the healing process, like the excess and deficiency of the extracellular matrix deposition.Aproxima-se uma época na qual é fundamental a compreensão do processo cicatricial cutâneo frente à necessidade da restauração tecidual precoce, visando a diminuição das morbidades física, social e psicológica. O avanço no conhecimento acerca do controle das interações entre as células, a matriz e os fatores de crescimento dará maiores informações à Medicina Regenerativa, área de pesquisa emergente da bioengenharia médica. Entretanto, diante do dinamismo e complexidade da resposta cicatricial cutânea torna-se indispensável o entendimento do mecanismo de controle exercido pela interação e sinergismo do sistema nervoso cutâneo e o sistema nervoso central, via eixo hipotálamo-hipófise-adrenal, tema relevante, porém, pouco abordado. O presente estudo revisa a fisiologia neuro-imuno-endócrina da pele, responsável por suas múltiplas funções, e os distúrbios extremos do processocicatricial, como o excesso e deficiência de deposição da matriz extracelular.

  5. The early identification of anxiety-laden material with the aid of skin conductance measurements.

    Science.gov (United States)

    Lukens, H R

    1979-01-01

    Measured electrodermal responses (EDR), in the form of changes in skin conductivity, during administration of a calibration questionnaire (CQ) and a personal history questionnaire (PHQ) to each of 25 Ss. "Strong" changes were defined statistically for each S from the amplitudes of EDR evoked by the CQ. The free-floating anxiety of each S also was measured. As predicted on the grounds that questions of the PHQ were more likely than the non-personal questions of the CQ to intersect unresolved, anxiety-laden material, it was found that strong EDR evoked by the PHQ were significantly more likely to perseverate than those evoked by the CQ. Hence, the technique has potential clinical use in identifying anxiety-laden material. Free-floating anxiety did not correlate significantly with EDR data.

  6. Changes in the Skin Conductance Monitor as an End Point for Sympathetic Nerve Blocks.

    Science.gov (United States)

    Gungor, Semih; Rana, Bhumika; Fields, Kara; Bae, James J; Mount, Lauren; Buschiazzo, Valeria; Storm, Hanne

    2017-11-01

    There is a lack of objective methods for determining the achievement of sympathetic block. This study validates the skin conductance monitor (SCM) as an end point indicator of successful sympathetic blockade as compared with traditional monitors. This interventional study included 13 patients undergoing 25 lumbar sympathetic blocks to compare time to indication of successful blockade between the SCM indices and traditional measures, clinically visible hyperemia, clinically visible engorgement of veins, subjective skin temperature difference, unilateral thermometry monitoring, bilateral comparative thermometry monitoring, and change in waveform amplitude in pulse oximetry plethysmography, within a 30-minute observation period. Differences in the SCM indices were studied pre- and postblock to validate the SCM. SCM showed substantially greater odds of indicating achievement of sympathetic block in the next moment (i.e., hazard rate) compared with all traditional measures (clinically visible hyperemia, clinically visible engorgement of veins, subjective temperature difference, unilateral thermometry monitoring, bilateral comparative thermometry monitoring, and change in waveform amplitude in pulse oximetry plethysmography; P ≤ 0.011). SCM indicated successful block for all (100%) procedures, while the traditional measures failed to indicate successful blocks in 16-84% of procedures. The SCM indices were significantly higher in preblock compared with postblock measurements (P SCM is a more reliable and rapid response indicator of a successful sympathetic blockade when compared with traditional monitors. © 2017 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  7. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  8. Deceased donor skin allograft banking: Response and utilization

    Directory of Open Access Journals (Sweden)

    Gore Madhuri

    2010-10-01

    Full Text Available Background: In the absence of xenograft and biosynthetic skin substitutes, deceased donor skin allografts is a feasible option for saving life of patient with extensive burn injury in our country. Aims: The first deceased donor skin allograft bank in India became functional at Lokmanya Tilak Municipal (LTM medical college and hospital on 24 th April 2000. The response of Indian society to this new concept of skin donation after death and the pattern of utilization of banked allografts from 2000 to 2010 has been presented in this study. Settings and Design: This allograft skin bank was established by the department of surgery. The departments of surgery and microbiology share the responsibility of smooth functioning of the bank. Materials and Methods: The response in terms of number of donations and the profile of donors was analyzed from records. Pattern and outcome of allograft utilization was studied from specially designed forms. Results: During these ten years, 262 deceased donor skin allograft donations were received. The response showed significant improvement after counselling was extended to the community. Majority of the donors were above 70 years of age and procurement was done at home for most. Skin allografts from 249 donors were used for 165 patients in ten years. The outcome was encouraging with seven deaths in 151 recipients with burn injuries. Conclusions: Our experience shows that the Indian society is ready to accept the concept of skin donation after death. Use of skin allografts is life saving for large burns. We need to prepare guidelines for the establishment of more skin banks in the country.

  9. Effect of skin temperature on cutaneous vasodilator response to the β-adrenergic agonist isoproterenol.

    Science.gov (United States)

    Hodges, Gary J; Kellogg, Dean L; Johnson, John M

    2015-04-01

    The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography. Data were expressed as cutaneous vascular conductance (CVC; laser-Doppler flux/mean arterial blood pressure). Pharmacological agents were administered via intradermal microdialysis. We prepared four skin sites: one site was maintained at a thermoneutral temperature of 34°C (32 ± 10%CVCmax) one site was heated to 39°C (38 ± 11%CVCmax); and two sites were cooled, one to 29°C (22 ± 7%CVCmax) and the other 24°C (16 ± 4%CVCmax). After 20 min at these temperatures to allow stabilization of skin blood flow, isoproterenol was perfused in concentrations of 10, 30, 100, and 300 μM. Each concentration was perfused for 15 min. Relative to the CVC responses to isoproterenol at the thermoneutral skin temperature (34°C) (+21 ± 10%max), low skin temperatures reduced (at 29°C) (+17 ± 6%max) or abolished (at 24°C) (+1 ± 5%max) the vasodilator response, and warm (39°C) skin temperatures enhanced the vasodilator response (+40 ± 9%max) to isoproterenol. These data indicate that β-adrenergic function was influenced by local skin temperature. This finding raises the possibility that a part of the vasoconstrictor response to direct skin cooling could include reduced background β-receptor mediated vasodilation. Copyright © 2015 the American Physiological Society.

  10. Response of Human Skin to Aesthetic Scarification

    Science.gov (United States)

    Gabriel, Vincent A.; McClellan, Elizabeth A.; Scheuermann, Richard H.

    2014-01-01

    This study was undertaken to investigate changes in RNA expression in previously healthy adult human skin following thermal injury induced by contact with hot metal that was undertaken as part of aesthetic scarification, a body modification practice. Subjects were recruited to have pre-injury skin and serial wound biopsies performed. 4 mm punch biopsies were taken prior to branding and 1 hour, 1 week, and 1, 2 and 3 months post injury. RNA was extracted and quality assured prior to the use of a whole-genome based bead array platform to describe expression changes in the samples using the pre-injury skin as a comparator. Analysis of the array data was performed using k-means clustering and a hypergeometric probability distribution without replacement and corrections for multiple comparisons were done. Confirmatory q-PCR was performed. Using a k of 10, several clusters of genes were shown to co-cluster together based on Gene Ontology classification with probabilities unlikely to occur by chance alone. OF particular interest were clusters relating to cell cycle, proteinaceous extracellular matrix and keratinization. Given the consistent expression changes at one week following injury in the cell cycle cluster, there is an opportunity to intervene early following burn injury to influence scar development. PMID:24582755

  11. Mechanical response of human female breast skin under uniaxial stretching.

    Science.gov (United States)

    Kumaraswamy, N; Khatam, Hamed; Reece, Gregory P; Fingeret, Michelle C; Markey, Mia K; Ravi-Chandar, Krishnaswamy

    2017-10-01

    Skin is a complex material covering the entire surface of the human body. Studying the mechanical properties of skin to calibrate a constitutive model is of great importance to many applications such as plastic or cosmetic surgery and treatment of skin-based diseases like decubitus ulcers. The main objective of the present study was to identify and calibrate an appropriate material constitutive model for skin and establish certain universal properties that are independent of patient-specific variability. We performed uniaxial tests performed on breast skin specimens freshly harvested during mastectomy. Two different constitutive models - one phenomenological and another microstructurally inspired - were used to interpret the mechanical responses observed in the experiments. Remarkably, we found that the model parameters that characterize dependence on previous maximum stretch (or preconditioning) exhibited specimen-independent universal behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Characterizing human skin blood flow regulation in response to different local skin temperature perturbations

    NARCIS (Netherlands)

    Wu, Y.; Nieuwenhoff, M.D.; Huygen, Frank J.P.M.; van der Helm, F. C.T.; Niehof, S.P.; Schouten, A. C.

    2017-01-01

    Small nerve fibers regulate local skin blood flow in response to local thermal perturbations. Small nerve fiber function is difficult to assess with classical neurophysiological tests. In this study, a vasomotor response model in combination with a heating protocol was developed to quantitatively

  13. Complex conductivity response to silver nanoparticles in ...

    Science.gov (United States)

    The increase in the use of nanoscale materials in consumer products has resulted in a growing concern of their potential hazard to ecosystems and public health from their accidental or intentional introduction to the environment. Key environmental, health, and safety research needs include knowledge and methods for their detection, characterization, fate, and transport. Specifically, techniques available for the direct detection and quantification of their fate and transport in the environment are limited. Their small size, high surface area to volume ratio, interfacial, and electrical properties make metallic nanoparticles, such as silver nanoparticles, good targets for detection using electrical geophysical techniques. Here we measured the complex conductivity response to silver nanoparticles in sand columns under varying moisture conditions (0–30%), nanoparticle concentrations (0–10 mg/g), lithology (presence of clay), pore water salinity (0.0275 and 0.1000 S/m), and particle size (35, 90–210 and 1500–2500 nm). Based on the Cole-Cole relaxation models we obtained the chargeability and the time constant. We demonstrate that complex conductivity can detect silver nanoparticles in porous media with the response enhanced by higher concentrations of silver nanoparticles, moisture content, ionic strength, clay content and particle diameter. Quantification of the volumetric silver nanoparticles content in the porous media can also be obtained from complex co

  14. Harsh Parenting and Child Externalizing Behavior: Skin Conductance Level Reactivity as a Moderator

    Science.gov (United States)

    Erath, Stephen A.; El-Sheikh, Mona; Cummings, E. Mark

    2009-01-01

    Skin conductance level reactivity (SCLR) was examined as a moderator of the association between harsh parenting and child externalizing behavior. Participants were 251 boys and girls (8-9 years). Mothers and fathers provided reports of harsh parenting and their children's externalizing behavior; children also provided reports of harsh parenting.…

  15. Skin Conductance Level Reactivity Moderates the Association between Harsh Parenting and Growth in Child Externalizing Behavior

    Science.gov (United States)

    Erath, Stephen A.; El-Sheikh, Mona; Hinnant, J. Benjamin; Cummings, E. Mark

    2011-01-01

    Skin conductance level reactivity (SCLR) was examined as a moderator of the association between harsh parenting at age 8 years and growth in child externalizing behavior from age 8 to age 10 (N = 251). Mothers and fathers provided reports of harsh parenting and their children's externalizing behavior; children also provided reports of harsh…

  16. Sympathetic nervous system activity measured by skin conductance quantifies the challenge of walking adaptability tasks after stroke.

    Science.gov (United States)

    Clark, David J; Chatterjee, Sudeshna A; McGuirk, Theresa E; Porges, Eric C; Fox, Emily J; Balasubramanian, Chitralakshmi K

    2018-02-01

    Walking adaptability tasks are challenging for people with motor impairments. The construct of perceived challenge is typically measured by self-report assessments, which are susceptible to subjective measurement error. The development of an objective physiologically-based measure of challenge may help to improve the ability to assess this important aspect of mobility function. The objective of this study to investigate the use of sympathetic nervous system (SNS) activity measured by skin conductance to gauge the physiological stress response to challenging walking adaptability tasks in people post-stroke. Thirty adults with chronic post-stroke hemiparesis performed a battery of seventeen walking adaptability tasks. SNS activity was measured by skin conductance from the palmar surface of each hand. The primary outcome variable was the percent change in skin conductance level (ΔSCL) between the baseline resting and walking phases of each task. Task difficulty was measured by performance speed and by physical therapist scoring of performance. Walking function and balance confidence were measured by preferred walking speed and the Activities-specific Balance Confidence Scale, respectively. There was a statistically significant negative association between ΔSCL and task performance speed and between ΔSCL and clinical score, indicating that tasks with greater SNS activity had slower performance speed and poorer clinical scores. ΔSCL was significantly greater for low functioning participants versus high functioning participants, particularly during the most challenging walking adaptability tasks. This study supports the use of SNS activity measured by skin conductance as a valuable approach for objectively quantifying the perceived challenge of walking adaptability tasks in people post-stroke. Published by Elsevier B.V.

  17. Oral warfarin intake affects skin inflammatory cytokine responses in rats.

    Science.gov (United States)

    Aleksandrov, Aleksandra Popov; Mirkov, Ivana; Zolotarevski, Lidija; Ninkov, Marina; Mileusnic, Dina; Kataranovski, Dragan; Kataranovski, Milena

    2017-09-01

    Warfarin is an anticoagulant used in prevention/prophylaxis of thromboembolism. Besides the effects on coagulation, non-hemorrhagic reactions have also been documented. Although cutaneous reactions were reported in some patients, the impact on skin immunity was not explored. In the present paper, the effect of 30-day oral warfarin intake on skin cytokine responses in rats was analyzed. Increased release of inflammatory cytokines (TNF, IL-1β and IL-10) was noted by skin explants from rats which received warfarin, but without effect on IL-6. No impact on epidermal cell cytokine secretion was seen, except a tendency of an increase of IL-6 response to stimulation with microbial product lipopolysaccharide (LPS). Topical application of contact allergen dinitrochlorobenzene (DNCB) resulted in slight (numerical solely) increase of TNF release by skin explants of warfarin-treated animals, while epidermal cells responded by increased secretion of all four cytokines examined. The data presented provide new information on the potential of oral warfarin to modulate skin innate immune activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Conformable Skin-Like Conductive Thin Films with AgNWs Strips for Flexible Electronic Devices

    Directory of Open Access Journals (Sweden)

    Yuhang SUN

    2015-08-01

    Full Text Available Keeping good conductivity at high stretching strain is one of the main requirements for the fabrication of flexible electronic devices. The elastic nature of siloxane-based elastomers enables many innovative designs in wearable sensor devices and non-invasive insertion instruments, including skin-like tactile sensors. Over the last few years, polydimethylsiloxane (PDMS thin films have been widely used as the substrates in the fabrication of flexible electronic devices due to their good elasticity and outstanding biocompatibility. However, these kind of thin films usually suffer poor resistance to tearing and insufficient compliance to curved surfaces, which limits their applications. Currently no three-dimensionally mountable tactile sensor arrays have been reported commercially available. In this work, we developed a kind of mechanically compliant skin-like conductive thin film by patterning silver nano wire traces in strip-style on Dragon Skin® (DS substrates instead of PDMS. High cross- link quality was achieved then. To further improve the conductivity, a thin gold layer was coated onto the silver nanowires (AgNWs strips. Four different gold deposition routines have been designed and investigated by using different E-beam and spin coating processing methods. Owning to the intrinsically outstanding physical property of the Dragon Skin material and the uniform embedment built in the gold deposition processes, the DS/AgNWs thin films showed convincible advantages over PDMS/AgNWs thin films in both mechanical capability and conductive stability. Through experimental tests, the DS/AgNWs electrode thin films were proven to be able to maintain high conductivity following repeated linear deformations.

  19. Electromechanical Response of Conductive Porous Structure

    Directory of Open Access Journals (Sweden)

    Hye-Mi So

    2015-01-01

    Full Text Available Porous conductors with large surface-volume ratios have been applied to a variety of fields, including absorbents, flexible heaters, and electrodes for supercapacitors. In this study, we implemented sensitive pressure sensors using the mechanical and electrical characteristics of conductive porous structures manufactured by immersing sponges into a carbon nanotube solution and then measured the change in resistance. When pressure was applied to conductive sponges, carbon nanotubes were attached to each other and the resistance was reduced by up to 20%. The carbon nanotube sponges, which were soft and had superior elasticity, were quickly stabilized without any changes taking place in their shape, and they showed consistent change in resistance during experiments of repetitive pressure. The pressure devices based on conductive porous sponges were connected to single-walled carbon nanotube field effect transistors (SWCNT-FETs and changes in their characteristics were investigated according to external pressure.

  20. Effect of compression stockings on cutaneous microcirculation: Evaluation based on measurements of the skin thermal conductivity.

    Science.gov (United States)

    Grenier, E; Gehin, C; McAdams, E; Lun, B; Gobin, J-P; Uhl, J-F

    2016-03-01

    To study of the microcirculatory effects of elastic compression stockings. In phlebology, laser Doppler techniques (flux or imaging) are widely used to investigate cutaneous microcirculation. It is a method used to explore microcirculation by detecting blood flow in skin capillaries. Flux and imaging instruments evaluate, non-invasively in real-time, the perfusion of cutaneous micro vessels. Such tools, well known by the vascular community, are not really suitable to our protocol which requires evaluation through the elastic compression stockings fabric. Therefore, we involve another instrument, called the Hematron (developed by Insa-Lyon, Biomedical Sensor Group, Nanotechnologies Institute of Lyon), to investigate the relationship between skin microcirculatory activities and external compression provided by elastic compression stockings. The Hematron measurement principle is based on the monitoring of the skin's thermal conductivity. This clinical study examined a group of 30 female subjects, aged 42 years ±2 years, who suffer from minor symptoms of chronic venous disease, classified as C0s, and C1s (CEAP). The resulting figures show, subsequent to the pressure exerted by elastic compression stockings, an improvement of microcirculatory activities observed in 83% of the subjects, and a decreased effect was detected in the remaining 17%. Among the total population, the global average increase of the skin's microcirculatory activities is evaluated at 7.63% ± 1.80% (p compression stockings has a direct influence on the skin's microcirculation within this female sample group having minor chronic venous insufficiency signs. Further investigations are required for a deeper understanding of the elastic compression stockings effects on the microcirculatory activity in venous diseases at other stages of pathology. © The Author(s) 2014.

  1. Attachment and conduct disorder: The Response Programme.

    OpenAIRE

    Holland, R.; Moretti, M. M.; Verlaan, V.; Peterson, S.

    1993-01-01

    An increasing number of youths are being identified as suffering from behavioral problems that cause difficulties in their family and peer relations, which in turn reduce their chances of academic and vocational success. The common diagnosis given to these disaffiliated youths is conduct disorder. A community-oriented program designed to ensure long-term care for these youths is described. The program is designed to focus members of the youth's environment on the attachment and affiliation is...

  2. Response of pig skin to fractionated radiation doses

    International Nuclear Information System (INIS)

    Wiernik, G.; Hopewell, J.W.; Patterson, T.J.S.; Young, C.M.A.; Foster, J.L.

    1977-01-01

    The individual components of a fractionated course of irradiation treatment have been considered separately. Methods of accurate measurement of individual parameters has brought to light different interpretations of the observations. Reasons are given for the necessity of having a radiobiological model which has a direct relevance to the clinical situation. Results are reported for fractionated regimes of irradiation in which the dose has been varied above and below normal tissue tolerance which has been equated with clinical skin necrosis. The components of the acute skin reaction, erythema, pigmentation and desquamation have been analysed separately and their contribution as a method of measurement assessed. Initially, the range of numerical scores attributed to erythema did not reach the scores attributed to necrosis but we now believe that radiation damage expressed as erythema can move directly into necrosis without passing through desquamation. Desquamation, on the other hand, only became a useful parameter at higher dose levels; it has also been shown to be a component associated with skin breakdown. Pigmentation showed no dose response at the dose levels employed in our experiments and it is our belief that this is due to this system being fully saturated under these circumstances. Measurement of the late radiation reaction in the skin has been considered in detail and our results have been expressed by comparing the relative lengths of irradiated and control fields in the same pig. From these findings iso-effect graphs have been constructed and time and fractionation factors have been derived. (author)

  3. Influence of chemical peeling on the skin stress response system.

    Science.gov (United States)

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2012-07-01

    Skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC)-derived peptides, such as adrenocorticotropic hormone (ACTH), a-melanocyte-stimulating hormone (MSH) and b-endorphin that are locally generated in response to locally provided stressors or proinflammatory cytokines. This system would restrict tissue damage and restore local homoeostasis. Trichloroacetic acid (TCA) is one of the most widely used peeling agents and applied for cosmetic treatment of photodamaged skin. However, the biological mechanism responsible for TCA peeling has yet to be fully determined. While our investigation focused on the inflammation and wound healing pathways, in the recent study, we have examined involvement of the SSRS as the third pathway. Mostly depending on our findings that TCA peeling activates the SSRS by inducing the POMC expression of keratinocytes in the CRH-independent manner, together with the results reported by other researchers, we can say that the biological effect of POMC seems to be responsible for the TCA-induced epidermal SSRS activation. © 2012 John Wiley & Sons A/S.

  4. Response of Human Skin Equivalents to Sarcoptes scabiei

    Science.gov (United States)

    MORGAN, MARJORIE S.; ARLIAN, LARRY G.

    2010-01-01

    Studies have shown that molecules in an extract made from bodies of the ectoparasitic mite, Sarcoptes scabiei De Geer, modulate cytokine secretion from cultured human keratinocytes and fibroblasts. In vivo, in the parasitized skin, these cells interact with each other by contact and cytokine mediators and with the matrix in which they reside. Therefore, these cell types may function differently together than they do separately. In this study, we used a human skin equivalent (HSE) model to investigate the influence of cellular interactions between keratinocytes and fibroblasts when the cells were exposed to active/burrowing scabies mites, mite products, and mite extracts. The HSE consisted of an epidermis of stratified stratum corneum, living keratinocytes, and basal cells above a dermis of fibroblasts in a collagen matrix. HSEs were inoculated on the surface or in the culture medium, and their cytokine secretions on the skin surface and into the culture medium were determined by enzyme-linked immunosorbent assay. Active mites on the surface of the HSE induced secretion of cutaneous T cell-attracting chemokine, thymic stromal lymphopoietin, interleukin (IL)-1α, IL-1β, IL-1 receptor antagonist (IL-1ra), IL-6, IL-8, monocyte chemoattractant protein-1, granulocyte/macrophage colony-stimulating factor, and macrophage colony-stimulating factor. The main difference between HSEs and monocultured cells was that the HSEs produced the proinflammatory cytokines IL-1α and IL-1β and their competitive inhibitor IL-1ra, whereas very little of these mediators was previously found for cultured keratinocytes and fibroblasts. It is not clear how the balance between these cytokines influences the overall host response. However, IL-1ra may contribute to the depression of an early cutaneous inflammatory response to scabies in humans. These contrasting results illustrate that cell interactions are important in the host’s response to burrowing scabies mites. PMID:20939384

  5. A study on the frictional response of reptilian shed skin

    International Nuclear Information System (INIS)

    Abdel-Aal, H A; Vargiolu, R; Zahouani, H; Mansori, M El

    2011-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  6. A study on the frictional response of reptilian shed skin

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Aal, H A [Arts et Metier ParisTech, Rue Saint Dominique BP 508, 51006 Chalons-en-Champagne (France); Vargiolu, R; Zahouani, H [Laboratoire de Tribology et Dynamique des Systemes, UMR CNRS 5513, ENI Saint Etienne - Ecole Centrale de Lyon -36 Avenue Guy de Collongue, 69131 Ecully cedex. France (France); Mansori, M El, E-mail: Hisham.abdel-aal@ensam.eu [Ecole Nationale Superieure d' Arts et Metiers, 2, cours des Arts et Metiers - 13617 Aix en Provence cedex 1 (France)

    2011-08-19

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  7. Does transcutaneous nerve stimulation have effect on sympathetic skin response?

    Science.gov (United States)

    Okuyucu, E Esra; Turhanoğlu, Ayşe Dicle; Guntel, Murat; Yılmazer, Serkan; Savaş, Nazan; Mansuroğlu, Ayhan

    2018-01-01

    This study examined the effects of transcutaneous electrical nerve stimulation (TENS) on the sympathetic nerve system by sympathetic skin response test. Fifty-five healthy volunteers received either: (i) 30minutes TENS (25 participants) (ii) 30minutes sham TENS (30 participants) and SSR test was performed pre- and post-TENS. The mean values of latency and peak-to-peak amplitude of five consecutive SSRs were calculated. A significant amplitude difference was found between TENS and sham TENS group both in right and left hand (p=0.04, p=0.01, respectively). However there was no significant latancy difference between two groups (p>0.05 ). TENS has an inhibitory effect on elicited SNS responses when compared with sham TENS control group. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Miniature ambulatory skin conductance monitor and algorithm for investigating hot flash events

    Energy Technology Data Exchange (ETDEWEB)

    Bahr, Dennis E; Webster, John G; Shults, Mark [Department of Research and Development, Bahr Management, Inc., Middleton, WI 53562 (United States); Grady, Deborah; Creasman, Jennifer; Macer, Judy [Department of Medicine, University of California, San Francisco, CA 94115 (United States); Kronenberg, Fredi [School of Medicine, Stanford University, Palo Alto, CA 94305 (United States); Tyler, Mitchell; Zhou, Xin [Department of Biomedical Engineering, University of Wisconsin, Madison, WI 53706 (United States)

    2014-02-15

    A skin conductance monitoring system was developed and shown to reliably acquire and record hot flash events in both supervised laboratory and unsupervised ambulatory conditions. The 7.2 × 3.8 × 1.2 cm{sup 3} monitor consists of a disposable adhesive patch supporting two hydrogel electrodes and a reusable, miniaturized, enclosed electronic circuit board that snaps onto the electrodes. The monitor measures and records the skin conductance for seven days without external wires or telemetry and has an event marker that the subject can press whenever a hot flash is experienced. The accuracy of the system was demonstrated by comparing the number of hot flashes detected by algorithms developed during this research with the number identified by experts in hot flash studies. Three methods of detecting hot flash events were evaluated, but only two were fully developed. The two that were developed were an artificial neural network and a matched filter technique with multiple kernels implemented as a sliding form of the Pearson product-moment correlation coefficient. Both algorithms were trained on a ‘development’ cohort of 17 women and then validated using a second similar ‘validation’ cohort of 20. All subjects were between the ages of 40 and 60 and self-reported ten or more hot flashes per day over a three day period. The matched filter was the most accurate with a mean sensitivity of 0.92 and a mean specificity of 0.90 using the data from the development cohort and a mean sensitivity of 0.92 and a mean specificity of 0.87 using the data from the validation cohort. The matched filter was the method implemented in our processing software. (paper)

  9. Promoting responsible research conduct in a developing world ...

    African Journals Online (AJOL)

    As reports of research misconduct seem to increase, research integrity and the promotion of responsible research conduct are important for academic institutions. This paper considers what research integrity means for individual researchers and institutions, and explores trends for promoting responsible research conduct.

  10. Dramatic response to nivolumab in xeroderma pigmentosum skin tumor.

    Science.gov (United States)

    Chambon, Fanny; Osdoit, Sophie; Bagny, Kelly; Moro, Anne; Nguyen, Jacqueline; Réguerre, Yves

    2018-02-01

    We report the case of a 6-year-old female with xeroderma pigmentosum (XP) who developed a nonoperable scalp tumor, treated with anti-programmed cell death protein 1 (anti-PD-1) therapy (nivolumab). She presented with a sarcomatoid carcinoma of the scalp with bone lysis as well as vascular and meningeal contact. Nivolumab was initiated because it has emerged as a promising immunotherapy. We observed a dramatic tumor response with excellent tolerance. However, while on nivolumab therapy she developed two large skin melanomas and several squamous cell carcinomas, which have been resected. These results demonstrate that cancer immunotherapy in patients with XP can be impressive but complex and warrants further investigation. © 2017 Wiley Periodicals, Inc.

  11. The tell-tale: what do heart rate; skin temperature and skin conductance reveal about emotions of people with severe and profound intellectual disabilities?

    Science.gov (United States)

    Vos, Pieter; De Cock, Paul; Munde, Vera; Petry, Katja; Van Den Noortgate, Wim; Maes, Bea

    2012-01-01

    Identifying emotions in people with severe and profound intellectual disabilities is a difficult challenge. Since self-reports are not available, behaviour is the most used source of information. Given the limitations and caveats associated with using behaviour as the sole source of information about their emotions, it is important to supplement behavioural information with information from another source. As it is accepted that emotions consist of language, behaviour and physiology, in this article we investigated if physiology could give information about the emotions of people with severe and profound intellectual disabilities. To this aim we tested hypotheses derived from the motivational model of Bradley, Codispoti, Cuthbert, and Lang (2001) about the relation between heart rate and the valence of emotions and between heart rate, skin conductance and skin temperature and behavioural expressions of emotions of people with severe and profound intellectual disability. We presented 27 participants with 4 staff-selected negative and 4 staff-selected positive stimuli. The situations were videotaped and their heart rate, skin conductance and skin temperature was measured. Each behaviour of the participant was coded using the observational method developed by Petry and Maes (2006). As hypothesized, we found a lower heart rate when participants were presented with negative stimuli than when they were presented with positive stimuli in the first 6s of stimuli presentation. Their skin temperature was higher for the expression of low intensity negative emotions compared to the expression of low intensity positive emotions. The results suggest that, as with people without disability, heart rate and skin temperature can give information about the emotions of persons with severe and profound ID. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. The choice of sensitive skin layer responsible for aftereffects of daily irradiation of the skin

    International Nuclear Information System (INIS)

    Keirim-Markus, I.B.

    1992-01-01

    The choice of sensitive human skin layer manifesting in delayed period after daily irradiation of the human skin (stochastic and determined effects) was evaluated. It was established that delayed aftereffects of daily radiation of the skin manifested as epidem damages. This layer of papilla derma of 10-15 mg/cm 2 thick situated at the great part of body surface, 15 mg/cm 2 on dorsal side of hands and 40 mg/cm 2 on palms and pillows of the fingers. Sensitive layer of skin dosimeter for a control of daily irradiation of people must have the same geometry

  13. Skin examination behavior: the role of melanoma history, skin type, psychosocial factors, and region of residence in determining clinical and self-conducted skin examination.

    Science.gov (United States)

    Kasparian, Nadine A; Bränström, Richard; Chang, Yu-mei; Affleck, Paul; Aspinwall, Lisa G; Tibben, Aad; Azizi, Esther; Baron-Epel, Orna; Battistuzzi, Linda; Bruno, William; Chan, May; Cuellar, Francisco; Debniak, Tadeusz; Pjanova, Dace; Ertmanski, Slawomir; Figl, Adina; Gonzalez, Melinda; Hayward, Nicholas K; Hocevar, Marko; Kanetsky, Peter A; Leachman, Sancy; Bergman, Wilma; Heisele, Olita; Palmer, Jane; Peric, Barbara; Puig, Susana; Schadendorf, Dirk; Gruis, Nelleke A; Newton-Bishop, Julia; Brandberg, Yvonne

    2012-10-01

    To examine the frequency and correlates of skin examination behaviors in an international sample of individuals at varying risk of developing melanoma. A cross-sectional, web-based survey. Data were collected from the general population over a 20-month period on behalf of the Melanoma Genetics Consortium (GenoMEL). A total of 8178 adults from Northern (32%), Central (33%), and Southern (14%) Europe, Australia (13%), and the United States (8%). Self-reported frequency of skin self-examination (SSE) and clinical skin examination (CSE). After adjustment for age and sex, frequency of skin examination was higher in both Australia (odds ratio [OR]SSE=1.80 [99% CI, 1.49-2.18]; ORCSE=2.68 [99% CI, 2.23-3.23]) and the United States (ORSSE=2.28 [99% CI, 1.76-2.94]; ORCSE=3.39 [99% CI, 2.60-4.18]) than in the 3 European regions combined. Within Europe, participants from Southern Europe reported higher rates of SSE than those in Northern Europe (ORSSE=1.61 [99% CI, 1.31-1.97]), and frequency of CSE was higher in both Central (ORCSE=1.47 [99% CI, 1.22-1.78]) and Southern Europe (ORCSE=3.46 [99% CI, 2.78, 4.31]) than in Northern Europe. Skin examination behavior also varied according to melanoma history: participants with no history of melanoma reported the lowest levels of skin examination, while participants with a previous melanoma diagnosis reported the highest levels. After adjustment for region, and taking into account the role of age, sex, skin type, and mole count, engagement in SSE and CSE was associated with a range of psychosocial factors, including perceived risk of developing melanoma; perceived benefits of, and barriers to, skin examination; perceived confidence in one's ability to engage in screening; and social norms. In addition, among those with no history of melanoma, higher cancer-related worry was associated with greater frequency of SSE. Given the strong association between psychosocial factors and skin examination behaviors, particularly among people with

  14. Skin conductance at baseline and postheel lance reflects sympathetic activation in neonatal opiate withdrawal.

    Science.gov (United States)

    Oji-Mmuo, Christiana N; Michael, Eric J; McLatchy, Jacqueline; Lewis, Mary M; Becker, Julie E; Doheny, Kim Kopenhaver

    2016-03-01

    Skin conductance (SC) provides an objective measure of autonomic system regulation through sympathetic-mediated filling of sweat glands. This study aimed to test the utility of SC to detect sympathetic activation in neonatal abstinence syndrome (NAS). Fourteen term (mean, SE: 38.8 ± 0.35 weeks gestational age) neonates with chronic prenatal opiate exposure were enrolled. SC (peaks/seconds and mean of peaks) was measured at baseline, during heel lance/squeeze (HLS) and recovery from HLS at 24-48 (mean 38) hours of life prior to treatment for NAS. Blinded coders with established reliability assessed neonates using the Modified Finnegan Neonatal Scoring System (MFNSS). Nonparametric tests were used to determine group differences, phase differences from baseline to HLS and HLS to recovery, and associations between MFNSS and SC measures. Neonates that would later require morphine treatment for NAS (n = 6) had higher baseline SC mean of peaks than those that did not require treatment (n = 8) (p < 0.05). Moreover, there were unique phase differences between groups and SC positively correlated with MFNSS (p < 0.05). SC provides early identification of NAS severity. However, a larger sample is needed to determine sensitivity and specificity of SC for early identification of NAS and treatment effectiveness. ©2015 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  15. Contributions of Observed Parent Socialization of Coping and Skin Conductance Level Reactivity to Childhood Adjustment.

    Science.gov (United States)

    Stanger, Sarah; Abaied, Jamie; Wagner, Caitlin; Sanders, Wesley

    2018-03-01

    This research examined the longitudinal association between parent socialization of coping and child adjustment, as well as the moderating role of children's skin conductance level reactivity (SCLR). Participants were a community sample of children (n = 64, M age = 9.02, 54.5% females, 93.2% Caucasian) and their parent(s). Parent coping suggestions were observed while their child engaged in a stressful challenge task, during which the child's SCLR, a measure of children's physiological reactivity to stress, was also measured. Parent(s) completed the Child Behavior Checklist (Achenbach & Rescorla, 2001) at baseline and a 6-month follow-up to assess internalizing and externalizing problems. Results revealed that secondary control engagement suggestions predicted fewer internalizing problems over time. In addition, disengagement suggestions predicted fewer externalizing problems over time among children with high SCLR. This study provides evidence that parent coping suggestions serve as a resource that protects youth from developing adjustment problems. © 2016 Family Process Institute.

  16. Sweating under pressure: skin conductance level reactivity moderates the association between peer victimization and externalizing behavior.

    Science.gov (United States)

    Gregson, Kim D; Tu, Kelly M; Erath, Stephen A

    2014-01-01

    This study examined whether the association between peer victimization and externalizing behavior may be illuminated by individual differences in skin conductance level reactivity (SCLR) in the context of peer stress. Participants included 123 fifth and sixth graders (Mean age = 12.03 years, 50% females; 42% ethnic minorities). SCLR was assessed in the context of an ecologically relevant, lab-based peer-evaluative stress experience in preadolescence. As hypothesized, self-reported peer victimization was linked with parent- and teacher-reported externalizing behavior, and SCLR consistently moderated these associations. Peer victimization was associated with parent- and teacher-reported externalizing behavior among preadolescents who exhibited lower SCLR, but not among preadolescents who exhibited higher SCLR. Results suggest that promoting engagement with peer stress experiences and enhancing inhibitory control are potential intervention targets that may reduce externalizing behavior in the context of peer victimization (or reduce peer victimization among preadolescents who exhibit externalizing behavior). © 2013 The Authors. Journal of Child Psychology and Psychiatry © 2013 Association for Child and Adolescent Mental Health.

  17. Symptomatic Response to Divalproex in Subtypes of Conduct Disorder

    Science.gov (United States)

    Padhy, Ranjit; Saxena, Kirti; Remsing, Lisa; Huemer, Julia; Plattner, Belinda; Steiner, Hans

    2011-01-01

    To investigate response to Divalproex sodium (DVPX) with respect to Reactive/Affective/Defensive/Impulsive (RADI) and Proactive/Instrumental/Premeditated (PIP) aggression among adolescent males with conduct disorder (CD), using results from a randomized, double-blind, placebo-controlled trial. It was hypothesized that DVPX response among…

  18. Readability of informed consent forms in clinical trials conducted in a skin research center

    Science.gov (United States)

    Samadi, Aniseh; Asghari, Fariba

    2016-01-01

    Obtaining informed consents is one of the most fundamental principles in conducting a clinical trial. In order for the consent to be informed, the patient must receive and comprehend the information appropriately. Complexity of the consent form is a common problem that has been shown to be a major barrier to comprehension for many patients. The objective of this study was to assess the readability of different templates of informed consent forms (ICFs) used in clinical trials in the Center for Research and Training in Skin Diseases and Leprosy (CRTSDL), Tehran, Iran. This study was conducted on ICFs of 45 clinical trials of the CRTSDL affiliated with Tehran University of Medical Sciences. ICFs were tested for reading difficulty, using the readability assessments formula adjusted for the Persian language including the Flesch–Kincaid reading ease score, Flesch–Kincaid grade level, and Gunning fog index. Mean readability score of the whole text of ICFs as well as their 7 main information parts were calculated. The mean ± SD Flesch Reading Ease score for all ICFs was 31.96 ± 5.62 that is in the difficult range. The mean ± SD grade level was calculated as 10.71 ± 1.8 (8.23–14.09) using the Flesch–Kincaid formula and 14.64 ± 1.22 (12.67–18.27) using the Gunning fog index. These results indicate that the text is expected to be understandable for an average student in the 11th grade, while the ethics committee recommend grade level 8 as the standard readability level for ICFs. The results showed that the readability scores of ICFs assessed in our study were not in the acceptable range. This means they were too complex to be understood by the general population. Ethics committees must examine the simplicity and readability of ICFs used in clinical trials. PMID:27471590

  19. Calibration of thermoluminescence skin dosemeter response to beta emitters found in Ontario Hydro nuclear power stations

    International Nuclear Information System (INIS)

    Walsh, M.L.; Agnew, D.A.; Donnelly, K.E.

    1984-01-01

    The response of the Ontario Hydro Thermoluminescence Dosimetry System to beta radiation in nuclear power station environments was evaluated. Synthetic beta spectra were constructed, based on activity samples from heat transport systems and fuelling machine contamination smears at nuclear power stations. Using these spectra and dosemeter energy response functions, an overall response factor for the skin dosemeter relative to skin dose at 7 mg.cm -2 was calculated. This calculation was done assuming three specific geometries: (1) an infinite uniformly contaminated plane source at a distance of 33 cm (50 mg.cm -2 total shielding) from the receptor; (2) an infinite cloud surrounding the receptor; (3) a point source at 33 cm. Based on these calculations, a conservative response factor of 0.7 has been chosen. This provides an equation for skin dose assignment, i.e. Skin Dose = 1.4 x Skin Dosemeter Reading when the skin dosemeter is directly calibrated in mGy(gamma). (author)

  20. Skin Blood Perfusion and Cellular Response to Insertion of Insulin Pen Needles With Different Diameters

    DEFF Research Database (Denmark)

    Præstmark, Kezia Ann; Stallknecht, Bente Merete; Bo Jensen, Casper

    2014-01-01

    skin blood perfusion response around needle insertion sites. Three common sized pen needles of 28G, 30G, and 32G as well as hooked 32G needles, were inserted into the neck skin of pigs and then removed. Laser Speckle Contrast Analysis was used to measure skin blood perfusion for 20 minutes after...... blood perfusion recording and grouped according to needle type, skin blood perfusion response relates to needle diameter. The response was significantly higher after insertions with 28G and hooked 32G needles than with 30G (P ..., but there was a trend of an increased response with increasing needle diameter. Skin blood perfusion response to pen needle insertions rank according to needle diameter, and the tissue response caused by hooked 32G needles corresponds to that of 28G needles. The relation between needle diameter and trauma when...

  1. Appreciating the image of God in all humanity: Towards a pastoral response to skin lightening as image enhancement to exit dark skin

    Directory of Open Access Journals (Sweden)

    Noah K. Tenai

    2016-05-01

    Full Text Available The practice of skin lightening is prevalent amongst dark-skinned people globally. Various current studies that map this practice and that seek motivations behind the practice are examined. It is observed that through shrewd marketing, dark-skinned people are offered a promise of a better quality of life, obtained by a lighter skin, through the use of skin lighteners. In spite of the severe health risks involved, the promise is ostensibly irresistible to some dark-skinned persons. A pastoral response is offered that affirms the full personhood and complete humanity of dark-skinned people as fully human and whole in their dark skins. Keywords: Skin lightening, Dark skin, Image of God

  2. Combined esophageal intraluminal impedance, pH and skin conductance monitoring to detect discomfort in GERD infants.

    Directory of Open Access Journals (Sweden)

    Francesco Cresi

    Full Text Available BACKGROUND: The clinical significance of weakly acidic reflux in infants is unclear. Skin conductance is a novel not-invasive method to evaluate discomfort. The aim of our study was to evaluate reflux-induced discomfort in infants with gastroesophageal reflux disease using simultaneously combined skin conductance and esophageal multichannel intraluminal impedance and pH monitoring. METHODOLOGY/PRINCIPAL FINDINGS: Infants with gastroesophageal reflux symptoms were investigated for almost 20 hours divided into 120-second intervals. Temporal relationships between refluxes and discomfort were evaluated calculating the symptom association probability. Twelve infants aged 17-45 days were studied. Out of 194.38 hours of adequate artifact-free MII/pH and skin conductance monitoring, 584 reflux events were observed; 35.78% were positive for stress, of which 16.27% were acid and 83.73% weakly acidic. A significant association between refluxes and discomfort (p<0.05 was present in all infants. The intervals with reflux events showed increased skin conductance values compared to reflux-free intervals (p<0.001; SC values were similar for acid and weakly acidic reflux events. CONCLUSION/SIGNFICANCE: Discomfort was significantly associated with reflux events and did not differ between weakly acidic and acid refluxes. Our results may raise concerns about the over-prescription use of antacid drugs in the management of gastroesophageal reflux symptoms in infancy.

  3. Dose-response relationships and threshold levels in skin and respiratory allergy

    NARCIS (Netherlands)

    Arts, J.H.E.; Mommers, C.; Heer, C.de

    2006-01-01

    A literature study was performed to evaluate dose-response relationships and no-effect levels for sensitization and elicitation in skin- and respiratory allergy. With respect to the skin, dose-response relationships and no-effect levels were found for both intradermal and topical induction, as well

  4. Construction, in vitro and in vivo evaluation of an in-house conductance meter for measurement of skin hydration.

    Science.gov (United States)

    Hamed, Saja H; Altrabsheh, Bilal; Assa'd, Tareq; Jaradat, Said; Alshra'ah, Mohammad; Aljamal, Abdulfattah; Alkhatib, Hatim S; Almalty, Abdul-Majeed

    2012-12-01

    Different probes are used in dermato-cosmetic research to measure the electrical properties of the skin. The principle governing the choice of the geometry and material of the measuring probe is not well defined in the literature and some device's measuring principles are not accessible for the scientific community. The purpose of this work was to develop a simple inexpensive conductance meter for the objective in vivo evaluation of skin hydration. The conductance meter probe was designed using the basic equation governing wave propagation along Transverse Electromagnetic transmission lines. It consisted of two concentric copper circular electrodes printed on FR4 dielectric material. The performance of the probe was validated by evaluating its measurement depth, its ability to monitor in vitro water sorption-desorption and in vivo skin hydration effect in comparison to that of the Corneometer CM 825. The measurement depth of the probe, 15 μm, was comparable to that of CM 825. The in vitro readings of the probe correlated strongly with the amount of water adsorbed on filter paper. Skin hydration after application of a moisturizer was monitored effectively by the new probe with good correlation to the results of CM 825. In conclusion, a simple probe for evaluating skin hydration was made from off-the-shelf materials and its performance was validated in comparison to a commercially available probe. Copyright © 2012 IPEM. Published by Elsevier Ltd. All rights reserved.

  5. Histamine response and local cooling in the human skin: involvement of H1- and H2-receptors.

    Science.gov (United States)

    Grossmann, M; Jamieson, M J; Kirch, W

    1999-08-01

    Histamine may contribute locally to cutaneous blood flow control under normal and pathologic conditions. The objective of this study was to observe the influence of skin temperature on histamine vasodilation, and the roles of H1-and H2-receptors using novel noninvasive methods. Eleven healthy subjects received, double-blind, single doses of the H1-receptor antagonist cetirizine (10 mg), cetirizine (10 mg) plus the H2-receptor antagonist cimetidine (400 mg), or placebo on separate occasions. Histamine was dosed cumulatively by iontophoresis to the forearm skin at 34 degrees C and 14 degrees C. Laser-Doppler flux (LDF) was measured at the same sites using customised probeholder/iontophoretic chambers with Peltier cooling elements. Finger mean arterial pressure (MAP) was measured and cutaneous vascular conductance calculated as LDF/MAP. Histamine vasodilation was reduced in cold skin. Cetirizine shifted the histamine dose-response at both temperatures: statistically significantly at 14 degrees C only. Combined H1- and H2-receptor antagonism shifted the response significantly at both temperatures. H1- and H2-receptors mediate histamine-induced skin vasodilation. The sensitivity of these receptors, particularly the H1- receptor, is attenuated at low skin temperature. Whether the reduced effect in cold skin represents specific receptor or postreceptor desensitization, or nonspecific attenuation of cutaneous vasodilation remains to be elucidated.

  6. Dielectric response and ac conductivity analysis of hafnium oxide nanopowder

    International Nuclear Information System (INIS)

    Karahaliou, P K; Xanthopoulos, N; Krontiras, C A; Georga, S N

    2012-01-01

    The dielectric response of hafnium oxide nanopowder was studied in the frequency range of 10 -2 -10 6 MHz and in the temperature range of 20-180 °C. Broadband dielectric spectroscopy was applied and the experimental results were analyzed and discussed using the electric modulus (M*) and alternating current (ac) conductivity formalisms. The analyses of the dc conductivity and electric modulus data revealed the presence of mechanisms which are thermally activated, both with almost the same activation energy of 1.01 eV. A fitting procedure involving the superposition of the thermally activated dc conductivity, the universal dielectric responce and the near constant loss terms has been used to describe the frequency evolution of the real part of the specific electrical conductivity. The conductivity master curve was obtained, suggesting that the time-temperature superposition principle applies for the studied system, thus implying that the conductivity mechanisms are temperature independent.

  7. Attachment-security prime effect on skin-conductance synchronization in psychotherapists: An empirical study.

    Science.gov (United States)

    Palmieri, Arianna; Kleinbub, Johann R; Calvo, Vincenzo; Benelli, Enrico; Messina, Irene; Sambin, Marco; Voci, Alberto

    2018-03-01

    Physiological synchronization (PS) is a phenomenon of simultaneous activity between two persons' physiological signals. It has been associated with empathy, shared affectivity, and efficacious therapeutic relationships. The aim of the present study was to explore the possible connections between PS and the attachment system, seeking preliminary evidence of this link by means of an experimental manipulation of the sense of attachment security in psychotherapists according to a protocol by Mikulincer and Shaver (2001), which has been proven to elicit empathetic behavior. We compared the synchronization of skin-conductance signals in brief psychological interviews between 18 psychodynamic therapists and 18 healthy volunteers. A sense of attachment-security priming was administered to half of the therapists, whereas the other half received a positive-affect control prime. Lag analysis was performed to investigate the "leading" or "following" attitudes of the participants in the two conditions. Mixed-model regressions and evidence-ratio model comparisons were used to investigate the effects of the manipulation on PS. Therapist attachment anxiety and avoidance traits were considered covariates. The attachment-security prime showed a significant effect on PS lag dynamics, but not on overall PS amount. Lag analysis showed that the therapists in the attachment-security condition were significantly more prone to assume a leading attitude in the physiological coupling than the therapists in the control condition. Therapist attachment anxiety and avoidance had no apparent effect. Our result paves the way for further exploration of the clinical relationship from a physiological standpoint. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  8. Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.

    Science.gov (United States)

    Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T

    1999-04-01

    The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.

  9. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  10. Relational victimization and proactive versus reactive relational aggression: The moderating effects of respiratory sinus arrhythmia and skin conductance.

    Science.gov (United States)

    Wagner, Caitlin R; Abaied, Jamie L

    2015-01-01

    This research examined the moderating effect of the autonomic nervous system (ANS) on the associations between relational victimization and reactive and proactive relational aggression. Both branches of the ANS, the parasympathetic nervous system (indexed by respiratory sinus arrhythmia reactivity; RSA-Reactivity) and the sympathetic nervous system (indexed by skin conductance level reactivity; SCL-Reactivity), were examined. Emerging adults (N = 168) self-reported on relational victimization and proactive and reactive relational aggression; RSA-Reactivity and SCL-Reactivity were assessed in response to a laboratory stressor. Relational victimization predicted heightened reactive relational aggression given RSA augmentation/high SCL-Reactivity (i.e., coactivation) and RSA withdrawal/low SCL-Reactivity (i.e., coinhibition). In addition, relational victimization predicted heightened reactive relational aggression given RSA augmentation/low SCL-Reactivity (i.e., reciprocal parasympathetic activation). This study extends previous research on relational victimization and provides novel evidence that (a) exposure to relational victimization is associated with reactive relational aggression, but not proactive relational aggression, and (b) parasympathetic and sympathetic nervous system reactivity jointly moderate the link between relational victimization and reactive relational aggression. © 2015 Wiley Periodicals, Inc.

  11. Skin Conductance Level Reactivity Moderates the Association Between Parental Psychological Control and Relational Aggression in Emerging Adulthood.

    Science.gov (United States)

    Wagner, Caitlin R; Abaied, Jamie L

    2016-04-01

    When studying factors that may heighten risk for relational aggression in youth, it is important to consider characteristics of both the individual and their environment. This research examined the associations between parental psychological control and reactive and proactive relational aggression in emerging adults in college. Given that sympathetic nervous system (SNS) activation may underlie differences between reactive and proactive aggression and has been shown to moderate the effects of parenting on youth development, the moderating role of SNS reactivity [indexed by skin conductance level reactivity (SCLR)] was also examined. Emerging adults (N = 180; 77.2 % female) self-reported on perceptions of parental psychological control and reactive and proactive relational aggression. SCLR was assessed in response to an interpersonal laboratory challenge task. Parental psychological control was positively associated with reactive relational aggression only for emerging adults who exhibited high SCLR. Parental psychological control was positively associated with proactive relational aggression only among emerging adults who showed low SCLR. This study extends previous research on parenting and aggression and suggests that parental psychological control is differentially associated with reactive versus proactive relational aggression, depending on emerging adults' SCLR to interpersonal stress.

  12. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection

    Science.gov (United States)

    Leal, Esther; Granja, Aitor G.; Zarza, Carlos; Tafalla, Carolina

    2016-01-01

    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3+ T cells and flow cytometry analysis confirmed that the percentage of CD8+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  13. Facial skin blood flow responses during exposures to emotionally charged movies.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Ishii, Kei; Ito, Momoka; Liang, Nan

    2018-03-01

    The changes in regional facial skin blood flow and vascular conductance have been assessed for the first time with noninvasive two-dimensional laser speckle flowmetry during audiovisually elicited emotional challenges for 2 min (comedy, landscape, and horror movie) in 12 subjects. Limb skin blood flow and vascular conductance and systemic cardiovascular variables were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by the subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Facial skin blood flow and vascular conductance, especially in the lips, decreased during viewing of comedy and horror movies, whereas they did not change during viewing of a landscape movie. The decreases in facial skin blood flow and vascular conductance were the greatest with the comedy movie. The changes in lip, cheek, and chin skin blood flow negatively correlated (P < 0.05) with the subjective ratings of pleasantness and consciousness. The changes in lip skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of pleasantness, while the changes in infraorbital, subnasal, and chin skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of consciousness. However, none of the changes in limb skin blood flow and vascular conductance and systemic hemodynamics correlated with the subjective ratings. The mental arithmetic task did not alter facial and limb skin blood flows, although the task influenced systemic cardiovascular variables. These findings suggest that the more emotional status becomes pleasant or conscious, the more neurally mediated vasoconstriction may occur in facial skin blood vessels.

  14. Characterization of the early local immune response to Ixodes ricinus tick bites in human skin.

    Science.gov (United States)

    Glatz, Martin; Means, Terry; Haas, Josef; Steere, Allen C; Müllegger, Robert R

    2017-03-01

    Little is known about the immunomodulation by tick saliva during a natural tick bite in human skin, the site of the tick-host interaction. We examined the expression of chemokines, cytokines and leucocyte markers on the mRNA levels and histopathologic changes in human skin biopsies of tick bites (n=37) compared to unaffected skin (n=9). Early tick-bite skin lesions (skin. With longer tick attachment (>24 hours), the numbers of innate immune cells and mediators (not significantly) declined, whereas the numbers of lymphocytes (not significantly) increased. Natural tick bites by Ixodes ricinus ticks initially elicit a strong local innate immune response in human skin. Beyond 24 hours of tick attachment, this response usually becomes less, perhaps because of immunomodulation by tick saliva. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Skin conductance biofeedback training in adults with drug-resistant temporal lobe epilepsy and stress-triggered seizures: a proof-of-concept study.

    Science.gov (United States)

    Micoulaud-Franchi, Jean-Arthur; Kotwas, Iliana; Lanteaume, Laura; Berthet, Christelle; Bastien, Mireille; Vion-Dury, Jean; McGonigal, Aileen; Bartolomei, Fabrice

    2014-12-01

    The present proof-of-concept study investigated the feasibility of skin conductance biofeedback training in reducing seizures in adults with drug-resistant temporal lobe epilepsy (TLE), whose seizures are triggered by stress. Skin conductance biofeedback aims to increase levels of peripheral sympathetic arousal in order to reduce cortical excitability. This might seem somewhat counterintuitive, since such autonomic arousal may also be associated with increased stress and anxiety. Thus, this sought to verify that patients with TLE and stress-triggered seizures are not worsened in terms of stress, anxiety, and negative emotional response to this nonpharmacological treatment. Eleven patients with drug-resistant TLE with seizures triggered by stress were treated with 12 sessions of biofeedback. Patients did not worsen on cognitive evaluation of attentional biases towards negative emotional stimuli (P>.05) or on psychometric evaluation with state anxiety inventory (P = .059); in addition, a significant improvement was found in the Negative Affect Schedule (P = .014) and in the Beck Depression Inventory (P = .009). Biofeedback training significantly reduced seizure frequency with a mean reduction of -48.61% (SD = 27.79) (P = .005). There was a correlation between the mean change in skin conductance activity over the biofeedback treatment and the reduction of seizure frequency (r(11) = .62, P = .042). Thus, the skin conductance biofeedback used in the present study, which teaches patients to achieve an increased level of peripheral sympathetic arousal, was a well-tolerated nonpharmacological treatment. Further, well-controlled studies are needed to confirm the therapeutic value of this nonpharmacological treatment in reducing seizures in adults with drug-resistant TLE with seizures triggered by stress. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Effect of infrared-C radiation on skin temperature, electrodermal conductance and pain in hemiparetic stroke patients.

    Science.gov (United States)

    Lin, Chun-Chih; Chiang, Yong-Shun; Lung, Chia-Chi

    2015-01-01

    A novel application of infrared-C (IR-C) radiation (3-1000 μm) on hemiparetic stroke patients was evaluated. Hot compresses (HC) were used on the paretic shoulders of patients in this placebo-controlled trial to investigate the effects of IR-C on skin temperature, electrodermal conductance (EC) and pain relief. Skin temperature at the center of the middle deltoid (CMD), Quchi (LI11), and the center of the third metacarpal bone on dorsum of hand (COT) of the subjects at Brunnstrom stage 3-5 before and after IR-C HC, were examined. Meanwhile, EC was measured on Hegu (LI4), Quchi and Juanyu (LI15). Pain intensity was evaluated before and after treatment. Skin temperature increased significantly at the CMD and COT on the paretic side in males. In females after treatment, similar skin temperatures were found in each measured region on both the paretic and non-paretic sides. The EC on the paretic side tended to be higher than the non-paretic side before treatment. After treatment, the EC on paretic side declined in both sexes and became even lower than the non-paretic side in females. Pain intensity was lessened after treatment especially in males, which appeared to correspond with an increase in skin temperature and a decrease in EC. IR-C hot compress is a promising method for stroke patients in rehabilitation. Physiological mechanisms of this treatment were proposed and summarized from this research.

  17. Responsible conduct by life scientists in an age of terrorism.

    Science.gov (United States)

    Atlas, Ronald M

    2009-09-01

    The potential for dual use of research in the life sciences to be misused for harm raises a range of problems for the scientific community and policy makers. Various legal and ethical strategies are being implemented to reduce the threat of the misuse of research and knowledge in the life sciences by establishing a culture of responsible conduct.

  18. Practical Guide to Conducting an Item Response Theory Analysis

    Science.gov (United States)

    Toland, Michael D.

    2014-01-01

    Item response theory (IRT) is a psychometric technique used in the development, evaluation, improvement, and scoring of multi-item scales. This pedagogical article provides the necessary information needed to understand how to conduct, interpret, and report results from two commonly used ordered polytomous IRT models (Samejima's graded…

  19. Effect of skin temperature on cutaneous vasodilator response to the β-adrenergic agonist isoproterenol

    OpenAIRE

    Hodges, Gary J.; Kellogg, Dean L.; Johnson, John M.

    2015-01-01

    The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography....

  20. Synthesis of Conductive Polymeric Nanocomposites for Applications in Responsive Materials

    Science.gov (United States)

    Chavez, Jessica

    The development of next generation "smart" textiles has emerged with significant interest due to the immense demand for high-performance wearable technology. The economic market for wearable technologies is predicted to increase significantly in both volume and value. In the next four years, the wearable technology market will be valued at $34 billion. This large demand has opened up a new research area involving smart wearable devices and conductive fabrics. Many research groups have taken various paths to study and ultimately fabricate wearable devices. Due to the limiting capabilities of conventional conductors, researchers have centered their research on the integration of conductive polymers into textile materials for applications involving responsive material. Conducive polymers are very unique organic molecules that have the ability to transfer electrons across their molecular structure due to the excess presence of pi-electrons. Conductive polymers are favored over conventional conductors because they can be easily manipulated and integrated into flexible material. Two very common conductive polymers are polyaniline (PANI) and polypyrrole (PPY) because of their large favorability in literature, high conductance values, and environmental stability. Common commercial fibers were coated via the chemical polymerization of PANI or PPY. A series of reactions were done to study the polymerization process of each polymer. The conductive efficiency of each conducting polymer is highly dependent on the type of reactants used, the acidic nature of the reaction, and the temperature of the reaction. The coated commercial fiber nanocomposites produced higher conductivity values when the polymerization reaction was run using ammonium peroxydisulfate (APS) as the oxidizing agent, run in an acidic environment, and run at very low temperatures. Other factors that improved the overall efficiency of the coated commercial fiber nanocomposites was the increase in polymer

  1. Cicatrização conduzida e enxerto de pele parcial no tratamento de feridas Conducted healing and skin graft for the treatment of skin wounds

    Directory of Open Access Journals (Sweden)

    Mauro Ivan Salgado

    2007-02-01

    Full Text Available OBJETIVO: Avaliar comparativamente os tratamentos para área cruenta da pele por meio de cicatrização conduzida (método original de cicatrização cutânea por segunda intenção e enxerto de pele autógena. MÉTODOS: Foram utilizados 17 coelhos, dos quais foram retirados dois segmentos de pele, um de cada lado do dorso. De um lado, a área doadora do enxerto permaneceu cruenta, para cicatrização conduzida (A. Do outro lado do dorso, a pele foi implantada como enxerto (B, para recobrir a área cruenta. Assim, cada animal tinha em seu dorso os dois tipos de tratamentos (A e B. Os coelhos foram distribuídos em dois grupos, de acordo com o tamanho das feridas provocadas em seu dorso: grupo 1 - A e B (4 cm² e grupo 2 - A e B (25 cm². Avaliou-se o tempo de cicatrização de ambos os tratamentos: grupo 1, após 19 dias, e grupo 2, após 35 dias. Os aspectos macro e microscópico finais da cicatrização foram analisados comparativamente nos quatro subgrupos. À histologia, avaliaram-se o número e a espessura de estratos da epiderme, a presença de células inflamatórias, bem como de cistos epidérmicos e de células gigantes. O estudo estatístico usou os testes não paramétricos de Fischer, Kruskall-Wallis e Wilcoxon. RESULTADOS: Não se observou diferença macro ou microscópica entre a cicatrização conduzida e o enxerto de pele. CONCLUSÃO: A cicatrização conduzida parece ser uma boa opção terapêutica para áreas cruentas cutâneas em coelhos.OBJECTIVE: The present study compared the treatment of skin wounds by means of conducted healing (an innovative method for treatment of secondary healing and autogenous skin graft. METHODS: Seventeen rabbits were submitted to removal of two skin segments, one on each side of the dorsum. The graft donor area was left as a wound for conducted healing (A and was submitted only to debridement, local care and dressings. The skin removed from the above mentioned side was implanted as a graft (B to

  2. Rate dependency and role of nitric oxide in the vascular response to direct cooling in human skin.

    Science.gov (United States)

    Yamazaki, Fumio; Sone, Ryoko; Zhao, Kun; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2006-01-01

    Local cooling of nonglabrous skin without functional sympathetic nerves causes an initial vasodilation followed by vasoconstriction. To further characterize these responses to local cooling, we examined the importance of the rate of local cooling and the effect of nitric oxide synthase (NOS) inhibition in intact skin and in skin with vasoconstrictor function inhibited. Release of norepinephrine was blocked locally (iontophoresis) with bretylium tosylate (BT). Skin blood flow was monitored from the forearm by laser-Doppler flowmetry (LDF). Cutaneous vascular conductance (CVC) was calculated as the ratio of LDF to blood pressure. Local temperature was controlled over 6.3 cm2 around the sites of LDF measurement. Local cooling was applied at -0.33 or -4 degrees C/min. At -4 degrees C/min, CVC increased (P cooling (-4 degrees C/min) to 24 degrees C decreased (P cooling, CVC decreased at BT + saline sites relative to the precooling levels (P cooling, but not functional NOS, is an important determinant of the early non-adrenergic vasodilator response to local cooling and that functional NOS, adrenergic nerves, as well as other mechanisms play roles in vasoconstriction during prolonged local cooling of skin.

  3. Strongly anisotropic thermal conductivity and adequate breathability of bilayered films for heat management of on-skin electronics

    Science.gov (United States)

    Zhou, Tianle; Wei, Hao; Tan, Huaping; Wang, Xin; Zeng, Haibo; Liu, Xiaoheng; Nagao, Shijo; Koga, Hirotaka; Nogi, Masaya; Sugahara, Tohru; Suganuma, Katsuaki

    2018-07-01

    Thin-film wearable electronics are required to be directly laminated on to human skin for reliable, sensitive bio-sensing but with minimal irritation to the user after long-time use. Excellent heat management films with strongly anisotropic thermal conductivity (K) and adequate breathability are increasingly desirable for shielding the skin from heating while allowing the skin to breathe properly. Here, interfacial self-assembly of a graphene oxide (GO) film covering an ambient-dried bacterial cellulose aerogel (AD-BCA) film followed by laser reduction was proposed to prepare laser-reduced GO (L-rGO)/AD-BCA bilayered films. The AD-BCA substrate provides low cross-plane K (K ⊥  ≈  0.052 W mK‑1), high breathability, and high compressive and tensile resistance by ‘partially’ inheriting the pore structure from bacterial cellulose (BC) gel. The introduction of an upper L-rGO film, which is only 0.31 wt% content, dramatically increases the in-plane K (K // ) from 0.3 W mK‑1 in AD-BCA to 10.72 W mK‑1 owing to the highly in-plane oriented, continuous, uniform assembling geometry of the GO film; while K ⊥ decreases to a lower value of 0.033 W mK‑1, mainly owing to the air pockets between L-rGO multilayers caused by the laser reduction. The bilayered films achieve a K // /K ⊥ of 325, which is substantially larger even than that of graphite and similar polymer composites. They permit high transmission rates for water vapor (416.78 g/m2/day, >204 g/m2/day of normal skin) and O2 (449.35 cm3/m2/day). The combination of strongly anisotropic thermal conductivity and adequate breathability facilitates applications in heat management in on-skin electronics.

  4. Electromagnetic response of a conductor with complex conductivity

    Science.gov (United States)

    Leylekian, L.; Ocio, M.; Hammann, J.

    1993-02-01

    The aim of this paper is to describe the electromagnetic response of a conductor with complex conductivity. We will show how the geometry of the measuring apparatus can modify the amplitude of this response. We will particularly emphasize the role that plays a complex conductivity, as we can find in granular superconductors, on the mesured magnetic susceptibility of the sample. Cet article a pour but de décrire la réponse électromagnétique d'un conducteur muni d'une conductivité complexe. Nous montrerons comment la géométrie du dispositif de mesure peut modifier l'amplitude de cette réponse. Nous insisterons particulièrement sur le rôle que joue une conductivité complexe, comme nous pouvons en trouver dans les supraconducteurs granulaires, sur la susceptibilité magnétique mesurée de l'échantillon.

  5. Skin inspired fractal strain sensors using a copper nanowire and graphite microflake hybrid conductive network.

    Science.gov (United States)

    Jason, Naveen N; Wang, Stephen J; Bhanushali, Sushrut; Cheng, Wenlong

    2016-09-22

    This work demonstrates a facile "paint-on" approach to fabricate highly stretchable and highly sensitive strain sensors by combining one-dimensional copper nanowire networks with two-dimensional graphite microflakes. This paint-on approach allows for the fabrication of electronic skin (e-skin) patches which can directly replicate with high fidelity the human skin surface they are on, regardless of the topological complexity. This leads to high accuracy for detecting biometric signals for applications in personalised wearable sensors. The copper nanowires contribute to high stretchability and the graphite flakes offer high sensitivity, and their hybrid coating offers the advantages of both. To understand the topological effects on the sensing performance, we utilized fractal shaped elastomeric substrates and systematically compared their stretchability and sensitivity. We could achieve a high stretchability of up to 600% and a maximum gauge factor of 3000. Our simple yet efficient paint-on approach enabled facile fine-tuning of sensitivity/stretchability simply by adjusting ratios of 1D vs. 2D materials in the hybrid coating, and the topological structural designs. This capability leads to a wide range of biomedical sensors demonstrated here, including pulse sensors, prosthetic hands, and a wireless ankle motion sensor.

  6. p120-catenin mediates inflammatory responses in the skin

    DEFF Research Database (Denmark)

    Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

    2006-01-01

    but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

  7. Modeling slug tests in unconfined aquifers with both oscillatory and overdamped responses, and with low-K and high-K skin effects

    Science.gov (United States)

    Thoma, M. J.; Malama, B.; Barrash, W.; Bohling, G.; Butler, J. J.

    2009-12-01

    We extend the models for slug tests developed by Hyder et al. (1994) and Butler and Zhan (2004) to obtain a single general model for slug tests in unconfined aquifers in partially penetrating wells with a near-well disturbed zone (skin). The full range of responses, oscillatory to overdamped, is considered since both types of responses are common in wells in unconsolidated coarse fluvial aquifers, and others. The general semi-analytical solution allows for skin and formation storage as well as anisotropy in skin and formation hydraulic conductivity (K). The water table is treated as a fixed head boundary so the solution is applicable for wells screened below the water table. The model is validated by comparison with other models and by matching field data from unconfined fluvial aquifers at sites in Nebraska (MSEA) and Idaho (BHRS). We examine the effects of varying skin K and skin thickness to simulate the impact of a near-well disturbed zone that is lower (damage) or higher (filter pack) K than the formation. Results indicate that, for a given set of measured behavior at an example test zone, minor progressive decreases in estimated formation K occur with increases in assumed skin K, and moderate increases in estimated formation K occur with decreases in assumed skin K. Major increases (orders of magnitude) in estimated formation K occur with increased thickness of low-K skin. The importance of incorporating a finite-thickness representation of the skin, rather than the conventional infinitely thin representation, is also addressed.

  8. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin.

    Science.gov (United States)

    Spandau, Dan F; Lewis, Davina A; Somani, Ally-Khan; Travers, Jeffrey B

    2012-06-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylactic therapy. Geriatric volunteers were treated with fractionated laser resurfacing therapy on either sun-protected (upper buttocks) or chronically sun-exposed (dorsal forearm) skin. Fractionated laser resurfacing therapy was shown to decrease the occurrence of senescent fibroblasts in geriatric dermis, increase the dermal expression of IGF-1, and correct the inappropriate UVB response observed in untreated geriatric skin. These responses to fractionated laser resurfacing were equal to the effects seen previously using the more aggressive wounding following dermabrasion. Furthermore, fractionated laser resurfacing was equally effective in both sun-protected and sun-exposed skin. The ability of fractionated laser resurfacing treatment to protect against the occurrence of UVB-damaged proliferating keratinocytes indicates the potential of fractionated laser resurfacing to reduce or prevent aging-associated non-melanoma skin cancer.

  9. Skin response to cobalt 60 irradiation and the consequences for matching the color of facial prostheses

    International Nuclear Information System (INIS)

    van Oort, R.P.; Vermey, J.; Ten Bosch, J.J.

    1984-01-01

    A radiotherapy treatment ( 60 Co) of cancer in the head and neck region causes side effects in the skin that postpone the facial prosthetic treatment. The increasing and fading erythema and pigmentation of the skin was investigated with the use of a subtractive colorimeter. This method was verified with photographs scored according to the Oxford scoring system. Fourteen patients were investigated during a period of 24 weeks. The mean colorimetric skin response showed a peak 6 weeks after the onset of irradiation. Six to 7 weeks later, there was no significant difference between the skin color before and after irradiation. At this time the dry desquamation of the skin is healed. From this viewpoint, the color matching procedure for a facial prosthesis may start not earlier than 15 weeks from the onset of irradiation. If a nonirradiated control field in the facial region is present, a color match for the facial prosthesis can be started just after the irradiation period

  10. Pitch Syntax Violations Are Linked to Greater Skin Conductance Changes, Relative to Timbral Violations - The Predictive Role of the Reward System in Perspective of Cortico-subcortical Loops.

    Science.gov (United States)

    Gorzelańczyk, Edward J; Podlipniak, Piotr; Walecki, Piotr; Karpiński, Maciej; Tarnowska, Emilia

    2017-01-01

    According to contemporary opinion emotional reactions to syntactic violations are due to surprise as a result of the general mechanism of prediction. The classic view is that, the processing of musical syntax can be explained by activity of the cerebral cortex. However, some recent studies have indicated that subcortical brain structures, including those related to the processing of emotions, are also important during the processing of syntax. In order to check whether emotional reactions play a role in the processing of pitch syntax or are only the result of the general mechanism of prediction, the comparison of skin conductance levels reacting to three types of melodies were recorded. In this study, 28 subjects listened to three types of short melodies prepared in Musical Instrument Digital Interface Standard files (MIDI) - tonally correct, tonally violated (with one out-of-key - i.e., of high information content), and tonally correct but with one note played in a different timbre. The BioSemi ActiveTwo with two passive Nihon Kohden electrodes was used. Skin conductance levels were positively correlated with the presented stimuli (timbral changes and tonal violations). Although changes in skin conductance levels were also observed in response to the change in timbre, the reactions to tonal violations were significantly stronger. Therefore, despite the fact that timbral change is at least as equally unexpected as an out-of-key note, the processing of pitch syntax mainly generates increased activation of the sympathetic part of the autonomic nervous system. These results suggest that the cortico-subcortical loops (especially the anterior cingulate - limbic loop) may play an important role in the processing of musical syntax.

  11. Dermal damage promoted by repeated low-level UV-A1 exposure despite tanning response in human skin.

    Science.gov (United States)

    Wang, Frank; Smith, Noah R; Tran, Bao Anh Patrick; Kang, Sewon; Voorhees, John J; Fisher, Gary J

    2014-04-01

    Solar UV irradiation causes photoaging, characterized by fragmentation and reduced production of type I collagen fibrils that provide strength to skin. Exposure to UV-B irradiation (280-320 nm) causes these changes by inducing matrix metalloproteinase 1 and suppressing type I collagen synthesis. The role of UV-A irradiation (320-400 nm) in promoting similar molecular alterations is less clear yet important to consider because it is 10 to 100 times more abundant in natural sunlight than UV-B irradiation and penetrates deeper into the dermis than UV-B irradiation. Most (approximately 75%) of solar UV-A irradiation is composed of UV-A1 irradiation (340-400 nm), which is also the primary component of tanning beds. To evaluate the effects of low levels of UV-A1 irradiation, as might be encountered in daily life, on expression of matrix metalloproteinase 1 and type I procollagen (the precursor of type I collagen). In vivo biochemical analyses were conducted after UV-A1 irradiation of normal human skin at an academic referral center. Participants included 22 healthy individuals without skin disease. Skin pigmentation was measured by a color meter (chromometer) under the L* variable (luminescence), which ranges from 0 (black) to 100 (white). Gene expression in skin samples was assessed by real-time polymerase chain reaction. Lightly pigmented human skin (L* >65) was exposed up to 4 times (1 exposure/d) to UV-A1 irradiation at a low dose (20 J/cm2), mimicking UV-A levels from strong sun exposure lasting approximately 2 hours. A single exposure to low-dose UV-A1 irradiation darkened skin slightly and did not alter matrix metalloproteinase 1 or type I procollagen gene expression. With repeated low-dose UV-A1 irradiation, skin darkened incrementally with each exposure. Despite this darkening, 2 or more exposures to low-dose UV-A1 irradiation significantly induced matrix metalloproteinase 1 gene expression, which increased progressively with successive exposures. Repeated UV-A1

  12. The effect of surface wave propagation on neural responses to vibration in primate glabrous skin.

    Directory of Open Access Journals (Sweden)

    Louise R Manfredi

    Full Text Available Because tactile perception relies on the response of large populations of receptors distributed across the skin, we seek to characterize how a mechanical deformation of the skin at one location affects the skin at another. To this end, we introduce a novel non-contact method to characterize the surface waves produced in the skin under a variety of stimulation conditions. Specifically, we deliver vibrations to the fingertip using a vibratory actuator and measure, using a laser Doppler vibrometer, the surface waves at different distances from the locus of stimulation. First, we show that a vibration applied to the fingertip travels at least the length of the finger and that the rate at which it decays is dependent on stimulus frequency. Furthermore, the resonant frequency of the skin matches the frequency at which a subpopulation of afferents, namely Pacinian afferents, is most sensitive. We show that this skin resonance can lead to a two-fold increase in the strength of the response of a simulated afferent population. Second, the rate at which vibrations propagate across the skin is dependent on the stimulus frequency and plateaus at 7 m/s. The resulting delay in neural activation across locations does not substantially blur the temporal patterning in simulated populations of afferents for frequencies less than 200 Hz, which has important implications about how vibratory frequency is encoded in the responses of somatosensory neurons. Third, we show that, despite the dependence of decay rate and propagation speed on frequency, the waveform of a complex vibration is well preserved as it travels across the skin. Our results suggest, then, that the propagation of surface waves promotes the encoding of spectrally complex vibrations as the entire neural population is exposed to essentially the same stimulus. We also discuss the implications of our results for biomechanical models of the skin.

  13. Pyroelectric response of perovskite heterostructures incorporating conductive oxide electrodes

    Science.gov (United States)

    Tipton, Charles Wesley, IV

    2000-10-01

    The use of imaging technologies has become pervasive in many applications as the demand for situational awareness information has increased over the last decade. No better example of the integration of these technologies can be found than that of infrared or thermal imaging. This dissertation, in the field of thermal imaging, has been motivated by the desire to advance the technology of uncooled, thin-film pyroelectric sensors and focuses on the materials and structures from which the detector elements will be built. This work provides a detailed study of the pyroelectric response of the La-Sr-Co-O/Pb-La-Zr-Ti-O/La-Sr-Co-O (LPL) structure. The LPL structure was chosen based on the needs of thin film detectors, the unique properties of the conductive oxide La-Sr-Co-O (LSCO), and the broad applicability of the Pb-La-Zr-Ti-O (PLZT) material system. Epitaxial heterostructures were grown by pulsed laser deposition on single-crystal oxide substrates. Using the oxygen pressure during cooling and heating of the LSCO layer as a key variable, we have been able to produce structures that have a pronounced internal field in the as-grown state. In these capacitors, where the bottom electrode has a large concentration of oxygen vacancies, we have discovered very large pyroelectric responses that are 10 to 30 times larger than expected of PLZT-based pyroelectric materials (typical values are 20 to 40 nCcm-2K -1). The enhanced pyroelectric responses are very repeatable, stable over time, and distinctly different from responses attributed to thermally stimulated currents. Detailed positron annihilation spectroscopy measurements reveal that there is indeed an oxygen concentration gradient across the capacitor. Based on the results of this study, I will present an analysis of the enhanced pyroelectric response. Although the enhanced response has been correlated with high concentrations of oxygen vacancies in the PLZT film and LSCO electrodes, the mechanism by which the large

  14. Aligning Objectives and Assessment in Responsible Conduct of Research Instruction

    Science.gov (United States)

    Antes, Alison L.; DuBois, James M.

    2014-01-01

    Efforts to advance research integrity in light of concerns about misbehavior in research rely heavily on education in the responsible conduct of research (RCR). However, there is limited evidence for the effectiveness of RCR instruction as a remedy. Assessment is essential in RCR education if the research community wishes to expend the effort of instructors, students, and trainees wisely. This article presents key considerations that instructors and course directors must consider in aligning learning objectives with instructional methods and assessment measures, and it provides illustrative examples. Above all, in order for RCR educators to assess outcomes more effectively, they must align assessment to their learning objectives and attend to the validity of the measures used. PMID:25574258

  15. Music through the Skin--Simple Demonstration of Human Electrical Conductivity

    Science.gov (United States)

    Vollmer, M.; Möllmann, K. P.

    2016-01-01

    The conduction of electricity is an important topic for any basic physics course. Issues of safety often results in teacher demonstration experiments in front of the class or in extremely simple though--for students--not really fascinating (not to say boring) hands on activities for everybody using 1.5 V batteries, cables and light bulbs etc. Here…

  16. Computer incident response and forensics team management conducting a successful incident response

    CERN Document Server

    Johnson, Leighton

    2013-01-01

    Computer Incident Response and Forensics Team Management provides security professionals with a complete handbook of computer incident response from the perspective of forensics team management. This unique approach teaches readers the concepts and principles they need to conduct a successful incident response investigation, ensuring that proven policies and procedures are established and followed by all team members. Leighton R. Johnson III describes the processes within an incident response event and shows the crucial importance of skillful forensics team management, including when and where the transition to forensics investigation should occur during an incident response event. The book also provides discussions of key incident response components. Provides readers with a complete handbook on computer incident response from the perspective of forensics team management Identify the key steps to completing a successful computer incident response investigation Defines the qualities necessary to become a succ...

  17. Proton magnetic resonance spectroscopy of the frontal, cingulate and perirolandic cortices and its relationship to skin conductance in patients with schizophrenia

    Energy Technology Data Exchange (ETDEWEB)

    Sanches, R.F.; Crippa, J.A.S.; Hallak, J.E.C.; Sousa, J.P.M. de; Zuardi, A.W. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP, (Brazil). Faculdade de Medicina. Dept. de Neurociencias e Ciencias do Comportamento]. E-mail: awzuardi@fmrp.usp.br; Araujo, D.; Santos, A.C. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP, (Brazil). Faculdade de Medicina. Div. de Radiologia

    2008-07-01

    The aim of the present study was to determine whether specific subgroups of schizophrenic patients, grouped according to electrodermal characteristics, show differences in the N-acetylaspartate/creatine plus choline (NAA / (Cr + Cho)) ratios in the frontal, cingulate and perirolandic cortices. Skin conductance levels (SCL) and skin conductance responses to auditory stimulation were measured in 38 patients with schizophrenia and in the same number of matched healthy volunteers (control). All subjects were submitted to multivoxel proton magnetic resonance spectroscopic imaging. When compared to the control group, patients presented significantly lower NAA / (Cr + Cho) ratios in the right dorsolateral prefrontal cortex (schizophrenia 0.95 {+-} 0.03; control = 1.12 {+-} 0.04) and in the right (schizophrenia 0.88 {+-} 0.02; control = 0.94 {+-} 0.03) and left (schizophrenia 0.84 {+-} 0.03; control = 0.94 {+-} 0.03) cingulates. These ratios did not differ between electrodermally responsive and non-responsive patients. When patients were divided into two groups: lower SCL (less than the mean SCL of the control group minus two standard deviations) and normal SCL (similar to the control group), the subgroup with a lower level of SCL showed a lower NAA / (Cr + Cho) ratio in the left cingulate (0.78 {+-} 0.05) than the controls (0.95 {+-} 0.02, P < 0.05) and the subgroup with normal SCL (0.88 {+-} 0.03, P < 0.05). There was a negative correlation between the NAA / (Cr + Cho) ratio in the left cingulate of patients with schizophrenia and the duration of the disease and years under medication. These data suggest the existence of a schizophrenic subgroup characterized by low SCL that could be a consequence of the lower neuronal viability observed in the left cingulate of these patients. (author)

  18. Proton magnetic resonance spectroscopy of the frontal, cingulate and perirolandic cortices and its relationship to skin conductance in patients with schizophrenia

    International Nuclear Information System (INIS)

    Sanches, R.F.; Crippa, J.A.S.; Hallak, J.E.C.; Sousa, J.P.M. de; Zuardi, A.W.; Araujo, D.; Santos, A.C.

    2008-01-01

    The aim of the present study was to determine whether specific subgroups of schizophrenic patients, grouped according to electrodermal characteristics, show differences in the N-acetylaspartate/creatine plus choline (NAA / (Cr + Cho)) ratios in the frontal, cingulate and perirolandic cortices. Skin conductance levels (SCL) and skin conductance responses to auditory stimulation were measured in 38 patients with schizophrenia and in the same number of matched healthy volunteers (control). All subjects were submitted to multivoxel proton magnetic resonance spectroscopic imaging. When compared to the control group, patients presented significantly lower NAA / (Cr + Cho) ratios in the right dorsolateral prefrontal cortex (schizophrenia 0.95 ± 0.03; control = 1.12 ± 0.04) and in the right (schizophrenia 0.88 ± 0.02; control = 0.94 ± 0.03) and left (schizophrenia 0.84 ± 0.03; control = 0.94 ± 0.03) cingulates. These ratios did not differ between electrodermally responsive and non-responsive patients. When patients were divided into two groups: lower SCL (less than the mean SCL of the control group minus two standard deviations) and normal SCL (similar to the control group), the subgroup with a lower level of SCL showed a lower NAA / (Cr + Cho) ratio in the left cingulate (0.78 ± 0.05) than the controls (0.95 ± 0.02, P < 0.05) and the subgroup with normal SCL (0.88 ± 0.03, P < 0.05). There was a negative correlation between the NAA / (Cr + Cho) ratio in the left cingulate of patients with schizophrenia and the duration of the disease and years under medication. These data suggest the existence of a schizophrenic subgroup characterized by low SCL that could be a consequence of the lower neuronal viability observed in the left cingulate of these patients. (author)

  19. Effect of adjuvants on responses to skin immunization by microneedles coated with influenza subunit vaccine.

    Directory of Open Access Journals (Sweden)

    William C Weldon

    Full Text Available Recent studies have demonstrated the effectiveness of vaccine delivery to the skin by vaccine-coated microneedles; however there is little information on the effects of adjuvants using this approach for vaccination. Here we investigate the use of TLR ligands as adjuvants with skin-based delivery of influenza subunit vaccine. BALB/c mice received 1 µg of monovalent H1N1 subunit vaccine alone or with 1 µg of imiquimod or poly(I:C individually or in combination via coated microneedle patches inserted into the skin. Poly(I:C adjuvanted subunit influenza vaccine induced similar antigen-specific immune responses compared to vaccine alone when delivered to the skin by microneedles. However, imiquimod-adjuvanted vaccine elicited higher levels of serum IgG2a antibodies and increased hemagglutination inhibition titers compared to vaccine alone, suggesting enhanced induction of functional antibodies. In addition, imiquimod-adjuvanted vaccine induced a robust IFN-γ cellular response. These responses correlated with improved protection compared to influenza subunit vaccine alone, as well as reduced viral replication and production of pro-inflammatory cytokines in the lungs. The finding that microneedle delivery of imiquimod with influenza subunit vaccine induces improved immune responses compared to vaccine alone supports the use of TLR7 ligands as adjuvants for skin-based influenza vaccines.

  20. The relation between constitutional skin color and photosensitivity estimated from UV-induced erythema and pigmentation dose-response curves

    NARCIS (Netherlands)

    Westerhof, W.; Estevez-Uscanga, O.; Meens, J.; Kammeyer, A.; Durocq, M.; Cario, I.

    1990-01-01

    In 54 healthy volunteers we assessed predictors of sensitivity to ultraviolet (UV) light, including Fitzpatrick's sun reactive skin types and constitutional skin color, and compared these with one another and with responses of the skin to UV irradiation, as determined experimentally by a minimal

  1. Effects of skin-to-skin contact on autonomic pain responses in preterm infants.

    Science.gov (United States)

    Cong, Xiaomei; Cusson, Regina M; Walsh, Stephen; Hussain, Naveed; Ludington-Hoe, Susan M; Zhang, Di

    2012-07-01

    The purpose of this randomized crossover trial was to determine the effects on autonomic responses in preterm infants of longer Kangaroo Care (30 minutes, KC30) and shorter KC (15 minutes, KC15) before and throughout heel stick compared with incubator care (IC). Beat-to-beat heart rate (HR) and spectral power analysis of heart rate variability, low frequency power (LF), high frequency power (HF), and LF/HF ratio were measured in 26 infants. HR changes from Baseline to Heel Stick were significantly less in KC30 and KC15 than in IC, and more infants had HR decrease in IC than in 2 KC conditions. In IC, LF and HF significantly increased from Baseline to Heel Stick and dropped from Heel Stick to Recovery; in 2 KC conditions, no changes across study phases were found. During Heel Stick, LF and HF were significantly higher in IC than in KC30. In all 3 conditions, LF/HF ratio decreased from Baseline to Heel Stick and increased to Recovery; no differences were found between IC and two KC conditions. Both longer and shorter KC before and throughout heel stick can stabilize HR response in preterm infants, and longer KC significantly affected infants' sympathetic and parasympathetic responses during heel stick compared with incubator care. This study showed that KC has a significant effect on reducing autonomic pain responses in preterm infants. The findings support that KC is a safe and effective pain intervention in the neonatal intensive care unit. Copyright © 2012 American Pain Society. Published by Elsevier Inc. All rights reserved.

  2. The effect of starting or stopping skin cooling on the thermoregulatory responses during leg exercise in humans.

    Science.gov (United States)

    Demachi, K; Yoshida, T; Kume, M; Tsuneoka, H

    2012-07-01

    To assess the effects of starting or stopping leg cooling on the thermoregulatory responses during exercise, 60 min of cycling exercise at 30% of maximal oxygen uptake was performed under 4 conditions using tube trouser perfused with water at 10 °C; no leg cooling (NC), starting of leg cooling after 30 min of exercise (delayed cooling, DC), continuous leg cooling (CC), and stopping of continuous leg cooling after 30 min of exercise (SC) at an environmental temperature of 28.5 °C. During exercise under the DC conditions, an instantaneous increase in the esophageal temperature (Tes), a suppression of the cutaneous vascular conductance at the forearm (%CVC), and a decrease in the mean skin temperature (Tsk) were observed after leg cooling. The total sweat loss (Δm sw,tot) was lower under the DC than the NC condition. In the SC study, however, the Tes remained constant, while the %CVC increased gradually after leg cooling was stopped, and the Δm sw,tot was greater than that under the CC condition. These results suggest that during exercise, rapid skin cooling of the leg may cause an increase in core temperature, while also enhancing thermal stress. However, stopping skin cooling did not significantly affect the core temperature long-term, because the skin blood flow and sweat rate subsequently increased. © Georg Thieme Verlag KG Stuttgart · New York.

  3. The sympathetic skin response in diabetic neuropathy and its relationship to autonomic symptoms

    International Nuclear Information System (INIS)

    Al-Moallem, Mansour A.; Zaidan, Radwan M.; Alkali, Nura H.

    2008-01-01

    Objective was to examine the utility of the sympathetic skin response (SSR) as a measure of impaired autonomic function among diabetic patients in Saudi Arabia. In this case-control study, baseline SSR was obtained from 18 healthy subjects, followed by nerve conduction studies and SSR testing on a consecutive cohort of 50 diabetic patients with peripheral neuropathy. The SSR in diabetic patients was compared between those with autonomic neuropathy and those without autonomic neuropathy. This study was conducted at the King Khalid University Hospital, Riyadh, Saudi Arabia, from June 2006 to June 2007. The SSR was present in all healthy subjects and in 32 diabetic patients. Among 16 patients with autonomic neuropathy, the SSR was absent in 14 and present in 2, while 4 of 34 patients lacking evidence of autonomic neuropathy had absent SSR. Using Fisher's exact test, we found a strong association between absent SSR and autonomic neuropathy (p<0.001), however, not with age or duration of diabetes mellitus. As a diagnostic test of autonomic neuropathy, the SSR had a sensitivity of 87.5%, a specificity of 88.2%, a positive predictive value of 77.8%, and a negative predictive value of 93.7%. Absence of the SSR is a reliable indicator of autonomic neuropathy among patients with diabetes mellitus in Saudi Arabia. (author)

  4. Exposure to 4100K fluorescent light elicits sex specific transcriptional responses in Xiphophorus maculatus skin.

    Science.gov (United States)

    Boswell, William T; Boswell, Mikki; Walter, Dylan J; Navarro, Kaela L; Chang, Jordan; Lu, Yuan; Savage, Markita G; Shen, Jianjun; Walter, Ronald B

    2018-06-01

    It has been reported that exposure to artificial light may affect oxygen intake, heart rate, absorption of vitamins and minerals, and behavioral responses in humans. We have reported specific gene expression responses in the skin of Xiphophorus fish after exposure to ultraviolet light (UV), as well as, both broad spectrum and narrow waveband visible light. In regard to fluorescent light (FL), we have shown that male X. maculatus exposed to 4100K FL (i.e. "cool white") rapidly suppress transcription of many genes involved with DNA replication and repair, chromosomal segregation, and cell cycle progression in skin. We have also detailed sex specific transcriptional responses of Xiphophorus skin after exposure to UVB. However, investigation of gender differences in global gene expression response after exposure to 4100K FL has not been reported, despite common use of this FL source for residential, commercial, and animal facility illumination. Here, we compare RNA-Seq results analyzed to assess changes in the global transcription profiles of female and male X. maculatus skin in response to 4100K FL exposure. Our results suggest 4100K FL exposure incites a sex-biased genetic response including up-modulation of inflammation in females and down modulation of DNA repair/replication in males. In addition, we identify clusters of genes that become oppositely modulated in males and females after FL exposure that are principally involved in cell death and cell proliferation. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Zurvarra, F.; Kerner, N.; Hagelin, K.

    2009-01-01

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  6. Effects of niacin restriction on sirtuin and PARP responses to photodamage in human skin.

    Directory of Open Access Journals (Sweden)

    Claudia A Benavente

    Full Text Available Sirtuins (SIRTs and poly(ADP-ribose polymerases (PARPs, NAD(+-dependent enzymes, link cellular energy status with responses to environmental stresses. Skin is frequently exposed to the DNA damaging effects of UV irradiation, a known etiology in skin cancer. Thus, understanding the defense mechanisms in response to UV, including the role of SIRTs and PARPs, may be important in developing skin cancer prevention strategies. Here, we report expression of the seven SIRT family members in human skin. SIRTs gene expressions are progressively upregulated in A431 epidermoid carcinoma cells (SIRTs1 and 3, actinic keratoses (SIRTs 2, 3, 5, 6, and 7 and squamous cell carcinoma (SIRTs 1-7. Photodamage induces dynamic changes in SIRT expression with upregulation of both SIRT1 and SIRT4 mRNAs. Specific losses of SIRT proteins occur early after photodamage followed by accumulation later, especially for SIRT4. Niacin restriction, which decreases NAD(+, the sirtuin substrate, results in an increase in acetylated proteins, upregulation of SIRTs 2 and 4, increased inherent DNA damage, alterations in SIRT responses to photodamage, abrogation of PARP activation following photodamage, and increased sensitivity to photodamage that is completely reversed by repleting niacin. These data support the hypothesis that SIRTs and PARPs play important roles in resistance to photodamage and identify specific SIRTs that respond to photodamage and may be targets for skin cancer prevention.

  7. Direct skin-to-skin vs. indirect touch modulates neural responses to stroking vs. tapping

    Science.gov (United States)

    Kress, Inge U; Minati, Ludovico; Ferraro, Stefania; Critchley, Hugo D

    2011-01-01

    It remains unclear whether direct inter-personal contact is processed differently from similar soft touch applied through inanimate objects. We performed a functional MRI (fMRI) experiment in healthy volunteers, whereby activity during gentle stroking or tapping was compared between stimuli delivered using the experimenter’s hand or a velvet stick. Stroking with a hand elicited larger responses than the other three conditions in the contralateral primary and secondary somatosensory areas and posterior insula. The observed effects likely originate from a combination of perceptual differences and cognitive and emotional correlates of contact with another person. This empirical observation indicates that to ensure ecological validity studies of affective touch processing should be performed with stimuli delivered with direct inter-personal contact rather than inanimate objects. PMID:21817928

  8. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli.

    Science.gov (United States)

    Kim, Elmer K; Wellnitz, Scott A; Bourdon, Sarah M; Lumpkin, Ellen A; Gerling, Gregory J

    2012-07-23

    The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI) afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI) before validating the model to assess its performance. Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm), mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is observed in afferent recordings. Finally, the SAI afferent's characteristic response

  9. The university and the responsible conduct of research: who is responsible for what?

    Science.gov (United States)

    Alfredo, Katherine; Hart, Hillary

    2011-09-01

    Research misconduct has been thoroughly discussed in the literature, but mainly in terms of definitions and prescriptions for proper conduct. Even when case studies are cited, they are generally used as a repository of "lessons learned." What has been lacking from this conversation is how the lessons of responsible conduct of research are imparted in the first place to graduate students, especially those in technical fields such as engineering. Nor has there been much conversation about who is responsible for what in training students in Responsible Conduct of Research or in allocating blame in cases of misconduct. This paper explores three seemingly disparate cases of misconduct-the 2004 plagiarism scandal at Ohio University; the famous Robert Millikan article of 1913, in which his reported data selection did not match his notebooks; and the 1990 fabrication scandal in Dr. Leroy Hood's research lab. Comparing these cases provides a way to look at the relationship between the graduate student (or trainee) and his/her advisor (a relationship that has been shown to be the most influential one for the student) as well as at possibly differential treatment for established researchers and researchers-in-training, in cases of misconduct. This paper reflects on the rights and responsibilities of research advisers and their students and offers suggestions for clarifying both those responsibilities and the particularly murky areas of research-conduct guidelines.

  10. Autonomic skin responses in females with Fabry disease

    DEFF Research Database (Denmark)

    Møller, Anette Torvin; Bach, Flemming W.; Feldt-Rasmussen, Ulla

    2009-01-01

    Fabry disease is a genetic lysosomal disorder with dysfunction of the lysosomal enzyme alpha-galactosidase A causing accumulation of glycolipids in multiple organs including the nervous system and with neuropathy as a prominent manifestation. Neurological symptoms include pain and autonomic...... dysfunction. This study examined peripheral autonomic nerve function in 19 female patients with Fabry disease and 19 sex and age-matched controls by measuring (1) sweat production following acetylcholine challenge; (2) the sympathetically mediated vasoconstrictor responses to inspiratory gasp, stress...

  11. Skin-Inspired Multifunctional Autonomic-Intrinsic Conductive Self-Healing Hydrogels with Pressure Sensitivity, Stretchability, and 3D Printability.

    Science.gov (United States)

    Darabi, Mohammad Ali; Khosrozadeh, Ali; Mbeleck, Rene; Liu, Yuqing; Chang, Qiang; Jiang, Junzi; Cai, Jun; Wang, Quan; Luo, Gaoxing; Xing, Malcolm

    2017-08-01

    The advent of conductive self-healing (CSH) hydrogels, a class of novel materials mimicking human skin, may change the trajectory of the industrial process because of their potential applications in soft robots, biomimetic prostheses, and health-monitoring systems. Here, the development of a mechanically and electrically self-healing hydrogel based on physically and chemically cross-linked networks is reported. The autonomous intrinsic self-healing of the hydrogel is attained through dynamic ionic interactions between carboxylic groups of poly(acrylic acid) and ferric ions. A covalent cross-linking is used to support the mechanical structure of the hydrogel. Establishing a fair balance between the chemical and physical cross-linking networks together with the conductive nanostructure of polypyrrole networks leads to a double network hydrogel with bulk conductivity, mechanical and electrical self-healing properties (100% mechanical recovery in 2 min), ultrastretchability (1500%), and pressure sensitivity. The practical potential of CSH hydrogels is further revealed by their application in human motion detection and their 3D-printing performance. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Ethnic differences in objective and subjective skin irritation response: an international study.

    Science.gov (United States)

    Lee, E; Kim, S; Lee, J; Cho, S-A; Shin, K

    2014-08-01

    Due to global marketing in the cosmetics industry, it is important to assess ethnic population susceptibility when evaluating the safety of cosmetic products or chemicals. To investigate ethnic variations in skin irritation response to positive irritants. Clinical testing was performed in four countries on two ethnic groups - Asian and Caucasian. We performed patch tests on the subjects' back with 0.5% aqueous sodium lauryl sulfate (SLS) and 0.15% retinol prepared in 1,3-butylene glycol. Stinging tests were performed using 5% aqueous lactic acid and 0.001% (w/v) capsaicin prepared in 10% ethanol solution separately. The incidence of self-perceived skin sensitivity was similar in the two ethnic groups. However, the incidence of adverse skin reaction to cosmetics appeared significantly higher in Asian (33.0%) than in Caucasian subjects (11.3%). For standard positive irritants such as 0.5% aqueous SLS solution, Asian subjects showed significantly higher scores than Caucasian subjects. The incidence of positive reaction to the 0.15% retinol patch test tended to be higher in Asian than in Caucasian subjects. Our data also showed that neurosensitivity to 5% lactic acid and 0.001% capsaicin was higher in Asian than in Caucasian subjects. Although self-reported skin sensitivity does not appear to differ according to ethnicity, there are ethnic differences in objective and subjective skin irritation responses to several standard positive materials. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device

    Directory of Open Access Journals (Sweden)

    Woraphong Manuskiatti

    2016-01-01

    Full Text Available Background. Fractional radiofrequency microneedle system (FRMS is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E, Verhoeff-Van Gieson (VVG, colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70 antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars.

  14. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    Science.gov (United States)

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  15. Expectancy, False Galvanic Skin Response Feedback, and Systematic Desensitization in the Modification of Phobic Behavior

    Science.gov (United States)

    Lick, John

    1975-01-01

    This study compared systematic desensitization and two pseudotherapy manipulations with and without false galvanic skin response feedback after every session suggesting improvement in the modification of intense snake and spider fear. The results indicated no consistent differences between the three treatment groups. (Author)

  16. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

    International Nuclear Information System (INIS)

    Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.

    2008-01-01

    Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers

  17. A synthetic peptide blocking TRPV1 activation inhibits UV-induced skin responses.

    Science.gov (United States)

    Kang, So Min; Han, Sangbum; Oh, Jang-Hee; Lee, Young Mee; Park, Chi-Hyun; Shin, Chang-Yup; Lee, Dong Hun; Chung, Jin Ho

    2017-10-01

    Transient receptor potential type 1 (TRPV1) can be activated by ultraviolet (UV) irradiation, and mediates UV-induced matrix metalloproteinase (MMP)-1 and proinflammatory cytokines in keratinocytes. Various chemicals and compounds targeting TRPV1 activation have been developed, but are not in clinical use mostly due to their safety issues. We aimed to develop a novel TRPV1-targeting peptide to inhibit UV-induced responses in human skin. We designed and generated a novel TRPV1 inhibitory peptide (TIP) which mimics the specific site in TRPV1 (aa 701-709: Gln-Arg-Ala-Ile-Thr-Ile-Leu-Asp-Thr, QRAITILDT), Thr 705 , and tested its efficacy of blocking UV-induced responses in HaCaT, mouse, and human skin. TIP effectively inhibited capsaicin-induced calcium influx and TRPV1 activation. Treatment of HaCaT with TIP prevented UV-induced increases of MMP-1 and pro-inflammatory cytokines such as interleukin (IL)-6 and tumor necrosis factor-α. In mouse skin in vivo, TIP inhibited UV-induced skin thickening and prevented UV-induced expression of MMP-13 and MMP-9. Moreover, TIP attenuated UV-induced erythema and the expression of MMP-1, MMP-2, IL-6, and IL-8 in human skin in vivo. The novel synthetic peptide targeting TRPV1 can ameliorate UV-induced skin responses in vitro and in vivo, providing a promising therapeutic approach against UV-induced inflammation and photoaging. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  18. The Response of the Ocean Thermal Skin Layer to Variations in Incident Infrared Radiation

    Science.gov (United States)

    Wong, Elizabeth W.; Minnett, Peter J.

    2018-04-01

    Ocean warming trends are observed and coincide with the increase in concentrations of greenhouse gases in the atmosphere resulting from human activities. At the ocean surface, most of the incoming infrared (IR) radiation is absorbed within the top micrometers of the ocean's surface where the thermal skin layer (TSL) exists. Thus, the incident IR radiation does not directly heat the upper few meters of the ocean. This paper investigates the physical mechanism between the absorption of IR radiation and its effect on heat transfer at the air-sea boundary. The hypothesis is that given the heat lost through the air-sea interface is controlled by the TSL, the TSL adjusts in response to variations in incident IR radiation to maintain the surface heat loss. This modulates the flow of heat from below and hence controls upper ocean heat content. This hypothesis is tested using the increase in incoming longwave radiation from clouds and analyzing vertical temperature profiles in the TSL retrieved from sea-surface emission spectra. The additional energy from the absorption of increasing IR radiation adjusts the curvature of the TSL such that the upward conduction of heat from the bulk of the ocean into the TSL is reduced. The additional energy absorbed within the TSL supports more of the surface heat loss. Thus, more heat beneath the TSL is retained leading to the observed increase in upper ocean heat content.

  19. Skin microvascular and metabolic response to pressure relief maneuvers in people with spinal cord injury

    Science.gov (United States)

    Ramella-Roman, Jessica C.; Le, Du V. N.; Ghassemi, Pejhman; Nguyen, Thu A.; Lichy, Alison; Groah, Suzanne

    2013-02-01

    Clinician's recommendations on wheelchair pressure reliefs in the context of the high prevalence of pressure ulcers that occur in people with spinal cord injury is not supported by strong experimental evidence. Some data indicates that altered tissue perfusion and oxygenation occurring under pressure loads, such as during sitting, induce various pathophysiologic changes that may lead to pressure ulcers. Pressure causes a cascade of responses, including initial tissue hypoxia, which leads to ischemia, vascular leakage, tissue acidification, compensatory angiogenesis, thrombosis, and hyperemia, all of which may lead to tissue damage. We have developed an advanced skin sensor that allows measurement of oxygenation in addition to perfusion, and can be safely used during sitting. The sensor consists of a set of fiber optics probes, spectroscopic and Laser Doppler techniques that are used to obtain parameters of interest. The overriding goal of this project is to develop the evidence base for clinical recommendations on pressure reliefs. In this paper we will illustrate the experimental apparatus as well as some preliminary results of a small clinical trial conducted at the National Rehabilitation Hospital.

  20. Measurement of erythema and tanning responses in human skin using a tri-stimulus colorimeter.

    Science.gov (United States)

    Seitz, J C; Whitmore, C G

    1988-01-01

    A 'Minolta Tri-Stimulus Colorimeter II' was evaluated for obtaining objective measurements of early changes in erythema and tanning. The meter showed a subtle, continuous transition between the primary erythematous response and the delayed tanning of skin which was below the visual threshold for detection. Thereafter, the a* (redness) value of the meter showed a significant linear correlation with the dermatologist's perception of erythema while the b* (yellow) value showed a significant correlation with the perception of tanning. This capability of the tri-stimulus colorimeter to simultaneously evaluate the hue and saturation of skin color affords an improved opportunity to quantitate the transition from erythema to tanning without subjective bias.

  1. Influence of hydration and experimental length scale on themechanical response of human skin in vivo, using optical coherence tomography

    NARCIS (Netherlands)

    Hendriks, F.M.; Brokken, D.; Oomens, C.W.J.; Baaijens, F.P.T.

    2004-01-01

    Human skin is a complex tissue consisting of different layers. To gain better insight into the mechanical behaviour of different skin layers, the mechanical response was studied with experiments of various length scales. Also, the influence of (superficial) hydration on the mechanical response is

  2. Computer Breakdown as a Stress Factor during Task Completion under Time Pressure: Identifying Gender Differences Based on Skin Conductance

    Directory of Open Access Journals (Sweden)

    René Riedl

    2013-01-01

    Full Text Available In today’s society, as computers, the Internet, and mobile phones pervade almost every corner of life, the impact of Information and Communication Technologies (ICT on humans is dramatic. The use of ICT, however, may also have a negative side. Human interaction with technology may lead to notable stress perceptions, a phenomenon referred to as technostress. An investigation of the literature reveals that computer users’ gender has largely been ignored in technostress research, treating users as “gender-neutral.” To close this significant research gap, we conducted a laboratory experiment in which we investigated users’ physiological reaction to the malfunctioning of technology. Based on theories which explain that men, in contrast to women, are more sensitive to “achievement stress,” we predicted that male users would exhibit higher levels of stress than women in cases of system breakdown during the execution of a human-computer interaction task under time pressure, if compared to a breakdown situation without time pressure. Using skin conductance as a stress indicator, the hypothesis was confirmed. Thus, this study shows that user gender is crucial to better understanding the influence of stress factors such as computer malfunctions on physiological stress reactions.

  3. Caffeine ameliorates radiation-induced skin reactions in mice but does not influence tumour radiation response

    Energy Technology Data Exchange (ETDEWEB)

    Hebbar, S.A.; Mitra, A.K.; George, K.C.; Verma, N.C. [Radiation Biology Division, Bhabha Atomic Research Centre, Trombay, Mumbai (India)]. E-mail: ncverma@apsara.barc.ernet.in

    2002-03-01

    Intramuscular administration of caffeine at a dose of 80 mg kg{sup -1} body weight to the gastrocnemius muscles of Swiss mice 5 min prior to local irradiation (35 Gy) of the leg delayed the progression of radiation-induced skin reactions in such animals. While 90% epilation with reddening of the skin was noted in animals treated with radiation alone, animals pretreated with caffeine suffered only partial hair loss with slight reddening of the skin on the 16th and 20th days post-irradiation. Beyond the 28th day, damage scores in irradiated feet for both the groups were similar (score 3) and remained unchanged until the 32nd day and then decreased and disappeared completely in both treatment groups by the 40th day after irradiation. In addition, the effect of caffeine on the radiation response of a mouse fibrosarcoma was investigated. Results showed that intratumoral administration of caffeine at a dose of 80 mg kg{sup -1} body weight 5 min prior to local exposure of tumours to 10 Gy of {sup 60}Co {gamma}-rays did not influence the response of tumours to radiation. The present study thus showed that although caffeine ameliorated radiation-induced skin reactions in the mouse leg, it did not affect the tumour radiation response, indicating its potential application in cancer radiotherapy. (author)

  4. Enhanced immune responses by skin vaccination with influenza subunit vaccine in young hosts.

    Science.gov (United States)

    Koutsonanos, Dimitrios G; Esser, E Stein; McMaster, Sean R; Kalluri, Priya; Lee, Jeong-Woo; Prausnitz, Mark R; Skountzou, Ioanna; Denning, Timothy L; Kohlmeier, Jacob E; Compans, Richard W

    2015-09-08

    Skin has gained substantial attention as a vaccine target organ due to its immunological properties, which include a high density of professional antigen presenting cells (APCs). Previous studies have demonstrated the effectiveness of this vaccination route not only in animal models but also in adults. Young children represent a population group that is at high risk from influenza infection. As a result, this group could benefit significantly from influenza vaccine delivery approaches through the skin and the improved immune response it can induce. In this study, we compared the immune responses in young BALB/c mice upon skin delivery of influenza vaccine with vaccination by the conventional intramuscular route. Young mice that received 5 μg of H1N1 A/Ca/07/09 influenza subunit vaccine using MN demonstrated an improved serum antibody response (IgG1 and IgG2a) when compared to the young IM group, accompanied by higher numbers of influenza-specific antibody secreting cells (ASCs) in the bone marrow. In addition, we observed increased activation of follicular helper T cells and formation of germinal centers in the regional lymph nodes in the MN immunized group, rapid clearance of the virus from their lungs as well as complete survival, compared with partial protection observed in the IM-vaccinated group. Our results support the hypothesis that influenza vaccine delivery through the skin would be beneficial for protecting the high-risk young population from influenza infection. Copyright © 2015. Published by Elsevier Ltd.

  5. Dose-response models for the radiation-induction of skin tumours in mice

    International Nuclear Information System (INIS)

    Papworth, D.G.; Hulse, E.V.

    1983-01-01

    Extensive data on radiation-induced skin tumours in mice were examined using 8 models, all based on the concept that incidences of radiation-induced tumours depend on a combination of two radiation effects: a tumour induction process and the loss of reproductive integrity by the potential tumour cells. Models with and without a threshold were used, in spite of theoretical objections to threshold models. No model fitted well both the epidermal and the dermal tumour data and models which proved to be statistically satisfactory for some of the data were rejected for biological reasons. It is concluded that, for skin tumours, dose-response curves depending on a combination of cancer induction and loss of cellular reproductive integrity are distorted by some special, relatively radio-resistant, factor which we have previously postulated as being involved in radiation skin carcinogenesis. (author)

  6. Effects of methylglyoxal bis(guanylhydrazone) on tumour and skin responses to hyperthermia in mice

    International Nuclear Information System (INIS)

    Miyakoshi, J.; Oda, W.; Inagaki, C.; Hiraoka, M.; Takahashi, M.; Abe, M.

    1984-01-01

    Effects of methylglyoxal bis(guanylhydrazone) (MGBG) on tumour and skin responses to hyperthermia (42degC) were examined in C3H mice. MGBG (50 mg/kg) was administered intraperitoneally to mice 4 hours before hyperthermic treatment. The tumour (FM3A) growth time was elongated by an amount dependent on the exposure time of treatment at 42degC (60, 90 and 120 min). Pre-treatment of mice with MGBG (50 mg/kg, i.p.) apparently further lengthened the tumour growth time after treatment at 42degC. No significant damage of foot skin was caused by 42degC hyperthermia. Pre-treatment with MGBG did not make the foot skin susceptible to the heating. From these findings, it can be considered that MGBG or related less-toxic compounds may have a clinical advantage for the mild (42degC) hyperthermic treatment in cancer therapy. (author)

  7. Effects of methylglyoxal bis(guanylhydrazone) on tumour and skin responses to hyperthermia in mice

    Energy Technology Data Exchange (ETDEWEB)

    Miyakoshi, J.; Oda, W.; Inagaki, C. (Kyoto Coll. of Pharmacy (Japan)); Hiraoka, M.; Takahashi, M.; Abe, M. (Kyoto Univ. (Japan). Faculty of Medicine)

    1984-09-01

    Effects of methylglyoxal bis(guanylhydrazone) (MGBG) on tumour and skin responses to hyperthermia (42degC) were examined in C3H mice. MGBG (50 mg/kg) was administered intraperitoneally to mice 4 hours before hyperthermic treatment. The tumour (FM3A) growth time was elongated by an amount dependent on the exposure time of treatment at 42degC (60, 90 and 120 min). Pre-treatment of mice with MGBG (50 mg/kg, i.p.) apparently further lengthened the tumour growth time after treatment at 42degC. No significant damage of foot skin was caused by 42degC hyperthermia. Pre-treatment with MGBG did not make the foot skin susceptible to the heating. From these findings, it can be considered that MGBG or related less-toxic compounds may have a clinical advantage for the mild (42degC) hyperthermic treatment in cancer therapy.

  8. Tissue responses to fractional transient heating with sinusoidal heat flux condition on skin surface.

    Science.gov (United States)

    Ezzat, Magdy A; El-Bary, Alaa A; Al-Sowayan, Noorah S

    2016-10-01

    A fractional model of Bioheat equation for describing quantitatively the thermal responses of skin tissue under sinusoidal heat flux conditions on skin surface is given. Laplace transform technique is used to obtain the solution in a closed form. The resulting formulation is applied to one-dimensional application to investigate the temperature distribution in skin with instantaneous surface heating for different cases. According to the numerical results and its graphs, conclusion about the fractional bioheat transfer equation has been constructed. Sensitivity analysis is performed to explore the thermal effects of various control parameters on tissue temperature. The comparisons are made with the results obtained in the case of the absence of time-fractional order. © 2016 Japanese Society of Animal Science. © 2016 Japanese Society of Animal Science.

  9. Applicability of cable theory to vascular conducted responses.

    Science.gov (United States)

    Hald, Bjørn Olav; Jensen, Lars Jørn; Sørensen, Preben Graae; Holstein-Rathlou, Niels-Henrik; Jacobsen, Jens Christian Brings

    2012-03-21

    Conduction processes in the vasculature have traditionally been described using cable theory, i.e., locally induced signals decaying passively along the arteriolar wall. The decay is typically quantified using the steady-state length-constant, λ, derived from cable theory. However, the applicability of cable theory to blood vessels depends on assumptions that are not necessarily fulfilled in small arteries and arterioles. We have employed a morphologically and electrophysiologically detailed mathematical model of a rat mesenteric arteriole to investigate if the assumptions hold and whether λ adequately describes simulated conduction profiles. We find that several important cable theory assumptions are violated when applied to small blood vessels. However, the phenomenological use of a length-constant from a single exponential function is a good measure of conduction length. Hence, λ should be interpreted as a descriptive measure and not in light of cable theory. Determination of λ using cable theory assumes steady-state conditions. In contrast, using the model it is possible to probe how conduction behaves before steady state is achieved. As ion channels have time-dependent activation and inactivation, the conduction profile changes considerably during this dynamic period with an initially longer spread of current. This may have implications in relation to explaining why different agonists have different conduction properties. Also, it illustrates the necessity of using and developing models that handle the nonlinearity of ion channels. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. Skin conductance rises in preparation and recovery to psychosocial stress and its relationship with impulsivity and testosterone in intimate partner violence perpetrators.

    Science.gov (United States)

    Romero-Martínez, A; Lila, M; Williams, R K; González-Bono, E; Moya-Albiol, L

    2013-12-01

    Intimate partner violence (IPV) perpetrators were categorized into 2 groups using Gottman et al.'s (1995) typology depending on their skin conductance (SC) reactivity to stress. Overall, type I perpetrators tend to show autonomic underarousal, whereas type II perpetrators present a preparatory hyperreactivity to confront stress. Moreover, impulsivity traits and testosterone (T) levels may modulate SC responses to increase the risk of proneness to violence. In this study, SC response to stress was assessed by comparing IPV perpetrators with non-violent controls while performing a modified version of the Trier Social Stress Test (TSST). Subjects with a history of IPV demonstrated higher non-specific SC responses during the recovery period than the non-violent controls. Nonetheless, there were no differences between groups in the case of mean SC levels. Furthermore, impulsivity and baseline T levels were associated with higher SC level reactivity during a preparation period only in IPV perpetrators, with both relationships being mediated by anger expression. Our results confirm that the IPV perpetrators correspond physiologically to type II and support the validity of SC as a diagnostic indicator for IPV classification. Our findings contribute to the development of effective treatment and prevention programs that could benefit from the use of biological indicators for analyzing the risk of recidivism in IPV perpetrators. © 2013.

  11. Optimization of gelatine extraction from grass carp (Catenopharyngodon idella) fish skin by response surface methodology.

    Science.gov (United States)

    Kasankala, Ladislaus M; Xue, Yan; Weilong, Yao; Hong, Sun D; He, Qian

    2007-12-01

    To establish the optimum gelatine extraction conditions from grass carp fish skin, response surface methodology (RSM) was adopted in this study. The effects of concentration of HCl (%, A), pre-treatment time (h, B), extraction temperature ( degrees C, C) and extraction time (h, D) were studied. The responses were yield (%) and gel strength (g). A=1.19%, B=24 h, C=52.61 degrees C and D=5.12h were determined as the optimum conditions while the predicted responses were 19.83% yield and 267 g gel strength. Gelling and melting points were 19.5 degrees C and 26.8 degrees C, respectively. Moreover, grass carp gelatine showed high contents of imino acids (proline and hydroxyproline) 19.47%. RSM provided a powerful tool to optimize the extraction parameters and the results may be adapted for industrial extraction of gelatine from grass carp fish skins.

  12. Detecting concealed information from groups using a dynamic questioning approach: simultaneous skin conductance measurement and immediate feedback

    Directory of Open Access Journals (Sweden)

    Ewout H Meijer

    2013-02-01

    Full Text Available Lie detection procedures typically aim at determining the guilt or innocence of a single suspect. The Concealed Information Test (CIT, for example, has been shown to be highly successful in detecting the presence or absence of crime-related information in a suspect’s memory. Many of today’s security threats, however, do not come from individuals, but from organized groups such as criminal organizations or terrorist networks. In this study, we tested whether a plan of an upcoming mock terrorist attack could be extracted from a group of suspects using a dynamic questioning approach. One-hundred participants were tested in 20 groups of 5. Each group was asked to plan a mock terrorist attack based on a list of potential countries, cities and streets. Next, three questions referring to the country, city, and street were presented, each with 5 options. Skin conductance in all 5 members of the group was measured simultaneously during this presentation. The dynamic questioning approach entailed direct analysis of the data, and if the average skin conductance of the group to a certain option exceeded a threshold, this option was followed up. E.g., if the reaction to the option ‘Italy’ exceeded the threshold, this was followed up by presenting 5 cities in Italy. Results showed that in 19 of the 20 groups the country was correctly detected using this procedure. In 13 of these remaining 19 groups the city was correctly detected. In 7 of these 13, the street was also correctly detected. The question about the country resulted in no false positives (out of 20, the question about the city resulted in 2 false positives (out of 19, while the question about the streets resulted in 2 false positives (out of 13. Furthermore, the 2 false positives at the city level also yielded a false positive at the street level. Taken together these results indicate our dynamic questioning approach can help to unveil plans about a mock terrorist attack.

  13. Applicability of cable theory to vascular conducted responses

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Jensen, Lars Jørn; Sørensen, Preben Graae

    2012-01-01

    Conduction processes in the vasculature have traditionally been described using cable theory, i.e., locally induced signals decaying passively along the arteriolar wall. The decay is typically quantified using the steady-state length-constant, ¿, derived from cable theory. However......, the applicability of cable theory to blood vessels depends on assumptions that are not necessarily fulfilled in small arteries and arterioles. We have employed a morphologically and electrophysiologically detailed mathematical model of a rat mesenteric arteriole to investigate if the assumptions hold and whether...... ¿ adequately describes simulated conduction profiles. We find that several important cable theory assumptions are violated when applied to small blood vessels. However, the phenomenological use of a length-constant from a single exponential function is a good measure of conduction length. Hence, ¿ should...

  14. Soil water sensor response to bulk electrical conductivity

    Science.gov (United States)

    Soil water monitoring using electromagnetic (EM) sensors can facilitate observations of water content at high temporal and spatial resolutions. These sensors measure soil dielectric permittivity (Ka) which is largely a function of volumetric water content. However, bulk electrical conductivity BEC c...

  15. Influence of trichloroacetic acid peeling on the skin stress response system.

    Science.gov (United States)

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2011-08-01

    Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation. © 2010 Japanese Dermatological Association.

  16. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  17. Exogenous melatonin administration modifies cutaneous vasoconstrictor response to whole body skin cooling in humans.

    Science.gov (United States)

    Aoki, Ken; Zhao, Kun; Yamazaki, Fumio; Sone, Ryoko; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2008-03-01

    Humans and other diurnal species experience a fall in internal temperature (T(int)) at night, accompanied by increased melatonin and altered thermoregulatory control of skin blood flow (SkBF). Also, exogenous melatonin induces a fall in T(int), an increase in distal skin temperatures and altered control of the cutaneous active vasodilator system, suggesting an effect of melatonin on the control of SkBF. To test whether exogenous melatonin also affects the more tonically active vasoconstrictor system in glabrous and nonglabrous skin during cooling, healthy males (n = 9) underwent afternoon sessions of whole body skin temperature (T(sk)) cooling (water-perfused suits) after oral melatonin (Mel; 3 mg) or placebo (Cont). Cutaneous vascular conductance (CVC) was calculated from SkBF (laser Doppler flowmetry) and non-invasive blood pressure. Baseline T(int) was lower in Mel than in Cont (P forearm CVC was first significantly reduced at T(sk) of 34.33 +/- 0.01 degrees C (P forearm CVC in Mel was significantly less than in Cont at T(sk) of 32.66 +/- 0.01 degrees C and lower (P < 0.05). In Mel, palmar CVC was significantly higher than in Cont above T(sk) of 33.33 +/- 0.01 degrees C, but not below. Thus exogenous melatonin blunts reflex vasoconstriction in nonglabrous skin and shifts vasoconstrictor system control to lower T(int). It provokes vasodilation in glabrous skin but does not suppress the sensitivity to falling T(sk). These findings suggest that by affecting the vasoconstrictor system, melatonin has a causal role in the nocturnal changes in body temperature and its control.

  18. Immune sensitization to methylene diphenyl diisocyanate (MDI resulting from skin exposure: albumin as a carrier protein connecting skin exposure to subsequent respiratory responses

    Directory of Open Access Journals (Sweden)

    Redlich Carrie A

    2011-03-01

    Full Text Available Abstract Background Methylene diphenyl diisocyanate (MDI, a reactive chemical used for commercial polyurethane production, is a well-recognized cause of occupational asthma. The major focus of disease prevention efforts to date has been respiratory tract exposure; however, skin exposure may also be an important route for inducing immune sensitization, which may promote subsequent airway inflammatory responses. We developed a murine model to investigate pathogenic mechanisms by which MDI skin exposure might promote subsequent immune responses, including respiratory tract inflammation. Methods Mice exposed via the skin to varying doses (0.1-10% w/v of MDI diluted in acetone/olive oil were subsequently evaluated for MDI immune sensitization. Serum levels of MDI-specific IgG and IgE were measured by enzyme-linked immunosorbant assay (ELISA, while respiratory tract inflammation, induced by intranasal delivery of MDI-mouse albumin conjugates, was evaluated based on bronchoalveolar lavage (BAL. Autologous serum IgG from "skin only" exposed mice was used to detect and guide the purification/identification of skin proteins antigenically modified by MDI exposure in vivo. Results Skin exposure to MDI resulted in specific antibody production and promoted subsequent respiratory tract inflammation in animals challenged intranasally with MDI-mouse albumin conjugates. The degree of (secondary respiratory tract inflammation and eosinophilia depended upon the (primary skin exposure dose, and was maximal in mice exposed to 1% MDI, but paradoxically limited in mice receiving 10-fold higher doses (e.g. 10% MDI. The major antigenically-modified protein at the local MDI skin exposure site was identified as albumin, and demonstrated biophysical changes consistent with MDI conjugation. Conclusions MDI skin exposure can induce MDI-specific immune sensitivity and promote subsequent respiratory tract inflammatory responses and thus, may play an important role in MDI asthma

  19. Promoting responsible research conduct in a developing world ...

    African Journals Online (AJOL)

    2013-06-22

    Jun 22, 2013 ... from 51 countries, it contains 4 principles and 14 responsibilities and has been .... Likewise, all institutions must have an 'assurance' registered with the ... requirements and standards, via process auditing. Whether these .... Office for Human Research Protections, Health and Human Services, US Federal.

  20. EXPLORING THE POTENTIAL OF SHORT-TIME FOURIER TRANSFORMS FOR ANALYZING SKIN CONDUCTANCE AND PUPILLOMETRY IN REAL-TIME APPLICATIONS

    International Nuclear Information System (INIS)

    Roger Lew; Brian P. Dyre; Steffen Werner; Jeffrey C. Joe; Brian Wotring; Tuan Tran

    2008-01-01

    The development of real-time predictors of mental workload is critical for the practical application of augmented cognition to human-machine systems. This paper explores a novel method based on a short-time Fourier transform (STFT) for analyzing galvanic skin conductance (SC) and pupillometry time-series data to extract estimates of mental workload with temporal bandwidth high-enough to be useful for augmented cognition applications. We tested the method in the context of a process control task based on the DURESS simulation developed by Vincente and Pawlak (1994; ported to Java by Cosentino, and Ross, 1999). SC, pupil dilation, blink rate, and visual scanning patterns were measured for four participants actively engaged in controlling the simulation. Fault events were introduced that required participants to diagnose errors and make control adjustments to keep the simulator operating within a target range. We were interested in whether the STFT of these measures would produce visible effects of the increase in mental workload and stress associated with these events. Graphical exploratory data analysis of the STFT showed visible increases in the power spectrum across a range of frequencies directly following fault events. We believe this approach shows potential as a relatively unobtrusive, low-cost, high bandwidth measure of mental workload that could be particularly useful for the application of augmented cognition to human-machine systems

  1. EXPLORING THE POTENTIAL OF SHORT-TIME FOURIER TRANSFORMS FOR ANALYZING SKIN CONDUCTANCE AND PUPILLOMETRY IN REAL-TIME APPLICATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Roger Lew; Brian P. Dyre; Steffen Werner; Jeffrey C. Joe; Brian Wotring; Tuan Tran

    2008-09-01

    The development of real-time predictors of mental workload is critical for the practical application of augmented cognition to human-machine systems. This paper explores a novel method based on a short-time Fourier transform (STFT) for analyzing galvanic skin conductance (SC) and pupillometry time-series data to extract estimates of mental workload with temporal bandwidth high-enough to be useful for augmented cognition applications. We tested the method in the context of a process control task based on the DURESS simulation developed by Vincente and Pawlak (1994; ported to Java by Cosentino,& Ross, 1999). SC, pupil dilation, blink rate, and visual scanning patterns were measured for four participants actively engaged in controlling the simulation. Fault events were introduced that required participants to diagnose errors and make control adjustments to keep the simulator operating within a target range. We were interested in whether the STFT of these measures would produce visible effects of the increase in mental workload and stress associated with these events. Graphical exploratory data analysis of the STFT showed visible increases in the power spectrum across a range of frequencies directly following fault events. We believe this approach shows potential as a relatively unobtrusive, low-cost, high bandwidth measure of mental workload that could be particularly useful for the application of augmented cognition to human-machine systems.

  2. Comparison of electrochemical skin conductance and vibration perception threshold measurement in the detection of early diabetic neuropathy.

    Directory of Open Access Journals (Sweden)

    Amit Goel

    Full Text Available The early diagnosis of diabetic peripheral neuropathy (DPN is challenging. Sudomotor dysfunction is one of the earliest detectable abnormalities in DPN. The present study aimed to determine the diagnostic performance of the electrochemical skin conductance (ESC test in detecting early DPN, compared with the vibration perception threshold (VPT test and diabetic neuropathy symptom (DNS score, using the modified neuropathy disability score (NDS as the reference standard. Five hundred and twenty-three patients with type 2 diabetes underwent an NDS-based clinical assessment for neuropathy. Participants were classified into the DPN and non-DPN groups based on the NDS (≥ 6. Both groups were evaluated further using the DNS, and VPT and ESC testing. A receiver-operator characteristic (ROC curve analysis was performed to compare the efficacy of ESC measurements with those of DNS and VPT testing in detecting DPN. The DPN group (n = 110, 21% had significantly higher HbA1c levels and longer diabetes durations compared with the non-DPN group (n = 413. The sensitivity of feet ESC 15 V, and DNS ≥ 1, were 16.4, 10.9 and 1.8, respectively. ESC measurement is an objective and sensitive technique for the early detection of DPN. Feet ESC measurement was superior to VPT testing for identifying patients with early DPN.

  3. Inflammatory Murine Skin Responses to UV-B Light Are Partially Dependent on Endothelin-1 and Mast Cells

    OpenAIRE

    Metz, Martin; Lammel, Verena; Gibbs, Bernhard F.; Maurer, Marcus

    2006-01-01

    Endothelin (ET-1) has been shown to crucially contribute to UV-induced skin responses such as tanning. To test whether ET-1 is also involved in early cutaneous reactions to UV, we assessed ET-1 skin levels in UV-irradiated mice. In correlation with the levels of UV-induced skin inflammation, ET-1 concentrations increased substantially and continually. Moreover, blocking of ET-1 receptors (ETA) resulted in significantly decreased cutaneous inflammation following UV irradiation. When we assesse...

  4. Sleep Deprivation in Young and Healthy Subjects Is More Sensitively Identified by Higher Frequencies of Electrodermal Activity than by Skin Conductance Level Evaluated in the Time Domain

    Directory of Open Access Journals (Sweden)

    Hugo F. Posada-Quintero

    2017-06-01

    Full Text Available We analyzed multiple measures of the autonomic nervous system (ANS based on electrodermal activity (EDA and heart rate variability (HRV for young healthy subjects undergoing 24-h sleep deprivation. In this study, we have utilized the error awareness test (EAT every 2 h (13 runs total, to evaluate the deterioration of performance. EAT consists of trials where the subject is presented words representing colors. Subjects are instructed to press a button (“Go” trials or withhold the response if the word presented and the color of the word mismatch (“Stroop No-Go” trial, or the screen is repeated (“Repeat No-Go” trials. We measured subjects' (N = 10 reaction time to the “Go” trials, and accuracy to the “Stroop No-Go” and “Repeat No-Go” trials. Simultaneously, changes in EDA and HRV indices were evaluated. Furthermore, the relationship between reactiveness and vigilance measures and indices of sympathetic control based on HRV were analyzed. We found the performance improved to a stable level from 6 through 16 h of deprivation, with a subsequently sustained impairment after 18 h. Indices of higher frequencies of EDA related more to vigilance measures, whereas lower frequencies index (skin conductance leve, SCL measured the reactiveness of the subject. We conclude that indices of EDA, including those of the higher frequencies, termed TVSymp, EDASymp, and NSSCRs, provide information to better understand the effect of sleep deprivation on subjects' autonomic response and performance.

  5. Optical conductivity and electronic Raman response of cuprate superconductors

    International Nuclear Information System (INIS)

    Vanyolos, A.; Dora, B.; Virosztek, A.

    2010-01-01

    We present the results of detailed analytical calculations for the in-plane optical conductivity and the electronic Raman susceptibility in quasi two-dimensional systems possessing a ground state with two competing order parameters: a d-wave density wave (dDW) and d-wave superconductor (dSC). In the coexisting dDW+dSC phase we determine the frequency dependence of these correlation functions in the presence of randomly distributed non-magnetic impurities in the unitary limit.

  6. OPTIMIZATION AND CHARACTERIZATION OF 5-FLUOROURACIL TRANSETHOSOMES FOR SKIN CANCER THERAPY USING RESPONSE SURFACE METHODOLOGY.

    OpenAIRE

    Jessy Shaji; Rinki Bajaj.

    2018-01-01

    The purpose of the present study was to develop, optimize and characterize 5-Fluorouracil transethosomes for skin cancer targeting. 5- Fluorouracil transethosomes were prepared by cold method using phospholipon 90G as the lipid and sodium cholate as edge activator. The size reduction was done by probe sonication. Central composite design was used for optimization procedure with different concentration of phospholipon 90G and sodium cholate as independent variables. The response variables sele...

  7. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate.

    Science.gov (United States)

    De Jongh, Cindy M; Verberk, Maarten M; Withagen, Carien E T; Jacobs, John J L; Rustemeyer, Thomas; Kezic, Sanja

    2006-06-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels and the skin response to a single and a repeated irritation test. This study also aimed to determine changes in SC cytokine levels after repeated irritation. Transepidermal water loss (TEWL) and erythema were measured in 20 volunteers after single 24-hr exposure to 1% sodium lauryl sulfate (SLS), and during and after repeated exposure to 0.1% SLS over a 3-week period. SC cytokine levels were measured from an unexposed skin site and from the repeatedly exposed site. Interleukin (IL)-1alpha decreased by 30% after repeated exposure, while IL-1RA increased 10-fold and IL-8 increased fourfold. Baseline IL-1RA and IL-8 values were predictors of TEWL and erythema after single exposure (r = 0.55-0.61). 6 subjects showed barrier recovery during repeated exposure. Baseline IL-1RA and IL-8 levels are likely to be indicators of higher skin irritability after single exposure to SLS. Barrier repair in some of the subjects might explain the lack of agreement between the TEWL response after single and repeated irritation.

  8. Posterior superior temporal sulcus responses predict perceived pleasantness of skin stroking

    Directory of Open Access Journals (Sweden)

    Monika Davidovic

    2016-09-01

    Full Text Available Love and affection is expressed through a range of physically intimate gestures, including caresses. Recent studies suggest that posterior temporal lobe areas typically associated with visual processing of social cues also respond to interpersonal touch. Here, we asked whether these areas are selective to caress-like skin stroking. We collected functional magnetic resonance imaging (fMRI data from 23 healthy participants and compared brain responses to skin stroking and vibration. We did not find any significant differences between stroking and vibration in the posterior temporal lobe; however, right posterior superior temporal sulcus (pSTS responses predicted healthy participant's perceived pleasantness of skin stroking, but not vibration. These findings link right pSTS responses to individual variability in perceived pleasantness of caress-like tactile stimuli. We speculate that the right pSTS may play a role in the translation of tactile stimuli into positively valenced, socially relevant interpersonal touch and that this system may be affected in disorders associated with impaired attachment.

  9. Skin response to X-irradiation in the guinea-pig

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R J; Mole, R H; Barnes, D W.H. [Medical Research Council, Harwell (UK). Radiobiological Research Unit

    1976-12-01

    Skin reaction to X-irradiation has been studied in the albino quinea-pig; early response in limited-field irradiations of the flank was comparable to that commonly seen in rodents, swine and man, and was dose-dependent with a dynamic range from mild erythema to moist desquamation. The peak early skin reaction was seen between 14 and 21 days after irradiation, and declined before 30 days except at the highest doses used. Fractionation of the X-ray dose at 24 hours resulted in a 'sparing' of about 340 rad. Permanent partial epilation was detectable at doses in excess of 1400 rad, and complete epilation at 1 year occurred in 50 per cent of irradiated fields at 1740 rad. Twenty-four hour two-dose fractionation resulted in a 'sparing' of about 500 rad for epilation. Palpable dermal 'fibrosis' was detectable at 3 months after irradiation in fields given more than 2070 rad, and at 1 year after irradiation in fields given more than 1800 rad; 50 per cent of fields showed palpable 'fibrosis' at 1 year at 1930 rad. Unlike domestic swine and man, skin fields in the quinea-pig showed no dimensional contraction after X-ray doses which produced gross early skin damage.

  10. Modifications of the sympathetic skin response in workers chronically exposed to lead

    Directory of Open Access Journals (Sweden)

    D.B. Nora

    2007-01-01

    Full Text Available The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9. The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%, axonal sensorimotor polyneuropathy in 2 (3.3%, and carpal tunnel syndrome in 6 (10%. SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3% reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.

  11. The Response of the Ocean Thermal Skin Layer to Air-Sea Surface Heat Fluxes

    Science.gov (United States)

    Wong, Elizabeth Wing-See

    -or-less fixed. The surplus energy, from absorbing increasing levels of infrared radiation, is found to adjust the curvature of the thermal skin layer such that there is a smaller gradient at the interface between the thermal skin layer and the mixed layer beneath. The vertical conduction of heat from the mixed layer to the surface is therefore hindered while the additional energy within the thermal skin layer is supporting the gradient changes of the skin layer's temperature profile. This results in heat beneath the thermal skin layer, which is a product of the absorption of solar radiation during the day, to be retained and cause an increase in upper ocean heat content. The accuracy of four published skin layer models were evaluated by comparison with the field results. The results show a need to include radiative effects, which are currently absent, in such models as they do not replicate the findings from the field data and do not elucidate the effects of the absorption of infrared radiation.

  12. Normative Values for Electrochemical Skin Conductance Measurements for Quantitative Assessment of Sudomotor Function in Healthy Indian Adults.

    Science.gov (United States)

    Shivaprasad, C; Goel, Amit; Vilier, Alice; Calvet, Jean-Henri

    2018-01-01

    Electrochemical skin conductance (ESC) test is a widely accepted objective technique for quantitatively assessing sudomotor dysfunction, which is one of the earliest-detected neurophysiologic abnormalities in diabetic patients with distal symmetric polyneuropathy. This study aimed to provide normative data for ESC values among healthy Indian participants and assess the potential influence of age, sex, and body mass index (BMI) on ESC measurements. A sample of 217 healthy participants aged 18-75 years were recruited and assessed for parameters including age, gender, BMI, and ESC measurements of the hands and feet. The Shapiro-Wilk test was used to assess the normality of the data. Pearson's correlation was used to evaluate the association between age, gender, and BMI, and ESC measurements. The mean age of the participants was 43.3 ± 13.2 years, and mean BMI was 26.0 ± 4.3 kg/m 2 . Mean ESC for the hands and feet was 68.9 ± 13.1 and 71 ± 12.9 micro-Siemens, respectively, and there was a significant correlation between values from the right and left hands and feet ( r = 0.9, P < 0.0001). A significant correlation was also observed between ESC measurements of the hands and feet ( r = 0.94, P < 0.0001). ESC values of both hands and feet declined with age. A weak but significant inverse correlation between ESC and age was observed for the hands ( r = 0.02, P = 0.01) and for the feet ( r = 0.12, P < 0.0001). There was no significant difference in hand or feet ESC measurement between male and female participants. No significant correlation was observed between BMI and ESC of hands or feet. Only age was identified as a significant determinant of ESC on multivariate logistic regression analysis. Normative values for Indians are lower than that reported for Caucasians.

  13. Skin Carotenoid Response to a High-Carotenoid Juice in Children: A Randomized Clinical Trial.

    Science.gov (United States)

    Aguilar, Sheryl S; Wengreen, Heidi J; Dew, Jeffrey

    2015-11-01

    Previous studies have shown an increase in serum carotenoid status among children when fed carotenoids. This study looked at the effect and dose-response of a known amount of carotenoid consumption on change in skin carotenoid status among children. Participants were children aged 5 to 17 years from Cache County, UT (n=58). Children were randomly assigned to one of three groups: high (n=18) or low (n=18) dose of a carotenoid-rich juice (2.75 mg carotenoids/30 mL juice), or placebo juice (n=22). Children were asked to drink an assigned dose of the juice (30 to 120 mL/day) based on the weight of the child and group assignment, every day for 8 weeks. Skin carotenoids were measured every 2 weeks by resonance Raman spectroscopy. Participants were asked to maintain their usual diet throughout the study. Usual diet was assessed using three averaged 24-hour recalls; diet constancy was measured using food frequency questionnaires administered at baseline, Week 4, and Week 8. Repeated measures analysis of variance was used to assess the group differences in skin carotenoid status over time. The high-dose and low-dose groups had mean±standard deviation increases in skin carotenoid status of 11,515±1,134 and 10,009±1,439 Raman intensity counts, respectively (both P values juice significantly increased skin carotenoid status over an 8-week period among children aged 5 to 17 years. The amount of carotenoids found in this amount of juice is equal to the amount found in approximately 23 to 92 g cooked carrots per day. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  14. Response of the skin of hamsters to fractionated irradiation with X rays or accelerated carbon ions

    International Nuclear Information System (INIS)

    Leith, J.T.; Powers-Risius, P.; Woodruff, K.H.; McDonald, M.; Howard, J.

    1981-01-01

    The ventral thoracic skin of hamsters was irradiated with either single, split (two fractions given in 24 hr), or multiple (five fractions given daily) exposures of X rays or accelerated carbon ions using a 4-cm spread Bragg peak. Animals were positioned in the heavy-ion beam so that the ventral thoracic skin surface was 1 cm distal to the proximal peak of the modified beam. Early skin reactions from 6 to 30 days postirradiation were assessed. Using the average skin reactions produced in this period, it was found that the relative biological effect (RBE) for single doses of carbon ions was about 1.6 (5-17 Gy per fraction), for two fractions about 1.8 (5-17 Gy perfraction), and for five fractions about 1.9 (2.4-7.2 Gy per fraction). The fractional amount of sublethal damage repaired after carbon ion irradiation was about 0.3 (at dose levels of 2.4-8.0 Gy per fraction) compared to a value of about 0.45 (at dose levels of 60-13.0 Gy per fraction) found for the fractionated X irradiations, indicting about a 33% decrease in the relative amount of sublethal damage repaired after carbon ion irradiation in this position in the spread Bragg curve. Also, data were interpreted using plots of the reciprocal total dose needed to produce a given level of skin damage versus the dose per fraction used in the multifraction experiments, and of the RBE versus dose per fraction obtained from a nonparametric analysis of the responses. These approaches allow estimation of RBE at dose levels relevant to the clinical situation. Also, estimation may be made of the maximum permissible RBE by using the zero dose intercept value from the linear reciprocal dose plot. With this approach, the RBE at a dose level of 2 Gy is about 2.5 and the maximum RBE value is about 2.7

  15. The Effects of Low Dose Irradiation on Inflammatory Response Proteins in a 3D Reconstituted Human Skin Tissue Model

    Energy Technology Data Exchange (ETDEWEB)

    Varnum, Susan M.; Springer, David L.; Chaffee, Mary E.; Lien, Katie A.; Webb-Robertson, Bobbie-Jo M.; Waters, Katrina M.; Sacksteder, Colette A.

    2012-12-01

    Skin responses to moderate and high doses of ionizing radiation include the induction of DNA repair, apoptosis, and stress response pathways. Additionally, numerous studies indicate that radiation exposure leads to inflammatory responses in skin cells and tissue. However, the inflammatory response of skin tissue to low dose radiation (<10 cGy) is poorly understood. In order to address this, we have utilized a reconstituted human skin tissue model (MatTek EpiDerm FT) and assessed changes in 23 cytokines twenty-four and forty eight hours following treatment of skin with either 3 or 10 cGy low-dose of radiation. Three cytokines, IFN-γ, IL-2, MIP-1α, were significantly altered in response to low dose radiation. In contrast, seven cytokines were significantly altered in response to a high radiation dose of 200 cGy (IL-2, IL-10, IL-13, IFN-γ, MIP-1α, TNF α, and VEGF) or the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (G-CSF, GM-CSF, IL-1α, IL-8, MIP-1α, MIP-1β, RANTES). Additionally, radiation induced inflammation appears to have a distinct cytokine response relative to the non-radiation induced stressor, TPA. Overall, these results indicate that there are subtle changes in the inflammatory protein levels following exposure to low dose radiation and this response is a sub-set of what is seen following a high dose in a human skin tissue model.

  16. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Directory of Open Access Journals (Sweden)

    M. de Troya-Martín

    2016-01-01

    Full Text Available Background. Skin Cancer Index (SCI is a specific questionnaire measuring health related quality of life (HRQL in patients with cervicofacial non-melanoma skin cancer (CFNMSC. The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0, 7 days after surgery (t1, and 5 months after surgery (t2. The scale and subscales scores (C1: social/appearance, C2: emotional were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p<0.05. The lowest values were found at time of diagnosis and postsurgery. Women and patients under 65 years showed the lowest values at the three times. Limitations. Concrete geographic and cultural area. Clinical and histological variables are not analysed. Conclusions. Our results confirm responsiveness of the Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  17. The effect of the moisture content of a local heat source on the blood flow response of the skin.

    Science.gov (United States)

    Petrofsky, Jerrold Scott; Bains, Gurinder; Raju, Chinna; Lohman, Everett; Berk, Lee; Prowse, Michelle; Gunda, Shashi; Madani, Piyush; Batt, Jennifer

    2009-09-01

    Numerous studies have examined the effect of local and global heating of the body on skin blood flow. However, the effect of the moisture content of the heat source on the skin blood flow response has not been examined. Thirty-three subjects, without diabetes or cardiovascular disease, between the ages of 22 and 32 were examined to determine the relationship between the effects of dry vs. moist heat applied for the same length of time and with the skin clamped at the same skin temperature on the blood flow response of the skin. The skin, heated with an infrared heat lamp (skin temperature monitored with a thermocouple) to 40 degrees C for 15 min, was either kept moist with wet towels or, in a separate experiment, kept dry with Drierite (a desiccant) between the towels to remove any moisture. Before and after heat exposure of the forearm, blood pressure, heart rate, skin moisture content, skin temperature, and skin blood flow were recorded. The results of the experiment showed that there was no change in skin moisture after 15 min exposure to dry heat at 40 degrees C. However, with moist heat, skin moisture increased by 43.7%, a significant increase (P heat, blood flow increased from the resting value by 282.3% whereas with moist heat, blood flow increased by 386% over rest, a significant increase over dry heat (P heat was a better heating modality than dry heat. The reason may be linked to moisture sensitivity in calcium channels in the vascular endothelial cell.

  18. Characterization and diagnostic evaluation of chronic polyneuropathies induced by oxaliplatin and docetaxel comparing skin biopsy to quantitative sensory testing and nerve conduction studies

    DEFF Research Database (Denmark)

    Krøigård, T; Schrøder, H D; Qvortrup, C

    2014-01-01

    was to characterize the neuropathies with regard to symptoms, neurological signs and objective evidence of damage to the structure and function of the peripheral nerves. Furthermore, the diagnostic values of skin biopsy, quantitative sensory testing (QST) and nerve conduction studies (NCS) were compared. METHODS......: Patients complaining of neuropathy symptoms at least 3 months after completion of treatment with oxaliplatin (n = 20) or docetaxel (n = 20) were recruited from the Department of Oncology or using hospital records. Neuropathy scores were determined along with the intraepidermal nerve fibre density in skin....... Mechanical detection threshold was most often affected in the QST. NCS, QTS and skin biopsy were abnormal in 11, 13 and 17 and 7, 11 and 15 of the oxaliplatin-treated patients and docetaxel-treated patients, respectively. CONCLUSIONS: Chemotherapy-induced peripheral neuropathy after oxaliplatin or docetaxel...

  19. Influence of Conductive and Semi-Conductive Nanoparticles on the Dielectric Response of Natural Ester-Based Nanofluid Insulation

    Directory of Open Access Journals (Sweden)

    M. Z. H. Makmud

    2018-02-01

    Full Text Available Nowadays, studies of alternative liquid insulation in high voltage apparatus have become increasingly important due to higher concerns regarding safety, sustainable resources and environmentally friendly issues. To fulfil this demand, natural ester has been extensively studied and it can become a potential product to replace mineral oil in power transformers. In addition, the incorporation of nanoparticles has been remarkable in producing improved characteristics of insulating oil. Although much extensive research has been carried out, there is no general agreement on the influence on the dielectric response of base oil due to the addition of different amounts and conductivity types of nanoparticle concentrations. Therefore, in this work, a natural ester-based nanofluid was prepared by a two-step method using iron oxide (Fe2O3 and titanium dioxide (TiO2 as the conductive and semi-conductive nanoparticles, respectively. The concentration amount of each nanoparticle types was varied at 0.01, 0.1 and 1.0 g/L. The nanofluid samples were characterised by visual inspection, morphology and the dynamic light scattering (DLS method before the dielectric response measurement was carried out for frequency-dependent spectroscopy (FDS, current-voltage (I-V, and dielectric breakdown (BD strength. The results show that the dielectric spectra and I-V curves of nanofluid-based iron oxide increases with the increase of iron oxide nanoparticle loading, while for titanium dioxide, it exhibits a decreasing response. The dielectric BD strength is enhanced for both types of nanoparticles at 0.01 g/L concentration. However, the increasing amount of nanoparticles at 0.1 and 1.0 g/L led to a contrary dielectric BD response. Thus, the results indicate that the augmentation of conductive nanoparticles in the suspension can lead to overlapping mechanisms. Consequently, this reduces the BD strength compared to pristine materials during electron injection in high electric

  20. Chemical signals of fish skin for the attachment response of Acanthostomum brauni cercariae.

    Science.gov (United States)

    Haas, W; de Nuñez, M O

    1988-01-01

    The chemical signals of the skin surface of fish, which stimulate the attachment responses of Acanthostomum brauni cercariae, were identified by offering chemicals and fish-skin extracts in agarose substrates to the cercariae. Smaller molecules such as amino acids, fatty acids, monosaccharides, electrolytes, urea, and carbonate solutions did not stimulate attachments, but hyaluronic acid had some effects. Bovine submaxillary glycoproteins had a strong stimulating activity that disappeared after neuraminidase digestion. The stimulating components of the skin surface of fish were hydrophilic substances with molecular weights of more than 10,000. They were sensitive to neuraminidase digestion but not to hyaluronidase digestion and thus can be identified as glycoproteins. A. brauni cercariae respond only to the complete glycoprotein molecules and not to their monosaccharide components. The known attachment triggers of other cercariae are small molecules. Large glycoproteins as host signals for A. brauni cercariae may be an adaptation to muddy habitats, where various substances with low molecular weights may interfere with the host identification.

  1. Raman spectroscopy: in vivo quick response code of skin physiological status

    Science.gov (United States)

    Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette

    2014-11-01

    Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

  2. A comparison between conductive and infrared devices for measuring mean skin temperature at rest, during exercise in the heat, and recovery.

    Science.gov (United States)

    Bach, Aaron J E; Stewart, Ian B; Disher, Alice E; Costello, Joseph T

    2015-01-01

    Skin temperature assessment has historically been undertaken with conductive devices affixed to the skin. With the development of technology, infrared devices are increasingly utilised in the measurement of skin temperature. Therefore, our purpose was to evaluate the agreement between four skin temperature devices at rest, during exercise in the heat, and recovery. Mean skin temperature ([Formula: see text]) was assessed in thirty healthy males during 30 min rest (24.0 ± 1.2°C, 56 ± 8%), 30 min cycle in the heat (38.0 ± 0.5°C, 41 ± 2%), and 45 min recovery (24.0 ± 1.3°C, 56 ± 9%). [Formula: see text] was assessed at four sites using two conductive devices (thermistors, iButtons) and two infrared devices (infrared thermometer, infrared camera). Bland-Altman plots demonstrated mean bias ± limits of agreement between the thermistors and iButtons as follows (rest, exercise, recovery): -0.01 ± 0.04, 0.26 ± 0.85, -0.37 ± 0.98°C; thermistors and infrared thermometer: 0.34 ± 0.44, -0.44 ± 1.23, -1.04 ± 1.75°C; thermistors and infrared camera (rest, recovery): 0.83 ± 0.77, 1.88 ± 1.87°C. Pairwise comparisons of [Formula: see text] found significant differences (p heat and recovery. These results indicate poor agreement between conductive and infrared devices at rest, during exercise in the heat, and subsequent recovery. Infrared devices may not be suitable for monitoring [Formula: see text] in the presence of, or following, metabolic and environmental induced heat stress.

  3. The nonlinear flexural response of a whole teleost fish: Contribution of scales and skin.

    Science.gov (United States)

    Szewciw, Lawrence; Zhu, Deju; Barthelat, Francois

    2017-12-01

    The scaled skin of fish is an intricate system that provides mechanical protection against hard and sharp puncture, while maintaining the high flexural compliance required for unhindered locomotion. This unusual combination of local hardness and global compliance makes fish skin an interesting model for bioinspired protective systems. In this work we investigate the flexural response of whole teleost fish, and how scales may affect global flexural stiffness. A bending moment is imposed on the entire body of a striped bass (Morone saxatilis). Imaging is used to measure local curvature, to generate moment-curvature curves as function of position along the entire axis of the fish. We find that the flexural stiffness is the highest in the thick middle portion of the fish, and lowest in the caudal and rostral ends. The flexural response is nonlinear, with an initial soft response followed by significant stiffening at larger flexural deformations. Low flexural stiffness at low curvatures promotes efficient swimming, while higher stiffness at high curvatures enables a possible tendon effect, where the mechanical energy at the end of a stroke is stored in the form of strain energy in the fish skin. To assess the contribution of the scales to stiffening we performed flexural tests with and without scales, following a careful protocol to take in account tissue degradation and the effects of temperature. Our findings suggest that scales do not substantially increase the whole body flexural stiffness of teleost fish over ranges of deformations which are typical of swimming and maneuvering. Teleost scales are thin and relatively flexible, so they can accommodate large flexural deformations. This finding is in contrast to the bulkier ganoid scales which were shown in previous reports to have a profound impact of global flexural deformations and swimming in fish like gar or Polypterus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. A Study on the Effects of Sympathetic Skin Response Parameters in Diagnosis of Fibromyalgia Using Artificial Neural Networks.

    Science.gov (United States)

    Ozkan, Ozhan; Yildiz, Murat; Arslan, Evren; Yildiz, Sedat; Bilgin, Suleyman; Akkus, Selami; Koyuncuoglu, Hasan R; Koklukaya, Etem

    2016-03-01

    Fibromyalgia syndrome (FMS), usually observed commonly in females over age 30, is a rheumatic disease accompanied by extensive chronic pain. In the diagnosis of the disease non-objective psychological tests and physiological tests and laboratory test results are evaluated and clinical experiences stand out. However, these tests are insufficient in differentiating FMS with similar diseases that demonstrate symptoms of extensive pain. Thus, objective tests that would help the diagnosis are needed. This study analyzes the effect of sympathetic skin response (SSR) parameters on the auxiliary tests used in FMS diagnosis, the laboratory tests and physiological tests. The study was conducted in Suleyman Demirel University, Faculty of Medicine, Physical Medicine and Rehabilitation Clinic in Turkey with 60 patients diagnosed with FMS for the first time and a control group of 30 healthy individuals. In the study all participants underwent laboratory tests (blood tests), certain physiological tests (pulsation, skin temperature, respiration) and SSR measurements. The test data and SSR parameters obtained were classified using artificial neural network (ANN). Finally, in the ANN framework, where only laboratory and physiological test results were used as input, a simulation result of 96.51 % was obtained, which demonstrated diagnostic accuracy. This data, with the addition of SSR parameter values obtained increased to 97.67 %. This result including SSR parameters - meaning a higher diagnostic accuracy - demonstrated that SSR could be a new auxillary diagnostic method that could be used in the diagnosis of FMS.

  5. Differences in finger skin contact cooling response between an arterial occlusion and a vasodilated condition.

    Science.gov (United States)

    Jay, Ollie; Havenith, George

    2006-05-01

    To assess the presence and magnitude of the effect of skin blood flow on finger skin cooling on contact with cold objects against the background of circulatory disorder risks in occupational exposures, this study investigates the effect of zero vs. close-to-maximal hand blood flow on short-term (cooling response at a contact pressure that allows capillary perfusion of the distal pulp of the fingertip. Six male volunteers touched a block of aluminium with a finger contact force of 0.5 N at a temperature of -2 degrees C under a vasodilated and an occluded condition. Before both conditions, participants were required to exercise in a hot room for > or = 30 min for cutaneous vasodilation to occur (increase in rectal temperature of 1 degrees C). Under the vasodilated condition, forearm blood flow rate rose as high as 16.8 ml.100 ml(-1).min(-1). Under the occluded condition, the arm was exsanguinated, after which a blood pressure cuff was secured on the wrist inducing arterial occlusion. Contact temperature of the finger pad during the subsequent cold contact exposure was measured. No significant difference was found between the starting skin temperatures for the two blood flow conditions, but a distinct difference in shape of the contact cooling curve was apparent between the two blood flow conditions, with Newtonian cooling observed under the occluded condition, whereas a rewarming of the finger skin toward the end of the exposure occurred for the vasodilated condition. Blood flow was found to significantly increase contact temperature from 40 s onward (P cooling during a vasodilated state.

  6. Staphylococcus aureus α-toxin modulates skin host response to viral infection.

    Science.gov (United States)

    Bin, Lianghua; Kim, Byung Eui; Brauweiler, Anne; Goleva, Elena; Streib, Joanne; Ji, Yinduo; Schlievert, Patrick M; Leung, Donald Y M

    2012-09-01

    Patients with atopic dermatitis (AD) with a history of eczema herpeticum have increased staphylococcal colonization and infections. However, whether Staphylococcus aureus alters the outcome of skin viral infection has not been determined. We investigated whether S aureus toxins modulated host response to herpes simplex virus (HSV) 1 and vaccinia virus (VV) infections in normal human keratinocytes (NHKs) and in murine infection models. NHKs were treated with S aureus toxins before incubation of viruses. BALB/c mice were inoculated with S aureus 2 days before VV scarification. Viral loads of HSV-1 and VV were evaluated by using real-time PCR, a viral plaque-forming assay, and immunofluorescence staining. Small interfering RNA duplexes were used to knockdown the gene expression of the cellular receptor of α-toxin, a disintegrin and metalloprotease 10 (ADAM10). ADAM10 protein and α-toxin heptamers were detected by using Western blot assays. We demonstrate that sublytic staphylococcal α-toxin increases viral loads of HSV-1 and VV in NHKs. Furthermore, we demonstrate in vivo that the VV load is significantly greater (P skin inoculated with an α-toxin-producing S aureus strain compared with murine skin inoculated with the isogenic α-toxin-deleted strain. The viral enhancing effect of α-toxin is mediated by ADAM10 and is associated with its pore-forming property. Moreover, we demonstrate that α-toxin promotes viral entry in NHKs. The current study introduces the novel concept that staphylococcal α-toxin promotes viral skin infection and provides a mechanism by which S aureus infection might predispose the host toward disseminated viral infections. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  7. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  8. Postural vascular response in human skin: passive and active reactions to alteration of transmural pressure.

    Science.gov (United States)

    Jepsen, H; Gaehtgens, P

    1993-09-01

    Laser-Doppler (LD) fluxmetry was performed in the palmar finger skin of healthy subjects to study the mechanisms contributing to the postural vascular response. Local transmural pressure in the skin blood vessels of the region studied was altered for 1 min in two experimental series either by passive movement of the arm to different vertical hand positions relative to heart level or by application of external pressure (-120-180 mmHg) to the finger. Heart and respiratory rate, arterial blood pressure, and LD flux in the contralateral finger (kept at heart level) were measured. The measurements suggest a compound reaction of local (myogenic) and systemic (neurogenic) mechanisms: the local regulatory component appears as a graded active vascular response elicited by passive vessel distension or compression. A systemic component, associated with a single deep inspiration, is frequently observed during the actual movement of the arm. In addition, prolonged holding of the test hand in a given vertical position also elicits a delayed vascular response in the control hand at heart level, which may be generated by volume receptors in the intrathoracic low-pressure system.

  9. Relation between chloride exchange diffusion and a conductive chloride pathway across the isolated skin of the toad (Bufo bufo)

    DEFF Research Database (Denmark)

    Kristensen, P; Larsen, Erik Hviid

    1978-01-01

    Substitution of chloride in the outside bathing medium of the toad skin with bromide, iodide, nitrate and sulphate leads to a reduction in the apparent exchange diffusion of chloride across this tissue, and also to a reduction of the chloride current recorded during hyperpolarization. A series...

  10. Skin-Resident T Cells Drive Dermal Dendritic Cell Migration in Response to Tissue Self-Antigen.

    Science.gov (United States)

    Ali, Niwa; Zirak, Bahar; Truong, Hong-An; Maurano, Megan M; Gratz, Iris K; Abbas, Abul K; Rosenblum, Michael D

    2018-05-01

    Migratory dendritic cell (DC) subsets deliver tissue Ags to draining lymph nodes (DLNs) to either initiate or inhibit T cell-mediated immune responses. The signals mediating DC migration in response to tissue self-antigen are largely unknown. Using a mouse model of inducible skin-specific self-antigen expression, we demonstrate that CD103 + dermal DCs (DDCs) rapidly migrate from skin to skin DLN (SDLNs) within the first 48 h after Ag expression. This window of time was characterized by the preferential activation of tissue-resident Ag-specific effector T cells (Teffs), with no concurrent activation of Ag-specific Teffs in SDLNs. Using genetic deletion and adoptive transfer approaches, we show that activation of skin-resident Teffs is required to drive CD103 + DDC migration in response to tissue self-antigen and this Batf3-dependent DC population is necessary to mount a fulminant autoimmune response in skin. Conversely, activation of Ag-specific Teffs in SDLNs played no role in DDC migration. Our studies reveal a crucial role for skin-resident T cell-derived signals, originating at the site of self-antigen expression, to drive DDC migration during the elicitation phase of an autoimmune response. Copyright © 2018 by The American Association of Immunologists, Inc.

  11. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  12. 575 Photoaging Attenuates Skin Test Response to Histamine More Than Natural Aging

    OpenAIRE

    King, Monroe James; Fitzhugh, David; Lockey, Richard F.

    2012-01-01

    Background Clinical experience suggests that skin test reactivity is often decreased in photo-exposed skin versus sun-protected skin in older individuals. The current study was designed to address whether photoaging or natural aging of skin causes a greater diminution in skin test reponse. Methods Prick-puncture skin tests to histamine were performed on sun-exposed and sun-protected areas in younger (n = 61, age 20–50) and older (n = 63, age 60–87) adult volunteers who were recruited for skin...

  13. Responsible Conduct of Research in Communication Sciences and Disorders: Faculty and Student Perceptions

    Science.gov (United States)

    Minifie, Fred D.; Robey, Randall R.; Horner, Jennifer; Ingham, Janis C.; Lansing, Charissa; McCartney, James H.; Alldredge, Elham-Eid; Slater, Sarah C.; Moss, Sharon E.

    2011-01-01

    Purpose: Two Web-based surveys (Surveys I and II) were used to assess perceptions of faculty and students in Communication Sciences and Disorders (CSD) regarding the responsible conduct of research (RCR). Method: Survey questions addressed 9 RCR domains thought important to the responsible conduct of research: (a) human subjects protections; (b)…

  14. Cooling reduces the cutaneous afferent firing response to vibratory stimuli in glabrous skin of the human foot sole.

    Science.gov (United States)

    Lowrey, Catherine R; Strzalkowski, Nicholas D J; Bent, Leah R

    2013-02-01

    Skin on the foot sole plays an important role in postural control. Cooling the skin of the foot is often used to induce anesthesia to determine the role of skin in motor and balance control. The effect of cooling on the four classes of mechanoreceptor in the skin is largely unknown, and thus the aim of the present study was to characterize the effects of cooling on individual skin receptors in the foot sole. Such insight will better isolate individual receptor contributions to balance control. Using microneurography, we recorded 39 single nerve afferents innervating mechanoreceptors in the skin of the foot sole in humans. Afferents were identified as fast-adapting (FA) or slowly adapting (SA) type I or II (FA I n = 16, FA II n = 7, SA I n = 6, SA II n = 11). Receptor response to vibration was compared before and after cooling of the receptive field (2-20 min). Overall, firing response was abolished in 30% of all receptors, and this was equally distributed across receptor type (P = 0.69). Longer cooling times were more likely to reduce firing response below 50% of baseline; however, some afferent responses were abolished with shorter cooling times (2-5 min). Skin temperature was not a reliable indicator of the level of receptor activation and often became uncoupled from receptor response levels, suggesting caution in the use of this parameter as an indicator of anesthesia. When cooled, receptors preferentially coded lower frequencies in response to vibration. In response to a sustained indentation, SA receptors responded more like FA receptors, primarily coding "on-off" events.

  15. Syk/Src Pathway-Targeted Inhibition of Skin Inflammatory Responses by Carnosic Acid

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2012-01-01

    Full Text Available Carnosic acid (CA is a diterpene compound exhibiting antioxidative, anticancer, anti-angiogenic, anti-inflammatory, anti-metabolic disorder, and hepatoprotective and neuroprotective activities. In this study, the effect of CA on various skin inflammatory responses and its inhibitory mechanism were examined. CA strongly suppressed the production of IL-6, IL-8, and MCP-1 from keratinocyte HaCaT cells stimulated with sodium lauryl sulfate (SLS and retinoic acid (RA. In addition, CA blocked the release of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 from RAW264.7 cells activated by the toll-like receptor (TLR-2 ligands, Gram-positive bacterium-derived peptidoglycan (PGN and pam3CSK, and the TLR4 ligand, Gram-negative bacterium-derived lipopolysaccharide (LPS. CA arrested the growth of dermatitis-inducing Gram-positive and Gram-negative microorganisms such Propionibacterium acnes, Pseudomonas aeruginosa, and Staphylococcus aureus. CA also blocked the nuclear translocation of nuclear factor (NF-κB and its upstream signaling including Syk/Src, phosphoinositide 3-kinase (PI3K, Akt, inhibitor of κBα (IκBα kinase (IKK, and IκBα for NF-κB activation. Kinase assays revealed that Syk could be direct enzymatic target of CA in its anti-inflammatory action. Therefore, our data strongly suggest the potential of CA as an anti-inflammatory drug against skin inflammatory responses with Src/NF-κB inhibitory properties.

  16. Optimisation of gelatin extraction from Unicorn leatherjacket (Aluterus monoceros) skin waste: response surface approach.

    Science.gov (United States)

    Hanjabam, Mandakini Devi; Kannaiyan, Sathish Kumar; Kamei, Gaihiamngam; Jakhar, Jitender Kumar; Chouksey, Mithlesh Kumar; Gudipati, Venkateshwarlu

    2015-02-01

    Physical properties of gelatin extracted from Unicorn leatherjacket (Aluterus monoceros) skin, which is generated as a waste from fish processing industries, were optimised using Response Surface Methodology (RSM). A Box-Behnken design was used to study the combined effects of three independent variables, namely phosphoric acid (H3PO4) concentration (0.15-0.25 M), extraction temperature (40-50 °C) and extraction time (4-12 h) on different responses like yield, gel strength and melting point of gelatin. The optimum conditions derived by RSM for the yield (10.58%) were 0.2 M H3PO4 for 9.01 h of extraction time and hot water extraction of 45.83 °C. The maximum achieved gel strength and melting point was 138.54 g and 22.61 °C respectively. Extraction time was found to be most influencing variable and had a positive coefficient on yield and negative coefficient on gel strength and melting point. The results indicated that Unicorn leatherjacket skins can be a source of gelatin having mild gel strength and melting point.

  17. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K [University of Washington, Department of Bioengineering, Seattle, Washington 98195 (United States)

    2014-08-31

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  18. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Science.gov (United States)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.

    2014-08-01

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  19. Impact of Age and Insulin-Like Growth Factor-1 on DNA Damage Responses in UV-Irradiated Human Skin.

    Science.gov (United States)

    Kemp, Michael G; Spandau, Dan F; Travers, Jeffrey B

    2017-02-26

    The growing incidence of non-melanoma skin cancer (NMSC) necessitates a thorough understanding of its primary risk factors, which include exposure to ultraviolet (UV) wavelengths of sunlight and age. Whereas UV radiation (UVR) has long been known to generate photoproducts in genomic DNA that promote genetic mutations that drive skin carcinogenesis, the mechanism by which age contributes to disease pathogenesis is less understood and has not been sufficiently studied. In this review, we highlight studies that have considered age as a variable in examining DNA damage responses in UV-irradiated skin and then discuss emerging evidence that the reduced production of insulin-like growth factor-1 (IGF-1) by senescent fibroblasts in the dermis of geriatric skin creates an environment that negatively impacts how epidermal keratinocytes respond to UVR-induced DNA damage. In particular, recent data suggest that two principle components of the cellular response to DNA damage, including nucleotide excision repair and DNA damage checkpoint signaling, are both partially defective in keratinocytes with inactive IGF-1 receptors. Overcoming these tumor-promoting conditions in aged skin may therefore provide a way to lower aging-associated skin cancer risk, and thus we will consider how dermal wounding and related clinical interventions may work to rejuvenate the skin, re-activate IGF-1 signaling, and prevent the initiation of NMSC.

  20. Impact of Age and Insulin-Like Growth Factor-1 on DNA Damage Responses in UV-Irradiated Human Skin

    Directory of Open Access Journals (Sweden)

    Michael G. Kemp

    2017-02-01

    Full Text Available The growing incidence of non-melanoma skin cancer (NMSC necessitates a thorough understanding of its primary risk factors, which include exposure to ultraviolet (UV wavelengths of sunlight and age. Whereas UV radiation (UVR has long been known to generate photoproducts in genomic DNA that promote genetic mutations that drive skin carcinogenesis, the mechanism by which age contributes to disease pathogenesis is less understood and has not been sufficiently studied. In this review, we highlight studies that have considered age as a variable in examining DNA damage responses in UV-irradiated skin and then discuss emerging evidence that the reduced production of insulin-like growth factor-1 (IGF-1 by senescent fibroblasts in the dermis of geriatric skin creates an environment that negatively impacts how epidermal keratinocytes respond to UVR-induced DNA damage. In particular, recent data suggest that two principle components of the cellular response to DNA damage, including nucleotide excision repair and DNA damage checkpoint signaling, are both partially defective in keratinocytes with inactive IGF-1 receptors. Overcoming these tumor-promoting conditions in aged skin may therefore provide a way to lower aging-associated skin cancer risk, and thus we will consider how dermal wounding and related clinical interventions may work to rejuvenate the skin, re-activate IGF-1 signaling, and prevent the initiation of NMSC.

  1. Longitudinal changes of nerve conduction velocity, distal motor latency, compound motor action potential duration, and skin temperature during prolonged exposure to cold in a climate chamber.

    Science.gov (United States)

    Maetzler, Walter; Klenk, Jochen; Becker, Clemens; Zscheile, Julia; Gabor, Kai-Steffen; Lindemann, Ulrich

    2012-09-01

    Changes of nerve conduction velocity (NCV), distal motor latency (DML), compound motor action potential (CMAP) duration, and skin temperature with regard to cold have been investigated by use of ice packs or cold water baths, but not after cooling of environmental temperature which has higher ecological validity. The aim of this study was to investigate these parameters during cooled room temperature. NCV, DML, and CMAP duration of the common fibular nerve, and skin temperature were measured in 20 healthy young females during exposure to 15°C room temperature, coming from 25°C room. We found that NCV decreased and DML increased linearly during 45 min observation time, in contrast to CMAP duration and skin temperature which changes followed an exponential curve. To the best of our knowledge, this is the first study investigating changes of these parameters during exposure to environmental cold. The results may pilot some new hypotheses and studies on physiological and pathological changes of the peripheral nervous system and skin to environmental cold, e.g., in elderly with peripheral neuropathies.

  2. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  3. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  4. Auditory Brainstem Responses to Bone-Conducted Brief Tones in Young Children with Conductive or Sensorineural Hearing Loss

    Directory of Open Access Journals (Sweden)

    Jennifer L. Hatton

    2012-01-01

    Full Text Available The bone-conduction (BC tone ABR has been used clinically for over 20 years. The current study formally evaluated the test performance of the BC tone-evoked ABR in infants with hearing loss. Method. By comparing BC-ABR results to follow-up behavioural results, this study addressed two questions: (i whether the BC tone ABR was successful in differentiating children with conductive versus sensorineural hearing loss (Study A; conductive: 68 ears; SNHL: 129 ears and (ii the relationship between BC ABR and behavioural hearing loss severity (Study B: 2000 Hz: 104 ears; 500 Hz: 47 ears. Results. Results demonstrate that the “normal” BC-ABR levels accurately differentiated normal versus elevated cochlear sensitivity (accuracy: 98% for 2000 Hz; 98% for 500 Hz. A subset of infants in Study A with elevated BC-ABR (i.e., no response at normal level had additional testing at higher intensities, which allowed for categorization of the degree of cochlear impairment. Study B results indicate that the BC ABR accurately categorizes the degree of cochlear hearing loss for 2000 Hz (accuracy = 95.2%. A preliminary dBnHL-to-dBHL correction factor of “0 dB” was determined for 2000 Hz BC ABR. Conclusions. These findings further support the use of BC tone ABR for diagnostic ABR testing.

  5. Auditory Brainstem Responses to Bone-Conducted Brief Tones in Young Children with Conductive or Sensorineural Hearing Loss

    Science.gov (United States)

    Hatton, Jennifer L.; Janssen, Renée M.; Stapells, David R.

    2012-01-01

    The bone-conduction (BC) tone ABR has been used clinically for over 20 years. The current study formally evaluated the test performance of the BC tone-evoked ABR in infants with hearing loss. Method. By comparing BC-ABR results to follow-up behavioural results, this study addressed two questions: (i) whether the BC tone ABR was successful in differentiating children with conductive versus sensorineural hearing loss (Study A; conductive: 68 ears; SNHL: 129 ears) and (ii) the relationship between BC ABR and behavioural hearing loss severity (Study B: 2000 Hz: 104 ears; 500 Hz: 47 ears). Results. Results demonstrate that the “normal” BC-ABR levels accurately differentiated normal versus elevated cochlear sensitivity (accuracy: 98% for 2000 Hz; 98% for 500 Hz). A subset of infants in Study A with elevated BC-ABR (i.e., no response at normal level) had additional testing at higher intensities, which allowed for categorization of the degree of cochlear impairment. Study B results indicate that the BC ABR accurately categorizes the degree of cochlear hearing loss for 2000 Hz (accuracy = 95.2%). A preliminary dBnHL-to-dBHL correction factor of “0 dB” was determined for 2000 Hz BC ABR. Conclusions. These findings further support the use of BC tone ABR for diagnostic ABR testing. PMID:22988461

  6. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  7. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac

    2011-03-11

    Determining the mechanical properties of an individual\\'s skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior forearm and posterior upper arm under a rich set of three-dimensional deformations. We investigated the suitability of the Ogden and Tong and Fung strain energy functions along with a quasi-linear viscoelastic law. Using non-linear optimization techniques, we found material parameters and in vivo pre-stresses for different volunteers. The model simulated the experiments with errors-of-fit ranging from 13.7 to 21.5%. Pre-stresses ranging from 28 to 92 kPa were estimated. We show that using only in-plane experimental data in the parameter optimization results in a poor prediction of the out-of-plane response. The identifiability of the model parameters, which are evaluated using different determinability criteria, improves by increasing the number of deformation orientations in the experiments. © 2011 Biomedical Engineering Society.

  8. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    Science.gov (United States)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.

    2015-09-01

    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  9. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    Science.gov (United States)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.

    2012-02-01

    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  10. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac; Taberner, Andrew; Nielsen, Poul

    2011-01-01

    Determining the mechanical properties of an individual's skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior

  11. A rare subset of skin-tropic regulatory T cells expressing Il10/Gzmb inhibits the cutaneous immune response.

    Science.gov (United States)

    Ikebuchi, Ryoyo; Teraguchi, Shunsuke; Vandenbon, Alexis; Honda, Tetsuya; Shand, Francis H W; Nakanishi, Yasutaka; Watanabe, Takeshi; Tomura, Michio

    2016-10-19

    Foxp3 + regulatory T cells (Tregs) migrating from the skin to the draining lymph node (dLN) have a strong immunosuppressive effect on the cutaneous immune response. However, the subpopulations responsible for their inhibitory function remain unclear. We investigated single-cell gene expression heterogeneity in Tregs from the dLN of inflamed skin in a contact hypersensitivity model. The immunosuppressive genes Ctla4 and Tgfb1 were expressed in the majority of Tregs. Although Il10-expressing Tregs were rare, unexpectedly, the majority of Il10-expressing Tregs co-expressed Gzmb and displayed Th1-skewing. Single-cell profiling revealed that CD43 + CCR5 + Tregs represented the main subset within the Il10/Gzmb-expressing cell population in the dLN. Moreover, CD43 + CCR5 + CXCR3 - Tregs expressed skin-tropic chemokine receptors, were preferentially retained in inflamed skin and downregulated the cutaneous immune response. The identification of a rare Treg subset co-expressing multiple immunosuppressive molecules and having tissue-remaining capacity offers a novel strategy for the control of skin inflammatory responses.

  12. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    International Nuclear Information System (INIS)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The effect of previous x-irradiation on the response to hyperthermia (44 0 C), x-irradiation, and irradiation combined with hyperthermia (43 0 C or 44 0 C) was studied in mouse foot skin. Irradiation of mice feet 90 days before, with 20 Gy, increased the subsequent response to heat alone, or combined with irradiation, as well as to irradiation alone. It had little effect on the thermal enhancement ratios for both acute and late skin reactions. Memory of the previous irradiation treatment could be masked when the temperature of the subsequent heat treatment alone, or combined with irradiation, was 44 0 C. Priming heat treatment induced resistance to a subsequent heat treatment and to a subsequent combined irradiation-heat treatment in normal as well as previously irradiated skin. When late skin reaction was considered, a larger 'memory' of the previous irradiation treatment was always evident, compared to acute skin reaction: the 'remembered' dose in the late skin reaction was about twice the 'remembered' dose in the acute reaction. (U.K.)

  13. Detecting electroporation by assessing the time constants in the exponential response of human skin to voltage controlled impulse electrical stimulation.

    Science.gov (United States)

    Bîrlea, Sinziana I; Corley, Gavin J; Bîrlea, Nicolae M; Breen, Paul P; Quondamatteo, Fabio; OLaighin, Gearóid

    2009-01-01

    We propose a new method for extracting the electrical properties of human skin based on the time constant analysis of its exponential response to impulse stimulation. As a result of this analysis an adjacent finding has arisen. We have found that stratum corneum electroporation can be detected using this analysis method. We have observed that a one time-constant model is appropriate for describing the electrical properties of human skin at low amplitude applied voltages (30V). Higher voltage amplitudes (>30V) have been proven to create pores in the skin's stratum corneum which offer a new, lower resistance, pathway for the passage of current through the skin. Our data shows that when pores are formed in the stratum corneum they can be detected, in-vivo, due to the fact that a second time constant describes current flow through them.

  14. The response of mouse skin to multiple small doses of radiation

    International Nuclear Information System (INIS)

    Denekamp, J.; Harris, S.R.

    1975-01-01

    The response of mouse skin has been tested by irradiating the foot of albino mice and scoring erythema and desquamation during the following month. Multiple small doses of 150, 250 and 350 rad have been given 'daily', and the test dose necessary to achieve a given reaction has been determined one day after the last small fraction. This test dose has been compared with the single dose necessary to produce the same reaction level in previously untreated mice, in order to determine the ratio of the slopes of the dose-response curve at low and high doses: Slope ratio = (single dose - test dose)/total fractionated priming dose. In three separate experiments the slope ratio decreased as the dose per fraction was reduced from 350 to 150 rad. This conflicts with the data of Dutreix et al, who found a constant slope ratio over this dose range. The present data are compared with those obtained by Denekamp using 4, 9 and 14 fractions of 300 rad and by Douglas et al, using the same experimental technique, over the dose range 45 to 200 rad/fraction. In addition, the results from multifraction experiments in which equal dose increments were administered until the requisite skin reaction was achieved are also analysed in terms of their slope ratio (Fowler et al. Douglas et al). When all these results are plotted it is impossible to be sure whether the slope ratio is decreasing over the range 300 to 45 rad per fraction, although it seems likely. Most of the values at low doses lie in the range 0.15 to 0.25, indicating that at low doses the radiation is only 15 to 25% as effective per rad in causing cell death as at higher doses. (author)

  15. An experimental evaluation of electrical skin conductivity changes in postmortem interval and its assessment for time of death estimation.

    Science.gov (United States)

    Cantürk, İsmail; Karabiber, Fethullah; Çelik, Safa; Şahin, M Feyzi; Yağmur, Fatih; Kara, Sadık

    2016-02-01

    In forensic medicine, estimation of the time of death (ToD) is one of the most important and challenging medico-legal problems. Despite the partial accomplishments in ToD estimations to date, the error margin of ToD estimation is still too large. In this study, electrical conductivity changes were experimentally investigated in the postmortem interval in human cases. Electrical conductivity measurements give some promising clues about the postmortem interval. A living human has a natural electrical conductivity; in the postmortem interval, intracellular fluids gradually leak out of cells. These leaked fluids combine with extra-cellular fluids in tissues and since both fluids are electrolytic, intracellular fluids help increase conductivity. Thus, the level of electrical conductivity is expected to increase with increased time after death. In this study, electrical conductivity tests were applied for six hours. The electrical conductivity of the cases exponentially increased during the tested time period, indicating a positive relationship between electrical conductivity and the postmortem interval. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac

    2011-06-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin\\'s mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  17. Skin mechanical properties and modeling: A review.

    Science.gov (United States)

    Joodaki, Hamed; Panzer, Matthew B

    2018-04-01

    The mechanical properties of the skin are important for various applications. Numerous tests have been conducted to characterize the mechanical behavior of this tissue, and this article presents a review on different experimental methods used. A discussion on the general mechanical behavior of the skin, including nonlinearity, viscoelasticity, anisotropy, loading history dependency, failure properties, and aging effects, is presented. Finally, commonly used constitutive models for simulating the mechanical response of skin are discussed in the context of representing the empirically observed behavior.

  18. Tuberculous Lymphadenitis: Skin Delayed-Type Hypersensitivity ...

    African Journals Online (AJOL)

    Tuberculous Lymphadenitis: Skin Delayed-Type Hypersensitivity Reaction and Cellular Immune Responses. ... The tuberculin skin test (TST) and peripheral blood mono-nuclear cells (PBMCs) culture were conducted using PPD. The cytokines were measured using commercial kits. Results: The mean TST was 24.6 ±8.0 ...

  19. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    NARCIS (Netherlands)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The skin of the mouse foot was used to study the effects of previous irradiation on the response to hyperthermia (44 degrees C), to irradiation, or to irradiation combined with hyperthermia (43 degrees C or 44 degrees C). Hyperthermia was applied by immersing the mouse foot into a hot waterbath and

  20. Spitting Image: Tick Saliva Assists the Causative Agent of Lyme Disease in Evading Host Skin's Innate Immune Response

    NARCIS (Netherlands)

    Hovius, Joppe W. R.

    2009-01-01

    Lyme disease is caused by the spirochete Borrelia burgdorferi and is transmitted through ticks. Inhibition of host skin's innate immune response might be instrumental to both tick feeding and B. burgdorferi transmission. The article by Marchal et al. describes how tick saliva suppresses B.

  1. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin.

    Science.gov (United States)

    Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E; Smith, Trevor R F

    2017-01-03

    The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin

    OpenAIRE

    Spandau, Dan F; Lewis, Davina A.; Somani, Ally-Khan; Travers, Jeffrey B.

    2012-01-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylacti...

  3. Vascular mapping of the retroauricular skin - proposal for a posterior superior surgical incision for transcutaneous bone-conduction hearing implants.

    Science.gov (United States)

    Perenyi, Adam; Bere, Zsofia; Jarabin, Janos; Sztano, Balazs; Kukla, Edit; Bikhazi, Ziad; Tiszlavicz, Laszlo; Toth, Ferenc; Kiss, Jozsef Geza; Rovo, Laszlo

    2017-01-17

    Passive transcutaneous osseointegrated hearing implant systems have become increasingly popular more recently. The area over the implant is vulnerable due to vibration and pressure from the externally worn sound processor. Good perfusion and neural integrity has the potential to reduce complications. The authors' objective was to determine the ideal surgical exposure to maintain perfusion and neural integrity and decrease surgical time as a result of reduced bleeding. The vascular anatomy of the temporal-parietal soft tissue was examined in a total of 50 subjects. Imaging diagnostics included magnetic resonance angiography in 12 and Doppler ultrasound in 25 healthy subjects to reveal the arterial network. Cadaver dissection of 13 subjects formed the control group. The prevalence of the arteries were statistically analyzed with sector analysis in the surgically relevant area. The main arterial branches of this region could be well identified with each method. Statistical analysis showed that the arterial pattern was similar in all subjects. The prevalence of major arteries is low in the upper posterior area though large in proximity to the auricle region. Diverse methods indicate the advantages of a posterior superior incision because the major arteries and nerves are at less risk of damage and best preserved. Although injury to these structures is rare, when it occurs, the distal flow is compromised and the peri-implant area is left intact. Hand-held Doppler is efficient and cost-effective in finding the best position for incision, if necessary, in subjects with a history of surgical stress to the retroauricular skin. This was a non-interventional study.

  4. The influence of increased membrane conductance on response properties of spinal motoneurons

    DEFF Research Database (Denmark)

    Grigonis, Ramunas; Guzulaitis, Robertas; Buisas, Rokas

    2016-01-01

    During functional spinal neural network activity motoneurons receive massive synaptic excitation and inhibition, and their membrane conductance increases considerably – they are switched to a high-conductance state. High-conductance states can substantially alter response properties of motoneurons....... In the present study we investigated how an increase in membrane conductance affects spike frequency adaptation, the gain (i.e., the slope of the frequency-current relationship) and the threshold for action potential generation. We used intracellular recordings from adult turtle motoneurons in spinal cord slices....... Membrane conductance was increased pharmacologically by extracellular application of the GABAA receptor agonist muscimol. Our findings suggest that an increase in membrane conductance of about 40–50% increases the magnitude of spike frequency adaptation, but does not change the threshold for action...

  5. The effect of salmeterol and salbutamol on mediator release and skin responses in immediate and late phase allergic cutaneous reactions

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Skov, P S

    1999-01-01

    on clinical and biochemical EAR and LPR in human skin. METHODS: Measurement of wheal and flare reactions to allergen, codeine, and histamine, and LPR (induration) to allergen. Assessment of histamine and prostaglandin D2 (PGD2) release by microdialysis technique in EAR, and measurement of mediators in LPR......, myeloperoxidase, or eosinophil cationic protein in LPR. CONCLUSIONS: Salmeterol and salbutamol inhibited allergen-induced skin responses, and reduced mediator release in EAR but not LPR. In general, the anti-inflammatory effects of salmeterol did not differ from those induced by salbutamol....

  6. Safety and skin delayed-type hypersensitivity response in vervet monkeys immunized with Leishmania donovani sonicate antigen delivered with adjuvants

    OpenAIRE

    Mutiso,Joshua M.; Macharia,John C.; Taracha,Evans; Wafula,Kellern; Rikoi,Hitler; Gicheru,Michael M.

    2012-01-01

    In this study, we report on the safety and skin delayed-type hypersensitivity (DTH), responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG), Montanide ISA 720 (MISA) or Monophosphoryl lipid A (MPLA) in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) levels ...

  7. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    OpenAIRE

    Laurence A. Marchat; Elena Aréchaga Ocampo; Mavil López Casamichana; Carlos Pérez-Plasencia; César López-Camarillo; Elizbeth Álvarez-Sánchez

    2011-01-01

    Solar ultraviolet (UV) radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-?B, AP-1, and NRF2...

  8. [An Investigation of the Role Responsibilities of Clinical Research Nurses in Conducting Clinical Trials].

    Science.gov (United States)

    Kao, Chi-Yin; Huang, Guey-Shiun; Dai, Yu-Tzu; Pai, Ya-Ying; Hu, Wen-Yu

    2015-06-01

    Clinical research nurses (CRNs) play an important role in improving the quality of clinical trials. In Taiwan, the increasing number of clinical trials has increased the number of practicing CRNs. Understanding the role responsibilities of CRNs is necessary to promote professionalism in this nursing category. This study investigates the role responsibilities of CRNs in conducting clinical trials / research. A questionnaire survey was conducted in a medical center in Taipei City, Taiwan. Eighty CRNs that were registered to facilitate and conduct clinical trials at this research site completed the survey. "Subject protection" was the CRN role responsibility most recognized by participants, followed by "research coordination and management", "subject clinical care", and "advanced professional nursing". Higher recognition scores were associated with higher importance scores and lower difficulty scores. Participants with trial training had significantly higher difficulty scores for "subject clinical care" and "research coordination and management" than their peers without this training (p research coordination and management" (p clinical practice.

  9. Doing global science a guide to responsible conduct in the global research enterprise

    CERN Document Server

    InterAcademy Partnership

    2016-01-01

    This concise introductory guide explains the values that should inform the responsible conduct of scientific research in today's global setting. Featuring accessible discussions and ample real-world scenarios, Doing Global Science covers proper conduct, fraud and bias, the researcher's responsibilities to society, communication with the public, and much more. The book places special emphasis on the international and highly networked environment in which modern research is done, presenting science as an enterprise that is being transformed by globalization, interdisciplinary research projects, team science, and information technologies. Accessibly written by an InterAcademy Partnership committee comprised of leading scientists from around the world, Doing Global Science is required reading for students, practitioners, and anyone concerned about the responsible conduct of science today.

  10. Cotton Fabric Coated with Conducting Polymers and its Application in Monitoring of Carnivorous Plant Response

    Directory of Open Access Journals (Sweden)

    Václav Bajgar

    2016-04-01

    Full Text Available The paper describes the electrical plant response to mechanical stimulation monitored with the help of conducting polymers deposited on cotton fabric. Cotton fabric was coated with conducting polymers, polyaniline or polypyrrole, in situ during the oxidation of respective monomers in aqueous medium. Thus, modified fabrics were again coated with polypyrrole or polyaniline, respectively, in order to investigate any synergetic effect between both polymers with respect to conductivity and its stability during repeated dry cleaning. The coating was confirmed by infrared spectroscopy. The resulting fabrics have been used as electrodes to collect the electrical response to the stimulation of a Venus flytrap plant. This is a paradigm of the use of conducting polymers in monitoring of plant neurobiology.

  11. Synergistic skin heat shock protein expression in response to combined laser treatment with a diode laser and ablative fractional lasers.

    Science.gov (United States)

    Paasch, Uwe; Sonja, Grunewald; Haedersdal, Merete

    2014-06-01

    Diode laser-based skin heating has been shown to minimise scars by interfering with wound healing responses through the induction of heat shock proteins (HSP). HSP are also induced after ablative fractional laser (AFXL) wound healing. AFXL itself is highly recommended for scar treatment. Therefore, the sequential combination of both modalities may produce superior outcomes. The aim of this study was to examine the pretreatment effects of a diode laser before AFXL on wound healing responses in terms of HSP up-regulation in an in vitro model. Immediate responses and responses on days 1, 3 or 6 post-procedure were studied in an in vitro porcine skin model (n = 240). Untreated samples served as control. Immunohistochemical investigation (Hsp70) was performed in all untreated controls, diode laser-, AFXL-, and in diode laser + AFXL-treated samples. Hsp70 was shown to be up-regulated by all interventions between days 1 and 6 after interventions. The largest effect was caused by the combination of a diode laser and an AFXL procedure. Diode laser exposure induces a skin HSP response that can be further enhanced by sequential AFXL treatment. Clinical studies are necessary to investigate the dose response of HSP on scar formation and refine suitable laser exposure settings.

  12. Effects of husbandry conditions on the skin colour and stress response of red porgy, Pagrus pagrus

    NARCIS (Netherlands)

    Salm, A.L. van der; Martinez, M.; Flik, G.; Wendelaar Bonga, S.E.

    2004-01-01

    Red porgy, Pagrus pagrus, is a potential candidate for aquaculture. However, darkening of the body occurs after capture of wild fish and during fanning of cultured animals. In fish, skin pigmentation is hormonally controlled and the main hormone involved in skin darkening,

  13. Inhibition of ultraviolet irradiation response of human skin by topical phlogostatic compounds

    International Nuclear Information System (INIS)

    Weirich, E.G.; Lutz, U.C.

    1977-01-01

    By adaption of the model of UV dermatitis in human skin a test procedure has been developed which facilitates realistic assessment of topical contra-inflammatory activity of steroidal as well as non-steroidal compounds. Sixt typical skin drug agents were tested according to their reaction inhibition effect. (orig./MG) [de

  14. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac; Taberner, Andrew; Nielsen, Poul

    2011-01-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin's mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  15. Clinical features, fungal load, coinfections, histological skin changes, and itraconazole treatment response of cats with sporotrichosis caused by Sporothrix brasiliensis.

    Science.gov (United States)

    de Souza, Elaine Waite; Borba, Cintia de Moraes; Pereira, Sandro Antonio; Gremião, Isabella Dib Ferreira; Langohr, Ingeborg Maria; Oliveira, Manoel Marques Evangelista; de Oliveira, Raquel de Vasconcellos Carvalhaes; da Cunha, Camila Rocha; Zancopé-Oliveira, Rosely Maria; de Miranda, Luisa Helena Monteiro; Menezes, Rodrigo Caldas

    2018-06-13

    Zoonotic sporotrichosis caused by the fungus Sporothrix brasiliensis is usually severe in cats. This study investigated the associations between clinical features, fungal load, coinfections, histological skin changes, and response to itraconazole in cats with sporotrichosis caused by S. brasiliensis. Fifty-two cats with skin lesions and a definitive diagnosis of sporotrichosis were treated with itraconazole for a maximum period of 36 weeks. The animals were submitted to clinical examination and two subsequent collections of samples from the same skin lesion for fungal diagnosis and histopathology, as well as serology for feline immunodeficiency (FIV) and leukaemia (FeLV) viruses. Thirty-seven (71%) cats were clinically cured. Nasal mucosa lesions and respiratory signs were associated with treatment failure. Cats coinfected with FIV/FeLV (n = 12) had a lower neutrophil count in the lesion. A high fungal load in skin lesions was linked to young age and treatment failure, as well as to a longer time of wound healing, poorly formed granulomas and fewer neutrophils, macrophages and lymphocytes in these lesions. These results indicate that itraconazole is effective, but nasal mucosal involvement, respiratory signs and high fungal loads in skin lesions are predictors of treatment failure that will assist in the development of better treatment protocols for cats.

  16. Isolation of fish skin and bone gelatin from tilapia (Oreochromis niloticus): Response surface approach

    Science.gov (United States)

    Arpi, N.; Fahrizal; Novita, M.

    2018-03-01

    In this study, gelatin from fish collagen, as one of halal sources, was extracted from tilapia (Oreochromis niloticus) skin and bone, by using Response Surface Methodology to optimize gelatin extraction conditions. Concentrations of alkaline NaOH and acid HCl, in the pretreatment process, and temperatures in extraction process were chosen as independent variables, while dependent variables were yield, gel strength, and emulsion activity index (EAI). The result of investigation showed that lower NaOH pretreatment concentrations provided proper pH extraction conditions which combine with higher extraction temperatures resulted in high gelatin yield. However, gelatin emulsion activity index increased proportionally to the decreased in NaOH concentrations and extraction temperatures. No significant effect of the three independent variables on the gelatin gel strength. RSM optimization process resulted in optimum gelatin extraction process conditions using alkaline NaOH concentration of 0.77 N, acid HCl of 0.59 N, and extraction temperature of 66.80 °C. The optimal solution formula had optimization targets of 94.38%.

  17. Sympathetic skin response and R-R interval variation in cases with rheumatoid arthritis.

    Science.gov (United States)

    Gozke, E; Erdogan, N; Akyuz, G; Turan, B; Akyuz, E; Us, O

    2003-03-01

    To investigate the autonomic nervus system involvement in cases with rheumatoid arthritis (RA) by assesing sympathetic skin response (SSR) and R-R interval variation (RRIV), 14 healthy women and 10 women with RA, all of them without clinic dysautonomies were examined. SSR's were recorded palmar surface of both hands and soles of both feet, after stimulating median and tibial nerves individually. RRIV's were assessed at rest and during six deep breathing in one minute with electrodes placed on dorsal surfaces of both hands. SSR could not be obtained from lower extremities of one case with RA. We could not find any significant difference between two groups in terms of SSR latencies. RRIV values obtained during deep breathing to those recorded at rest (D%/R%) was found to be significantly lower in RA cases than healthy controls. RRIV values increased with deep breathing in healthy subjects, while they decreased in 50% of the RA cases. We conclude that assessment of SSR and RRIV are valuble methods for revelation of subclinical autonomic involvement in cases with RA.

  18. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  19. Predictions of the electro-mechanical response of conductive CNT-polymer composites

    Science.gov (United States)

    Matos, Miguel A. S.; Tagarielli, Vito L.; Baiz-Villafranca, Pedro M.; Pinho, Silvestre T.

    2018-05-01

    We present finite element simulations to predict the conductivity, elastic response and strain-sensing capability of conductive composites comprising a polymeric matrix and carbon nanotubes. Realistic representative volume elements (RVE) of the microstructure are generated and both constituents are modelled as linear elastic solids, with resistivity independent of strain; the electrical contact between nanotubes is represented by a new element which accounts for quantum tunnelling effects and captures the sensitivity of conductivity to separation. Monte Carlo simulations are conducted and the sensitivity of the predictions to RVE size is explored. Predictions of modulus and conductivity are found in good agreement with published results. The strain-sensing capability of the material is explored for multiaxial strain states.

  20. Predicting photosynthesis and transpiration responses to ozone: decoupling modeled photosynthesis and stomatal conductance

    Directory of Open Access Journals (Sweden)

    D. Lombardozzi

    2012-08-01

    Full Text Available Plants exchange greenhouse gases carbon dioxide and water with the atmosphere through the processes of photosynthesis and transpiration, making them essential in climate regulation. Carbon dioxide and water exchange are typically coupled through the control of stomatal conductance, and the parameterization in many models often predict conductance based on photosynthesis values. Some environmental conditions, like exposure to high ozone (O3 concentrations, alter photosynthesis independent of stomatal conductance, so models that couple these processes cannot accurately predict both. The goals of this study were to test direct and indirect photosynthesis and stomatal conductance modifications based on O3 damage to tulip poplar (Liriodendron tulipifera in a coupled Farquhar/Ball-Berry model. The same modifications were then tested in the Community Land Model (CLM to determine the impacts on gross primary productivity (GPP and transpiration at a constant O3 concentration of 100 parts per billion (ppb. Modifying the Vcmax parameter and directly modifying stomatal conductance best predicts photosynthesis and stomatal conductance responses to chronic O3 over a range of environmental conditions. On a global scale, directly modifying conductance reduces the effect of O3 on both transpiration and GPP compared to indirectly modifying conductance, particularly in the tropics. The results of this study suggest that independently modifying stomatal conductance can improve the ability of models to predict hydrologic cycling, and therefore improve future climate predictions.

  1. Assessment of Skin Pathological Responses in the Yellowfin Seabream (Acanthopagrus latus under the Aeromonas hydrophila Exposure

    Directory of Open Access Journals (Sweden)

    Fatemeh Azadbakht

    2018-01-01

    Full Text Available Background: Bacterial diseases in cultured fish are considered the main problem to aquaculture system. Skin is the structure that covers the body in fish. Skin histopatological alterations were used to assess the effects of Aeromonas hydrophila exposure on the yellowfin seabream Acanthopagrus latus(. Methods: In this regard, 90 A. latus were exposed to sublethal concentrations of A. hydrophila (103,106 CFU/ml for 3 weeks. Results: Some more severe alternations found in the skin of fish exposed. The most frequent histopathological changes detected in the skin including hyperplasia of epidermis, hypertrophy and hyperplasia of the mucosal cells and dermis edema. Some more severe alternations found in the skin of fish exposed to higher level of A. hydrophila (106 CFU/ml included telangiectasia of dermis layer. In addition, according to the results of histometrical studies in treated fish compared to control group showed that thickness of epidermis and dermis layers were increased significantly (P<0.05. Conclusion: A. hydrophila can cause major histophatological changes in the skin of A. latus. In addition, histopathological changes of the skin provide helpful information about the environmental conditions and as particular biomarkers may provide imminent into evaluating the general health and stress status of fish.

  2. Creating a Three-Parent Child: An Educational Paradigm for the Responsible Conduct of Research

    Directory of Open Access Journals (Sweden)

    Ruth L. Fischbach

    2014-10-01

    Full Text Available The field of assisted reproduction is renowned for its remarkable advances and constant pushing forward of research boundaries in an effort to offer innovative and effective methods for enhancing fertility. Accompanying these advances, however, are physiological, psychological, and bioethical consequences that must be considered. These concomitant advances and consequences make assisted reproduction an excellent educational paradigm for inculcating responsible conduct in both research and clinical practice. Ultimately, responsible conduct rests on the ethical researcher and clinician. Here, we present the as-yet unapproved, contentious assisted reproductive technology of mitochondrial replacement transfer (MRT as an ideal educational platform to foster the responsible conduct of research by advancing dialogue among multidisciplinary scholars, researchers, and students. Using a likely future case, we present the basic science, legal, and ethical considerations, and the pedagogical principles and strategies for using MRT as an effective educational paradigm. Society will benefit when the ethical issues inherent in creating children with three genetic parents as well as germline interference are discussed across multiple academic levels that include researchers, legal experts, bioethicists, and government-appointed commissions. Furthermore, undergraduate and graduate students should be included because they will likely determine the ethical fates of these biotechnologies. While emerging assisted reproduction technologies such as MRT are highly complex and will take years to be readily available for patients in need, now is the time to consider their scientific, legal, ethical, and cultural/religious implications for ensuring the responsible conduct of research.

  3. 5 CFR 2606.106 - OGE employee Privacy Act rules of conduct and responsibilities.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false OGE employee Privacy Act rules of conduct and responsibilities. 2606.106 Section 2606.106 Administrative Personnel OFFICE OF GOVERNMENT ETHICS... requirement to inform each individual asked to supply information to be maintained in a system of records the...

  4. Electrical conductivity and piezoresistive response of 3D printed thermoplastic polyurethane/multiwalled carbon nanotube composites

    Science.gov (United States)

    Hohimer, Cameron J.; Petrossian, Gayaneh; Ameli, Amir; Mo, Changki; Pötschke, Petra

    2018-03-01

    Additive manufacturing (AM) is an emerging field experiencing rapid growth. This paper presents a feasibility study of using fused-deposition modeling (FDM) techniques with smart materials to fabricate objects with sensing and actuating capabilities. The fabrication of objects with sensing typically requires the integration and assembly of multiple components. Incorporating sensing elements into a single FDM process has the potential to significantly simplify manufacturing. The integration of multiple materials, especially smart materials and those with multi-functional properties, into the FDM process is challenging and still requires further development. Previous works by the authors have demonstrated a good printability of thermoplastic polyurethane/multiwall carbon nanotubes (TPU/MWCNT) while maintaining conductivity and piezoresistive response. This research explores the effects of layer height, nozzle temperature, and bed temperature on the electrical conductivity and piezoresistive response of printed TPU/MWCNT nanocomposites. An impedance analyzer was used to determine the conductivity of printed samples under different printing conditions from 5Hz-13MHz. The samples were then tested under compression loads to measure the piezoresistive response. Results show the conductivity and piezoresistive response are only slightly affected by the print parameters and they can be largely considered independent of the print conditions within the examined ranges of print parameters. This behavior simplifies the printing process design for TPU/MWCNT complex structures. This work demonstrates the possibility of manufacturing embedded and multidirectional flexible strain sensors using an inexpensive and versatile method, with potential applications in soft robotics, flexible electronics, and health monitoring.

  5. Integrating Responsible Conduct of Research Education into Undergraduate Biochemistry and Molecular Biology Laboratory Curricula

    Science.gov (United States)

    Hendrickson, Tamara L.

    2015-01-01

    Recently, a requirement for directed responsible conduct in research (RCR) education has become a priority in the United States and elsewhere. In the US, both the National Institutes of Health and the National Science Foundation require RCR education for all students who are financially supported by federal awards. The guidelines produced by these…

  6. Cracking the Code: Assessing Institutional Compliance with the Australian Code for the Responsible Conduct of Research

    Science.gov (United States)

    Morris, Suzanne E.

    2010-01-01

    This paper provides a review of institutional authorship policies as required by the "Australian Code for the Responsible Conduct of Research" (the "Code") (National Health and Medical Research Council (NHMRC), the Australian Research Council (ARC) & Universities Australia (UA) 2007), and assesses them for Code compliance.…

  7. Mesocosm Community Response Sensitivities to Specific Conductivity Comprised of Different Major Ions

    Science.gov (United States)

    Traditional toxicity test assays have been used to evaluate the relative sensitivity to different major ion mixtures as a proxy for understanding what the response of aquatic species growing in their natural environment would be during exposure to specific conductivity stress ema...

  8. Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing.

    Science.gov (United States)

    Orringer, Jeffrey S; Sachs, Dana L; Shao, Yuan; Hammerberg, Craig; Cui, Yilei; Voorhees, John J; Fisher, Gary J

    2012-10-01

    Fractionated ablative laser resurfacing has become a widely used treatment modality. Its clinical results are often found to approach those of traditional fully ablative laser resurfacing. To directly compare the molecular changes that result from fractionated and fully ablative carbon dioxide (CO(2)) laser resurfacing in photodamaged human skin. Photodamaged skin of 34 adult volunteers was focally treated at distinct sites with a fully ablative CO(2) laser and a fractionated CO(2) laser. Serial skin samples were obtained at baseline and several time points after treatment. Real-time reverse transcriptase polymerase chain reaction technology and immunohistochemistry were used to quantify molecular responses to each type of laser treatment. Fully ablative and fractionated CO(2) laser resurfacing induced significant dermal remodeling and collagen induction. After a single treatment, fractionated ablative laser resurfacing resulted in collagen induction that was approximately 40% to 50% as pronounced as that induced by fully ablative laser resurfacing. The fundamental cutaneous responses that result from fully ablative and fractionated carbon dioxide laser resurfacing are similar but differ in magnitude and duration, with the fully ablative procedure inducing relatively greater changes including more pronounced collagen induction. However, the molecular data reported here provide substantial support for fractionated ablative resurfacing as an effective treatment modality for improving skin texture. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  9. Response-surface models for deterministic effects of localized irradiation of the skin by discrete β/γ -emitting sources

    International Nuclear Information System (INIS)

    Scott, B.R.

    1995-01-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete Β- and γ-emitting (ΒγE) sources (e.g., ΒγE hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot ΒγE particles are 60 Co- or nuclear fuel-derived particles with diameters > 10 μm and < 3 mm and contain at least 3.7 kBq (0.1 μCi) of radioactivity. For such ΒγE sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for evaluating the risk of deterministic effects of localized Β irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete ΒγE sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to Β radiation from ΒγE sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects

  10. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.

    1995-12-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  11. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  12. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  13. DESCRIPTION OF BRAINSTEM AUDITORY EVOKED RESPONSES (AIR AND BONE CONDUCTION IN CHILDREN WITH NORMAL HEARING

    Directory of Open Access Journals (Sweden)

    A. V. Pashkov

    2014-01-01

    Full Text Available Diagnosis of hearing level in small children with conductive hearing loss associated with congenital craniofacial abnormalities, particularly with agenesis of external ear and external auditory meatus is a pressing issue. Conventional methods of assessing hearing in the first years of life, i. e. registration of brainstem auditory evoked responses to acoustic stimuli in the event of air conduction, does not give an indication of the auditory analyzer’s condition due to potential conductive hearing loss in these patients. This study was aimed at assessing potential of diagnosing the auditory analyzer’s function with registering brainstem auditory evoked responses (BAERs to acoustic stimuli transmitted by means of a bone vibrator. The study involved 17 children aged 3–10 years with normal hearing. We compared parameters of registering brainstem auditory evoked responses (peak V depending on the type of stimulus transmission (air/bone in children with normal hearing. The data on thresholds of the BAERs registered to acoustic stimuli in the event of air and bone conduction obtained in this study are comparable; hearing thresholds in the event of acoustic stimulation by means of a bone vibrator correlates with the results of the BAERs registered to the stimuli transmitted by means of air conduction earphones (r = 0.9. High correlation of thresholds of BAERs to the stimuli transmitted by means of a bone vibrator with thresholds of BAERs registered when air conduction earphones were used helps to assess auditory analyzer’s condition in patients with any form of conductive hearing loss.  

  14. Electrochemical skin conductance to detect sudomotor dysfunction, peripheral neuropathy and the risk of foot ulceration among Saudi patients with diabetes mellitus.

    Science.gov (United States)

    Sheshah, Eman; Madanat, Amal; Al-Greesheh, Fahad; Al-Qaisi, Dalal; Al-Harbi, Mohammad; Aman, Reem; Al-Ghamdi, Abdul Aziz; Al-Madani, Khaled

    2015-01-01

    Sudomotor dysfunction is manifested clinically as abnormal sweating leading to dryness of feet skin and increased risk of foot ulceration. The aim of this study was to test the performance of foot electrochemical skin conductance (ESC) to detect diabetic peripheral neuropathy and the risk of foot ulceration against traditional methods in Saudi patients with diabetes mellitus. This cross-sectional study was conducted on 296 Saudi patients with diabetes mellitus. Painful neuropathic symptoms were evaluated using the neuropathy symptom score (NSS). The risk of foot ulceration and diabetic peripheral neuropathy were determined using the neuropathy disability score (NDS). Vibration perception threshold (VPT) was assessed using neurothesiometer. Neurophysiological assessment of the right and left sural, peroneal and tibial nerves was performed in 222 participants. Diabetic peripheral neuropathy was defined according to the definition of the American Academy of Neurology. ESC was measured with Sudoscan. Feet-ESC decreased as the scores of sensory and motor function tests increased. Feet-ESC decreased as the NSS, NDS and severity of diabetic peripheral neuropathy increased. Sensitivity of feet-ESC peripheral neuropathy assessed by VPT ≥ 25 V, NDS ≥ 3, NDS ≥ 6 was 90.1, 61 and 63.8 % respectively and specificity 77, 85 and 81.9 % respectively. Sensitivity of feet-ESC peripheral neuropathy assessed by VPT ≥ 25 V, NDS ≥ 3, NDS ≥ 6 was 100, 80.6 and 80.9 % respectively. Sensitivity and specificity of feet-ESC peripheral neuropathy were 67.5 and 58.9 % respectively. Sudoscan a simple and objective tool can be used to detect diabetic peripheral neuropathy and the risk of foot ulceration among patients with diabetes mellitus. Prospective studies to confirm our results are warranted.

  15. Comparison of human skin opto-thermal response to near-infrared and visible laser irradiations: a theoretical investigation

    Energy Technology Data Exchange (ETDEWEB)

    Dai Tianhong [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Pikkula, Brian M [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Wang, Lihong V [Department of Biomedical Engineering, Texas A and M University, College Station, TX 77843 (United States); Anvari, Bahman [Department of Bioengineering, Rice University, Houston, TX 77251 (United States)

    2004-11-07

    Near-infrared wavelengths are absorbed less by epidermal melanin, and penetrate deeper into human skin dermis and blood than visible wavelengths. Therefore, laser irradiation using near-infrared wavelengths may improve the therapeutic outcome of cutaneous hyper-vascular malformations in moderately to heavily pigmented skin patients and those with large-sized blood vessels or blood vessels extending deeply into the skin. A mathematical model composed of a Monte Carlo algorithm to estimate the distribution of absorbed light, numerical solution of a bio-heat diffusion equation to calculate the transient temperature distribution, and a damage integral based on an empirical Arrhenius relationship to quantify the tissue damage was utilized to investigate the opto-thermal response of human skin to near-infrared and visible laser irradiations in conjunction with cryogen spray cooling. In addition, the thermal effects of a single continuous laser pulse and micropulse-composed laser pulse profiles were compared. Simulation results indicated that a 940 nm wavelength induces improved therapeutic outcome compared with a 585 and 595 nm wavelengths for the treatment of patients with large-sized blood vessels and moderately to heavily pigmented skin. On the other hand, a 585 nm wavelength shows the best efficacy in treating small-sized blood vessels, as characterized by the largest laser-induced blood vessel damage depth compared with 595 and 940 nm wavelengths. Dermal blood content has a considerable effect on the threshold incident dosage for epidermal damage, while the effect of blood vessel size is minimal. For the same macropulse duration and incident dosage, a micropulse-composed pulse profile results in higher peak temperature at the basal layer of skin epidermis than an ideal single continuous pulse profile.

  16. Numerical simulation on the thermal response of heat-conducting asphalt pavements

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Wu Shaopeng; Chen Mingyu; Zhang Yuan, E-mail: wusp@whut.edu.c [Key Laboratory of Silicate Materials Science and Engineering, Ministry of Education, Wuhan University of Technology, Wuhan 430070 (China)

    2010-05-01

    Using asphalt pavements as a solar collector is a subject of current interest all over the world because the sun provides a cheap and abundant source of clean and renewable energy, which can be captured by black asphalt pavements. A heat-conducting device is designed to absorb energy from the sun. In order to validate what parameters are critical in the asphalt collector, a finite element model is developed to predict the thermal response of the heat-conducting device compared to the conventional asphalt mixture. Some factors that may affect the asphalt pavement collector are considered, including the coefficient of heat conductivity of the asphalt pavement, the distance between pipes with the medium, water, and the pipe's diameter. Ultimately, the finite element model can provide pavement engineers with an efficient computational tool that can be a guide to the conductive asphalt solar collector's experiment in the laboratory.

  17. Numerical simulation on the thermal response of heat-conducting asphalt pavements

    International Nuclear Information System (INIS)

    Wang Hong; Wu Shaopeng; Chen Mingyu; Zhang Yuan

    2010-01-01

    Using asphalt pavements as a solar collector is a subject of current interest all over the world because the sun provides a cheap and abundant source of clean and renewable energy, which can be captured by black asphalt pavements. A heat-conducting device is designed to absorb energy from the sun. In order to validate what parameters are critical in the asphalt collector, a finite element model is developed to predict the thermal response of the heat-conducting device compared to the conventional asphalt mixture. Some factors that may affect the asphalt pavement collector are considered, including the coefficient of heat conductivity of the asphalt pavement, the distance between pipes with the medium, water, and the pipe's diameter. Ultimately, the finite element model can provide pavement engineers with an efficient computational tool that can be a guide to the conductive asphalt solar collector's experiment in the laboratory.

  18. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D.; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400–700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions. PMID:26121474

  19. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400-700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  20. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.

    Directory of Open Access Journals (Sweden)

    Manpreet Randhawa

    Full Text Available Visible light (400-700 nm lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  1. Methods of Using a Magnetic Field Response Sensor Within Closed, Electrically Conductive Containers

    Science.gov (United States)

    Woodward, Stanley E.; Taylor, Bryant D.

    2010-01-01

    Magnetic field response sensors are a class of sensors that are powered via oscillating magnetic fields, and when electrically active, respond with their own magnetic fields with attributes dependent upon the magnitude of the physical quantity being measured. A magnetic field response recorder powers and interrogates the magnetic sensors [see Magnetic-Field-Response Measurement- Acquisition System, NASA Tech Briefs Vol. 30, No, 6 (June 2006, page 28)]. Electrically conductive containers have low transmissivity for radio frequency (RF) energy and thus present problems for magnetic field response sensors. It is necessary in some applications to have a magnetic field response sensor s capacitor placed in these containers. Proximity to conductive surfaces alters the inductance and capacitance of the sensors. As the sensor gets closer to a conductive surface, the electric field and magnetic field energy of the sensor is reduced due to eddy currents being induced in the conductive surface. Therefore, the capacitors and inductors cannot be affixed to a conductive surface or embedded in a conductive material. It is necessary to have a fixed separation away from the conductive material. The minimum distance for separation is determined by the desired sensor response signal to noise ratio. Although the inductance is less than what it would be if it were not in proximity to the conductive surface, the inductance is fixed. As long as the inductance is fixed, all variations of the magnetic field response are due to capacitance changes. Numerous variations of inductor mounting can be utilized, such as providing a housing that provides separation from the conductive material as well as protection from impact damage. The sensor can be on the same flexible substrate with a narrow throat portion of the sensor between the inductor and the capacitor, Figure 1. The throat is of sufficient length to allow the capacitor to be appropriately placed within the container and the inductor

  2. Hydraulic conductivity in response to exchangeable sodium percentage and solution salt concentration

    Directory of Open Access Journals (Sweden)

    Jefferson Luiz de Aguiar Paes

    2014-10-01

    Full Text Available Hydraulic conductivity is determined in laboratory assays to estimate the flow of water in saturated soils. However, the results of this analysis, when using distilled or deionized water, may not correspond to field conditions in soils with high concentrations of soluble salts. This study therefore set out to determine the hydraulic conductivity in laboratory conditions using solutions of different electrical conductivities in six soils representative of the State of Pernambuco, with the exchangeable sodium percentage adjusted in the range of 5-30%. The results showed an increase in hydraulic conductivity with both decreasing exchangeable sodium percentage and increasing electrical conductivity in the solution. The response to the treatments was more pronounced in soils with higher proportion of more active clays. Determination of hydraulic conductivity in laboratory is routinely performed with deionized or distilled water. However, in salt affected soils, these determinations should be carried out using solutions of electrical conductivity different from 0 dS m-1, with values close to those determined in the saturation extracts.

  3. Threshold responses of Blackside Dace (Chrosomus cumberlandensis) and Kentucky Arrow Darter (Etheostoma spilotum) to stream conductivity

    Science.gov (United States)

    Hitt, Nathaniel P.; Floyd, Michael; Compton, Michael; McDonald, Kenneth

    2016-01-01

    Chrosomus cumberlandensis (Blackside Dace [BSD]) and Etheostoma spilotum (Kentucky Arrow Darter [KAD]) are fish species of conservation concern due to their fragmented distributions, their low population sizes, and threats from anthropogenic stressors in the southeastern United States. We evaluated the relationship between fish abundance and stream conductivity, an index of environmental quality and potential physiological stressor. We modeled occurrence and abundance of KAD in the upper Kentucky River basin (208 samples) and BSD in the upper Cumberland River basin (294 samples) for sites sampled between 2003 and 2013. Segmented regression indicated a conductivity change-point for BSD abundance at 343 μS/cm (95% CI: 123–563 μS/cm) and for KAD abundance at 261 μS/cm (95% CI: 151–370 μS/cm). In both cases, abundances were negligible above estimated conductivity change-points. Post-hoc randomizations accounted for variance in estimated change points due to unequal sample sizes across the conductivity gradients. Boosted regression-tree analysis indicated stronger effects of conductivity than other natural and anthropogenic factors known to influence stream fishes. Boosted regression trees further indicated threshold responses of BSD and KAD occurrence to conductivity gradients in support of segmented regression results. We suggest that the observed conductivity relationship may indicate energetic limitations for insectivorous fishes due to changes in benthic macroinvertebrate community composition.

  4. Sympathetic skin response in multiple sclerosis: a meta-analysis of case-control studies.

    Science.gov (United States)

    Margaritella, Nicolò; Mendozzi, Laura; Garegnani, Massimo; Gilardi, Elisabetta; Nemni, Raffaello; Pugnetti, Luigi

    2018-01-01

    The usefulness of sympathetic skin responses (SSR) in multiple sclerosis (MS) has been advocated by several studies in the last 20 years; however, due to a great heterogeneity of findings, a comprehensive meta-analysis of case-control studies is in order to pinpoint consistencies and investigate the causes of discrepancies. We searched MEDLINE, EMBASE and Cochrane databases for case-control studies comparing SSR absence frequency and latency between patients with MS and healthy controls. Thirteen eligible studies including 415 MS patients and 331 healthy controls were identified. The pooled analysis showed that SSR can be always obtained in healthy controls while 34% of patients had absent SSRs in at least one limb (95% CI 22-47%; p studies (I 2  = 90.3%). Patients' age explained 22% of the overall variability and positive correlations were found with Expanded Disability Status Scale and disease duration. The pooled mean difference of SSR latency showed a significant increase in patients on both upper (193 ms; 95% CI 120-270 ms) and lower (350 ms; 95% CI 190-510 ms) extremities. We tested the discriminatory value of SSR latency thresholds defined as the 95% confidence interval (CI) upper bound of the healthy controls, and validated the results on a new dataset. The lower limb threshold of 1.964 s produces the best results in terms of sensitivity 0.86, specificity 0.67, positive predicted value 0.75 and negative predicted value 0.80. Despite a considerable heterogeneity of findings, there is evidence that SSR is a useful tool in MS.

  5. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  6. Membrane potential and response properties of populations of cortical neurons in the high conductance state

    International Nuclear Information System (INIS)

    Moreno-Bote, Ruben; Parga, Nestor

    2005-01-01

    Because of intense synaptic activity, cortical neurons are in a high conductance state. We show that this state has important consequences on the properties of a population of independent model neurons with conductance-based synapses. Using an adiabaticlike approximation we study both the membrane potential and the firing probability distributions across the population. We find that the latter is bimodal in such a way that at any particular moment some neurons are inactive while others are active. The population rate and the response variability are also characterized

  7. Identification of Scattering Mechanisms from Measured Impulse Response Signatures of Several Conducting Objects.

    Science.gov (United States)

    1984-02-01

    conducting sphere 35 compared to inverse transform of exact solution. 4-5. Measured impulse response of a conducting 2:1 right 37 circular cylinder with...frequency domain. This is equivalent to multiplication in the time domain by the inverse transform of w(n), which is shown in Figure 3-1 for N=15. The...equivalent pulse width from 0.066 T for the rectangular window to 0.10 T for the Hanning window. The inverse transform of the Hanning window is shown

  8. Framework for estimating response time data to conduct a seismic human reliability analysis - its feasibility

    International Nuclear Information System (INIS)

    Park, Jinkyun; Kin, Yochan; Jung, Wondea; Jang, Seung Cheol

    2014-01-01

    This is because the PSA has been used for several decades as the representative tool to evaluate the safety of NPPs. To this end, it is inevitable to evaluate human error probabilities (HEPs) in conducting important tasks being considered in the PSA framework (i.e., HFEs; human failure events), which are able to significantly affect the safety of NPPs. In addition, it should be emphasized that the provision of a realistic human performance data is an important precondition for calculating HEPs under a seismic condition. Unfortunately, it seems that HRA methods being currently used for calculating HEPs under a seismic event do not properly consider the performance variation of human operators. For this reason, in this paper, a framework to estimate response time data that are critical for calculating HEPs is suggested with respect to a seismic intensity. This paper suggested a systematic framework for estimating response time data that would be one of the most critical for calculating HEPs. Although extensive review of existing literatures is indispensable for identifying response times of human operators who have to conduct a series of tasks prescribed in procedures based on a couple of wrong indications, it is highly expected that response time data for seismic HRA can be properly secured through revisiting response time data collected from diverse situations without concerning a seismic event

  9. Semi-metallic, strong conductive polymer microfiber, method and fast response rate actuators and heating textiles

    KAUST Repository

    Zhou, Jian; Li, Er Qiang; Lubineau, Gilles; Thoroddsen, Sigurdur T; Mulle, Matthieu

    2016-01-01

    A method comprising: providing at least one first composition comprising at least one conjugated polymer and at least one solvent, wet spinning the at least one first composition to form at least one first fiber material, hot-drawing the at least one fiber to form at least one second fiber material. In lead embodiments, high-performance poly(3,4-ethylenedioxy- thiophene)/poly(styrenesulfonate) (PEDOT/PSS) conjugated polymer microfibers were fabricated via wet- spinning followed by hot-drawing. In these lead embodiments, due to the combined effects of the vertical hot-drawing process and doping/de-doping the microfibers with ethylene glycol (EG), a record electrical conductivity of 2804 S · cm-1 was achieved. This is believed to be a six-fold improvement over the best previously reported value for PEDOT/PSS fibers (467 S · cm-1) and a twofold improvement over the best values for conductive polymer films treated by EG de-doping (1418 S · cm-1). Moreover, these lead, highly conductive fibers experience a semiconductor-metal transition at 313 K. They also have superior mechanical properties with a Young's modulus up to 8.3 GPa, a tensile strength reaching 409.8 MPa and a large elongation before failure (21%). The most conductive fiber also demonstrates an extraordinary electrical performance during stretching/unstretching: the conductivity increased by 25% before the fiber rupture point with a maximum strain up to 21%. Simple fabrication of the semi-metallic, strong and stretchable wet-spun PEDOT/PSS microfibers can make them available for conductive smart electronics. A dramatic improvement in electrical conductivity is needed to make conductive polymer fibers viable candidates in applications such as flexible electrodes, conductive textiles, and fast-response sensors and actuators.

  10. Semi-metallic, strong conductive polymer microfiber, method and fast response rate actuators and heating textiles

    KAUST Repository

    Zhou, Jian

    2016-06-09

    A method comprising: providing at least one first composition comprising at least one conjugated polymer and at least one solvent, wet spinning the at least one first composition to form at least one first fiber material, hot-drawing the at least one fiber to form at least one second fiber material. In lead embodiments, high-performance poly(3,4-ethylenedioxy- thiophene)/poly(styrenesulfonate) (PEDOT/PSS) conjugated polymer microfibers were fabricated via wet- spinning followed by hot-drawing. In these lead embodiments, due to the combined effects of the vertical hot-drawing process and doping/de-doping the microfibers with ethylene glycol (EG), a record electrical conductivity of 2804 S · cm-1 was achieved. This is believed to be a six-fold improvement over the best previously reported value for PEDOT/PSS fibers (467 S · cm-1) and a twofold improvement over the best values for conductive polymer films treated by EG de-doping (1418 S · cm-1). Moreover, these lead, highly conductive fibers experience a semiconductor-metal transition at 313 K. They also have superior mechanical properties with a Young\\'s modulus up to 8.3 GPa, a tensile strength reaching 409.8 MPa and a large elongation before failure (21%). The most conductive fiber also demonstrates an extraordinary electrical performance during stretching/unstretching: the conductivity increased by 25% before the fiber rupture point with a maximum strain up to 21%. Simple fabrication of the semi-metallic, strong and stretchable wet-spun PEDOT/PSS microfibers can make them available for conductive smart electronics. A dramatic improvement in electrical conductivity is needed to make conductive polymer fibers viable candidates in applications such as flexible electrodes, conductive textiles, and fast-response sensors and actuators.

  11. SAVANNAH RIVER SITE CAPABILITIES FOR CONDUCTING INGESTION PATHWAY CONSEQUENCE ASSESSMENTS FOR EMERGENCY RESPONSE

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, C

    2007-12-11

    Potential airborne releases of radioactivity from facilities operated for the U. S. Department of Energy at the Savannah River Site could pose significant consequences to the public through the ingestion pathway. The Savannah River National Laboratory has developed a suite of technologies needed to conduct assessments of ingestion dose during emergency response, enabling emergency manager at SRS to develop initial protective action recommendation for state agencies early in the response and to make informed decisions on activation of additional Federal assets that would be needed to support long-term monitoring and assessment activities.

  12. Histologic analyses on the response of the skin to 1,927-nm fractional thulium fiber laser treatment.

    Science.gov (United States)

    Kwon, In Ho; Bae, Youin; Yeo, Un-Cheol; Lee, Jin Yong; Kwon, Hyuck Hoon; Choi, Young Hee; Park, Gyeong-Hun

    2018-02-01

    The histologic responses to varied parameters of 1,927-nm fractional thulium fiber laser treatment have not yet been sufficiently elucidated. This study sought to evaluate histologic changes immediately after 1,927-nm fractional thulium fiber laser session at various parameters. The dorsal skin of Yucatan mini-pig was treated with 1,927-nm fractional thulium fiber laser at varied parameters, with or without skin drying. The immediate histologic changes were evaluated to determine the effects of varying laser parameters on the width and the depth of treated zones. The increase in the level of pulse energy widened the area of epidermal changes in the low power level, but increased the dermal penetration depth in the high power level. As the pulse energy level increased, the increase in the power level under the given pulse energy level more evidently made dermal penetration deeper and the treatment area smaller. Skin drying did not show significant effects on epidermal changes, but evidently increased the depth of dermal denaturation under both high and low levels of pulse energy. These results may provide important information to establish treatment parameters of the 1,927-nm fractional thulium fiber laser for various skin conditions.

  13. Gamma- and electron dose response of the electrical conductivity of polyaniline based polymer blends

    International Nuclear Information System (INIS)

    Sevil, U.A.; Gueven, O.; Slezsak, I.

    2002-01-01

    Complete text of publication follows. Conducting polymers, also known as 'synthetic metals' have been the subject of widespread investigations over the past decade due to their very promising characteristics. Polyaniline (PANI) holds a special position among conducting polymers in that its most highly conducting doped form can be reached by protonic acid doping or oxidative doping. It was published earlier, that the electrical conductivity of some polyaniline based polymer composites increases to a significant extent when irradiated to gamma, electron or UV radiation. The aim of the present study was to measure the high frequency conductivity of blended films of PANI with poly(vinylchloride), PVC, and chlorinated poly(propylene) irradiated in air to different doses. In order to find the most suitable composition od these composites the mass percentage of PANI within the PPCl and PVC matrix was changed between 5 - 30%. These samples were then gamma irradiated and the induced electrical conductivity was measured in the 1 kHz - 1 MHz frequency range to determine the most sensitive evaluation conditions. After selecting both the most suitable measuring conditions as well as the blend compositions the dose response of the chosen samples was determined in the dose range of 10 - 250 kGy. With respect to potential dosimetry application the effect of electron irradiation, the effect of irradiation temperature and the stability of the irradiated samples have also been investigated

  14. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin.

    Science.gov (United States)

    Li, Zhi; Gothard, Elizabeth; Coles, Mark C; Ambler, Carrie A

    2018-01-01

    In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s), by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  15. Benefits of plasma rich in growth factors (PRGF) in skin photodamage: clinical response and histological assessment.

    Science.gov (United States)

    Díaz-Ley, B; Cuevast, J; Alonso-Castro, L; Calvo, M I; Ríos-Buceta, L; Orive, G; Anitua, E; Jaén, P

    2015-01-01

    Skin ageing is characterized by small and fine wrinkles, roughness, laxity, and pigmentation as a result of epidermal thinning, collagen degradation, dermal atrophy, and fewer fibroblasts. Plasma rich in growth factors (PRGF) is an autologous plasma preparation enriched in proteins obtained from patient's own blood aimed at accelerating tissue repair and regeneration. To evaluate the benefits of PRGF in skin photodamage, 10 healthy volunteers were treated with three consecutive intradermal injections of PRGF in the facial area. Clinical outcomes and histological analysis were performed. A statistically significant increase in the epidermis and papillary dermis thickness was seen after PRGF treatment (p PRGF treatment, a reduction of the average area fraction of solar elastosis was observed in patients with clinical and histological signs of skin photodamage (p PRGF use was 0.75 (9/12) for the group of patients with signs of skin photodamage. Intradermal PRGF infiltration appears to be an effective treatment for the photodamaged skin. © 2015 Wiley Periodicals, Inc.

  16. Physical Mechanisms Responsible for Electrical Conduction in Pt/GaN Schottky Diodes

    OpenAIRE

    H. MAZARI; K. AMEUR; N. BENSEDDIK; Z. BENAMARA; R. KHELIFI; M. MOSTEFAOUI; N. ZOUGAGH; N. BENYAHYA; R. BECHAREF; G. BASSOU; B. GRUZZA; J. M. BLUET; C. BRU-CHEVALLIER

    2014-01-01

    The current-voltage (I-V) characteristics of Pt/(n.u.d)-GaN and Pt/Si-doped-GaN diodes Schottky are investigated. Based on these measurements, physical mechanisms responsible for electrical conduction have been suggested. The contribution of thermionic-emission current and various other current transport mechanisms were assumed when evaluating the Schottky barrier height. Thus the generation-recombination, tunneling and leakage currents caused by inhomogeneities and defects at metal-semicondu...

  17. A New Method for a Virtue-Based Responsible Conduct of Research Curriculum: Pilot Test Results.

    Science.gov (United States)

    Berling, Eric; McLeskey, Chet; O'Rourke, Michael; Pennock, Robert T

    2018-02-03

    Drawing on Pennock's theory of scientific virtues, we are developing an alternative curriculum for training scientists in the responsible conduct of research (RCR) that emphasizes internal values rather than externally imposed rules. This approach focuses on the virtuous characteristics of scientists that lead to responsible and exemplary behavior. We have been pilot-testing one element of such a virtue-based approach to RCR training by conducting dialogue sessions, modeled upon the approach developed by Toolbox Dialogue Initiative, that focus on a specific virtue, e.g., curiosity and objectivity. During these structured discussions, small groups of scientists explore the roles they think the focus virtue plays and should play in the practice of science. Preliminary results have shown that participants strongly prefer this virtue-based model over traditional methods of RCR training. While we cannot yet definitively say that participation in these RCR sessions contributes to responsible conduct, these pilot results are encouraging and warrant continued development of this virtue-based approach to RCR training.

  18. Immune and biochemical responses in skin differ between bovine hosts genetically susceptible and resistant to the cattle tick Rhipicephalus microplus.

    Science.gov (United States)

    Franzin, Alessandra Mara; Maruyama, Sandra Regina; Garcia, Gustavo Rocha; Oliveira, Rosane Pereira; Ribeiro, José Marcos Chaves; Bishop, Richard; Maia, Antônio Augusto Mendes; Moré, Daniela Dantas; Ferreira, Beatriz Rossetti; Santos, Isabel Kinney Ferreira de Miranda

    2017-01-31

    Ticks attach to and penetrate their hosts' skin and inactivate multiple components of host responses in order to acquire a blood meal. Infestation loads with the cattle tick, Rhipicephalus microplus, are heritable: some breeds carry high loads of reproductively successful ticks, whereas in others, few ticks feed and reproduce efficiently. In order to elucidate the mechanisms that result in the different outcomes of infestations with cattle ticks, we examined global gene expression and inflammation induced by tick bites in skins from one resistant and one susceptible breed of cattle that underwent primary infestations with larvae and nymphs of R. microplus. We also examined the expression profiles of genes encoding secreted tick proteins that mediate parasitism in larvae and nymphs feeding on these breeds. Functional analyses of differentially expressed genes in the skin suggest that allergic contact-like dermatitis develops with ensuing production of IL-6, CXCL-8 and CCL-2 and is sustained by HMGB1, ISG15 and PKR, leading to expression of pro-inflammatory chemokines and cytokines that recruit granulocytes and T lymphocytes. Importantly, this response is delayed in susceptible hosts. Histopathological analyses of infested skins showed inflammatory reactions surrounding tick cement cones that enable attachment in both breeds, but in genetically tick-resistant bovines they destabilized the cone. The transcription data provided insights into tick-mediated activation of basophils, which have previously been shown to be a key to host resistance in model systems. Skin from tick-susceptible bovines expressed more transcripts encoding enzymes that detoxify tissues. Interestingly, these enzymes also produce volatile odoriferous compounds and, accordingly, skin rubbings from tick-susceptible bovines attracted significantly more tick larvae than rubbings from resistant hosts. Moreover, transcripts encoding secreted modulatory molecules by the tick were significantly more

  19. Multiple helminth infection of the skin causes lymphocyte hypo-responsiveness mediated by Th2 conditioning of dermal myeloid cells.

    Directory of Open Access Journals (Sweden)

    Peter C Cook

    2011-03-01

    Full Text Available Infection of the mammalian host by schistosome larvae occurs via the skin, although nothing is known about the development of immune responses to multiple exposures of schistosome larvae, and/or their excretory/secretory (E/S products. Here, we show that multiple (4x exposures, prior to the onset of egg laying by adult worms, modulate the skin immune response and induce CD4(+ cell hypo-responsiveness in the draining lymph node, and even modulate the formation of hepatic egg-induced granulomas. Compared to mice exposed to a single infection (1x, dermal cells from multiply infected mice (4x, were less able to support lymph node cell proliferation. Analysis of dermal cells showed that the most abundant in 4x mice were eosinophils (F4/80(+MHC-II(-, but they did not impact the ability of antigen presenting cells (APC to support lymphocyte proliferation to parasite antigen in vitro. However, two other cell populations from the dermal site of infection appear to have a critical role. The first comprises arginase-1(+, Ym-1(+ alternatively activated macrophage-like cells, and the second are functionally compromised MHC-II(hi cells. Through the administration of exogenous IL-12 to multiply infected mice, we show that these suppressive myeloid cell phenotypes form as a consequence of events in the skin, most notably an enrichment of IL-4 and IL-13, likely resulting from an influx of RELMα-expressing eosinophils. We further illustrate that the development of these suppressive dermal cells is dependent upon IL-4Rα signalling. The development of immune hypo-responsiveness to schistosome larvae and their effect on the subsequent response to the immunopathogenic egg is important in appreciating how immune responses to helminth infections are modulated by repeated exposure to the infective early stages of development.

  20. Biochemical response of skin-coated citrus fruits irradiated for preservation

    International Nuclear Information System (INIS)

    Ahmed, E.S.

    1977-01-01

    Orange fruits (citrus Sinensis) Kind Egyptian Balady variety, were irradiated for 100, 200 and 400 Krad γ-ray doses in combination with sodium orthophenylphenate, 0.0025% incorporated in wax coatings as preirradiation treatment. The data revealed the utility of combined treatment to control postharvest decay in citrus fruits. 100 Krad extend shelflife of skin-coated fruits by 15 weeks without significant losses in Vitamin C, reducing sugars, or free amino acids and without storage disorders. Unirradiated non skin-coated and unirradiated skin-coated had a shelf-life of 7, and 10 weeks, respectively, under the same experimental storage conditions (14-20 C and R.H. 65-75%)

  1. The response of mouse skin to re-irradiation with x-rays or fast neutrons

    International Nuclear Information System (INIS)

    Tsukiyama, Iwao; Egawa, Sunao; Kumazawa, Akiyoshi; Iino, Yuu.

    1986-01-01

    Effects of neutrons and x-rays on mouse skin which had been previously irradiated with x-rays were investigated. Two tattoo marks were placed in the hairless legs of mice at intervals of 15 mm. The legs were exposed to various doses of x-ray and neutrons to determine the relative biological effectiveness (RBE) using the contraction of the skin as an index. The RBE was 0.93 - 1.73. The legs of the mice were preexposed to 25 Gy of x-ray, and exposed 4 months later. The contraction of the skin began earlier than after the first irradiation. RBE was 2.18 - 2.47. This RBE was higher than that in untreated mice. These results suggest that previously irradiated normal tissues are much more sensitive to neutrons than to x-rays. (author)

  2. The response of mouse skin and lung to fractionated x-rays

    International Nuclear Information System (INIS)

    Field, S.B.; Hornsey, S.

    1975-01-01

    The relationship between total dose and number of fractions has been investigated for damage to lung and skin in mice. Single doses and various numbers of fractions have been given and the results are analysed in two ways: (i) by comparing the fractionated treatment with a single dose. With this approach, and assuming that the observed damage to lung and skin is the result of cell killing, it is estimated that the ratio of initial to final slope of the cell survival curve is about 7:1; (ii) by measuring the additional dose required when the number of fractions is doubled. These results are roughly fitted by a single-hit times multitarget survival-curve model, with the ratio of slopes about 3:1. It is concluded from this discrepancy that the two-component model is an inadequate description of the survival curve for the cells of either skin or lung. (author)

  3. Early and late radiation response of human skin following chronic exposure of the hands

    International Nuclear Information System (INIS)

    Lenz, U.; Arndt, D.; Thormann, T.

    1979-01-01

    Clinical examinations on 45 radiation workers with chronical low-level exposures to their hands revealed that accumulated doses in the range of 15 to 30 Sv (1500 to 3000 rem) may already produce macroscopically unconspicuous early alterations of the vessel system within the corium as well as epidermal hyperplasia. Therefore, the annual permissible dose equivalent of 0.75 Sv (75 rem) recommended by ICRP for the skin of the extremities appears unjustifiably high and should be reduced to 0.30 Sv (30 rem), the limit valid for the remaining areas of skin. (author)

  4. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot1[OPEN

    Science.gov (United States)

    Collins, Thomas S.; Vicente, Ariel R.; Doyle, Carolyn L.; Ye, Zirou; Allen, Greg; Heymann, Hildegarde

    2015-01-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  5. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH. Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus foliaceus (EPF, 15 controls from the EPF endemic area, and 15 biopsies from healthy controls from the USA. We also tested archival biopsies from patients with selected ABD, including 30 patients with bullous pemphigoid, 20 with pemphigus vulgaris, 8 with pemphigus foliaceus and 14 with dermatitis herpetiformis. Results: We found a predominantly CD8 positive/CD45 positive T cell infiltrate in all ABD. Our skin biopsies demonstrated consistently positive staining for myeloperoxidase, but negative staining for neutrophil elastase. Most ABD biopsies displayed negative staining for CD4 and B cell markers; natural killer cell markers were also rarely seen. ZAP-70 and LAT were frequently detected. In El Bagre-EPF, a significant fragmentation of T cells in lesional skin was noted, as well as autoreactivity to lymph nodes. Conclusions: The documented T cell and myeloperoxidase staining are indicative of the role of T lymphocytes and neutrophils in lesional biopsies in patients with ABD, in addition to previously documented deposition of B cells, immunoglobulins and complement in situ. In El Bagre-EPF, T cells could also target lymph nodes; however, further studies are needed to confirm this possibility.

  6. Conductivity-Dependent Strain Response of Carbon Nanotube Treated Bacterial Nanocellulose

    Directory of Open Access Journals (Sweden)

    S. Farjana

    2013-01-01

    Full Text Available This paper reports the strain sensitivity of flexible, electrically conductive, and nanostructured cellulose which was prepared by modification of bacterial cellulose with double-walled carbon nanotubes (DWCNTs and multiwalled carbon nanotubes (MWCNTs. The electrical conductivity depends on the modifying agent and its dispersion process. The conductivity of the samples obtained from bacterial cellulose (BNC pellicles modified with DWCNT was in the range from 0.034 S·cm−1 to 0.39 S·cm−1, and for BNC pellicles modified with MWCNTs it was from 0.12 S·cm−1 to 1.6 S·cm−1. The strain-induced electromechanical response, resistance versus strain, was monitored during the application of tensile force in order to study the sensitivity of the modified nanocellulose. A maximum gauge factor of 252 was found from the highest conductive sample treated by MWCNT. It has been observed that the sensitivity of the sample depends on the conductivity of the modified cellulose.

  7. [Effects of self-foot reflexology on stress, fatigue, skin temperature and immune response in female undergraduate students].

    Science.gov (United States)

    Lee, Young-Mee

    2011-02-01

    The purpose of this study was to evaluate the effects of self-foot reflexology on stress (perceived stress, urine cortisol level, and serum cortisol level), fatigue, skin temperature and immune response in female undergraduate students. The research design was a nonequivalent control group pretest-post test design. Participants were 60 university students: 30 in the experiment group and 30 in the control group. The period of this study was from April to June 2010. The program was performed for 1 hr a session, three times a week for 6 weeks. The data were analyzed using the SPSS/WIN 17.0 program. The results showed that self-foot reflexology was effective in reducing perceived stress and fatigue, and raised skin temperature in female undergraduate students. But cortisol levels and immune response were not statistically significant different. The results of this study indicate that self-foot reflexology is an effective nursing intervention in reducing perceived stress and fatigue and, in improving skin temperature. Therefore, it is recommended that this be used in clinical practice as an effective nursing intervention for in female undergraduate students.

  8. Safety and skin delayed-type hypersensitivity response in vervet monkeys immunized with Leishmania donovani sonicate antigen delivered with adjuvants

    Directory of Open Access Journals (Sweden)

    Joshua M. Mutiso

    2012-02-01

    Full Text Available In this study, we report on the safety and skin delayed-type hypersensitivity (DTH, responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG, Montanide ISA 720 (MISA or Monophosphoryl lipid A (MPLA in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α and interferon gamma (IFN-γ levels were also measured and these were compared with DTH. Only those animals immunized with alum-BCG reacted adversely to the inoculum by producing ulcerative erythematous skin indurations. Non-parametric analysis of variance followed by a post-test showed significantly higher DTH responses in the MISA+Ag group compared with other immunized groups (p < 0.001. The MPLA+Ag group indicated significantly lower DTH responses to the sonicate antigen compared with the AlBCG+Ag group. There was a significant correlation between the DTH and cytokine responses (p < 0.0001. Based on this study we conclude that Leishmania donovani sonicate antigen containing MISA 720 is safe and is associated with a strong DTH reaction following immunization.

  9. Embedding responsible conduct in learning and research into an Australian undergraduate curriculum.

    Science.gov (United States)

    Fernandes, Lynette B

    2017-01-02

    Responsible conduct in learning and research (RCLR) was progressively introduced into the pharmacology curriculum for undergraduate science students at The University of Western Australia. In the second year of this undergraduate curriculum, a lecture introduces students to issues such as the use of animals in teaching and responsible conduct of research. Third year student groups deliver presentations on topics including scientific integrity and the use of human subjects in research. Academic and research staff attending these presentations provide feedback and participate in discussions. Students enrolled in an optional capstone Honours year complete an online course on the responsible conduct of research and participate in an interactive movie. Once RCLR became established in the curriculum, a survey of Likert-scaled and open-ended questions examined student and staff perceptions. Data were expressed as Approval (% of responses represented by Strongly Agree and Agree). RCLR was found to be relevant to the study of pharmacology (69-100% Approval), important for one's future career (62-100% Approval), and stimulated further interest in this area (32-75% Approval). Free entry comments demonstrated the value of RCLR and constructive suggestions for improvement have now been incorporated. RCLR modules were found to be a valuable addition to the pharmacology undergraduate curriculum. This approach may be used to incorporate ethics into any science undergraduate curriculum, with the use of discipline-specific topics. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(1):53-59, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  10. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...... modulated the oxidative stress response transcription factor Nrf-2 and its downstream effector haem-oxygenase (HO-1), possibly through the amelioration of the environmental stress induced by the plastic surface of the culturing flasks. Therefore, it is important to consider the role of ECM in modulating...

  11. Augmentation of skin response by exposure to a combination of allergens and irritants - a review

    DEFF Research Database (Denmark)

    Pedersen, Line Kynemund; Johansen, Jeanne Duus; Held, Elisabeth

    2004-01-01

    Clinical experimental studies on contact dermatitis (CD) often evaluate the effect of one allergen or one irritant at a time. In real life, the skin is often exposed to more allergens, more irritants or allergens and irritants in combination. This combined exposure may potentially influence irrit...

  12. Surface Lipids as Multifunctional Mediators of Skin Responses to Environmental Stimuli

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2010-01-01

    Full Text Available Skin surface lipid (SSL film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection.

  13. Skin Permeation Enhancers and their Effects on Narcotic Transdermal Drug Delivery Systems through Response Surface Experimental Design

    Directory of Open Access Journals (Sweden)

    A. Moghimi

    2014-02-01

    Full Text Available Drug delivery through skin is often obstructed by low permeability of skin towards most drugs; however, such problem would be solved by application of skin penetration enhancers in the formulations. In the present study, a drug in adhesive patch with buprenorphine as active ingredient was prepared. Drug-in-adhesive transdermal drug delivery systems with different chemical penetration enhancers were designed. For this purpose a response-surface experimental design was used. Response surface methodology based on a three-level, three-variable Box–Behnken design was used to evaluate the interactive effects of dependent variables such as: the rate of skin permeation and adhesion properties including peel strength and tack value. The parameters such as drug release and adhesion were used as independent variables. Levulinic acid, lauryl alcohol and Tween 80 were used as penetration enhancers. In order to prepare samples, buprenorphine with constant concentration was incorporated into acrylic pressure sensitive adhesive with carboxylic functionality and this mixture was added to chemical penetration enhancer with different concentrations. The results show that the cumulative amount of drug release in presence of Tween 80 is 462.9 ± 0.006 μg so it is higher than cumulative amount of drug release in presence of levulinic acid (357.9 ± 0.005 μg and lauryl alcohol (269.5 ± 0.001 μg. Results of adhesion properties such as peel strength and tack reveal that using levulinic acid and lauryl alcohol will increase peel strength while Tween 80 will decrease it. Besides, the results show that all these permeation enhancers have increased tack values.

  14. Complex conductivity response to silver nanoparticles in partially saturated sand columns

    Science.gov (United States)

    Abdel Aal, Gamal; Atekwana, Estella A.; Werkema, D. Dale

    2017-02-01

    The increase in the use of nanoscale materials in consumer products has resulted in a growing concern of their potential hazard to ecosystems and public health from their accidental or intentional introduction to the environment. Key environmental, health, and safety research needs include knowledge and methods for their detection, characterization, fate, and transport. Specifically, techniques available for the direct detection and quantification of their fate and transport in the environment are limited. Their small size, high surface area to volume ratio, interfacial, and electrical properties make metallic nanoparticles, such as silver nanoparticles, good targets for detection using electrical geophysical techniques. Here we measured the complex conductivity response to silver nanoparticles in sand columns under varying moisture conditions (0-30%), nanoparticle concentrations (0-10 mg/g), lithology (presence of clay), pore water salinity (0.0275 and 0.1000 S/m), and particle size (35, 90-210 and 1500-2500 nm). Based on the Cole-Cole relaxation models we obtained the chargeability and the time constant. We demonstrate that complex conductivity can detect silver nanoparticles in porous media with the response enhanced by higher concentrations of silver nanoparticles, moisture content, ionic strength, clay content and particle diameter. Quantification of the volumetric silver nanoparticles content in the porous media can also be obtained from complex conductivity parameters based on the strong power law relationships.

  15. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin

    Directory of Open Access Journals (Sweden)

    Zhi Li

    2018-02-01

    Full Text Available In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s, by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  16. Evaluating the effects that existing instruction on responsible conduct of research has on ethical decision making.

    Science.gov (United States)

    Antes, Alison L; Wang, Xiaoqian; Mumford, Michael D; Brown, Ryan P; Connelly, Shane; Devenport, Lynn D

    2010-03-01

    To examine the effects that existing courses on the responsible conduct of research (RCR) have on ethical decision making by assessing the ethicality of decisions made in response to ethical problems and the underlying processes involved in ethical decision making. These processes included how an individual thinks through ethical problems (i.e., meta-cognitive reasoning strategies) and the emphasis placed on social dimensions of ethical problems (i.e., social-behavioral responses). In 2005-2007, recruitment announcements were made, stating that a nationwide, online study was being conducted to examine the impact of RCR instruction on the ethical decision making of scientists. Recruitment yielded contacts with over 200 RCR faculty at 21 research universities and medical schools; 40 (20%) RCR instructors enrolled their courses in the current study. From those courses, 173 participants completed an ethical decision-making measure. A mixed pattern of effects emerged. The ethicality of decisions did not improve as a result of RCR instruction and even decreased for decisions pertaining to business aspects of research, such as contract bidding. Course participants improved on some meta-cognitive reasoning strategies, such as awareness of the situation and consideration of personal motivations, but declined for seeking help and considering others' perspectives. Participants also increased their endorsement of detrimental social-behavioral responses, such as deception, retaliation, and avoidance of personal responsibility. These findings indicated that RCR instruction may not be as effective as intended and, in fact, may even be harmful. Harmful effects might result if instruction leads students to overstress avoidance of ethical problems, be overconfident in their ability to handle ethical problems, or overemphasize their ethical nature. Future research must examine these and other possible obstacles to effective RCR instruction.

  17. High-ampacity conductive polymer microfibers as fast response wearable heaters and electromechanical actuators

    KAUST Repository

    Zhou, Jian; Mulle, Matthieu; Zhang, Yaobin; Xu, Xuezhu; Li, Erqiang; Han, Fei; Thoroddsen, Sigurdur T; Lubineau, Gilles

    2016-01-01

    Conductive fibers with enhanced physical properties and functionalities are needed for a diversity of electronic devices. Here, we report very high performance in the thermal and mechanical response of poly(3,4-ethylenedioxythiophene)/poly(styrenesulfonate) (PEDOT/PSS) microfibers when subjected to an electrical current. These fibers were made by combining the hot-drawing assisted wetspinning process with ethylene glycol doping/de-doping that can work at a current density as high as 1.8 × 104 A cm−2, which is comparable to that of carbon nanotube fibers. Their electrothermal response was investigated using optical sensors and verified to be as fast as 63 °C s−1 and is comparable with that of metallic heating elements (20–50 °C s−1). We investigated the electromechanical actuation resulted from the reversible sorption/desorption of moisture controlled by electro-induced heating. The results revealed an improvement of several orders of magnitudes compared to other linear conductive polymer-based actuators in air. Specifically, the fibers we designed here have a rapid stress generation rate (>40 MPa s−1) and a wide operating frequency range (up to 40 Hz). These fibers have several characteristics including fast response, low-driven voltage, good repeatability, long cycle life and high energy efficiency, favoring their use as heating elements on wearable textiles and as artificial muscles for robotics.

  18. High-ampacity conductive polymer microfibers as fast response wearable heaters and electromechanical actuators

    KAUST Repository

    Zhou, Jian

    2016-01-04

    Conductive fibers with enhanced physical properties and functionalities are needed for a diversity of electronic devices. Here, we report very high performance in the thermal and mechanical response of poly(3,4-ethylenedioxythiophene)/poly(styrenesulfonate) (PEDOT/PSS) microfibers when subjected to an electrical current. These fibers were made by combining the hot-drawing assisted wetspinning process with ethylene glycol doping/de-doping that can work at a current density as high as 1.8 × 104 A cm−2, which is comparable to that of carbon nanotube fibers. Their electrothermal response was investigated using optical sensors and verified to be as fast as 63 °C s−1 and is comparable with that of metallic heating elements (20–50 °C s−1). We investigated the electromechanical actuation resulted from the reversible sorption/desorption of moisture controlled by electro-induced heating. The results revealed an improvement of several orders of magnitudes compared to other linear conductive polymer-based actuators in air. Specifically, the fibers we designed here have a rapid stress generation rate (>40 MPa s−1) and a wide operating frequency range (up to 40 Hz). These fibers have several characteristics including fast response, low-driven voltage, good repeatability, long cycle life and high energy efficiency, favoring their use as heating elements on wearable textiles and as artificial muscles for robotics.

  19. Nonlinear vs. bolometric radiation response and phonon thermal conductance in graphene-superconductor junctions

    International Nuclear Information System (INIS)

    Vora, Heli; Nielsen, Bent; Du, Xu

    2014-01-01

    Graphene is a promising candidate for building fast and ultra-sensitive bolometric detectors due to its weak electron-phonon coupling and low heat capacity. In order to realize a practical graphene-based bolometer, several important issues, including the nature of radiation response, coupling efficiency to the radiation and the thermal conductance need to be carefully studied. Addressing these issues, we present graphene-superconductor junctions as a viable option to achieve efficient and sensitive bolometers, with the superconductor contacts serving as hot electron barriers. For a graphene-superconductor device with highly transparent interfaces, the resistance readout in the presence of radio frequency radiation is dominated by non-linear response. On the other hand, a graphene-superconductor tunnel device shows dominantly bolometric response to radiation. For graphene devices fabricated on SiO 2 substrates, we confirm recent theoretical predictions of T 2 temperature dependence of phonon thermal conductance in the presence of disorder in the graphene channel at low temperatures

  20. Low frequency complex dielectric (conductivity) response of dilute clay suspensions: Modeling and experiments.

    Science.gov (United States)

    Hou, Chang-Yu; Feng, Ling; Seleznev, Nikita; Freed, Denise E

    2018-04-11

    In this work, we establish an effective medium model to describe the low-frequency complex dielectric (conductivity) dispersion of dilute clay suspensions. We use previously obtained low-frequency polarization coefficients for a charged oblate spheroidal particle immersed in an electrolyte as the building block for the Maxwell Garnett mixing formula to model the dilute clay suspension. The complex conductivity phase dispersion exhibits a near-resonance peak when the clay grains have a narrow size distribution. The peak frequency is associated with the size distribution as well as the shape of clay grains and is often referred to as the characteristic frequency. In contrast, if the size of the clay grains has a broad distribution, the phase peak is broadened and can disappear into the background of the canonical phase response of the brine. To benchmark our model, the low-frequency dispersion of the complex conductivity of dilute clay suspensions is measured using a four-point impedance measurement, which can be reliably calibrated in the frequency range between 0.1 Hz and 10 kHz. By using a minimal number of fitting parameters when reliable information is available as input for the model and carefully examining the issue of potential over-fitting, we found that our model can be used to fit the measured dispersion of the complex conductivity with reasonable parameters. The good match between the modeled and experimental complex conductivity dispersion allows us to argue that our simplified model captures the essential physics for describing the low-frequency dispersion of the complex conductivity of dilute clay suspensions. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Ac-conductivity and dielectric response of new zinc-phosphate glass/metal composites

    Energy Technology Data Exchange (ETDEWEB)

    Maaroufi, A., E-mail: maaroufi@fsr.ac.ma [University of Mohammed V, Laboratory of Composite Materials, Polymers and Environment, Department of Chemistry, Faculty of Sciences, P.B. 1014, Rabat-Agdal (Morocco); Oabi, O. [University of Mohammed V, Laboratory of Composite Materials, Polymers and Environment, Department of Chemistry, Faculty of Sciences, P.B. 1014, Rabat-Agdal (Morocco); Lucas, B. [XLIM UMR 7252 – Université de Limoges/CNRS, 123 avenue Albert Thomas, 87060 Limoges Cedex (France)

    2016-07-01

    The ac-conductivity and dielectric response of new composites based on zinc-phosphate glass with composition 45 mol%ZnO–55 mol%P{sub 2}O{sub 5}, filled with metallic powder of nickel (ZP/Ni) were investigated by impedance spectroscopy in the frequency range from 100 Hz to 1 MHz at room temperature. A high percolating jump of seven times has been observed in the conductivity behavior from low volume fraction of filler to the higher fractions, indicating an insulator – semiconductor phase transition. The measured conductivity at higher filler volume fraction is about 10{sup −1} S/cm and is frequency independent, while, the obtained conductivity for low filler volume fraction is around 10{sup −8} S/cm and is frequency dependent. Moreover, the elaborated composites are characterized by high dielectric constants in the range of 10{sup 5} for conductive composites at low frequencies (100 Hz). In addition, the distribution of the relaxation processes was also evaluated. The Debye, Cole-Cole, Davidson–Cole and Havriliak–Negami models in electric modulus formalism were used to model the observed relaxation phenomena in ZP/Ni composites. The observed relaxation phenomena are fairly simulated by Davidson–Cole model, and an account of the interpretation of results is given. - Highlights: • Composites of ZnO-P{sub 2}O{sub 5}/metal were investigated by impedance spectroscopy. • Original ac-conductivity behavior was discovered in ZnO-P{sub 2}O{sub 5}/metal composites. • High dielectric constant is measured in ZnO-P{sub 2}O{sub 5}/metal composites. • Dielectric constant as filler function is well interpreted with percolation theory. • Observed relaxation processes are well described using electric modulus formalism.

  2. The acute effects of alpha and beta irradiation of mouse skin and the factors affecting the response

    International Nuclear Information System (INIS)

    Needham, S.G.; Coggle, J.E.

    1991-01-01

    Several problems regarding acute effects of alpha and beta irradiation were investigated in order to clarify protection problems of localised doses to the skin. A study into the acute biological effects of different energy beta emitters and the effects of energy and area on the response showed direct relationships between these criteria for a range of different acute responses with different time courses. Three different types of acute response were found and these are described as 'moist desquamation', 'acute ulceration' and 'acute epidermal necrosis'. An unexpected finding was that the lower energy beta emitter 170 Tm was as efficient at inducing scab formation as the higher energy 90 Sr sources for the same area of exposure. Experiments using 2x4 cm 2 exposures to 224 Cm alpha particles showed that the response to this poorly penetrating radiation was minimal after doses as high as 180 Gy measured at 10 μm into the skin. In comparison, large area exposure to 170 Tm produced areas of prolonged scabbing after doses up to 100 Gy. However, the intensity of the reaction varied between strains. (author)

  3. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Directory of Open Access Journals (Sweden)

    Yanhan Wang

    Full Text Available Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes, a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER of a peptide chain release factor 2 (RF2 were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre

  4. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Science.gov (United States)

    Wang, Yanhan; Zhu, Wenhong; Shu, Muya; Jiang, Yong; Gallo, Richard L; Liu, Yu-Tsueng; Huang, Chun-Ming

    2012-01-01

    Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV) radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes), a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD) in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ)-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER) of a peptide chain release factor 2 (RF2) were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre-symptomatic diagnosis

  5. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  6. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  7. Effect of Phase Response Curve Skew on Synchronization with and without Conduction Delays

    Directory of Open Access Journals (Sweden)

    Carmen eCanavier

    2013-12-01

    Full Text Available A central problem in cortical processing including sensory binding and attentional gating is how neurons can synchronize their responses with zero or near-zero time lag. For a spontaneously firing neuron, an input from another neuron can delay or advance the next spike by different amounts depending upon the timing of the input relative to the previous spike. This information constitutes the phase response curve (PRC. We present a simple graphical method for determining the effect of PRC shape on synchronization tendencies and illustrate it using type 1 PRCs, which consist entirely of advances (delays in response to excitation (inhibition. We obtained the following generic solutions for type 1 PRCs, which include the pulse coupled leaky integrate and fire model. For pairs with mutual excitation, exact synchrony can be stable for strong coupling because of the stabilizing effect of the causal limit region of the PRC in which an input triggers a spike immediately upon arrival. However, synchrony is unstable for short delays, because delayed inputs arrive during a refractory period and cannot trigger an immediate spike. Right skew destabilizes antiphase and enables modes with time lags that grow as the conduction delay is increased. Therefore, right skew favors near-synchrony at short conduction delays and a gradual transition between synchrony and antiphase for pairs coupled by mutual excitation. For pairs with mutual inhibition, zero time lag synchrony is stable for conduction delays ranging from zero to a substantial fraction of the period for pairs. However, for right skew there is a preferred antiphase mode at short delays. In contrast to mutual excitation, left skew destabilizes antiphase for mutual inhibition so that synchrony dominates at short delays as well. These pairwise synchronization tendencies constrain the synchronization properties of neurons embedded in larger networks.

  8. Electrical signaling, stomatal conductance, ABA and Ethylene content in avocado trees in response to root hypoxia

    Science.gov (United States)

    Gurovich, Luis; Schaffer, Bruce; García, Nicolás; Iturriaga, Rodrigo

    2009-01-01

    Avocado (Persea americana Mill.) trees are among the most sensitive of fruit tree species to root hypoxia as a result of flooded or poorly drained soil. Similar to drought stress, an early physiological response to root hypoxia in avocado is a reduction of stomatal conductance. It has been previously determined in avocado trees that an extracellular electrical signal between the base of stem and leaves is produced and related to reductions in stomatal conductance in response to drought stress. The current study was designed to determine if changes in the extracellular electrical potential between the base of the stem and leaves in avocado trees could also be detected in response to short-term (min) or long-term (days) root hypoxia, and if these signals could be related to stomatal conductance (gs), root and leaf ABA and ACC concentrations, ethylene emission from leaves and leaf abscission. In contrast to previous observations for drought-stressed trees, short-term or long-term root hypoxia did not stimulate an electrical potential difference between the base of the stem and leaves. Short-term hypoxia did not result in a significant decrease in gs compared with plants in the control treatment, and no differences in ABA concentration were found between plants subjected to hypoxia and control plants. Long-term hypoxia in the root zone resulted in a significant decrease in gs, increased leaf ethylene and increased leaf abscission. The results indicate that for avocado trees exposed to root hypoxia, electrical signals do not appear to be the primary root-to-shoot communication mechanism involved in signaling for stomatal closure as a result of hypoxia in the root zone. PMID:19649181

  9. How the type of input function affects the dynamic response of conducting polymer actuators

    Science.gov (United States)

    Xiang, Xingcan; Alici, Gursel; Mutlu, Rahim; Li, Weihua

    2014-10-01

    There has been a growing interest in smart actuators typified by conducting polymer actuators, especially in their (i) fabrication, modeling and control with minimum external data and (ii) applications in bio-inspired devices, robotics and mechatronics. Their control is a challenging research problem due to the complex and nonlinear properties of these actuators, which cannot be predicted accurately. Based on an input-shaping technique, we propose a new method to improve the conducting polymer actuators’ command-following ability, while minimizing their electric power consumption. We applied four input functions with smooth characteristics to a trilayer conducting polymer actuator to experimentally evaluate its command-following ability under an open-loop control strategy and a simulated feedback control strategy, and, more importantly, to quantify how the type of input function affects the dynamic response of this class of actuators. We have found that the four smooth inputs consume less electrical power than sharp inputs such as a step input with discontinuous higher-order derivatives. We also obtained an improved transient response performance from the smooth inputs, especially under the simulated feedback control strategy, which we have proposed previously [X Xiang, R Mutlu, G Alici, and W Li, 2014 “Control of conducting polymer actuators without physical feedback: simulated feedback control approach with particle swarm optimization’, Journal of Smart Materials and Structure, 23]. The idea of using a smooth input command, which results in lower power consumption and better control performance, can be extended to other smart actuators. Consuming less electrical energy or power will have a direct effect on enhancing the operational life of these actuators.

  10. How the type of input function affects the dynamic response of conducting polymer actuators

    International Nuclear Information System (INIS)

    Xiang, Xingcan; Alici, Gursel; Mutlu, Rahim; Li, Weihua

    2014-01-01

    There has been a growing interest in smart actuators typified by conducting polymer actuators, especially in their (i) fabrication, modeling and control with minimum external data and (ii) applications in bio-inspired devices, robotics and mechatronics. Their control is a challenging research problem due to the complex and nonlinear properties of these actuators, which cannot be predicted accurately. Based on an input-shaping technique, we propose a new method to improve the conducting polymer actuators’ command-following ability, while minimizing their electric power consumption. We applied four input functions with smooth characteristics to a trilayer conducting polymer actuator to experimentally evaluate its command-following ability under an open-loop control strategy and a simulated feedback control strategy, and, more importantly, to quantify how the type of input function affects the dynamic response of this class of actuators. We have found that the four smooth inputs consume less electrical power than sharp inputs such as a step input with discontinuous higher-order derivatives. We also obtained an improved transient response performance from the smooth inputs, especially under the simulated feedback control strategy, which we have proposed previously [X Xiang, R Mutlu, G Alici, and W Li, 2014 “Control of conducting polymer actuators without physical feedback: simulated feedback control approach with particle swarm optimization’, Journal of Smart Materials and Structure, 23]. The idea of using a smooth input command, which results in lower power consumption and better control performance, can be extended to other smart actuators. Consuming less electrical energy or power will have a direct effect on enhancing the operational life of these actuators. (paper)

  11. Local electric stimulation causes conducted calcium response in rat interlobular arteries

    DEFF Research Database (Denmark)

    Salomonsson, Max; Gustafsson, Finn; Andreasen, Ditte

    2002-01-01

    microscope. Local electrical pulse stimulation (200 ms, 100 V) was administered by means of an NaCl-filled microelectrode (0.7-1 M(Omega)) juxtaposed to one end of the vessel. Intracellular Ca(2+) concentration ([Ca(2+)](i)) was measured with an image system at a site approximately 500 microm from......The purpose of the present study was to investigate the conducted Ca(2+) response to local electrical stimulation in isolated rat interlobular arteries. Interlobular arteries were isolated from young Sprague-Dawley rats, loaded with fura 2, and attached to pipettes in a chamber on an inverted...

  12. Physical Mechanisms Responsible for Electrical Conduction in Pt/GaN Schottky Diodes

    Directory of Open Access Journals (Sweden)

    H. MAZARI

    2014-05-01

    Full Text Available The current-voltage (I-V characteristics of Pt/(n.u.d-GaN and Pt/Si-doped-GaN diodes Schottky are investigated. Based on these measurements, physical mechanisms responsible for electrical conduction have been suggested. The contribution of thermionic-emission current and various other current transport mechanisms were assumed when evaluating the Schottky barrier height. Thus the generation-recombination, tunneling and leakage currents caused by inhomogeneities and defects at metal-semiconductor interface were taken into account.

  13. Research as Profession and Practice: Frameworks for Guiding the Responsible Conduct of Research.

    Science.gov (United States)

    Chen, Jiin-Yu

    2016-01-01

    Programs in the responsible conduct of research (RCR) vary between institutions, demonstrated by disparate structures and goals. These variations may be attributed to the absence of grounding frameworks within which to examine research and RCR education programs. This article examines research as a practice and a profession, using these frames to draw out defining features of research and the moral obligations entailed. Situating research within virtue ethics can clarify how researchers might cultivate the virtues necessary for meeting its obligations and aims. By elucidating these features, these perspectives can serve to guide the development of RCR education programs.

  14. Boys with conduct problems and callous-unemotional traits: Neural response to reward and punishment and associations with treatment response

    Directory of Open Access Journals (Sweden)

    Amy L. Byrd

    2018-04-01

    Full Text Available Abnormalities in reward and punishment processing are implicated in the development of conduct problems (CP, particularly among youth with callous-unemotional (CU traits. However, no studies have examined whether CP children with high versus low CU traits exhibit differences in the neural response to reward and punishment. A clinic-referred sample of CP boys with high versus low CU traits (ages 8–11; n = 37 and healthy controls (HC; n = 27 completed a fMRI task assessing reward and punishment processing. CP boys also completed a randomized control trial examining the effectiveness of an empirically-supported intervention (i.e., Stop-Now-And-Plan; SNAP. Primary analyses examined pre-treatment differences in neural activation to reward and punishment, and exploratory analyses assessed whether these differences predicted treatment outcome. Results demonstrated associations between CP and reduced amygdala activation to punishment independent of age, race, IQ and co-occurring ADHD and internalizing symptoms. CU traits were not associated with reward or punishment processing after accounting for covariates and no differences were found between CP boys with high versus low CU traits. While boys assigned to SNAP showed a greater reduction in CP, differences in neural activation were not associated with treatment response. Findings suggest that reduced sensitivity to punishment is associated with early-onset CP in boys regardless of the level of CU traits. Keywords: Conduct problems, Callous-unemotional (CU traits, Reward, Punishment, fMRI

  15. Modeling the legal field of formation of socially responsible conduct among pharmacy specialists

    Directory of Open Access Journals (Sweden)

    N. O. Tkachenko

    2018-03-01

    Full Text Available Observation of legal and legislative standards of the company activities is the fundamental principle of social responsibility (SR. The results of the literature analysis show the lack of fundamental research of regulatory and legal support of formation of socially responsible conduct of pharmacists (SRCPh. AIM: modeling the legal framework and determining the completeness and content of the current regulatory and legal framework on formation of a system of SRCPh throughout the professional lifespan development. Materials and methods. The materials of the study were national and international regulatory legal acts, regulating SR, the activities of pharmaceutical organizations (PhO and getting a pharmaceutical education. During the work, such methods as searching information, systematization, content analysis, comparison and generalization were used. During the investigation, we summarized the legal framework that in various aspects forms the socially responsible conduct of the pharmacists throughout the lifespan professional development; and a model of the legal field of this process was formed. A content analysis of this regulatory framework in aspect of responsibility of the PhO and pharmacists with a description of the problem legal questions in the context of SR was carried out. In this article, attention is paid to the basic level of the legal field, within which general principles of social relations are formed in all spheres of the economy. Conclusions. We have formed a model of the legal field formation of a SRCPh system throughout the professional lifespan development. The model is a complex, multilevel system. The regulatory framework in the model is distributed according to two criteria (hierarchical and regulating relations in the system of socially responsible conduct of the pharmacists and includes 27 basic normative legal acts. We have identified problems in the legal field of the basic level of SRCPh formation: the indistinctness

  16. Fluoxetine ameliorates atopic dermatitis-like skin lesions in BALB/c mice through reducing psychological stress and inflammatory response

    Directory of Open Access Journals (Sweden)

    Yanxi Li

    2016-09-01

    Full Text Available Atopic dermatitis (AD is a common chronic inflammatory skin disorder, and patients with AD suffer from severe psychological stress, which markedly increases the prevalence rate of depression and anxiety disorders in later life. Fluoxetine, a selective serotonin reuptake inhibitor, has recently been reported to exert anti-inflammatory and immunosuppressive effects. However, it is unclear whether fluoxetine is effective in the treatment of AD through reducing psychological stress and inflammatory reaction. Here, we reported that a BALB/c mouse model of AD was induced by application of 2,4‑dinitrochlorobenzene (DNCB onto hairless dorsal skin. Chronic fluoxetine treatment (10 mg/kg per day, i.p. significantly attenuated AD-like symptoms, as reflected by a dramatic decrease in scratching bouts, as well as a decrease in anxiety- and depressive-like behaviors. Furthermore, these behavioral changes were accompanied by a significant decrease in epidermal thickness, the number of mast cells in skin tissue, mRNA levels of interleukin-4 (IL-4 and IL-13 in the spleen, as well as serum immunoglobulin E (IgE in the DNCB-treated mice by treatment with fluoxetine. Taken together, these results indicate that fluoxetine may suppress psychological stress and inflammatory response during AD development, and subsequently ameliorate AD symptoms, suggesting that fluoxetine may be a potential therapeutic agent against AD in clinic.

  17. Transdermal glyceryl trinitrate (nitroglycerin in healthy persons: acute effects on skin temperature and hemodynamic orthostatic response

    Directory of Open Access Journals (Sweden)

    Eva Maria Augusta Boeckh Haebisch

    Full Text Available In order to find an explanation for individual reactions to transdermal glyceryl trinitrate (GTN we studied the skin temperature and hemodynamic reactions in 63 healthy persons. The data were obtained before and after the application of GTN and Glycerin (GL placebo patches, during one hour. The skin temperature was measured on both forearms, the local (left sided and systemic (right sided reaction on GTN was related to the skin fold and the calculated body fat content. The bilateral rise of skin temperature and its duration was higher and longer in obese than in lean persons mainly in obese women. The UV induced thermo and the later photothermoreaction (Erythema was reduced on the left forearm after the application of GTN and GL patches. The observed hemodynamic GTN effect confirmed known postural reactions, such as decreased arterial pressure (ΔmAP = -2.9%, increased heart rate (ΔHR = +7,4% and QTc prolongation (ΔQTc = +4,9% in upright position. An adverse drug effect with increased mean blood pressure (ΔmAP = +12% and increased heart rate (ΔHR = + 10.4% mainly in supine position was observed in 11 % of the participants, but only in men. Such a reaction was already described by Murell, 1879. Individual GTN effects were analyzed and related to habits and family history. In male smokers and in persons with hypertensive and diabetic close relatives, the hypotensive GTN effect was accentuated in supine position. In the upright position the group with hypertensives in the family presented a moderate hypotensive reaction without secondary tachycardia and the smokers presented only a slightly increased heart rate. Our observations suggest that individual reactions to transdermal glyceryl trinitrate (GTN with its active component nitric oxide (NO depends on physiological conditions, related to endogenous vasoactive substances, mainly the interaction with EDRF (the endogenous NO and the activity of the Renin-Angiotensin System.

  18. From membrane to skin: aqueous permeation control through light-responsive amphiphilic polymer co-networks

    Czech Academy of Sciences Publication Activity Database

    Schöller, K.; Küpfer, S.; Baumann, L.; Hoyer, P.M.; de Courten, D.; Rossi, R.M.; Vetushka, Aliaksi; Wolf, M.; Bruns, N.; Scherer, L.J.

    2014-01-01

    Roč. 24, č. 33 (2014), s. 5194-5201 ISSN 1616-301X R&D Projects: GA ČR GB14-37427G; GA MŠk(CZ) LM2011026 Institutional support: RVO:68378271 Keywords : transdermal drug-delivery * porcine ear skin * in-vitro * surface modification Subject RIV: JI - Composite Materials Impact factor: 11.805, year: 2014

  19. Responses to hyperthermia. Optimizing heat dissipation by convection and evaporation: Neural control of skin blood flow and sweating in humans.

    Science.gov (United States)

    Smith, Caroline J; Johnson, John M

    2016-04-01

    Under normothermic, resting conditions, humans dissipate heat from the body at a rate approximately equal to heat production. Small discrepancies between heat production and heat elimination would, over time, lead to significant changes in heat storage and body temperature. When heat production or environmental temperature is high the challenge of maintaining heat balance is much greater. This matching of heat elimination with heat production is a function of the skin circulation facilitating heat transport to the body surface and sweating, enabling evaporative heat loss. These processes are manifestations of the autonomic control of cutaneous vasomotor and sudomotor functions and form the basis of this review. We focus on these systems in the responses to hyperthermia. In particular, the cutaneous vascular responses to heat stress and the current understanding of the neurovascular mechanisms involved. The available research regarding cutaneous active vasodilation and vasoconstriction is highlighted, with emphasis on active vasodilation as a major responder to heat stress. Involvement of the vasoconstrictor and active vasodilator controls of the skin circulation in the context of heat stress and nonthermoregulatory reflexes (blood pressure, exercise) are also considered. Autonomic involvement in the cutaneous vascular responses to direct heating and cooling of the skin are also discussed. We examine the autonomic control of sweating, including cholinergic and noncholinergic mechanisms, the local control of sweating, thermoregulatory and nonthermoregulatory reflex control and the possible relationship between sudomotor and cutaneous vasodilator function. Finally, we comment on the clinical relevance of these control schemes in conditions of autonomic dysfunction. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Enhanced brain responses to C-fiber input in the area of secondary hyperalgesia induced by high-frequency electrical stimulation of the skin.

    Science.gov (United States)

    van den Broeke, Emanuel N; Mouraux, André

    2014-11-01

    High-frequency electrical stimulation (HFS) of the human skin induces an increase in both mechanical and heat pain sensitivity in the surrounding unconditioned skin. The aim of this study was to investigate the effect of HFS on the intensity of perception and brain responses elicited by the selective activation of C fibers. HFS was applied to the ventral forearm of 15 healthy volunteers. Temperature-controlled CO2 laser stimulation was used to activate selectively low-threshold C-fiber afferents without concomitantly activating Aδ-fiber afferents. These stimuli were detected with reaction times compatible with the conduction velocity of C fibers. The intensity of perception and event-related brain potentials (ERPs) elicited by thermal stimuli delivered to the surrounding unconditioned skin were recorded before (T0) and after HFS (T1: 20 min after HFS; T2: 45 min after HFS). The contralateral forearm served as a control. Mechanical hyperalgesia following HFS was confirmed by measuring the change in the intensity of perception elicited by mechanical punctate stimuli. HFS resulted in increased intensity of perception to mechanical punctate stimulation and selective C-fiber thermal stimulation at both time points. In contrast, the N2 wave of the ERP elicited by C-fiber stimulation (679 ± 88 ms; means ± SD) was enhanced at T1 but not at T2. The P2 wave (808 ± 105 ms) was unaffected by HFS. Our results suggest that HFS enhances the sensitivity to thermal C-fiber input in the area of secondary hyperalgesia. However, there was no significant enhancement of the magnitude of the C-fiber ERPs at T2, suggesting that quickly adapting C fibers do not contribute to this enhancement. Copyright © 2014 the American Physiological Society.

  1. Comparison of thermal and hemodynamic responses in skin and muscles to heating with electric and magnetic field

    Directory of Open Access Journals (Sweden)

    Karmen Glažar

    2015-06-01

    Full Text Available 12.00 Introduction: It has been shown that sufficient amount of energy provided by electromagnetic diathermy induces the increase of skin temperature and underlying tissues. However, scarce information is available on the differences in responses initiated by various techniques of diathermy. The goal of the present study was to compare thermal and hemodynamic responses of the skin and underlying muscles of the forearm to diathermy applied with electric (EF or magnetic field (MF. Methods: Eleven healthy volunteers participated in the study. On two separate occasions, they randomly received 20-minut diathermy with EF or with MF. Skin and tympanic temperature, and heart rate were measured. Further, kinetics of muscle oxyhemoglobin and deoxyhemoglobin kinetics were obtained. Thermal perception and thermal comfort were noted through the application of EF and MF. Results: The skin temperature increased similarly during the administration of EF and MF, by ~ 8.0 ± 1.3°C on both occasions. The thermal perception was more intense during the application of EF. Accordingly, the thermal comfort during the application of EF was perceived as less comfortable as compared with MF. During MF the increase in minute muscle blood flow and oxygen consumption was for ~ 42 % higher compared to the heating with EF. Conclusion: Although the increase in skin temperature was similar between EF and MF, the application of diathermy with MF was perceived more comfortable by the participants. Furthermore, the increase in minute muscle blood flow and oxygen consumption was higher in MF compared with EF. Thus, when muscle is the target tissue for physical therapy, a diathermy with magnetic field is the technique of choice. Normal 0 21 false false false SL X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Navadna tabela"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso

  2. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Analysis and Modeling of the Galvanic Skin Response Spontaneous Component in the context of Intelligent Biofeedback Systems Development

    Science.gov (United States)

    Unakafov, A.

    2009-01-01

    The paper presents an approach to galvanic skin response (GSR) spontaneous component analysis and modeling. In the study a classification of biofeedback training methods is given, importance of intelligent methods development is shown. The INTENS method, which is perspective for intellectualization, is presented. An important problem of biofeedback training method intellectualization - estimation of the GSR spontaneous component - is solved in the main part of the work. Its main characteristics are described; results of GSR spontaneous component modeling are shown. Results of small research of an optimum material for GSR probes are presented.

  4. Using Pneumatics to Perform Laboratory Hydraulic Conductivity Tests on Gravel with Underdamped Responses

    Science.gov (United States)

    Judge, A. I.

    2011-12-01

    A permeameter has been designed and built to perform laboratory hydraulic conductivity tests on various kinds of gravel samples with hydraulic conductivity values ranging from 0.1 to 1 m/s. The tests are commenced by applying 200 Pa of pneumatic pressure to the free surface of the water column in a riser connected above a cylinder that holds large gravel specimens. This setup forms a permeameter specially designed for these tests which is placed in a barrel filled with water, which acts as a reservoir. The applied pressure depresses the free surface in the riser 2 cm until it is instantly released by opening a ball valve. The water then flows through the base of the cylinder and the specimen like a falling head test, but the water level oscillates about the static value. The water pressure and the applied air pressure in the riser are measured with vented pressure transducers at 100 Hz. The change in diameter lowers the damping frequency of the fluctuations of the water level in the riser, which allows for underdamped responses to be observed for all tests. The results of tests without this diameter change would otherwise be a series of critically damped responses with only one or two oscillations that dampen within seconds and cannot be evaluated with equations for the falling head test. The underdamped responses oscillate about the static value at about 1 Hz and are very sensitive to the hydraulic conductivity of all the soils tested. These fluctuations are also very sensitive to the inertia and friction in the permeameter that are calculated considering the geometry of the permeameter and verified experimentally. Several gravel specimens of various shapes and sizes are tested that show distinct differences in water level fluctuations. The friction of the system is determined by calibrating the model with the results of tests performed where the cylinder had no soil in it. The calculation of the inertia in the response of the water column for the typical testing

  5. Differential immune response of congenic mice to ultraviolet-treated major histocompatibility complex class II-incompatible skin grafts

    International Nuclear Information System (INIS)

    Vermeer, B.J.; Santerse, B.; Van De Kerckhove, B.A.; Schothorst, A.A.; Claas, F.H.

    1988-01-01

    The influence of ultraviolet (UVB) irradiation on the survival of H-2 class II-disparate skin grafts was studied in congenic mouse strains. Isolated skin was UVB irradiated in vitro at a dose of 40 mJ/cm 2 from both sides to remove Ia immunogenicity. Immediately after irradiation the skin was transplanted onto the flank of allogeneic mice. When B10.AQR grafts were transplanted onto B10.T(6R) recipients, a significant prolongation of the survival time was observed, while 50% of the UVB-treated grafts were not rejected at all. However, in the opposite direction--i.e., B10.T(6R) grafts onto B10.AQR recipients, no significant prolongation of the survival was observed. To test whether this effect was due to a difference in susceptibility of the donor skin to UVB irradiation or to a different immune response in the recipients, (B10.T(6R) x B10.AQR) grafts were transplanted onto the parent strains. Similar results were obtained, in that UVB-treated grafts did not show a prolonged survival in B10.AQR recipients, whereas a significant prolongation (50% of the grafts survived more than 100 days) was observed in B10.T(6R) recipients. UVB-treated (B10.T(6R) x B10.AQR)F1 grafts were also transplanted onto (B10.T(6R) x C57B1/10)F1, (B10.AQR x C57B1/10)F1, (B10.T(6R) x Balb/c)F1 and (B10.AQR x Balb/c)F1 recipients--but in none of these combinations was a prolonged survival time observed. These data suggest that, in contrast to all in vitro experiments, the abrogation of the immune response by UVB treatment of the stimulator cells is, in vivo, not a general phenomenon. The genetic constitution of the responder mice seems to play an important role in determining whether or not an immune response takes place

  6. In vitro assessment of skin irritation potential of surfactant-based formulations by using a 3-D skin reconstructed tissue model and cytokine response.

    Science.gov (United States)

    Walters, Russel M; Gandolfi, Lisa; Mack, M Catherine; Fevola, Michael; Martin, Katharine; Hamilton, Mathew T; Hilberer, Allison; Barnes, Nicole; Wilt, Nathan; Nash, Jennifer R; Raabe, Hans A; Costin, Gertrude-Emilia

    2016-12-01

    The personal care industry is focused on developing safe, more efficacious, and increasingly milder products, that are routinely undergoing preclinical and clinical testing before becoming available for consumer use on skin. In vitro systems based on skin reconstructed equivalents are now established for the preclinical assessment of product irritation potential and as alternative testing methods to the classic Draize rabbit skin irritation test. We have used the 3-D EpiDerm™ model system to evaluate tissue viability and primary cytokine interleukin-1α release as a way to evaluate the potential dermal irritation of 224 non-ionic, amphoteric and/or anionic surfactant-containing formulations, or individual raw materials. As part of our testing programme, two representative benchmark materials with known clinical skin irritation potential were qualified through repeated testing, for use as references for the skin irritation evaluation of formulations containing new surfactant ingredients. We have established a correlation between the in vitro screening approach and clinical testing, and are continually expanding our database to enhance this correlation. This testing programme integrates the efforts of global manufacturers of personal care products that focus on the development of increasingly milder formulations to be applied to the skin, without the use of animal testing. 2016 FRAME.

  7. Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

    Science.gov (United States)

    Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

    2014-03-01

    The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  8. Effects of CO2 laser irradiation on the wettability and human skin fibroblast cell response of magnesia partially stabilised zirconia

    International Nuclear Information System (INIS)

    Hao, L.; Lawrence, J.

    2003-01-01

    Human skin fibroblast cells in vitro responses on the surface of a bioinert zirconia ceramic partially stabilised with magnesia partially stabilised zirconia (MgO-PSZ) bioinert ceramic before and after CO 2 laser treatment were investigated to find the interrelationship between the cell adhesion, wettability and laser parameters. Contact angle, θ, measurements of a set of test liquids were a clear indication that surface treatment of the MgO-PSZ with a CO 2 laser brought about a reduction in θ, indicating that the wettability of the MgO-PSZ had been enhanced. A relationship was found between the wettability and the microstructure of the MgO-PSZ surface and laser processing parameters. It was subsequently deduced that the factors active in causing the observed modification in the wettability of the MgO-PSZ were the increases in the surface O 2 content and the polar component of the surface energy, γ sv p , the latter resulting from surface melting and resolidification. Moreover, the investigation into the human skin fibroblast cell response revealed that the CO 2 laser treatment of the MgO-PSZ had resulted in a surface favourable for cell adhesion, as the extent of cell attachment and adhesion on the MgO-PSZ surface was enhanced depending on laser parameters. Such an improvement in cell adhesion, which could be greatly beneficial to developing enhanced bonding at the tissue and implant interface, was influenced by the surface properties of the modified MgO-PSZ, particular wettability

  9. Heterogeneous response to X-ray and ultraviolet light irradiations of cultured skin fibroblasts in two families with Gardner's Syndrome

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Little, J.B.; Nove, J.; Weichselbaum, R.R.; Li, F.P.; Meyer, R.J.; Marchetto, D.J.; Patterson, W.B.

    1982-01-01

    A heterogeneous response to X-ray and far UV (254 nm) light irradiations was found in cultured skin fibroblast lines from 2 separate families with Gardner's syndrome. When compared to 2 normal control cultures and cultures from 2 patients with nonfamilial colon cancer, cultures from 4 clinically affected members of family 1 showed increased sensitivity to the lethal effects of both X-ray and UV light irradiations. These cells also showed a delayed pattern of X-ray potentially lethal damage repair (PLDR) and absent UV PLDR. In contrast, cultures from 3 members of family 2 (2 of whom were clinically affected) showed a normal response of survival and PLDR to both X-ray and UV light irradiations. Thus increased sensitivity of cultured skin fibroblasts to X-ray and UV light irradiations was not a consistent in vitro finding in patients with Gardner's syndrome. However, in families with Gardner's syndrome who demonstrate in vitro radiosensitivity, additional studies are needed to assess the usefulness of these techniques in detecting affected individuals prior to the development of colon carcinoma and other manifestations

  10. Education in the responsible conduct of research in psychology: methods and scope.

    Science.gov (United States)

    DiLorenzo, Terry A; Becker-Fiegeles, Jill; Gibelman, Margaret

    2014-01-01

    In this mixed-method study of education in the responsible conduct of research (RCR) in psychology, phase one survey respondents (n = 141) reported that faculty and students were familiar with RCR standards and procedures to educate them were believed to be adequate. However, educational methods varied widely. In phase two, seven survey respondents completed in-depth interviews assessing RCR training and education and research review procedures. Educational methods through which RCR content was presented included the following ones: traditional (lectures), technical (web-based), and experiential (internships), but RCR was often minimally considered in the formal curriculum. Our results suggest that psychology training programs might benefit from more formal consideration of RCR education and training in the curriculum.

  11. Anomalous Thermal Conductivity and Magnetic Torque Response in the Honeycomb Magnet α -RuCl3

    Science.gov (United States)

    Leahy, Ian A.; Pocs, Christopher A.; Siegfried, Peter E.; Graf, David; Do, S.-H.; Choi, Kwang-Yong; Normand, B.; Lee, Minhyea

    2017-05-01

    We report on the unusual behavior of the in-plane thermal conductivity κ and torque τ response in the Kitaev-Heisenberg material α -RuCl3 . κ shows a striking enhancement with linear growth beyond H =7 T , where magnetic order disappears, while τ for both of the in-plane symmetry directions shows an anomaly at the same field. The temperature and field dependence of κ are far more complex than conventional phonon and magnon contributions, and require us to invoke the presence of unconventional spin excitations whose properties are characteristic of a field-induced spin-liquid phase related to the enigmatic physics of the Kitaev model in an applied magnetic field.

  12. Localization of sclerotic-type chronic graft-vs-host disease to sites of skin injury: potential insight into the mechanism of isomorphic and isotopic responses.

    Science.gov (United States)

    Martires, Kathryn J; Baird, Kristin; Citrin, Deborah E; Hakim, Fran T; Pavletic, Steven Z; Cowen, Edward W

    2011-09-01

    The mechanisms responsible for the variable manifestations of chronic cutaneous graft-vs-host disease (cGVHD) are poorly understood. Localization of sclerotic-type chronic graft-vs-host disease to sites of skin injury (isomorphic and isotopic responses), a recognized phenomenon in morphea, suggests a potential common pathway between cGVHD and other sclerotic skin conditions. Four cases of sclerotic-type cGVHD developed at the site of disparate skin injuries (ionizing radiotherapy, repeated needle sticks, central catheter site, and varicella-zoster virus infection). We review the spectrum of previously reported cases of sclerotic and nonsclerotic cGVHD relating to external forces on the skin. Localization of sclerotic-type cGVHD may occur after many types of skin injury, including UV and ionizing radiotherapy, needle sticks, viral infection, and pressure or friction. Recognition of this phenomenon may be helpful for the early diagnosis of sclerotic disease. Recent insights into the immunological consequences of minor skin injury may provide important clues to the underlying pathogenesis of cGVHD-mediated skin disease.

  13. Instruction in the responsible conduct of research: an inventory of programs and materials within CTSAs.

    Science.gov (United States)

    DuBois, James M; Schilling, Debie A; Heitman, Elizabeth; Steneck, Nicholas H; Kon, Alexander A

    2010-06-01

    The National Institutes of Health (NIH) require instruction in the responsible conduct of research (RCR) as a component of any Clinical and Translational Science Award (CTSA). The Educational Materials Group of the NIH CTSA Consortium's Clinical Research Ethics Key Function Committee (CRE-KFC) conducted a survey of the 38 institutions that held CTSA funding as of January 2009 to determine how they satisfy RCR training requirements. An 8-item questionnaire was sent by email to directors of the Clinical Research Ethics, the Educational and Career Development, and the Regulatory Knowledge cores. We received 78 completed surveys from 38 CTSAs (100%). We found that there is no unified approach to RCR training across CTSAs, many programs lack a coherent plan for RCR instruction, and most CTSAs have not developed unique instructional materials tailored to the needs of clinical and translational scientists. We recommend collaboration among CTSAs and across CTSA key function committees to address these weaknesses. We also requested that institutions send electronic copies of original RCR training materials to share among CTSAs via the CTSpedia website. Twenty institutions submitted at least one educational product. The CTSpedia now contains more than 90 RCR resources.

  14. Pain Processing and Vegetative Dysfunction in Fibromyalgia: A Study by Sympathetic Skin Response and Laser Evoked Potentials

    Directory of Open Access Journals (Sweden)

    Marina de Tommaso

    2017-01-01

    Full Text Available Background. A dysfunction of pain processing at central and peripheral levels was reported in fibromyalgia (FM. We aimed to correlate laser evoked potentials (LEPs, Sympathetic Skin Response (SSR, and clinical features in FM patients. Methods. Fifty FM patients and 30 age-matched controls underwent LEPs and SSR by the right hand and foot. The clinical evaluation included FM disability (FIQ and severity scores (WPI, anxiety (SAS and depression (SDS scales, and questionnaires for neuropathic pain (DN4. Results. The LEP P2 latency and amplitude and the SSR latency were increased in FM group. This latter feature was more evident in anxious patients. The LEPs habituation was reduced in FM patients and correlated to pain severity scores. In a significant number of patients (32% with higher DN4 and FIQ scores, SSR or LEP responses were absent. Conclusions. LEPs and SSR might contribute to clarifying the peripheral and central nervous system involvement in FM patients.

  15. Establishing good collaborative research practices in the responsible conduct of research in nursing science.

    Science.gov (United States)

    Ulrich, Connie M; Wallen, Gwenyth R; Cui, Naixue; Chittams, Jesse; Sweet, Monica; Plemmons, Dena

    2015-01-01

    Team science is advocated to speed the pace of scientific discovery, yet the goals of collaborative practice in nursing science and the responsibilities of nurse stakeholders are sparse and inconclusive. The purpose of this study was to examine nurse scientists' views on collaborative research as part of a larger study on standards of scientific conduct. Web-based descriptive survey of nurse scientists randomly selected from 50 doctoral graduate programs in the United States. Nearly forty percent of nurse respondents were not able to identify good collaborative practices for the discipline; more than three quarters did not know of any published guidelines available to them. Successful research collaborations were challenged by different expectations of authorship and data ownership, lack of timeliness and communication, poorly defined roles and responsibilities, language barriers, and when they involve junior and senior faculty working together on a project. Individual and organizational standards, practices, and policies for collaborative research needs clarification within the discipline. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Effect of lanthanum substitution on dielectric relaxation, impedance response, conducting and magnetic properties of strontium hexaferrite

    Energy Technology Data Exchange (ETDEWEB)

    Want, Basharat, E-mail: bawant@kashmiruniversity.ac.in; Bhat, Bilal Hamid; Ahmad, Bhat Zahoor

    2015-04-05

    Highlights: • The substitution of La affects the dielectric and magnetic properties of strontium hexaferrite. • The electric behaviour of the compound follows the Koop’s phenomenological theory. • The impedance study shows the role of grain boundaries to the electric properties of the compound. • The substitution of La to strontium hexaferrite reduces the resistive nature of grain boundaries. - Abstract: Lanthanum strontium hexaferrite Sr{sub 1−x}La{sub x}Fe{sub 12}O{sub 19} (x = 0, 0.08, 0.13 , 0.18) has been successfully synthesized by using citrate-precursor method and characterized by different techniques. The X-ray diffraction results revealed that the sample is crystalline in nature and is of single phase with the space group P63/mmc. The dielectric, conducting and impedance related studies have been carried out as a function of frequency and concentration of lanthanum in the frequency ranges of 20 Hz–3 MHz. Impedance studies were performed in the frequency domain to distinguish between bulk and grain boundary contributions of the material to the overall dielectric response. The electric response of the material was also modeled by an equivalent circuit and different circuit parameters were calculated. Magnetic characterization of the material was also performed and the effect of lanthanum concentration was studied. The hysteresis loop obtained from the magnetometer showed that with the increase of lanthanum concentration, the saturation magnetisation decreases while as coercivity increases.

  17. 21 CFR 822.24 - What are my responsibilities once I am notified that I am required to conduct postmarket...

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false What are my responsibilities once I am notified that I am required to conduct postmarket surveillance? 822.24 Section 822.24 Food and Drugs FOOD AND... SURVEILLANCE Responsibilities of Manufacturers § 822.24 What are my responsibilities once I am notified that I...

  18. Optimization of Process Variables for Insulation Coating of Conductive Particles by Response Surface Methodology

    International Nuclear Information System (INIS)

    Sim, Chol-Ho

    2016-01-01

    The powder core, conventionally fabricated from iron particles coated with insulator, showed large eddy current loss under high frequency, because of small specific resistance. To overcome the eddy current loss, the increase in the specific resistance of powder cores was needed. In this study, copper oxide coating onto electrically conductive iron particles was performed using a planetary ball mill to increase the specific resistance. Coating factors were optimized by the Response surface methodology. The independent variables were the CuO mass fraction, mill revolution number, coating time, ball size, ball mass and sample mass. The response variable was the specific resistance. The optimization of six factors by the fractional factorial design indicated that CuO mass fraction, mill revolution number, and coating time were the key factors. The levels of these three factors were selected by the three-factors full factorial design and steepest ascent method. The steepest ascent method was used to approach the optimum range for maximum specific resistance. The Box-Behnken design was finally used to analyze the response surfaces of the screened factors for further optimization. The results of the Box-Behnken design showed that the CuO mass fraction and mill revolution number were the main factors affecting the efficiency of coating process. As the CuO mass fraction increased, the specific resistance increased. In contrast, the specific resistance increased with decreasing mill revolution number. The process optimization results revealed a high agreement between the experimental and the predicted data (Adj-R2=0.944). The optimized CuO mass fraction, mill revolution number, and coating time were 0.4, 200 rpm, and 15 min, respectively. The measured value of the specific resistance of the coated pellet under the optimized conditions of the maximum specific resistance was 530 kΩ·cm

  19. Optimization of Process Variables for Insulation Coating of Conductive Particles by Response Surface Methodology

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Chol-Ho [Sangji University, Wonju (Korea, Republic of)

    2016-02-15

    The powder core, conventionally fabricated from iron particles coated with insulator, showed large eddy current loss under high frequency, because of small specific resistance. To overcome the eddy current loss, the increase in the specific resistance of powder cores was needed. In this study, copper oxide coating onto electrically conductive iron particles was performed using a planetary ball mill to increase the specific resistance. Coating factors were optimized by the Response surface methodology. The independent variables were the CuO mass fraction, mill revolution number, coating time, ball size, ball mass and sample mass. The response variable was the specific resistance. The optimization of six factors by the fractional factorial design indicated that CuO mass fraction, mill revolution number, and coating time were the key factors. The levels of these three factors were selected by the three-factors full factorial design and steepest ascent method. The steepest ascent method was used to approach the optimum range for maximum specific resistance. The Box-Behnken design was finally used to analyze the response surfaces of the screened factors for further optimization. The results of the Box-Behnken design showed that the CuO mass fraction and mill revolution number were the main factors affecting the efficiency of coating process. As the CuO mass fraction increased, the specific resistance increased. In contrast, the specific resistance increased with decreasing mill revolution number. The process optimization results revealed a high agreement between the experimental and the predicted data (Adj-R2=0.944). The optimized CuO mass fraction, mill revolution number, and coating time were 0.4, 200 rpm, and 15 min, respectively. The measured value of the specific resistance of the coated pellet under the optimized conditions of the maximum specific resistance was 530 kΩ·cm.

  20. Transmission potential, skin inflammatory response, and parasitism of symptomatic and asymptomatic dogs with visceral leishmaniasis

    Directory of Open Access Journals (Sweden)

    Goto H

    2008-11-01

    Full Text Available Abstract Background Visceral leishmaniasis in Brazil is caused by the protozoan Leishmania (Leishmania chagasi and it is transmitted by sandfly of the genus Lutzomyia. Dogs are an important domestic reservoir, and control of the transmission of visceral leishmaniasis (VL to humans includes the elimination of infected dogs. However, though dogs are considered to be an important element in the transmission cycle of Leishmania, the identification of infected dogs representing an immediate risk for transmission has not been properly evaluated. Since it is not possible to treat infected dogs, they are sacrificed when a diagnosis of VL is established, a measure that is difficult to accomplish in highly endemic areas. In such areas, parameters that allow for easy identification of reservoirs that represents an immediate risk for transmission is of great importance for the control of VL transmission. In this study we aimed to identify clinical parameters, reinforced by pathological parameters that characterize dogs with potential to transmit the parasite to the vector. Results The major clinical manifestations of visceral leishmaniasis in dogs from an endemic area were onicogriphosis, skin lesions, conjunctivitis, lymphadenopathy, and weight loss. The transmission potential of these dogs was assessed by xenodiagnosis using Lutzomyia longipalpis. Six of nine symptomatic dogs were infective to Lutzomyia longipalpis while none of the five asymptomatic dogs were infective to the sandfly. Leishmania amastigotes were present in the skin of all clinically symptomatic dogs, but absent in asymptomatic dogs. Higher parasite loads were observed in the ear and ungueal region, and lower in abdomen. The inflammatory infiltrate was more intense in the ears and ungueal regions of both symptomatic and asymptomatic dogs. In clinically affected dogs in which few or none Leishmania amastigotes were observed, the inflammatory infiltrate was constituted mainly of lymphocytes

  1. Skin-transmitted pathogens and the heebie jeebies: evidence for a subclass of disgust stimuli that evoke a qualitatively unique emotional response.

    Science.gov (United States)

    Blake, Khandis R; Yih, Jennifer; Zhao, Kun; Sung, Billy; Harmon-Jones, Cindy

    2017-09-01

    Skin-transmitted pathogens have threatened humans since ancient times. We investigated whether skin-transmitted pathogens were a subclass of disgust stimuli that evoked an emotional response that was related to, but distinct from, disgust and fear. We labelled this response "the heebie jeebies". In Study 1, coding of 76 participants' experiences of disgust, fear, and the heebie jeebies showed that the heebie jeebies was elicited by unique stimuli which produced skin-crawling sensations and an urge to protect the skin. In Experiment 2,350 participants' responses to skin-transmitted pathogen, fear-inducing, and disgust-inducing vignettes showed that the vignettes elicited sensations and urges which loaded onto heebie jeebies, fear, and disgust factors, respectively. Experiment 3 largely replicated findings from Experiment 2 using video stimuli (178 participants). Results are consistent with the notion that skin-transmitted pathogens are a subclass of disgust stimuli which motivate behaviours that are functionally consistent with disgust yet qualitatively distinct.

  2. Adaptive technique for matching the spectral response in skin lesions' images

    International Nuclear Information System (INIS)

    Pavlova, P; Borisova, E; Avramov, L; Pavlova, E

    2015-01-01

    The suggested technique is a subsequent stage for data obtaining from diffuse reflectance spectra and images of diseased tissue with a final aim of skin cancer diagnostics. Our previous work allows us to extract patterns for some types of skin cancer, as a ratio between spectra, obtained from healthy and diseased tissue in the range of 380 – 780 nm region. The authenticity of the patterns depends on the tested point into the area of lesion, and the resulting diagnose could also be fixed with some probability. In this work, two adaptations are implemented to localize pixels of the image lesion, where the reflectance spectrum corresponds to pattern. First adapts the standard to the personal patient and second – translates the spectrum white point basis to the relative white point of the image. Since the reflectance spectra and the image pixels are regarding to different white points, a correction of the compared colours is needed. The latest is done using a standard method for chromatic adaptation. The technique follows the steps below: –Calculation the colorimetric XYZ parameters for the initial white point, fixed by reflectance spectrum from healthy tissue; –Calculation the XYZ parameters for the distant white point on the base of image of nondiseased tissue; –Transformation the XYZ parameters for the test-spectrum by obtained matrix; –Finding the RGB values of the XYZ parameters for the test-spectrum according sRGB; Finally, the pixels of the lesion's image, corresponding to colour from the test-spectrum and particular diagnostic pattern are marked with a specific colour

  3. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  4. Skin rash in patients treated with neoadjuvant erlotinib (Tarceva in resectable non-small cell lung cancer: Predictor for tumor response and survival?

    Directory of Open Access Journals (Sweden)

    Van Gool MH

    2017-08-01

    Full Text Available Background: Skin rash during treatment with epidermal growth factor receptor (EGFR-tyrosine kinase inhibitors (TKI has been reported to be predictive for response and survival in patients with advanced non-small cell lung cancer (NSCLC. The aim of this analysis was to evaluate whether skin rash during treatment (as a biomarker in a preoperative setting was related to response and survival. Methods: This study was designed as an open-label phase II trial (also known as M06NEL. Patients received preoperative erlotinib (Tarceva 150 mg once daily for 3 weeks. Skin toxicity during treatment was analysed in relation to metabolic and histopathological response, overall survival (OS and progression-free survival (PFS. Results: In total 59 patients (25 male, 34 female were eligible for analysis. In 39 patients (66% skin toxicity occurred. According to National Cancer Institute Common Toxicity Criteria (NCICTC, Grade 1 toxicity was seen in 15 patients (25%, Grade 2 in 19 patients (32% and Grade 3 in five patients (8%. None of the patients showed skin toxicity Grade 4 and 5. The median follow up was 74 months. Thirty-six patients (61% were alive at time of analysis. Twenty-seven patients (46% showed disease progression during follow up. Hazard ratios (HR indicated lower risk of death (HR = 0.66, 95%CI: 0.29 - 1.50 and progression (HR = 0.64, 0.30 - 1.36, although in this small group results were not significant. Skin rash did not adequately predict response. Conclusions: In this neoadjuvant setting with limited treatment time in patients with early stage NSCLC, skin rash was not associated with response and survival and cannot be used as an early biomarker.

  5. Cultivar Diversity of Grape Skin Polyphenol Composition and Changes in Response to Drought Investigated by LC-MS Based Metabolomics

    Directory of Open Access Journals (Sweden)

    Lucie Pinasseau

    2017-10-01

    Full Text Available Phenolic compounds represent a large family of plant secondary metabolites, essential for the quality of grape and wine and playing a major role in plant defense against biotic and abiotic stresses. Phenolic composition is genetically driven and greatly affected by environmental factors, including water stress. A major challenge for breeding of grapevine cultivars adapted to climate change and with high potential for wine-making is to dissect the complex plant metabolic response involved in adaptation mechanisms. A targeted metabolomics approach based on ultra high-performance liquid chromatography coupled to triple quadrupole mass spectrometry (UHPLC-QqQ-MS analysis in the Multiple Reaction Monitoring (MRM mode has been developed for high throughput profiling of the phenolic composition of grape skins. This method enables rapid, selective, and sensitive quantification of 96 phenolic compounds (anthocyanins, phenolic acids, stilbenoids, flavonols, dihydroflavonols, flavan-3-ol monomers, and oligomers…, and of the constitutive units of proanthocyanidins (i.e., condensed tannins, giving access to detailed polyphenol composition. It was applied on the skins of mature grape berries from a core-collection of 279 Vitis vinifera cultivars grown with or without watering to assess the genetic variation for polyphenol composition and its modulation by irrigation, in two successive vintages (2014–2015. Distribution of berry weights and δ13C values showed that non irrigated vines were subjected to a marked water stress in 2014 and to a very limited one in 2015. Metabolomics analysis of the polyphenol composition and chemometrics analysis of this data demonstrated an influence of water stress on the biosynthesis of different polyphenol classes and cultivar differences in metabolic response to water deficit. Correlation networks gave insight on the relationships between the different polyphenol metabolites and related biosynthetic pathways. They also

  6. Thermal Response of Cooled Silicon Nitride Plate Due to Thermal Conductivity Effects Analyzed

    Science.gov (United States)

    Baaklini, George Y.; Abdul-Aziz, Ali; Bhatt, Ramakrishna

    2003-01-01

    Lightweight, strong, tough high-temperature materials are required to complement efficiency improvements for next-generation gas turbine engines that can operate with minimum cooling. Because of their low density, high-temperature strength, and high thermal conductivity, ceramics are being investigated as materials to replace the nickelbase superalloys that are currently used for engine hot-section components. Ceramic structures can withstand higher operating temperatures and a harsh combustion environment. In addition, their low densities relative to metals help reduce component mass (ref. 1). To complement the effectiveness of the ceramics and their applicability for turbine engine applications, a parametric study using the finite element method is being carried out. The NASA Glenn Research Center remains very active in conducting and supporting a variety of research activities related to ceramic matrix composites through both experimental and analytical efforts (ref. 1). The objectives of this work are to develop manufacturing technology, develop a thermal and environmental barrier coating (TBC/EBC), develop an analytical modeling capability to predict thermomechanical stresses, and perform a minimal burner rig test on silicon nitride (Si3N4) and SiC/SiC turbine nozzle vanes under simulated engine conditions. Moreover, we intend to generate a detailed database of the material s property characteristics and their effects on structural response. We expect to offer a wide range of data since the modeling will account for other variables, such as cooling channel geometry and spacing. Comprehensive analyses have begun on a plate specimen with Si3N4 cooling holes.

  7. Creating an infrastructure for training in the responsible conduct of research: the University of Pittsburgh's experience.

    Science.gov (United States)

    Barnes, Barbara E; Friedman, Charles P; Rosenberg, Jerome L; Russell, Joanne; Beedle, Ari; Levine, Arthur S

    2006-02-01

    In response to public concerns about the consequences of research misconduct, academic institutions have become increasingly cognizant of the need to implement comprehensive, effective training in the responsible conduct of research (RCR) for faculty, staff, students, and external collaborators. The ability to meet this imperative is challenging as universities confront declining financial resources and increasing complexity of the research enterprise. The authors describe the University of Pittsburgh's design, implementation, and evaluation of a Web-based, institution-wide RCR training program called Research and Practice Fundamentals (RPF). This project, established in 2000, was embedded in the philosophy, organizational structure, and technology developed through the Integrated Advanced Information Management Systems grant from the National Library of Medicine. Utilizing a centralized, comprehensive approach, the RPF system provides an efficient mechanism for deploying content to a large, diverse cohort of learners and supports the needs of research administrators by providing access to information about who has successfully completed the training. During its first 3 years of operation, the RPF served over 17,000 users and issued more than 38,000 training certificates. The 18 modules that are currently available address issues required by regulatory mandates and other content areas important to the research community. RPF users report high levels of satisfaction with content and ease of using the system. Future efforts must explore methods to integrate non-RCR education and training into a centralized, cohesive structure. The University of Pittsburgh's experience with the RPF demonstrates the importance of developing an infrastructure for training that is comprehensive, scalable, reliable, centralized, affordable, and sustainable.

  8. Skin-safe photothermal therapy enabled by responsive release of acid-activated membrane-disruptive polymer from polydopamine nanoparticle upon very low laser irradiation.

    Science.gov (United States)

    Zhu, Rui; Gao, Feng; Piao, Ji-Gang; Yang, Lihua

    2017-07-25

    How to ablate tumor without damaging skin is a challenge for photothermal therapy. We, herein, report skin-safe photothermal cancer therapy provided by the responsive release of acid-activated hemolytic polymer (aHLP) from the photothermal polydopamine (PDA) nanoparticle upon irradiation at very low dosage. Upon skin-permissible irradiation (via an 850 nm laser irradiation at the power density of 0.4 W cm -2 ), the nanoparticle aHLP-PDA generates sufficient localized-heat to bring about mild hyperthermia treatment and consequently, responsively sheds off the aHLP polymer from its PDA nanocore; this leads to selective cytotoxicity to cancer cells under the acidic conditions of the extracellular microenvironment of tumor. As a result, our aHLP-PDA nanoparticle upon irradiation at a low dosage effectively inhibits tumor growth without damaging skin, as demonstrated using animal models. Effective in mitigating the otherwise inevitable skin damage in tumor photothermal therapy, the nanosystem reported herein offers an efficient pathway towards skin-safe photothermal therapy.

  9. Using Simulation in Nursing PhD Education: Facilitating Application of Responsible Conduct of Research Principles.

    Science.gov (United States)

    Clayton, Margaret F; Supiano, Katherine; Wilson, Rebecca; Lassche, Madeline; Latendresse, Gwen

    Simulation is a standard clinical nursing educational approach; however, simulation is rarely used in nonclinical nursing education. In doctor of philosophy (PhD) programs, ethical content about responsible conduct of research (RCR) is traditionally didactic, presented early in the program of study. Ethics content merits review before students begin the dissertation phase; thus, the purpose of this project was to design and implement simulated scenarios to help students apply RCR principles prior to beginning independent research. Two scenarios were developed: (a) a potential protocol change discussed in a research team meeting and (b) an in-home data collection experience with an elderly participant and her daughter. Actors were trained faculty volunteers, playing roles outside their usual academic positions. Faculty facilitated scenarios by posing questions as cues related to desired learning outcomes as scenarios unfolded. Eleven nursing PhD students and 6 faculty participated. Debriefing facilitated discussion of RCR principles, common research quandaries, and suggested scenario revisions. Faculty, expert observation, and video-review showed that younger and less experienced students tried to give the "right" answer rather than implement RCR appropriate solutions. Students with more clinical experience had difficulty adopting the less familiar researcher role. Overall, simulation is a novel and useful way to enhance RCR content in PhD programs. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Pulsed EM Field Response of a Thin, High-Contrast, Finely Layered Structure With Dielectric and Conductive Properties

    NARCIS (Netherlands)

    De Hoop, A.T.; Jiang, L.

    2009-01-01

    The response of a thin, high-contrast, finely layered structure with dielectric and conductive properties to an incident, pulsed, electromagnetic field is investigated theoretically. The fine layering causes the standard spatial discretization techniques to solve Maxwell's equations numerically to

  11. Complete Electric Dipole Response in 120Sn and 208Pb and Implications for Neutron Skin and Symmetry Energy

    Directory of Open Access Journals (Sweden)

    von Neumann-Cosel Peter

    2015-01-01

    Full Text Available Polarized proton scattering at energies of a few 100 MeV and extreme forward angles including 0° has been established as a new tool to extract the complete E1 response in nuclei up to excitation energies of about 20 MeV. A case study of 208Pb demonstrates excellent agreement with other electromagnetic probes. From the information on the B(E1 strength one can derive the electric dipole dipole polarizability, which is strongly correlated to the neutron skin and to parameters of the symmetry energy. Recently, we have extracted the polarizability of 120Sn with a comparable precision. The combination of both results further constrains the symmetry energy parameters and presents a challenge for mean-field models, since the relativistic and many Skyrme parameterizations cannot reproduce both experimental results simultaneously.

  12. Differential gene expression profiling of mouse skin after sulfur mustard exposure: Extended time response and inhibitor effect

    International Nuclear Information System (INIS)

    Gerecke, Donald R.; Chen Minjun; Isukapalli, Sastry S.; Gordon, Marion K.; Chang, Y.-C.; Tong Weida; Androulakis, Ioannis P.; Georgopoulos, Panos G.

    2009-01-01

    Sulfur mustard (HD, SM), is a chemical warfare agent that within hours causes extensive blistering at the dermal-epidermal junction of skin. To better understand the progression of SM-induced blistering, gene expression profiling for mouse skin was performed after a single high dose of SM exposure. Punch biopsies of mouse ears were collected at both early and late time periods following SM exposure (previous studies only considered early time periods). The biopsies were examined for pathological disturbances and the samples further assayed for gene expression profiling using the Affymetrix microarray analysis system. Principal component analysis and hierarchical cluster analysis of the differently expressed genes, performed with ArrayTrack showed clear separation of the various groups. Pathway analysis employing the KEGG library and Ingenuity Pathway Analysis (IPA) indicated that cytokine-cytokine receptor interaction, cell adhesion molecules (CAMs), and hematopoietic cell lineage are common pathways affected at different time points. Gene ontology analysis identified the most significantly altered biological processes as the immune response, inflammatory response, and chemotaxis; these findings are consistent with other reported results for shorter time periods. Selected genes were chosen for RT-PCR verification and showed correlations in the general trends for the microarrays. Interleukin 1 beta was checked for biological analysis to confirm the presence of protein correlated to the corresponding microarray data. The impact of a matrix metalloproteinase inhibitor, MMP-2/MMP-9 inhibitor I, against SM exposure was assessed. These results can help in understanding the molecular mechanism of SM-induced blistering, as well as to test the efficacy of different inhibitors

  13. 45 CFR 2508.8 - Who is responsible for establishing the Corporation's rules of conduct for Privacy Act compliance?

    Science.gov (United States)

    2010-10-01

    ... Corporation's rules of conduct for Privacy Act compliance? 2508.8 Section 2508.8 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE IMPLEMENTATION OF THE PRIVACY ACT OF 1974 § 2508.8 Who is responsible for establishing the Corporation's rules of conduct for...

  14. Selective CD28 Antagonist Blunts Memory Immune Responses and Promotes Long-Term Control of Skin Inflammation in Nonhuman Primates.

    Science.gov (United States)

    Poirier, Nicolas; Chevalier, Melanie; Mary, Caroline; Hervouet, Jeremy; Minault, David; Baker, Paul; Ville, Simon; Le Bas-Bernardet, Stephanie; Dilek, Nahzli; Belarif, Lyssia; Cassagnau, Elisabeth; Scobie, Linda; Blancho, Gilles; Vanhove, Bernard

    2016-01-01

    Novel therapies that specifically target activation and expansion of pathogenic immune cell subsets responsible for autoimmune attacks are needed to confer long-term remission. Pathogenic cells in autoimmunity include memory T lymphocytes that are long-lived and present rapid recall effector functions with reduced activation requirements. Whereas the CD28 costimulation pathway predominantly controls priming of naive T cells and hence generation of adaptive memory cells, the roles of CD28 costimulation on established memory T lymphocytes and the recall of memory responses remain controversial. In contrast to CD80/86 antagonists (CTLA4-Ig), selective CD28 antagonists blunt T cell costimulation while sparing CTLA-4 and PD-L1-dependent coinhibitory signals. Using a new selective CD28 antagonist, we showed that Ag-specific reactivation of human memory T lymphocytes was prevented. Selective CD28 blockade controlled both cellular and humoral memory recall in nonhuman primates and induced long-term Ag-specific unresponsiveness in a memory T cell-mediated inflammatory skin model. No modification of memory T lymphocytes subsets or numbers was observed in the periphery, and importantly no significant reactivation of quiescent viruses was noticed. These findings indicate that pathogenic memory T cell responses are controlled by both CD28 and CTLA-4/PD-L1 cosignals in vivo and that selectively targeting CD28 would help to promote remission of autoimmune diseases and control chronic inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.

  15. Membrane potentials and intracellular Cl- activity of toad skin epithelium in relation to activation and deactivation of the transepithelial Cl- conductance

    DEFF Research Database (Denmark)

    Willumsen, N J; Larsen, Erik Hviid

    1986-01-01

    M in skins from animals adapted to distilled water. Both Va and acCl were found to be positively correlated with Isc (r = 0.66 and r = 0.70, respectively). In eight epithelia from animals adapted to dry milieu/tap water Va and acCl were measured with KCl Ringer's on the outside during activation...... V was stepped back to 40 mV, Va instantaneously shifted to -67.8 +/- 3.9 mV while acCl and fRa remained constant during deactivation of GCl. Similar results were obtained in epithelia impaled from the serosal side. In 12 skins from animals adapted to either tap water or distilled water the density...... zero.(ABSTRACT TRUNCATED AT 400 WORDS)...

  16. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate

    NARCIS (Netherlands)

    de Jongh, Cindy M.; Verberk, Maarten M.; Withagen, Carien E. T.; Jacobs, John J. L.; Rustemeyer, Thomas; Kezic, Sanja

    2006-01-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels

  17. Influence of a detergent on skin response to methyldibromo glutaronitrile in sensitized individuals

    DEFF Research Database (Denmark)

    Pedersen, Line Kynemund; Haslund, Pia; Johansen, Jeanne Duus

    2004-01-01

    The present study was undertaken to evaluate the combined effect of the preservative methyldibromo glutaronitrile (MDBGN) and sodium lauryl sulfate (SLS) on the elicitation response of allergic contact dermatitis. 20 volunteers with contact allergy to MDBGN were patch tested with 5 concentrations...

  18. Actively Perceiving and Responsive Soft Robots Enabled by Self-Powered, Highly Extensible, and Highly Sensitive Triboelectric Proximity- and Pressure-Sensing Skins.

    Science.gov (United States)

    Lai, Ying-Chih; Deng, Jianan; Liu, Ruiyuan; Hsiao, Yung-Chi; Zhang, Steven L; Peng, Wenbo; Wu, Hsing-Mei; Wang, Xingfu; Wang, Zhong Lin

    2018-06-04

    Robots that can move, feel, and respond like organisms will bring revolutionary impact to today's technologies. Soft robots with organism-like adaptive bodies have shown great potential in vast robot-human and robot-environment applications. Developing skin-like sensory devices allows them to naturally sense and interact with environment. Also, it would be better if the capabilities to feel can be active, like real skin. However, challenges in the complicated structures, incompatible moduli, poor stretchability and sensitivity, large driving voltage, and power dissipation hinder applicability of conventional technologies. Here, various actively perceivable and responsive soft robots are enabled by self-powered active triboelectric robotic skins (tribo-skins) that simultaneously possess excellent stretchability and excellent sensitivity in the low-pressure regime. The tribo-skins can actively sense proximity, contact, and pressure to external stimuli via self-generating electricity. The driving energy comes from a natural triboelectrification effect involving the cooperation of contact electrification and electrostatic induction. The perfect integration of the tribo-skins and soft actuators enables soft robots to perform various actively sensing and interactive tasks including actively perceiving their muscle motions, working states, textile's dampness, and even subtle human physiological signals. Moreover, the self-generating signals can drive optoelectronic devices for visual communication and be processed for diverse sophisticated uses. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Response of mouse skin to tattooing: use of SKH-1 mice as a surrogate model for human tattooing

    International Nuclear Information System (INIS)

    Gopee, Neera V.; Cui, Yanyan; Olson, Greg; Warbritton, Alan R.; Miller, Barbara J.; Couch, Letha H.; Wamer, Wayne G.; Howard, Paul C.

    2005-01-01

    Tattooing is a popular cosmetic practice involving more than 45 million US citizens. Since the toxicology of tattoo inks and pigments used to formulate tattoo inks has not been reported, we studied the immunological impact of tattooing and determined recovery time from this trauma. SKH-1 hairless mice were tattooed using commercial tattoo inks or suspensions of titanium dioxide, cadmium sulfide, or iron oxide, and sacrificed at 0.5, 1, 3, 4, 7, or 14 days post-tattooing. Histological evaluation revealed dermal hemorrhage at 0.5 and 1 day. Acute inflammation and epidermal necrosis were initiated at 0.5 day decreasing in incidence by day 14. Dermal necrosis and epidermal hyperplasia were prominent by day 3, reducing in severity by day 14. Chronic active inflammation persisted in all tattooed mice from day 3 to 14 post-tattooing. Inguinal and axillary lymph nodes were pigmented, the inguinal being most reactive as evidenced by lymphoid hyperplasia and polymorphonuclear infiltration. Cutaneous nuclear protein concentrations of nuclear factor-kappa B were elevated between 0.5 and 4 days. Inflammatory and proliferative biomarkers, cyclooxygenase-1, cyclooxygenase-2, and ornithine decarboxylase protein levels were elevated between 0.5 and 4 days in the skin and decreased to control levels by day 14. Interleukin-1 beta and interleukin-10 were elevated in the lymph nodes but suppressed in the tattooed skin, with maximal suppression occurring between days 0.5 and 4. These data demonstrate that mice substantially recover from the tattooing insult by 14 days, leaving behind pigment in the dermis and the regional lymph nodes. The response seen in mice is similar to acute injury seen in humans, suggesting that the murine model might be a suitable surrogate for investigating the toxicological and phototoxicological properties of ingredients used in tattooing

  20. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    International Nuclear Information System (INIS)

    Ullrich, R.L.

    1975-01-01

    The possible mechanistic relationships between the early inflammatory response and subsequent fibrosis seen after radiation exposure was studied in rats were given single x ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The results suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses. (U.S.)

  1. Assessment of the respiratory metabolism in the skin from transcutaneous measurements of pO2 and pCO2: potential for non-invasive monitoring of response to tuberculin skin testing.

    Science.gov (United States)

    Abbot, N C; Spence, V A; Swanson-Beck, J; Carnochan, F M; Gibbs, J H; Lowe, J G

    1990-03-01

    A method is described for non-invasive transcutaneous (tc) measurement of tissue respiratory gas tensions in the skin on the forearm for study of delayed hypersensitivity reactions in man. Steady state values for tcpO2 and tcpCO2 were measured, and the skin respiratory rate (oxygen consumption) and the tissue pH were estimated from the changes in tcpO2 and tcpCO2 observed after interruption of the arterial circulation by cuff occlusion for 4 minutes. The extent of within-experiment and between subject variation in the steady-state measurements was not great (coefficient of variation 10%): tcpCO2.ss (steady state) was higher in men and tcpO2.ss was higher in women, but the extent of these sex differences was also small. Reference ranges have been established for tc measurements and calculated indices of tissue respiration in the undisturbed forearm skin of normal volunteers, against which the changes induced by tuberculin testing can be assessed. Severe changes, indicative of profound hypoxia and acidosis, are seen in intense delayed hypersensitivity reactions. Similar, but less severe changes were seen at the site of skin tests on BCG-vaccinated subjects who were 'negative' by conventional criteria of measurement of dermal induration and they became greatly exaggerated after successful re-vaccination. Intradermal injection of saline did not induce hypoxia or local acidosis. These new methods are very sensitive indicators of the tissue response in the DHS reaction.

  2. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine.

    Science.gov (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W

    2017-12-19

    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  3. Deep tissue injury in development of pressure ulcers: a decrease of inflammasome activation and changes in human skin morphology in response to aging and mechanical load.

    Directory of Open Access Journals (Sweden)

    Olivera Stojadinovic

    Full Text Available Molecular mechanisms leading to pressure ulcer development are scarce in spite of high mortality of patients. Development of pressure ulcers that is initially observed as deep tissue injury is multifactorial. We postulate that biomechanical forces and inflammasome activation, together with ischemia and aging, may play a role in pressure ulcer development. To test this we used a newly-developed bio-mechanical model in which ischemic young and aged human skin was subjected to a constant physiological compressive stress (load of 300 kPa (determined by pressure plate analyses of a person in a reclining position for 0.5-4 hours. Collagen orientation was assessed using polarized light, whereas inflammasome proteins were quantified by immunoblotting. Loaded skin showed marked changes in morphology and NLRP3 inflammasome protein expression. Sub-epidermal separations and altered orientation of collagen fibers were observed in aged skin at earlier time points. Aged skin showed significant decreases in the levels of NLRP3 inflammasome proteins. Loading did not alter NLRP3 inflammasome proteins expression in aged skin, whereas it significantly increased their levels in young skin. We conclude that aging contributes to rapid morphological changes and decrease in inflammasome proteins in response to tissue damage, suggesting that a decline in the innate inflammatory response in elderly skin could contribute to pressure ulcer pathogenesis. Observed morphological changes suggest that tissue damage upon loading may not be entirely preventable. Furthermore, newly developed model described here may be very useful in understanding the mechanisms of deep tissue injury that may lead towards development of pressure ulcers.

  4. Soil permittivity response to bulk electrical conductivity for selected soil water sensors

    Science.gov (United States)

    Bulk electrical conductivity can dominate the low frequency dielectric loss spectrum in soils, masking changes in the real permittivity and causing errors in estimated water content. We examined the dependence of measured apparent permittivity (Ka) on bulk electrical conductivity in contrasting soil...

  5. Inflammatory response, parasite load and AgNOR expression in ear skin of symptomatic and asymptomatic Leishmania (Leishmania chagasi infected dogs

    Directory of Open Access Journals (Sweden)

    Verçosa BLA

    2011-01-01

    Full Text Available The skin has an important role in the transmission of visceral leishmaniasis (VL as the infection pathway in dogs. To better characterize the inflammatory response of intact skin in VL, sixty infected dogs (30 symptomatic and 30 asymptomatic and six non-infected controls were studied. Diagnosis of visceral leishmaniasis was confirmed by RIFI and ELISA; direct visualization of the parasite in bone marrow aspirate; imprints of popliteal lymph nodes, spleen, liver and skin; culture in NNN-phase liquid Schneider's medium; and PCR (performed only in the ear skin. Amastigote forms of the parasite in intact skin were found only in symptomatic dogs. Inflammatory infiltrates were observed in all groups, varying from intense and/or moderate in symptomatic to discrete and/or negligible in asymptomatic and control animals. Parasite load was associated with the intensity of the inflammatory response and with clinical manifestations in canine visceral leishmaniasis. AgNOr as active transcription markers were expressed in inflammatory cells and within apoptotic bodies in all groups, including controls, with no statistical difference. Therefore, cell activation and transcription do occur in both symptomatic and asymptomatic canine visceral leishmaniasis and may result in more necrosis and inflammation or in apoptosis and less symptoms, depending on the parasite load.

  6. 5-HT receptors as novel targets for optimizing pigmentary responses in dorsal skin melanophores of frog, Hoplobatrachus tigerinus

    Science.gov (United States)

    Ali, Sharique A; Salim, Saima; Sahni, Tarandeep; Peter, Jaya; Ali, Ayesha S

    2012-01-01

    BACKGROUND AND PURPOSE Biochemical identification of 5-HT has revealed similar projection patterns across vertebrates. In CNS, 5-HT regulates major physiological functions but its peripheral functions are still emerging. The pharmacology of 5-HT is mediated by a diverse range of receptors that trigger different responses. Interestingly, 5-HT receptors have been detected in pigment cells indicating their role in skin pigmentation. Hence, we investigated the role of this monoaminergic system in amphibian pigment cells, melanophores, to further our understanding of its role in pigmentation biology together with its evolutionary significance. EXPERIMENTAL APPROACH Pharmacological profiling of 5-HT receptors was achieved using potent/selective agonists and antagonists. In vitro responses of melanophores were examined by Mean Melanophores Size Index assay. The melanophores of lower vertebrates are highly sensitive to external stimuli. The immediate cellular responses to drugs were defined in terms of pigment translocation within the cells. KEY RESULTS 5-HT exerted strong concentration-dependent pigment dispersion at threshold dose of 1 × 10−6 g·mL−1. Specific 5-HT1 and 5-HT2 receptor agonists, sumatriptan and myristicin. also induced dose-dependent dispersion. Yohimbine and metergoline synergistically antagonized sumatriptan-mediated dispersion, whereas trazodone partially blocked myristicin-induced dispersion. Conversely, 5-HT3 and 5-HT4 receptor agonists, 1 (3 chlorophenyl) biguanide (1,3 CPB) and 5-methoxytryptamine (5-MT), caused a dose-dependent pigment aggregation. The aggregatory effect of 1,3 CPB was completely blocked by ondansetron, whereas L-lysine partially blocked the effect of 5-MT. CONCLUSIONS AND IMPLICATIONS The results suggest that 5-HT-induced physiological effects are mediated via distinct classes of receptors, which possibly participate in the modulation of pigmentary responses in amphibian. PMID:21880033

  7. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  8. Prefrontal oxygenation correlates to the responses in facial skin blood flows during exposure to pleasantly charged movie

    OpenAIRE

    Matsukawa, Kanji; Endo, Kana; Asahara, Ryota; Yoshikawa, Miho; Kusunoki, Shinya; Ishida, Tomoko

    2017-01-01

    Abstract Our laboratory reported that facial skin blood flow may serve as a sensitive tool to assess an emotional status. Cerebral neural correlates during emotional interventions should be sought in relation to the changes in facial skin blood flow. To test the hypothesis that prefrontal activity has positive relation to the changes in facial skin blood flow during emotionally charged stimulation, we examined the dynamic changes in prefrontal oxygenation (with near‐infrared spectroscopy) and...

  9. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  10. Temperature and frequency response of conductivity in Ag2S doped chalcogenide glassy semiconductor

    Science.gov (United States)

    Ojha, Swarupa; Das, Anindya Sundar; Roy, Madhab; Bhattacharya, Sanjib

    2018-06-01

    The electric conductivity of chalcogenide glassy semiconductor xAg2S-(1-x)(0.5S-0.5Te) has been presented here as a function of temperature and frequency. Formation of different nanocrystallites has been confirmed from X-ray diffraction study. It is also noteworthy that average size of nanocrystallites decreases with the increase of dislocation density. Dc conductivity data have been interpreted using Mott's model and Greaves's model in low and high temperature regions respectively. Ac conductivity above the room temperature has been analyzed using Meyer-Neldel (MN) conduction rule. It is interestingly noted that Correlated Barrier Hopping (CBH) model is the most appropriate conduction mechanism for x = 0.35, where pairs of charge carrier are considered to hop over the potential barrier between the sites via thermal activation. To interpret experimental data for x = 0.45, modified non-overlapping small polaron tunnelling (NSPT) model is supposed to be appropriate model due to tunnelling through grain boundary. The conductivity spectra at various temperatures have been analyzed using Almond-West Formalism (power law model). Scaling of conductivity spectra reveals that electrical relaxation process of charge carriers (polaron) is temperature independent but depends upon the composition of the present chalcogenide glassy system.

  11. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    International Nuclear Information System (INIS)

    Ullrich, R.L.

    1975-01-01

    This study was designed to examine possible mechanistic relationships between the early inflammatory response and the subsequent fibrosis seen after radiation exposure. Anesthetized Rochester ex-Wistar rats were given single x-ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The data suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that (1) both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and (2) a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses

  12. Response of mouse skin and bone marrow to heavy charged particles

    International Nuclear Information System (INIS)

    Ainsworth, E.J.

    1980-01-01

    Because of the desirability to determine RBE at therapeutically relevant dose levels, our approach was to use a challenge-dose technique. This challenge-dose technique assesses injury accumulation and repair or recovery following administration of comparatively low doses by challenging animals. No previous studies have been conducted using CFU-S irradiated in vivo as a model system to assess the RBE of heavy charged particles for either cell killing or for late effects. The goal of the CFU-S studies reported here was to determine the RBE for cell killing, and to use these data to design experiments to explore the effects of HZE particle dose fractionation on femur CFU-S repopulation and on late effects indicated by a reduction in the size of the CFU-S compartment

  13. Use of Galvanic Skin Responses, Salivary Biomarkers, and Self-reports to Assess Undergraduate Student Performance During a Laboratory Exam Activity

    Science.gov (United States)

    Villanueva, Idalis; Valladares, Maria; Goodridge, Wade

    2016-01-01

    Typically, self-reports are used in educational research to assess student response and performance to a classroom activity. Yet, addition of biological and physiological measures such as salivary biomarkers and galvanic skin responses are rarely included, limiting the wealth of information that can be obtained to better understand student performance. A laboratory protocol to study undergraduate students' responses to classroom events (e.g., exams) is presented. Participants were asked to complete a representative exam for their degree. Before and after the laboratory exam session, students completed an academic achievement emotions self-report and an interview that paralleled these questions when participants wore a galvanic skin sensor and salivary biomarkers were collected. Data collected from the three methods resulted in greater depth of information about students' performance when compared to the self-report. The work can expand educational research capabilities through more comprehensive methods for obtaining nearer to real-time student responses to an examination activity. PMID:26891278

  14. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  15. Developmental changes in autonomic responses are associated with future reward/punishment expectations: A study of sympathetic skin responses in the Markov decision task.

    Science.gov (United States)

    Hosaka, Hiromi; Aoyagi, Kakuro; Kaga, Yoshimi; Kanemura, Hideaki; Sugita, Kanji; Aihara, Masao

    2017-08-01

    Autonomic nervous system activity is recognized as a major component of emotional responses. Future reward/punishment expectations depend upon the process of decision making in the frontal lobe, which is considered to play an important role in executive function. The aim of this study was to investigate the relationship between autonomic responses and decision making during reinforcement tasks using sympathetic skin responses (SSR). Nine adult and 9 juvenile (mean age, 10.2years) volunteers were enrolled in this study. SSRs were measured during the Markov decision task (MDT), which is a reinforcement task. In this task, subjects must endure a small immediate loss to ultimately get a large reward. The subjects had to undergo three sets of tests and their scores in these tests were assessed and evaluated. All adults showed gradually increasing scores for the MDT from the first to third set. As the trial progressed from the first to second set in adults, SSR appearance ratios remarkably increased for both punishment and reward expectations. In comparison with adults, children showed decreasing scores from the first to second set. There were no significant inter-target differences in the SSR appearance ratio in the first and second set in children. In the third set, the SSR appearance ratio for reward expectations was higher than that in the neutral condition. In reinforcement tasks, such as MDT, autonomic responses play an important role in decision making. We assume that SSRs are elicited during efficient decision making tasks associated with future reward/punishment expectations, which demonstrates the importance of autonomic function. In contrast, in children around the age of 10years, the autonomic system does not react as an organized response specific to reward/punishment expectations. This suggests the immaturity of the future reward/punishment expectations process in children. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B

  16. Determination of head conductivity frequency response in vivo with optimized EIT-EEG.

    Science.gov (United States)

    Dabek, Juhani; Kalogianni, Konstantina; Rotgans, Edwin; van der Helm, Frans C T; Kwakkel, Gert; van Wegen, Erwin E H; Daffertshofer, Andreas; de Munck, Jan C

    2016-02-15

    Electroencephalography (EEG) benefits from accurate head models. Dipole source modelling errors can be reduced from over 1cm to a few millimetres by replacing generic head geometry and conductivity with tailored ones. When adequate head geometry is available, electrical impedance tomography (EIT) can be used to infer the conductivities of head tissues. In this study, the boundary element method (BEM) is applied with three-compartment (scalp, skull and brain) subject-specific head models. The optimal injection of small currents to the head with a modular EIT current injector, and voltage measurement by an EEG amplifier is first sought by simulations. The measurement with a 64-electrode EEG layout is studied with respect to three noise sources affecting EIT: background EEG, deviations from the fitting assumption of equal scalp and brain conductivities, and smooth model geometry deviations from the true head geometry. The noise source effects were investigated depending on the positioning of the injection and extraction electrode and the number of their combinations used sequentially. The deviation from equal scalp and brain conductivities produces rather deterministic errors in the three conductivities irrespective of the current injection locations. With a realistic measurement of around 2 min and around 8 distant distinct current injection pairs, the error from the other noise sources is reduced to around 10% or less in the skull conductivity. The analysis of subsequent real measurements, however, suggests that there could be subject-specific local thinnings in the skull, which could amplify the conductivity fitting errors. With proper analysis of multiplexed sinusoidal EIT current injections, the measurements on average yielded conductivities of 340 mS/m (scalp and brain) and 6.6 mS/m (skull) at 2 Hz. From 11 to 127 Hz, the conductivities increased by 1.6% (scalp and brain) and 6.7% (skull) on the average. The proper analysis was ensured by using recombination of

  17. Subcutaneous L-tyrosine elicits cutaneous analgesia in response to local skin pinprick in rats.

    Science.gov (United States)

    Hung, Ching-Hsia; Chiu, Chong-Chi; Liu, Kuo-Sheng; Chen, Yu-Wen; Wang, Jhi-Joung

    2015-10-15

    The purpose of the study was to estimate the ability of L-tyrosine to induce cutaneous analgesia and to investigate the interaction between L-tyrosine and the local anesthetic lidocaine. After subcutaneously injecting the rats with L-tyrosine and lidocaine in a dose-dependent manner, cutaneous analgesia (by blocking the cutaneous trunci muscle reflex-CTMR) was evaluated in response to the local pinprick. The drug-drug interaction was analyzed by using an isobolographic method. We showed that both L-tyrosine and lidocaine produced dose-dependent cutaneous analgesia. On the 50% effective dose (ED50) basis, the rank of drug potency was lidocaine (5.09 [4.88-5.38] μmol)>L-tyrosine (39.1 [36.5-41.8] μmol) (Ptyrosine lasted longer than that caused by lidocaine (Ptyrosine exhibited an additive effect on infiltrative cutaneous analgesia. Our pre-clinical study demonstrated that L-tyrosine elicits the local/cutaneous analgesia, and the interaction between L-tyrosine and lidocaine is additive. L-tyrosine has a lower potency but much greater duration of cutaneous analgesia than lidocaine. Adding L-tyrosine to lidocaine preparations showed greater duration of cutaneous analgesia compared with lidocaine alone. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Real-time gene expression analysis in carp (Cyprinus carpio) skin: inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauska, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  19. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: Inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauskas, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  20. Enhanced high temperature thermoelectric response of sulphuric acid treated conducting polymer thin films

    KAUST Repository

    Sarath Kumar, S. R.; Kurra, Narendra; Alshareef, Husam N.

    2015-01-01

    We report the high temperature thermoelectric properties of solution processed pristine and sulphuric acid treated poly(3, 4-ethylenedioxythiophene):poly(4-styrenesulfonate) (or PEDOT:PSS) films. The acid treatment is shown to simultaneously enhance the electrical conductivity and Seebeck coefficient of the metal-like films, resulting in a five-fold increase in thermoelectric power factor (0.052 W/m. K ) at 460 K, compared to the pristine film. By using atomic force micrographs, Raman and impedance spectra and using a series heterogeneous model for electrical conductivity, we demonstrate that acid treatment results in the removal of PSS from the films, leading to the quenching of accumulated charge-induced energy barriers that prevent hopping conduction. The continuous removal of PSS with duration of acid treatment also alters the local band structure of PEDOT:PSS, resulting in simultaneous enhancement in Seebeck coefficient.

  1. Enhanced high temperature thermoelectric response of sulphuric acid treated conducting polymer thin films

    KAUST Repository

    Sarath Kumar, S. R.

    2015-11-24

    We report the high temperature thermoelectric properties of solution processed pristine and sulphuric acid treated poly(3, 4-ethylenedioxythiophene):poly(4-styrenesulfonate) (or PEDOT:PSS) films. The acid treatment is shown to simultaneously enhance the electrical conductivity and Seebeck coefficient of the metal-like films, resulting in a five-fold increase in thermoelectric power factor (0.052 W/m. K ) at 460 K, compared to the pristine film. By using atomic force micrographs, Raman and impedance spectra and using a series heterogeneous model for electrical conductivity, we demonstrate that acid treatment results in the removal of PSS from the films, leading to the quenching of accumulated charge-induced energy barriers that prevent hopping conduction. The continuous removal of PSS with duration of acid treatment also alters the local band structure of PEDOT:PSS, resulting in simultaneous enhancement in Seebeck coefficient.

  2. Experimental research and observation of the skin response of mice with a second-degree scald during irradiation by a CO2 laser

    Science.gov (United States)

    Wang, Yunxia; Wu, Shulian; Li, Zhifang; Xu, Xiaohui; Li, Hui

    2014-05-01

    Second-degree scalding is a common dermatological injury. Inappropriate treatment methods in clinical practice always produce scarring, and can lead to skin cancer and other complications in the longer term. In this study optical coherence tomography (OCT) combined with a skin detector was used to monitor the response of second-degree scalded skin tissue irradiated by a CO2 laser. The process of treatment of second-degree scalding was systematically studied from the perspective of tissue optics. The OCT signal intensity was stronger within the whole recovery period in the experimental group undergoing CO2 laser treatment, and the attenuation coefficient (μt) returned to its original value in a shorter time. The results help us to understand tissue injury in a second-degree scald and may help improve the standard treatment.

  3. The response of guinea pig primary utricular and saccular irregular neurons to bone-conducted vibration (BCV) and air-conducted sound (ACS).

    Science.gov (United States)

    Curthoys, Ian S; Vulovic, Vedran; Burgess, Ann M; Sokolic, Ljiljana; Goonetilleke, Samanthi C

    2016-01-01

    This study sought to characterize the response of mammalian primary otolithic neurons to sound and vibration by measuring the resting discharge rates, thresholds for increases in firing rate and supra-threshold sensitivity functions of guinea pig single primary utricular and saccular afferents. Neurons with irregular resting discharge were activated in response to bone conducted vibration (BCV) and air conducted sound (ACS) for frequencies between 100 Hz and 3000 Hz. The location of neurons was verified by labelling with neurobiotin. Many afferents from both maculae have very low or zero resting discharge, with saccular afferents having on average, higher resting rates than utricular afferents. Most irregular utricular and saccular afferents can be evoked by both BCV and ACS. For BCV stimulation: utricular and saccular neurons show similar low thresholds for increased firing rate (around 0.02 g on average) for frequencies from 100 Hz to 750 Hz. There is a steep increase in rate change threshold for BCV frequencies above 750 Hz. The suprathreshold sensitivity functions for BCV were similar for both utricular and saccular neurons, with, at low frequencies, very steep increases in firing rate as intensity increased. For ACS stimulation: utricular and saccular neurons can be activated by high intensity stimuli for frequencies from 250 Hz to 3000 Hz with similar flattened U-shaped tuning curves with lowest thresholds for frequencies around 1000-2000 Hz. The average ACS thresholds for saccular afferents across these frequencies is about 15-20 dB lower than for utricular neurons. The suprathreshold sensitivity functions for ACS were similar for both utricular and saccular neurons. Both utricular and saccular afferents showed phase-locking to BCV and ACS, extending up to frequencies of at least around 1500 Hz for BCV and 3000 Hz for ACS. Phase-locking at low frequencies (e.g. 100 Hz) imposes a limit on the neural firing rate evoked by the stimulus since the

  4. The Role of AKT/mTOR Pathway in Stress Response to UV-Irradiation: Implication in Skin Carcinogenesis by Regulation of Apoptosis, Autophagy and Senescence

    Science.gov (United States)

    Strozyk, Elwira; Kulms, Dagmar

    2013-01-01

    Induction of DNA damage by UVB and UVA radiation may generate mutations and genomic instability leading to carcinogenesis. Therefore, skin cells being repeatedly exposed to ultraviolet (UV) light have acquired multilayered protective mechanisms to avoid malignant transformation. Besides extensive DNA repair mechanisms, the damaged skin cells can be eliminated by induction of apoptosis, which is mediated through the action of tumor suppressor p53. In order to prevent the excessive loss of skin cells and to maintain the skin barrier function, apoptotic pathways are counteracted by anti-apoptotic signaling including the AKT/mTOR pathway. However, AKT/mTOR not only prevents cell death, but is also active in cell cycle transition and hyper-proliferation, thereby also counteracting p53. In turn, AKT/mTOR is tuned down by the negative regulators being controlled by the p53. This inhibition of AKT/mTOR, in combination with transactivation of damage-regulated autophagy modulators, guides the p53-mediated elimination of damaged cellular components by autophagic clearance. Alternatively, p53 irreversibly blocks cell cycle progression to prevent AKT/mTOR-driven proliferation, thereby inducing premature senescence. Conclusively, AKT/mTOR via an extensive cross talk with p53 influences the UV response in the skin with no black and white scenario deciding over death or survival. PMID:23887651

  5. Water bath hyperthermia is a simple therapy for psoriasis and also stimulates skin tanning in response to sunlight

    Energy Technology Data Exchange (ETDEWEB)

    Boreham, D.R.; Gasmann, H.C.; Mitchel, R.E.J

    1994-07-01

    An eight week trial, involving superficial hyperthermia delivered biweekly via simple water bath immersion, was tested for its ability to clear mild to moderate psoriatic lesions. Seven patients were treated and three cases rapidly improved. In the remaining patients, the treatment frequency was increased to alternate days; two cases improved significantly, one patient showed a partial response, and the fourth had no visible change (this was the only patient taking concurrent drug therapy - etretinate). In addition to resolving psoriatic lesions, water bath hyperthermia also reduced edema (swelling) and relieved pruritus (itching) in all patients, both during the treatment period and for up to several months after lesions had returned. Lesion reappearance occurred within one to three months after the last heat treatment. We retreated one patient and produced a second complete remission. These results indicate that simple repetitive water bath hyperthermia alone is effective in the treatment of psoriatic lesions in heatable locations. An unexpected side effect was enhanced melanin content (tanning) in all areas where hyperthermia treated skin was exposed to sunlight. (author)

  6. Optically-tracked handheld fluorescence imaging platform for monitoring skin response in the management of soft tissue sarcoma

    Science.gov (United States)

    Chamma, Emilie; Qiu, Jimmy; Lindvere-Teene, Liis; Blackmore, Kristina M.; Majeed, Safa; Weersink, Robert; Dickie, Colleen I.; Griffin, Anthony M.; Wunder, Jay S.; Ferguson, Peter C.; DaCosta, Ralph S.

    2015-07-01

    Standard clinical management of extremity soft tissue sarcomas includes surgery with radiation therapy. Wound complications (WCs) arising from treatment may occur due to bacterial infection and tissue breakdown. The ability to detect changes in these parameters during treatment may lead to earlier interventions that mitigate WCs. We describe the use of a new system composed of an autofluorescence imaging device and an optical three-dimensional tracking system to detect and coregister the presence of bacteria with radiation doses. The imaging device visualized erythema using white light and detected bacterial autofluorescence using 405-nm excitation light. Its position was tracked relative to the patient using IR reflective spheres and registration to the computed tomography coordinates. Image coregistration software was developed to spatially overlay radiation treatment plans and dose distributions on the white light and autofluorescence images of the surgical site. We describe the technology, its use in the operating room, and standard operating procedures, as well as demonstrate technical feasibility and safety intraoperatively. This new clinical tool may help identify patients at greater risk of developing WCs and investigate correlations between radiation dose, skin response, and changes in bacterial load as biomarkers associated with WCs.

  7. Electric dipole response of {sup 208}Pb from proton inelastic scattering: Constraints on neutron skin thickness and symmetry energy

    Energy Technology Data Exchange (ETDEWEB)

    Tamii, A. [Research Center for Nuclear Physics, Ibaraki (Japan); Neumann-Cosel, P. von; Poltoratska, I. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany)

    2014-02-15

    The electric dipole (E1) response of {sup 208}Pb has been precisely determined by measuring Coulomb excitation induced by proton scattering at very forward angles. The electric dipole polarizability, defined as inverse energy-weighted sum rule of the E1 strength, has been extracted as α{sub D} = 20.1 ± 0.6 fm{sup 3}. The data can be used to constrain the neutron skin thickness of {sup 208}Pb to Δr{sub np} = 0.165 ± (0.009){sub expt} ± (0.013){sub theor} ± (0.021){sub est} fm, where the subscript ''expt'' refers to the experimental uncertainty, ''theor'' to the theoretical confidence band and ''est'' to the uncertainty associated with the estimation of the symmetry energy at the saturation density. In addition, a constraint band has been extracted in the plane of the symmetry energy (J and its slope parameter L) at the saturation density. (orig.)

  8. Cotton fabric coated with conducting polymers and its application in monitoring of carnivorous plant response

    Czech Academy of Sciences Publication Activity Database

    Bajgar, V.; Penhaker, M.; Martinková, L.; Pavlovič, A.; Bober, Patrycja; Trchová, Miroslava; Stejskal, Jaroslav

    2016-01-01

    Roč. 16, č. 4 (2016), 498_1-498_12 ISSN 1424-8220 R&D Projects: GA TA ČR(CZ) TE01020022 Institutional support: RVO:61389013 Keywords : conducting polymers * plant neurobiology * polyaniline Subject RIV: CG - Electrochemistry Impact factor: 2.677, year: 2016

  9. An Item Response Theory Analysis of DSM-IV Conduct Disorder

    Science.gov (United States)

    Gelhorn, Heather; Hartman, Christie; Sakai, Joseph; Mikulich-Gilbertson, Susan; Stallings, Michael; Young, Susan; Rhee, Soo; Corley, Robin; Hewitt, John; Hopfer, Christian; Crowley, Thomas

    2009-01-01

    Interviews with over 3,000 adolescents were made to evaluate the extent to which DSM-IV criteria characterizes the range of severity of adolescent antisocial behavior within and across sex. The DSM-IV conduct disorder (CD) criteria are a useful indicator of severe adolescent antisocial behavior but some CD criteria display sex bias.

  10. Using Plant Temperature to Evaluate the Response of Stomatal Conductance to Soil Moisture Deficit

    Directory of Open Access Journals (Sweden)

    Ming-Han Yu

    2015-10-01

    Full Text Available Plant temperature is an indicator of stomatal conductance, which reflects soil moisture stresses. We explored the relationship between plant temperature and soil moisture to optimize irrigation schedules in a water-stress experiment using Firmiana platanifolia (L. f. Marsili in an incubator. Canopy temperature, leaf temperature, and stomatal conductance were measured using thermal imaging and a porometer. The results indicated that (1 stomatal conductance decreased with declines in soil moisture, and reflected average canopy temperature; (2 the variation of the leaf temperature distribution was a reliable indicator of soil moisture stress, and the temperature distribution in severely water-stressed leaves exhibited greater spatial variation than that in the presence of sufficient irrigation; (3 thermal indices (Ig and crop water stress index (CWSI were theoretically proportional to stomatal conductance (gs, Ig was certified to have linearity relationship with gs and CWSI have a logarithmic relationship with gs, and both of the two indices can be used to estimate soil moisture; and (4 thermal imaging data can reflect water status irrespective of long-term water scarcity or lack of sudden rainfall. This study applied thermal imaging methods to monitor plants and develop adaptable irrigation scheduling, which are important for the formulation of effective and economical agriculture and forestry policy.

  11. The New Multi-Ministry Response to Conduct Problems: A SWOT Analysis

    Science.gov (United States)

    Stanley, Peter

    2008-01-01

    "The Inter-agency Plan for Conduct Disorder/Severe Antisocial Behaviour 2007-2012" (Ministry of Social Development, 2007) is assessed according to the SWOT dimensions of strengths, weaknesses, opportunities and threats. The document is one of the most important statements for the social services in New Zealand because of the primacy that…

  12. Determination of head conductivity frequency response in vivo with optimized EIT-EEG

    NARCIS (Netherlands)

    Dabek, Juhani; Kalogianni, Konstantina; Rotgans, Edwin; van der Helm, Frans C.T.; Kwakkel, Gert; van Wegen, Erwin E.H.; Daffertshofer, Andreas; de Munck, Jan C.

    2016-01-01

    Electroencephalography (EEG) benefits from accurate head models. Dipole source modelling errors can be reduced from over 1 cm to a few millimetres by replacing generic head geometry and conductivity with tailored ones. When adequate head geometry is available, electrical impedance tomography (EIT)

  13. The responsibility of technology. Weighting goods - risk assessment - codes of conduct

    International Nuclear Information System (INIS)

    Lenk, H.; Maring, M.

    1991-01-01

    Under the heading 'The responsibility of technology' nineteen authors contribute to the following topics: Basic questions of weighting 'goods' relating to resources, the relationship of technical possibilities and (self)restraint of individuals and collectives, striving for knowledge and appropriate limits, possibilities of directing and influencing technology and questions concerning (the limits of) individual and collective responsibility. Dealt with in more detail are: The assessment of technical risks and uncertainties from an ethical and legal point of view, problems in nuclear research and technology illustrated by the example of Chernobyl, information technology, and the influence of the press when presenting technology matters. (orig./HSCH) [de

  14. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Research Ethics I: Responsible Conduct of Research (RCR)--Historical and Contemporary Issues Pertaining to Human and Animal Experimentation

    Science.gov (United States)

    Horner, Jennifer; Minifie, Fred D.

    2011-01-01

    Purpose: In this series of articles--"Research Ethics I", "Research Ethics II", and "Research Ethics III"--the authors provide a comprehensive review of the 9 core domains for the responsible conduct of research (RCR) as articulated by the Office of Research Integrity. In "Research Ethics I", they present a historical overview of the evolution of…

  16. Measuring the implementation of codes of conduct. An assessment method based on a process approach of the responsible organisation

    NARCIS (Netherlands)

    Nijhof, A.H.J.; Cludts, Stephan; Fisscher, O.A.M.; Laan, Albertus

    2003-01-01

    More and more organisations formulate a code of conduct in order to stimulate responsible behaviour among their members. Much time and energy is usually spent fixing the content of the code but many organisations get stuck in the challenge of implementing and maintaining the code. The code then

  17. Electroencephalographic, Heart Rate, and Galvanic Skin Response Assessment for an Advertising Perception Study: Application to Antismoking Public Service Announcements.

    Science.gov (United States)

    Cartocci, Giulia; Caratù, Myriam; Modica, Enrica; Maglione, Anton Giulio; Rossi, Dario; Cherubino, Patrizia; Babiloni, Fabio

    2017-08-28

    The evaluation of advertising, products, and packaging is traditionally performed through methods based on self-reports and focus groups, but these approaches often appear poorly accurate in scientific terms. Neuroscience is increasingly applied to the investigation of the neurophysiological bases of the perception of and reaction to commercial stimuli to support traditional marketing methods. In this context, a particular sector or marketing is represented by public service announcements (PSAs). The objective of this protocol is to apply electroencephalography (EEG) and autonomic signal analysis to study responses to selected antismoking PSAs. Two EEG indices were employed: the frontal alpha band EEG asymmetry (the Approach Withdrawal (AW) index) and the frontal theta (effort index). Furthermore, the autonomic Emotional Index (EI) was calculated, as derived from the Galvanic Skin Response (GSR) and Heart Rate (HR) signals. The present protocol describes a series of operational and computational steps required to properly estimate, through the aforementioned indices, the emotional and cerebral reaction of a group of subjects towards a selected number of antismoking PSAs. In particular, a campaign characterized by a symbolic communication style (classified as "awarded" on the basis of the prizes received by specialized committees) obtained the highest approach values, as estimated by the AW index. A spot and an image belonging to the same PSA campaign based on the "fear arousing appeal" and with a narrative/experiential communication style (classified as "effective" on the basis of the economical/health-related improvements promoted) reported the lowest and highest effort values, respectively. This is probably due to the complexity of the storytelling (spot) and to the immediateness of the image (a lady who underwent a tracheotomy). Finally, the same "effective" campaign showed the highest EI values, possibly because of the empathy induced by the testimonial and the

  18. Randomized placebo-controlled trial of sucrose analgesia on neonatal skin blood flow and pain response during heel lance.

    Science.gov (United States)

    Tutag Lehr, Victoria; Cortez, Josef; Grever, William; Cepeda, Eugene; Thomas, Ron; Aranda, Jacob V

    2015-05-01

    To evaluate the effect of oral sucrose on skin blood flow (SBF; perfusion units; PU) measured by Laser Doppler Imager (LDI) in term newborns and pain response (Neonatal Infant Pain Scale score; NIPS score) during heel lance; (2) determine SBF changes during heel lance; and (3) the relationship between SBF and NIPS. Term infants ≤7 days old (n=56) undergoing routine heel lance were randomized to pretreatment with 2.0 mL oral 24% sucrose (n=29) or sterile water (n=27) in a double-blinded, placebo-controlled trial. SBF was assessed by LDI scans and NIPS scores at 10 minutes before lance, immediately after lancing, and 5 minutes after blood extraction. Mean SBF and median NIPS scores were compared between groups using General Linear Model or Kruskal-Wallis. Regressions examined the relationship between SBF immediately after heel lance and NIPS score. Mean SBF and median NIPS scores immediately after heel lance were lower in sucrose-treated infants (167.9±15.5 vs. 205.4±16.0 PU, P=0.09; NIPS 1 [interquartile range 0 to 4] vs. NIPS 3 [interquartile range 0 to 6], P=0.02), although no significant difference in mean SBF. During heel lance NIPS score was predictive of SBF. An increase of 1 in NIPS score was associated with 11 PU increase in SBF (R=0.21; P=0.09) for sucrose, and 16 PU increase for placebo-treated infants (R=0.20; P=0.014). Increased SBF assessed by LDI is a pain response among term neonates after routine heel lance, which was not completely attenuated by oral sucrose administration. Increased SBF is associated with NIPS scores. Sucrose analgesic efficacy evidenced by decreased NIPS scores for the sucrose group. Association of SBF with NIPS scores suggests that LDI is potentially useful for assessing newborn procedural pain.

  19. Non-thermal near-infrared exposure photobiomodulates cellular responses to ionizing radiation in human full thickness skin models.

    Science.gov (United States)

    König, Anke; Zöller, Nadja; Kippenberger, Stefan; Bernd, August; Kaufmann, Roland; Layer, Paul G; Heselich, Anja

    2018-01-01

    Ionizing and near-infrared radiation are both part of the therapeutic spectrum in cancer treatment. During cancer therapy ionizing radiation is typically used for non-invasive reduction of malignant tissue, while near-infrared photobiomodulation is utilized in palliative medical approaches, e.g. for pain reduction or impairment of wound healing. Furthermore, near-infrared is part of the solar wavelength spectrum. A combined exposure of these two irradiation qualities - either intentionally during medical treatment or unintentionally due to solar exposure - is therefore presumable for cancer patients. Several studies in different model organisms and cell cultures show a strong impact of near-infrared pretreatment on ionizing radiation-induced stress response. To investigate the risks of non-thermal near-infrared (NIR) pretreatment in patients, a human in vitro full thickness skin models (FTSM) was evaluated for radiation research. FTSM were pretreated with therapy-relevant doses of NIR followed by X-radiation, and then examined for DNA-double-strand break (DSB) repair, cell proliferation and apoptosis. Double-treated FTSM revealed a clear influence of NIR on X-radiation-induced stress responses in cells in their typical tissue environment. Furthermore, over a 24h time period, double-treated FTSM presented a significant persistence of DSBs, as compared to samples exclusively irradiated by X-rays. In addition, NIR pretreatment inhibited apoptosis induction of integrated fibroblasts, and counteracted the radiation-induced proliferation inhibition of basal keratinocytes. Our work suggests that cancer patients treated with X-rays should be prevented from uncontrolled NIR irradiation. On the other hand, controlled double-treatment could provide an alternative therapy approach, exposing the patient to less radiation. Copyright © 2017. Published by Elsevier B.V.

  20. Internephron coupling by conducted vasomotor responses in normotensive and spontaneously hypertensive rats

    DEFF Research Database (Denmark)

    Wagner, A J; Holstein-Rathlou, N H; Marsh, D J

    1997-01-01

    strains. Mechanical length constants were similar in SD and SHR (approximately 325 microm), indicating that the signal responsible for the effect decays at the same rate in both strains. We conclude that internephron coupling strength is significantly greater in SHR and that internephron coupling is due...

  1. 49 CFR Appendix to Subtitle A - United States Railway Association-Employee Responsibilities and Conduct

    Science.gov (United States)

    2010-10-01

    ... accident insurance plan or other employee welfare or benefit plan that is maintained by a business or... 49 Transportation 1 2010-10-01 2010-10-01 false United States Railway Association-Employee... Subtitle A, App. Appendix to Subtitle A—United States Railway Association—Employee Responsibilities and...

  2. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  3. Auditory brainstem responses of CBA/J mice with neonatal conductive hearing losses and treatment with GM1 ganglioside.

    Science.gov (United States)

    Money, M K; Pippin, G W; Weaver, K E; Kirsch, J P; Webster, D B

    1995-07-01

    Exogenous administration of GM1 ganglioside to CBA/J mice with a neonatal conductive hearing loss ameliorates the atrophy of spiral ganglion neurons, ventral cochlear nucleus neurons, and ventral cochlear nucleus volume. The present investigation demonstrates the extent of a conductive loss caused by atresia and tests the hypothesis that GM1 ganglioside treatment will ameliorate the conductive hearing loss. Auditory brainstem responses were recorded from four groups of seven mice each: two groups received daily subcutaneous injections of saline (one group had normal hearing; the other had a conductive hearing loss); the other two groups received daily subcutaneous injections of GM1 ganglioside (one group had normal hearing; the other had a conductive hearing loss). In mice with a conductive loss, decreases in hearing sensitivity were greatest at high frequencies. The decreases were determined by comparing mean ABR thresholds of the conductive loss mice with those of normal hearing mice. The conductive hearing loss induced in the mice in this study was similar to that seen in humans with congenital aural atresias. GM1 ganglioside treatment had no significant effect on ABR wave I thresholds or latencies in either group.

  4. Responsible Code of Conduct for the Life Science and Dual-Use Research

    International Nuclear Information System (INIS)

    Bokan, S.

    2007-01-01

    The potential threat from misuse of current and future Dual-Use research in the field of NBC Defense is challenge to which scientific community must respond. The rapid advances in the life sciences and the worldwide growth of biotechnology industry only add urgency of this task. Code of conduct is formal statement of values and professional practices of a group of individuals with a common focus, either an occupation, academic field, or social doctrine. Codes of conduct can help to reduce the risk that scientific research will be misused. 'Dual-use' is a term often used in politics and diplomacy to refer to technology which can be used for both peaceful and military aims, usually in regard to the proliferation of nuclear weapons. Dual-use information and 'know-how' in the field of NBC defense are covered under the Export control regimes. Nearly all WMD production equipment is 'dual-use' and only very large capacity equipment is export controlled. Research in the life sciences, including NBC defense research must be conducted safely, securely, and ethically. Development of an international harmonized regime for control of biological and chemical warfare agents within and between laboratories and facilities is very important. This paper will present very important consideration of the content, promulgation and adoption of codes of conduct for scientists in the field of NBC research, for inducing of discussion between scientists into group of CBMTS members with aim how improve protection of sensitive research results and information in the field of NBC Defense sciences. (author)

  5. Response of pig skin to single doses of irradiation from strontium-90 sources of differing surface area

    Energy Technology Data Exchange (ETDEWEB)

    Hopewell, J.W.; Hamlet, R.; Peel, D. (Churchill Hospital, Oxford (UK). Research Inst.)

    1985-08-01

    In the present investigations the effects of irradiation of pig skin with 22.5 and 40 mm diameter /sup 90/Sr plaques are compared. In addition to comparing peak epithelial reactions, comparisons were also made as to the healing times for comparable peak skin reactions for each field size. The ED/sub 50/ values (dose to produce moist desquamation in 50% of the skin fields) 26.5 +- 1.5 Gy for the 22.5 diameter field was not significantly different from that obtained for the larger 40 mm diameter source (ED/sub 50/ 29.0 +- 1.5 Gy).

  6. The response of pig skin to single doses of irradiation from strontium-90 sources of differing surface area

    International Nuclear Information System (INIS)

    Hopewell, J.W.; Hamlet, R.; Peel, D.

    1985-01-01

    In the present investigations the effects of irradiation of pig skin with 22.5 and 40 mm diameter 90 Sr plaques are compared. In addition to comparing peak epithelial reactions, comparisons were also made as to the healing times for comparable peak skin reactions for each field size. The ED 50 values (dose to produce moist desquamation in 50% of the skin fields) 26.5+-1.5 Gy for the 22.5 diameter field was not significantly different from that obtained for the larger 40 mm diameter source (ED 50 29.0+-1.5 Gy). (U.K.)

  7. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  8. Preparation, conduct and evaluation of exercises to test preparedness for a nuclear or radiological emergency. Emergency preparedness and response

    International Nuclear Information System (INIS)

    2005-04-01

    The aim of this publication is to serve as a practical tool for the preparation, conduct and evaluation of exercises to test preparedness for response to a nuclear or radiological emergency. It fulfils in part the functions assigned to the IAEA under Article 5.a(ii) of the Convention on Assistance in Case of a Nuclear Accident or Radiological Emergency (Assistance Convention), namely, to collect and disseminate to States Parties and Member States information concerning the methodologies, techniques and available results of research on such emergencies. To ensure effective response to radiation emergencies when needed, provisions should be made for regular training of emergency response personnel. As stated in Preparedness and Response for a Nuclear or Radiological Emergency (Safety Requirements, Safety Standard Series No. GS-R-2), 'The operator and the response organizations shall make arrangements for the selection of personnel and training to ensure that the personnel have the requisite knowledge, skills, abilities, equipment, procedures and other arrangements to perform their assigned response functions'. A further requirement is that 'Exercise programmes shall be conducted to ensure that all specified functions required to be performed for emergency response and all organizational interfaces for facilities in threat category I, II or III and the national level programmes for threat category IV or V are tested at suitable intervals'. In 2004 the IAEA General Conference, in resolution GC(48)/RES/10 encouraged Member States to 'implement the Safety Requirements for Preparedness and Response to a Nuclear or Radiological Emergency'. This document is published as part of the IAEA Emergency Preparedness and Response Series to assist in meeting these requirements and to fulfil Article 5 of the Assistance Convention. It was developed based on a number of assumptions about national and local capabilities. Therefore, the exercise structure, terms and scenarios must be

  9. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  10. Emergence time and skin melanin spot patterns do not correlate with growth performance, social competitive ability or stress response in farmed rainbow trout

    DEFF Research Database (Denmark)

    Gesto, Manuel; Skov, Peter Vilhelm; Jokumsen, Alfred

    2017-01-01

    dissimilarities in the acute stress responses, emergence fraction displayed no correlation with growth rates, or the ability to compete for feed. Within the whole group of fish utilized in the experiments, no relationship between skinmelanin spot pattern and growth performance, stress response intensity......, or competitive ability was found. Altogether, the differences in physiological traits related to emergence time were not as strong as those found in earlier studies. It is hypothesized, that the origin and degree of domestication of the fish might be partly responsible for this. The predictive value of skin...... spots or emergence time to infer the fish stress coping style in farmed fish is also discussed...

  11. Predicting Treatment Response for Oppositional Defiant and Conduct Disorder Using Pre-treatment Adrenal and Gonadal Hormones.

    Science.gov (United States)

    Shenk, Chad E; Dorn, Lorah D; Kolko, David J; Susman, Elizabeth J; Noll, Jennie G; Bukstein, Oscar G

    2012-12-01

    Variations in adrenal and gonadal hormone profiles have been linked to increased rates of oppositional defiant disorder (ODD) and conduct disorder (CD). These relationships suggest that certain hormone profiles may be related to how well children respond to psychological treatments for ODD and CD. The current study assessed whether pre-treatment profiles of adrenal and gonadal hormones predicted response to psychological treatment of ODD and CD. One hundred five children, 6 - 11 years old, participating in a randomized, clinical trial provided samples for cortisol, testosterone, dehydroepiandrosterone, and androstenedione. Diagnostic interviews of ODD and CD were administered up to three years post-treatment to track treatment response. Group-based trajectory modeling identified two trajectories of treatment response: 1) a High-response trajectory where children demonstrated lower rates of an ODD or CD diagnosis throughout follow-up, and 2) a Low-response trajectory where children demonstrated higher rates of an ODD or CD diagnosis throughout follow-up. Hierarchical logistic regression predicting treatment response demonstrated that children with higher pre-treatment concentrations of testosterone were four times more likely to be in the Low-response trajectory. No other significant relationship existed between pre-treatment hormone profiles and treatment response. These results suggest that higher concentrations of testosterone are related to how well children diagnosed with ODD or CD respond to psychological treatment over the course of three years.

  12. Prefrontal oxygenation correlates to the responses in facial skin blood flows during exposure to pleasantly charged movie.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Asahara, Ryota; Yoshikawa, Miho; Kusunoki, Shinya; Ishida, Tomoko

    2017-11-01

    Our laboratory reported that facial skin blood flow may serve as a sensitive tool to assess an emotional status. Cerebral neural correlates during emotional interventions should be sought in relation to the changes in facial skin blood flow. To test the hypothesis that prefrontal activity has positive relation to the changes in facial skin blood flow during emotionally charged stimulation, we examined the dynamic changes in prefrontal oxygenation (with near-infrared spectroscopy) and facial skin blood flows (with two-dimensional laser speckle and Doppler flowmetry) during emotionally charged audiovisual challenges for 2 min (by viewing comedy, landscape, and horror movie) in 14 subjects. Hand skin blood flow and systemic hemodynamics were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Positively charged emotional stimulation (comedy) simultaneously decreased ( P  horror) or neutral (landscape) emotional stimulation did not alter or slightly decreased them. Any of hand skin blood flow and systemic cardiovascular variables did not change significantly during positively charged emotional stimulation. The changes in prefrontal oxygenation had a highly positive correlation with the changes in facial skin blood flow without altering perfusion pressure, and they were inversely correlated with the subjective rating of pleasantness. The reduction in prefrontal oxygenation during positively charged emotional stimulation suggests a decrease in prefrontal neural activity, which may in turn elicit neurally mediated vasoconstriction of facial skin blood vessels. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  13. Effects of galvanic skin response feedback on user experience in gaze-controlled gaming: A pilot study.

    Science.gov (United States)

    Larradet, Fanny; Barresi, Giacinto; Mattos, Leonardo S

    2017-07-01

    Eye-tracking (ET) is one of the most intuitive solutions for enabling people with severe motor impairments to control devices. Nevertheless, even such an effective assistive solution can detrimentally affect user experience during demanding tasks because of, for instance, the user's mental workload - using gaze-based controls for an extensive period of time can generate fatigue and cause frustration. Thus, it is necessary to design novel solutions for ET contexts able to improve the user experience, with particular attention to its aspects related to workload. In this paper, a pilot study evaluates the effects of a relaxation biofeedback system on the user experience in the context of a gaze-controlled task that is mentally and temporally demanding: ET-based gaming. Different aspects of the subjects' experience were investigated under two conditions of a gaze-controlled game. In the Biofeedback group (BF), the user triggered a command by means of voluntary relaxation, monitored through Galvanic Skin Response (GSR) and represented by visual feedback. In the No Biofeedback group (NBF), the same feedback was timed according to the average frequency of commands in BF. After the experiment, each subject filled out a user experience questionnaire. The results showed a general appreciation for BF, with a significant between-group difference in the perceived session time duration, with the latter being shorter for subjects in BF than for the ones in NBF. This result implies a lower mental workload for BF than for NBF subjects. Other results point toward a potential role of user's engagement in the improvement of user experience in BF. Such an effect highlights the value of relaxation biofeedback for improving the user experience in a demanding gaze-controlled task.

  14. Radiation-induced conductivity of doped silicon in response to photon, proton and neutron irradiation

    International Nuclear Information System (INIS)

    Kishimoto, N.; Amekura, H.; Plaksin, O.A.; Stepanov, V.A.

    2000-01-01

    The opto-electronic performance of semiconductors during reactor operation is restricted by radiation-induced conductivity (RIC) and the synergistic effects of neutrons/ions and photons. The RICs of Si due to photons, protons and pulsed neutrons have been evaluated, aiming at radiation correlation. Protons of 17 MeV with an ionizing dose rate of 10 3 Gy/s and/or photons (hν=1.3 eV) were used to irradiate impurity-doped Si (2x10 16 B atoms/cm 3 ) at 300 and 200 K. Proton-induced RIC (p-RIC) and photoconductivity (PC) were intermittently detected in an accelerator device. Neutron-induced RIC (n-RIC) was measured for the same Si in a pulsed fast-fission reactor, BARS-6, with a 70-μs pulse of 2x10 12 n/cm 2 (E>0.01 MeV) and a dose rate of up to 6x10 5 Gy/s. The neutron irradiation showed a saturation tendency in the flux dependence at 300 K due to the strong electronic excitation. Normalization of the electronic excitation, including the pulsed regime, gave a fair agreement among the different radiation environments. Detailed comparison among PC, p-RIC and n-RIC is discussed in terms of radiation correlation including the in-pile condition

  15. Fine-Needle Aspiration Biopsy of the Lymph Node: A Novel Tool for the Monitoring of Immune Responses after Skin Antigen Delivery.

    Science.gov (United States)

    Tatovic, Danijela; Young, Philippa; Kochba, Efrat; Levin, Yotam; Wong, F Susan; Dayan, Colin M

    2015-07-01

    Assessment of immune responses in lymph nodes (LNs) is routine in animals, but rarely done in humans. We have applied minimally invasive ultrasound-guided fine-needle aspiration of the LN to a before-and-after study of the immune response to intradermally delivered Ag in healthy volunteers (n = 25). By comparison with PBMCs from the same individual, LN cells (LNCs) were characterized by reduced numbers of effector memory cells, especially CD8(+) TEMRA cells (3.37 ± 1.93 in LNCs versus 22.53 ± 7.65 in PBMCs; p = 0.01) and a marked increased in CD69 expression (27.67 ± 7.49 versus 3.49 ± 2.62%, LNCs and PBMCs, respectively; p < 0.0001). At baseline, there was a striking absence of IFN-γ ELISPOT responses to recall Ags (purified protein derivative, Tetanus toxoid, or flu/EBV/CMV viral mix) in LN, despite strong responses in the peripheral blood. However, 48 h after tuberculin purified protein derivative administration in the ipsilateral forearm resulting in a positive skin reaction, a clear increase in IFN-γ ELISPOT counts was seen in the draining LN but not in PBMCs. This response was lost by 5 d. These data suggest that the low levels of effector memory cells in the LN may explain the low background of baseline ELISPOT responses in LNs as compared with PBMCs, and the appearance of a response after 48 h is likely to represent migration of effector memory cells from the skin to the LN. Hence, it appears that the combination of intradermal Ag administration and draining LN sampling can be used as a sensitive method to probe the effector memory T cell repertoire in the skin. Copyright © 2015 by The American Association of Immunologists, Inc.

  16. Optimum Depth of Investigation and Conductivity Response Rejection of the Different Electromagnetic Devices Measuring Apparent Magnetic Susceptibility

    OpenAIRE

    Benech , Christophe; Marmet , Eric

    1999-01-01

    International audience; Electromagnetic susceptibility surveys are valuable for archaeological prospection owing to their ability to cover large areas of land. Their use, however, is often compromised by the conductivity influence of the soil and the limited investigation depth of the susceptibility response. To examine these constraints further, we compared the characteristics of two types of apparatus: coincident loop (e.g. Bartington MS2 field coil) and 'Slingram' instruments (EM38, SH3, C...

  17. Auditory Steady-State Response Thresholds in Adults With Conductive and Mild to Moderate Sensorineural Hearing Loss

    OpenAIRE

    Hosseinabadi, Reza; Jafarzadeh, Sadegh

    2014-01-01

    Background: The Auditory steady state response (ASSR) provides a frequency-specific and automatic assessment of hearing sensitivity and is used in infants and difficult-to-test adults. Objectives: The aim of this study was to compare the ASSR thresholds among various types (normal, conductive, and sensorineural), degree (normal, mild, and moderate), and configuration (flat and sloping) of hearing sensitivity, and measuring the cutoff point between normal condition and hearing loss for differe...

  18. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  19. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  20. Oxygen sensing and conducted vasomotor responses in mouse cremaster arterioles in situ

    DEFF Research Database (Denmark)

    Ngo, Thuc Anh; Jensen, Lars Jørn; Riemann, Mads Achen

    2010-01-01

    .0 +/- 4.9 mum) when changing from high (PO(2) = 242.5 +/- 13.3 mm Hg) to low (PO(2) = 22.5 +/- 4.8 mm Hg) oxygen tension as seen in the intact cremaster circulation (DeltaD = 18.7 +/- 1.0 mum). Blockade of NO synthases by L: -NAME and adenosine receptors by DPCPX had no effects on vasomotor responses...... to low or high oxygen. Induction of localized low (PO(2) = 23.3 +/- 5.7 mmHg) or high (PO(2) = 300.0 +/- 25.7 mm Hg) oxygen tension caused vasodilatation or -constriction locally and at a site 1,000 mum upstream (distantly). Glibenclamide blocker of ATP-sensitive K(+) channels inhibited vasodilatation...... and -constriction to low (PO(2) = 16.0 +/- 6.4 mm Hg) and high (PO(2) = 337.4 +/- 12.8 mm Hg) oxygen tension. 1) ATP-sensitive K(+) channels seem to mediate, at least in part, vasodilatation and vasoconstriction to low and high oxygen tension; 2) Red blood cells are not necessary for inducing vasodilatation...

  1. Innovation or Violation? Leveraging Mobile Technology to Conduct Socially Responsible Community Research.

    Science.gov (United States)

    Roy, Amanda L

    2017-12-01

    Mobile technology is increasingly being used to measure individuals' moods, thoughts, and behaviors in real time. Current examples include the use of smartphones to collect ecological momentary assessments (EMAs; assessments delivered "in the moment"); wearable technology to passively collect objective measures of participants' movement, physical activity, sleep, and physiological response; and smartphones and wearable devices with global positioning system (GPS) capabilities to collect precise information about where participants spend their time. Although advances in mobile technology offer exciting opportunities for measuring and modeling individuals' experiences in their natural environments, they also introduce new ethical issues. Drawing on lessons learned while collecting GPS coordinates and EMAs measuring mood, companionship, and health-risk behavior with a sample of low-income, predominantly racial/ethnic minority youth living in Chicago, this manuscript discusses ethical challenges specific to the methodology (e.g., unanticipated access to personal information) and broader concerns related to data conceptualization and interpretation (e.g., the ethics of "monitoring" low-income youth of color). While encouraging researchers to embrace innovations offered by mobile technology, this discussion highlights some of the many ethical issues that also need to be considered. © Society for Community Research and Action 2017.

  2. Comparing the similarity of responses received from studies in Amazon's Mechanical Turk to studies conducted online and with direct recruitment.

    Directory of Open Access Journals (Sweden)

    Christoph Bartneck

    Full Text Available Computer and internet based questionnaires have become a standard tool in Human-Computer Interaction research and other related fields, such as psychology and sociology. Amazon's Mechanical Turk (AMT service is a new method of recruiting participants and conducting certain types of experiments. This study compares whether participants recruited through AMT give different responses than participants recruited through an online forum or recruited directly on a university campus. Moreover, we compare whether a study conducted within AMT results in different responses compared to a study for which participants are recruited through AMT but which is conducted using an external online questionnaire service. The results of this study show that there is a statistical difference between results obtained from participants recruited through AMT compared to the results from the participant recruited on campus or through online forums. We do, however, argue that this difference is so small that it has no practical consequence. There was no significant difference between running the study within AMT compared to running it with an online questionnaire service. There was no significant difference between results obtained directly from within AMT compared to results obtained in the campus and online forum condition. This may suggest that AMT is a viable and economical option for recruiting participants and for conducting studies as setting up and running a study with AMT generally requires less effort and time compared to other frequently used methods. We discuss our findings as well as limitations of using AMT for empirical studies.

  3. Comparing the similarity of responses received from studies in Amazon's Mechanical Turk to studies conducted online and with direct recruitment.

    Science.gov (United States)

    Bartneck, Christoph; Duenser, Andreas; Moltchanova, Elena; Zawieska, Karolina

    2015-01-01

    Computer and internet based questionnaires have become a standard tool in Human-Computer Interaction research and other related fields, such as psychology and sociology. Amazon's Mechanical Turk (AMT) service is a new method of recruiting participants and conducting certain types of experiments. This study compares whether participants recruited through AMT give different responses than participants recruited through an online forum or recruited directly on a university campus. Moreover, we compare whether a study conducted within AMT results in different responses compared to a study for which participants are recruited through AMT but which is conducted using an external online questionnaire service. The results of this study show that there is a statistical difference between results obtained from participants recruited through AMT compared to the results from the participant recruited on campus or through online forums. We do, however, argue that this difference is so small that it has no practical consequence. There was no significant difference between running the study within AMT compared to running it with an online questionnaire service. There was no significant difference between results obtained directly from within AMT compared to results obtained in the campus and online forum condition. This may suggest that AMT is a viable and economical option for recruiting participants and for conducting studies as setting up and running a study with AMT generally requires less effort and time compared to other frequently used methods. We discuss our findings as well as limitations of using AMT for empirical studies.

  4. Use of the novel contact heat evoked potential stimulator (CHEPS for the assessment of small fibre neuropathy: correlations with skin flare responses and intra-epidermal nerve fibre counts

    Directory of Open Access Journals (Sweden)

    Chizh Boris A

    2007-08-01

    Full Text Available Abstract Background The Contact Heat Evoked Potential Stimulator (CHEPS rapidly stimulates cutaneous small nerve fibres, and resulting evoked potentials can be recorded from the scalp. We have studied patients with symptoms of sensory neuropathy and controls using CHEPS, and validated the findings using other objective measures of small nerve fibres i.e. the histamine-induced skin flare response and intra-epidermal fibres (IEF, and also quantitative sensory testing (QST, a subjective measure. Methods In patients with symptoms of sensory neuropathy (n = 41 and healthy controls (n = 9 we performed clinical examination, QST (monofilament, vibration and thermal perception thresholds, nerve conduction studies, histamine-induced skin flares and CHEPS. Skin punch biopsies were immunostained using standard ABC immunoperoxidase for the nerve marker PGP 9.5 or the heat and capsaicin receptor TRPV1. Immunoreactive IEF were counted per length of tissue section and epidermal thickness recorded. Results Amplitudes of Aδ evoked potentials (μV following face, arm or leg stimulation were reduced in patients (e.g. for the leg: mean ± SEM – controls 11.7 ± 1.95, patients 3.63 ± 0.85, p = 0.0032. Patients showed reduced leg skin flare responses, which correlated with Aδ amplitudes (rs = 0.40, p = 0.010. In patient leg skin biopsies, PGP 9.5- and TRPV1-immunoreactive IEF were reduced and correlated with Aδ amplitudes (PGP 9.5, rs = 0.51, p = 0.0006; TRPV1, rs = 0.48, p = 0.0012. Conclusion CHEPS appears a sensitive measure, with abnormalities observed in some symptomatic patients who did not have significant IEF loss and/or QST abnormalities. Some of the latter patients may have early small fibre dysfunction or ion channelopathy. CHEPS provides a clinically practical, non-invasive and objective measure, and can be a useful additional tool for the assessment of sensory small fibre neuropathy. Although further evaluation is required, the technique shows

  5. Lower responsiveness of canopy evapotranspiration rate than of leaf stomatal conductance to open-air CO2 elevation in rice.

    Science.gov (United States)

    Shimono, Hiroyuki; Nakamura, Hirofumi; Hasegawa, Toshihiro; Okada, Masumi

    2013-08-01

    An elevated atmospheric CO2 concentration ([CO2 ]) can reduce stomatal conductance of leaves for most plant species, including rice (Oryza sativa L.). However, few studies have quantified seasonal changes in the effects of elevated [CO2 ] on canopy evapotranspiration, which integrates the response of stomatal conductance of individual leaves with other responses, such as leaf area expansion, changes in leaf surface temperature, and changes in developmental stages, in field conditions. We conducted a field experiment to measure seasonal changes in stomatal conductance of the uppermost leaves and in the evapotranspiration, transpiration, and evaporation rates using a lysimeter method. The study was conducted for flooded rice under open-air CO2 elevation. Stomatal conductance decreased by 27% under elevated [CO2 ], averaged throughout the growing season, and evapotranspiration decreased by an average of 5% during the same period. The decrease in daily evapotranspiration caused by elevated [CO2 ] was more significantly correlated with air temperature and leaf area index (LAI) rather than with other parameters of solar radiation, days after transplanting, vapor-pressure deficit and FAO reference evapotranspiration. This indicates that higher air temperatures, within the range from 16 to 27 °C, and a larger LAI, within the range from 0 to 4 m(2)  m(-2) , can increase the magnitude of the decrease in evapotranspiration rate caused by elevated [CO2 ]. The crop coefficient (i.e. the evapotranspiration rate divided by the FAO reference evapotranspiration rate) was 1.24 at ambient [CO2 ] and 1.17 at elevated [CO2 ]. This study provides the first direct measurement of the effects of elevated [CO2 ] on rice canopy evapotranspiration under open-air conditions using the lysimeter method, and the results will improve future predictions of water use in rice fields. © 2013 John Wiley & Sons Ltd.

  6. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  7. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  8. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  9. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  10. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  11. Different brain responses during empathy in autism spectrum disorders versus conduct disorder and callous-unemotional traits.

    Science.gov (United States)

    Klapwijk, Eduard T; Aghajani, Moji; Colins, Olivier F; Marijnissen, Godfried M; Popma, Arne; van Lang, Natasja D J; van der Wee, Nic J A; Vermeiren, Robert R J M

    2016-06-01

    Deficits in empathy are reported in autism spectrum disorders (ASD) and also underlie antisocial behavior of individuals with conduct disorder and callous-unemotional traits (CD/CU+). Many studies suggest that individuals with ASD are typically impaired in cognitive aspects of empathy, and individuals with CD/CU+ typically in affective aspects. In the current study, we compared the neural correlates of cognitive and affective aspects of empathy between youth with ASD and youth with CD/CU+. Functional magnetic resonance imaging (fMRI) was used to assess boys with ASD (N = 23), boys with CD/CU+ (N = 23), and typically developing (TD) boys (N = 33), aged 15-19 years. Angry and fearful faces were presented and participants were asked to either infer the emotional state from the face (other-task; emotion recognition) or to judge their own emotional response to the face (self-task; emotional resonance). During emotion recognition, boys with ASD showed reduced responses compared to the other groups in the ventromedial prefrontal cortex (vmPFC). During emotional resonance, the CD/CU+ and ASD groups showed reduced amygdala responses compared to the TD controls, boys with ASD showed reduced responses in bilateral hippocampus, and the CD/CU+ boys showed reduced responses in the inferior frontal gyrus (IFG) and anterior insula (AI). Results suggest differential abnormal brain responses associated with specific aspects of empathic functioning in ASD and CD/CU+. Decreased amygdala responses in ASD and CD/CU+ might point to impaired emotion processing in both disorders, whereas reduced vmPFC responses suggest problems in processing cognitive aspects of empathy in ASD. Reduced IFG/AI responses, finally, suggest decreased emotional resonance in CD/CU+. © 2015 Association for Child and Adolescent Mental Health.

  12. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  13. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  14. Measurement of leaf hydraulic conductance and stomatal conductance and their responses to irradiance and dehydration using the Evaporative Flux Method (EFM).

    Science.gov (United States)

    Sack, Lawren; Scoffoni, Christine

    2012-12-31

    Water is a key resource, and the plant water transport system sets limits on maximum growth and drought tolerance. When plants open their stomata to achieve a high stomatal conductance (gs) to capture CO2 for photosynthesis, water is lost by transpiration(1,2). Water evaporating from the airspaces is replaced from cell walls, in turn drawing water from the xylem of leaf veins, in turn drawing from xylem in the stems and roots. As water is pulled through the system, it experiences hydraulic resistance, creating tension throughout the system and a low leaf water potential (Ψ(leaf)). The leaf itself is a critical bottleneck in the whole plant system, accounting for on average 30% of the plant hydraulic resistance(3). Leaf hydraulic conductance (K(leaf) = 1/ leaf hydraulic resistance) is the ratio of the water flow rate to the water potential gradient across the leaf, and summarizes the behavior of a complex system: water moves through the petiole and through several orders of veins, exits into the bundle sheath and passes through or around mesophyll cells before evaporating into the airspace and being transpired from the stomata. K(leaf) is of strong interest as an important physiological trait to compare species, quantifying the effectiveness of the leaf structure and physiology for water transport, and a key variable to investigate for its relationship to variation in structure (e.g., in leaf venation architecture) and its impacts on photosynthetic gas exchange. Further, K(leaf) responds strongly to the internal and external leaf environment(3). K(leaf) can increase dramatically with irradiance apparently due to changes in the expression and activation of aquaporins, the proteins involved in water transport through membranes(4), and K(leaf) declines strongly during drought, due to cavitation and/or collapse of xylem conduits, and/or loss of permeability in the extra-xylem tissues due to mesophyll and bundle sheath cell shrinkage or aquaporin deactivation(5

  15. Anti-Inflammation Activities of Mycosporine-Like Amino Acids (MAAs) in Response to UV Radiation Suggest Potential Anti-Skin Aging Activity

    Science.gov (United States)

    Suh, Sung-Suk; Hwang, Jinik; Park, Mirye; Seo, Hyo Hyun; Kim, Hyoung-Shik; Lee, Jeong Hun; Moh, Sang Hyun; Lee, Taek-Kyun

    2014-01-01

    Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs). In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly), based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH) assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE) and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells. PMID:25317535

  16. The epidemiology of skin care provided by nurses at home: a multicentre prevalence study.

    Science.gov (United States)

    Kottner, Jan; Boronat, Xavier; Blume-Peytavi, Ulrike; Lahmann, Nils; Suhr, Ralf

    2015-03-01

    The aim of this study was to estimate the frequencies and patterns of skin care and applied skin care products in the home care nursing setting in Germany. Skin care belongs to the core activities of nursing practice. Especially in aged and long-term care settings, clients are vulnerable to various skin conditions. Dry skin is one of the most prevalent problems. Using mild skin cleansers and the regular application of moisturizing leave-on products is recommended. Until today, there are no quantitative empirical data about nursing skin care practice at home in the community. A multicentre cross-sectional study was conducted in July 2012. Home care clients from the German home care nursing setting were randomly selected. Instructed nurse raters performed the data collection using standardized forms. Variables included demographics, skin care needs and skin caring activities. Approximately 60% of home care clients received skin care interventions. The majority were washed and two-thirds received a leave-on product once daily. There was large heterogeneity in cleansing and skin care product use. Most often the product labels were unknown or product types were selected haphazardly. Skin care interventions play a significant role in home care and nurses have a considerable responsibility for skin health. Skin care provided does not meet recent recommendations. The importance of targeted skin cleansing and care might be underestimated. There are a confusing variety of skin care products available and often the labels provide little information regarding the ingredients or guidance about how they affect skin health. © 2014 John Wiley & Sons Ltd.

  17. Fairness decisions in response to emotions: a functional MRI study among criminal justice-involved boys with conduct disorder.

    Science.gov (United States)

    Klapwijk, Eduard T; Lelieveld, Gert-Jan; Aghajani, Moji; Boon, Albert E; van der Wee, Nic J A; Popma, Arne; Vermeiren, Robert R J M; Colins, Olivier F

    2016-04-01

    Research suggests that individuals with conduct disorder (CD) are marked by social impairments, such as difficulties in processing the affective reactions of others. Little is known, though, about how they make decisions during social interactions in response to emotional expressions of others. In this study, we therefore investigated the neural mechanisms underlying fairness decisions in response to communicated emotions of others in aggressive, criminal justice-involved boys with CD (N = 32) compared with typically developing (TD) boys (N = 33), aged 15-19 years. Participants received written emotional responses (angry, disappointed or happy) from peers in response to a previous offer and then had to make fairness decisions in a version of the Dictator Game. Behavioral results showed that CD boys did not make differential fairness decisions in response to the emotions, whereas the TD boys did show a differentiation and also responded more unfair to happy reactions than the CD boys. Neuroimaging results revealed that when receiving happy vs disappointed and angry reactions, the CD boys showed less activation than the TD boys in the temporoparietal junction and supramarginal gyrus, regions involved in perspective taking and attention. These results suggest that boys with CD have difficulties with processing explicit emotional cues from others on behavioral and neural levels. © The Author (2016). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  18. Subsurface Flow and Moisture Dynamics in Response to Swash Motions: Effects of Beach Hydraulic Conductivity and Capillarity

    Science.gov (United States)

    Geng, Xiaolong; Heiss, James W.; Michael, Holly A.; Boufadel, Michel C.

    2017-12-01

    A combined field and numerical study was conducted to investigate dynamics of subsurface flow and moisture response to waves in the swash zone of a sandy beach located on Cape Henlopen, DE. A density-dependent variably saturated flow model MARUN was used to simulate subsurface flow beneath the swash zone. Values of hydraulic conductivity (K) and characteristic pore size (α, a capillary fringe property) were varied to evaluate their effects on subsurface flow and moisture dynamics in response to swash motions in beach aquifers. The site-specific modeling results were validated against spatiotemporal measurements of moisture and pore pressure in the beach. Sensitivity analyses indicated that the hydraulic conductivity and capillary fringe thickness of the beach greatly influenced groundwater flow pathways and associated transit times in the swash zone. A higher value of K enhanced swash-induced seawater infiltration into the beach, thereby resulting in a faster expansion of a wedge of high moisture content induced by swash cycles, and a flatter water table mound beneath the swash zone. In contrast, a thicker capillary fringe retained higher moisture content near the beach surface, and thus, significantly reduced the available pore space for infiltration of seawater. This attenuated wave effects on pore water flow in the unsaturated zone of the beach. Also, a thicker capillary fringe enhanced horizontal flow driven by the larger-scale hydraulic gradient caused by tides.

  19. Electromechanical response of silk fibroin hydrogel and conductive polycarbazole/silk fibroin hydrogel composites as actuator material.

    Science.gov (United States)

    Srisawasdi, Thanida; Petcharoen, Karat; Sirivat, Anuvat; Jamieson, Alexander M

    2015-11-01

    Pure silk fibroin (SF) hydrogel and polycarbazole/silk fibroin (SF/PCZ) hydrogels were fabricated by solvent casting technique to evaluate electromechanical responses, dielectric properties, and cantilever deflection properties as functions of electric field strength, SF concentration, glutaraldehyde concentration, and PCZ concentration in the blends. Electromechanical properties were characterized in oscillatory shear mode at electric field strengths ranging from 0 to 600V/mm and at a temperature of 27°C. For both the pristine SF and SF/PCZ hydrogels, the storage modulus response (ΔG') and the storage modulus sensitivity (ΔG'/G'0) increased dramatically with increasing electric field strength. The pristine hydrogel possessed the highest storage modulus sensitivity value of 5.87, a relatively high value when compared with other previously studied electroactive polymers. With the addition of conductive PCZ in SF hydrogel, the storage modulus sensitivity and the relative dielectric constant decreased; the conductive polymer thus provided the softening effect under electric field. In the deflection response, the dielectrophoresis force and deflection distance increased monotonically with electric field strength, where the pure SF hydrogel showed the highest deflection distance and dielectrophoresis force. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Underlying Physics of Conductive Polymer Composites and Force Sensing Resistors (FSRs). A Study on Creep Response and Dynamic Loading.

    Science.gov (United States)

    Paredes-Madrid, Leonel; Matute, Arnaldo; Bareño, Jorge O; Parra Vargas, Carlos A; Gutierrez Velásquez, Elkin I

    2017-11-21

    Force Sensing Resistors (FSRs) are manufactured by sandwiching a Conductive Polymer Composite (CPC) between metal electrodes. The piezoresistive property of FSRs has been exploited to perform stress and strain measurements, but the rheological property of polymers has undermined the repeatability of measurements causing creep in the electrical resistance of FSRs. With the aim of understanding the creep phenomenon, the drift response of thirty two specimens of FSRs was studied using a statistical approach. Similarly, a theoretical model for the creep response was developed by combining the Burger's rheological model with the equations for the quantum tunneling conduction through thin insulating films. The proposed model and the experimental observations showed that the sourcing voltage has a strong influence on the creep response; this observation-and the corresponding model-is an important contribution that has not been previously accounted. The phenomenon of sensitivity degradation was also studied. It was found that sensitivity degradation is a voltage-related phenomenon that can be avoided by choosing an appropriate sourcing voltage in the driving circuit. The models and experimental observations from this study are key aspects to enhance the repeatability of measurements and the accuracy of FSRs.

  1. Adaptation of the dermal collagen structure of human skin and scar tissue in response to stretch: An experimental study

    NARCIS (Netherlands)

    Verhaegen, Pauline D.; Schouten, Hennie J.; Tigchelaar-Gutter, Wikky; van Marle, Jan; van Noorden, Cornelis J.; Middelkoop, Esther; van Zuijlen, Paul P.

    2012-01-01

    Surgeons are often faced with large defects that are difficult to close. Stretching adjacent skin can facilitate wound closure. In clinical practice, intraoperative stretching is performed in a cyclical or continuous fashion. However, exact mechanisms of tissue adaptation to stretch remain unclear.

  2. The static friction response of non-glabrous skin as a function of surface energy and environmental conditions

    NARCIS (Netherlands)

    Klaassen, Michel; de Vries, Erik G.; Masen, Marc Arthur

    2017-01-01

    The (local) environmental conditions have a significant effect on the interaction between skin and products. Plasticisation of the stratum corneum occurs at high humidity, causing this layer to soften and change its surface free energy. In this work we study the effects of the micro-climate on the

  3. Dielectric response and electric conductivity of ceramics obtained from BiFeO{sub 3} synthesized by microwave hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Chybczyńska, K.; Markiewicz, E., E-mail: ewamar@ifmpan.poznan.pl; Błaszyk, M.; Hilczer, B.; Andrzejewski, B.

    2016-06-25

    BiFeO{sub 3} powder which formed ball-like structures resembling flowers was obtained by microwave hydrothermal synthesis. The flowers were of a dozen or so μm in diameter and the thickness of the crystallites forming petals could be controlled. The material was characterized by X-ray diffraction, scanning electron microscopy and X-ray photoelectron spectroscopy. Dielectric response of ceramics obtained from the powder contained three extrinsic contributions, which could be correlated with the differences in temperature variation of the ac conductivity. The dielectric relaxation between 150 K and 300 K was related to reorientations of Fe{sup 3+}–Fe{sup 2+} dipoles and characterized by an activation energy of 0.4 eV, which was independent of the petal thickness. The dielectric and electric response in the range 300 K ÷ 450 K usually ascribed to the grain boundary and interfacial polarization effect was diffused and could not be characterized. Above 450 K the activation energy of dc conductivity was 1.73 eV and 1.52 eV for ceramics consisting of crystallites of mean thickness of 160 nm and 260 nm, respectively. The energies, which are considerably higher than those reported earlier for BFO nanoceramics, were discussed considering the interactions between oxygen vacancies and size scaled ferroelectric domain walls, which in BiFeO{sub 3} are associated with electrostatic potential steps. - Highlights: • BiFeO{sub 3} with controllable thickness of crystallites was synthesized hydrothermally. • The powder and ceramics obtained were characterized by XRD, SEM and XPS methods. • Dielectric response of the ceramics is correlated with the ac conductivity. • Size-scaled ferroelectric domains and oxygen vacancies interact above 450 K.

  4. In vivo study of human skin using pulsed terahertz radiation

    International Nuclear Information System (INIS)

    Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P

    2004-01-01

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation

  5. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  6. The role of anxiety in cortisol stress response and cortisol recovery in boys with oppositional defiant disorder/conduct disorder.

    Science.gov (United States)

    Schoorl, Jantiene; Rijn, Sophie van; Wied, Minet de; van Goozen, Stephanie; Swaab, Hanna

    2016-11-01

    Children with antisocial and aggressive behaviors have been found to show abnormal neurobiological responses to stress, specifically impaired cortisol stress reactivity. The role of individual characteristics, such as comorbid anxiety, in the stress response is far less studied. Furthermore, this study extended previous studies in that not only baseline and reactivity to a psychosocial stressor were examined, but also recovery from a stressor. These three phases of cortisol could be impacted differentially in boys with oppositional defiant disorder/conduct disorder (ODD/CD) with (+ANX) and without anxiety (-ANX). The results revealed that cortisol patterns in response to psychosocial stress were different for boys with ODD/CD+ANX (n=32), ODD/CD-ANX (n=22) and non-clinical controls (NC) (n=34), with age range of 7.8-12.9 years. The ODD/CD-ANX group showed lower overall cortisol levels than the NC group. When considering the three phases of cortisol separately, the ODD/CD-ANX group had lower baseline cortisol levels relative to the other groups, whereas the ODD/CD+ANX showed an impaired cortisol recovery response. Within those with ODD/CD, callous-unemotional traits were predictive of high baseline cortisol levels. Also, anxiety predicted high baseline and recovery cortisol levels, whereas a high number of CD symptoms predicted reduced cortisol stress reactivity. These results clearly indicate that comorbid anxiety is an important factor in explaining differences in stress response profiles in boys with ODD/CD; although boys with CD/ODD are generally characterized by an impaired cortisol stress response, we found that those with comorbid anxiety showed impaired cortisol recovery, whereas those without anxiety showed reduced baseline cortisol levels. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Effects of diffuse light on radiation use efficiency depend on the response of stomatal conductance to dynamic light intensity

    Directory of Open Access Journals (Sweden)

    Tao eLi

    2016-02-01

    Full Text Available The stimulating effect of diffuse light on radiation use efficiency (RUE of crops is often explained by the more homogeneous spatial light distribution, while rarely considering differences in temporal light distribution at leaf level. This study investigated whether diffuse light effects on crop RUE can be explained by dynamic responses of leaf photosynthesis to temporal changes of photosynthetic photon flux density (PPFD.Two Anthurium andreanum cultivars (‘Pink Champion’ and ‘Royal Champion’ were grown in two glasshouses covered by clear (control and diffuse glass, with similar light transmission. On clear days, diffusing the light resulted in less temporal fluctuations of PPFD. Stomatal conductance (gs varied strongly in response to transient PPFD in ‘Royal Champion’, whereas it remained relatively constant in ‘Pink Champion’. Instantaneous net leaf photosynthesis (Pn in both cultivars approached steady state Pn in diffuse light treatment. In control treatment this only occurred in ‘Pink Champion’. These cultivar differences were reflected by a higher RUE (8% in ‘Royal Champion’ in diffuse light treatment compared with control, whereas no effect on RUE was observed in ‘Pink Champion’. We conclude that the stimulating effect of diffuse light on RUE depends on the stomatal response to temporal PPFD fluctuations, which response is cultivar dependent.

  8. The response of a harmonically forced premixed flame stabilized on a heat-conducting bluff-body

    KAUST Repository

    Kedia, Kushal S.

    2015-01-01

    © 2014 The Combustion Institute. The objective of this work is to investigate the unsteady response of a bluff-body stabilized laminar premixed flame to harmonic inlet velocity excitation. A time series analysis was performed to analyze the physical sequence of events at a fixed longitudinal forcing frequency of 100 Hz for cases with (1) two different equivalence ratios and (2) two different thermal properties of the stabilizing bluff-body. It was observed that conjugate heat exchange between the heat conducting bluff-body and the surrounding reacting flow has a crucial impact on the dynamic response. The flame area and anchoring location, the net conjugate heat transfer and the total heat release underwent significant oscillations. The latter was mean shifted and had multiple frequencies. The burning velocity varied significantly along the flame length and the recirculation zone underwent complex changes in its shape and size during an unsteady cycle. The lower equivalence ratio case exhibited vortex shedding after an initial symmetric response with periodic flame extinction and re-ignition along its surface, unlike the higher equivalence ratio case. The metal/ceramic bluff-body showed a net heat transfer directed from/to the bluff-body, to/from the reacting flow during an unsteady cycle, resulting in a significantly different flame response for the two otherwise equivalent cases.

  9. Real-Time Gas Identification by Analyzing the Transient Response of Capillary-Attached Conductive Gas Sensor

    Directory of Open Access Journals (Sweden)

    Behzad Bahraminejad

    2010-05-01

    Full Text Available In this study, the ability of the Capillary-attached conductive gas sensor (CGS in real-time gas identification was investigated. The structure of the prototype fabricated CGS is presented. Portions were selected from the beginning of the CGS transient response including the first 11 samples to the first 100 samples. Different feature extraction and classification methods were applied on the selected portions. Validation of methods was evaluated to study the ability of an early portion of the CGS transient response in target gas (TG identification. Experimental results proved that applying extracted features from an early part of the CGS transient response along with a classifier can distinguish short-chain alcohols from each other perfectly. Decreasing time of exposition in the interaction between target gas and sensing element improved the reliability of the sensor. Classification rate was also improved and time of identification was decreased. Moreover, the results indicated the optimum interval of the early transient response of the CGS for selecting portions to achieve the best classification rates.

  10. The perceptual trap: Experimental and modelling examples of soil moisture, hydraulic conductivity and response units in complex subsurface settings.

    Science.gov (United States)

    Jackisch, Conrad; Demand, Dominic; Allroggen, Niklas; Loritz, Ralf; Zehe, Erwin

    2017-04-01

    In order to discuss hypothesis testing in hydrology, the question of the solid foundation of such tests has to be answered. But how certain are we about our measurements of the components of the water balance and the states and dynamics of the complex systems? What implicit assumptions or bias are already embedded in our perception of the processes? How can we find light in the darkness of heterogeneity? We will contribute examples from experimental findings, modelling approaches and landscape analysis to the discussion. Example soil moisture and the soil continuum: The definition of soil moisture as fraction of water in the porous medium assumes locally well-mixed conditions. Moreover, a unique relation of soil water retention presumes instant local thermodynamic equilibrium in the pore water arrangement. We will show findings from soil moisture responses to precipitation events, from irrigation experiments, and from a model study of initial infiltration velocities. The results highlight, that the implicit assumption relating soil moisture state dynamics with actual soil water flow is biased towards the slow end of the actual velocity distribution and rather blind for preferential flow acting in a very small proportion of the pore space. Moreover, we highlight the assumption of a well-defined continuum during the extrapolation of point-scale measurements and why spatially and temporally continuous observation techniques of soil water states are essential for advancing our understanding and development of subsurface process theories. Example hydraulic conductivity: Hydraulic conductivity lies at the heart of hydrological research and modelling. Its values can range across several orders of magnitude at a single site alone. Yet, we often consider it a crisp, effective parameter. We have conducted measurements of soil hydraulic conductivity in the lab and in the field. Moreover, we assessed infiltration capacity and conducted plot-scale irrigation experiments to

  11. The effects of garlic-supplemented diets on skin mucosal immune responses, stress resistance and growth performance of the Caspian roach (Rutilus rutilus) fry.

    Science.gov (United States)

    Ghehdarijani, Mahbubeh Salmanian; Hajimoradloo, Abdolmajid; Ghorbani, Rasol; Roohi, Zahra

    2016-02-01

    This study was conducted to evaluate the effects of garlic supplementation on some skin mucus immune parameters, mucus antimicrobial activity and growth performance of the Caspian roach (Rutilus rutilus caspicus) fry. Fish (1 ± 0.07 g) were divided into four groups fed diets containing 0 (control), 5, 10 and 15 g kg(-1) garlic for 8 weeks. The results showed that there was a significant increase in weight gain and specific growth rate in those fish fed garlic diets compared with the control (P garlic dosage. At the end of trial, the epidermal mucus protein level, alkaline phosphatase and antimicrobial activity against 2 g-negative bacteria (Escherichia coli and Serratia marcescens) and gram-positive bacteria (Streptococcus faecium and Micrococcus luteus) were measured. Skin mucus alkaline phosphatase, protein levels and antimicrobial activity were increased following garlic administration, and the bacterial growth inhibition zones were significantly elevated in garlic-fed fish (P garlic beneficially affects the skin mucus immune parameters and growth performance of the Caspian roach fry. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Effects of locus coeruleus stimulation on the responses of SI neurons of the rat to controlled natural and electrical stimulation of the skin.

    Science.gov (United States)

    Snow, P J; Andre, P; Pompeiano, O

    1999-02-01

    1. The effects of microstimulation of the locus coeruleus (LC) region on the spontaneous discharge and the response of SI neurons to natural and electrical stimulation of the skin have been investigated in 26 urethane anesthetized Sprague-Dawley rats. In particular, one or two air puffs, 5-10 msec in duration, 1-2 psi, usually separated by an interval of 40 msec, were applied on the hairy skin of the wrist or the forepaw at the presentation rate of 1/sec. For units unresponsive to air puffs, similar presentation of low intensity electrical stimuli (0.2-5.0 V, 0.2-0.4 msec pulses) were applied through two needles inserted on the most effective area of the skin. Both natural and electrical stimulations of the skin were applied under control conditions, as well as 50 msec after a 250 msec train of 0.3 msec pulses at 40 Hz. 20-30 microA applied stereotaxically to the LC complex through a tungsten microelectrode. 2. Not all cortical units exhibited spontaneous discharge. Most of the units, however, which were spontaneously active, were inhibited by electrical stimulation of the LC complex, while the remaining ones were excited. The sites of stimulation, which included either the LC proper or the locus subcoeruleus, were identified following both anatomical and physiological criteria. 3. SI neurons recorded at sites between 400 and 950 microns below the surface of the cortex, thus being most likely granule cells of layers III and IV, responded to cutaneous stimuli with spikes which occurred with a latency of 20-30 msec in response to single air puffs and a latency of 15-20 msec in response to single electrical pulses to the skin. In both instances the response to the second stimulus applied at the interstimulus interval of 40 msec was markedly reduced or abolished due to postexcitatory inhibition following the response to the first stimulus (in-field inhibition). In contrast, units particularly located at or below 1000 microns from the cortical surface, which were of

  13. Influence of laser wavelength on the thermal responses of port wine stain lesions in light, moderate and heavy pigmented skin

    International Nuclear Information System (INIS)

    Li, D.; Chen, B.; Wu, W.J.; Ying, Z.X.

    2017-01-01

    Highlights: • Laser surgery for port wine stain (PWS) was studied by local non-equilibrium theory. • Wavelength selection in laser surgery under various skin pigmentation was explored. • High pigmented skin prefers to 585 nm rather then 595 nm. • Dual-wavelength laser (585/595 + 1064 nm) has better clinic effect than single one. • Deep buried blood vessels can be damaged by 595/1064 nm dual-wavelength laser. - Abstract: Pulsed dye laser (PDL) in visible band (e.g. 585 or 595 nm) together with cryogen spray cooling has become the golden standard for treatment of vascular malformation such as port wine stain (PWS). However, due to the limited energy penetration depth of the PDL, deeply buried blood vessels are likely to survive from the laser irradiation. Nd:YAG laser in near infrared (1064 nm) has great potential in the laser treatment of PWS due to its deeper penetration depth. In this study, the influence of laser wavelength in treating PWS lesions with various melanin concentrations in epidermis was theoretically investigated by a two-temperature model following the local thermal non-equilibrium theory of porous media. The results showed that deeply buried blood vessels can be coagulated by dual-wavelength laser combing 585 or 595 nm with 1064 nm laser. Furthermore, the therapeutic results by dual-wavelength laser were highly related to the melanin concentration in epidermis. In the light and moderate pigmented skin, the 595/1064 nm dual-wavelength laser showed better treatment effect in treating PWS with deeply-buried blood vessels than of 585/1064 nm dual-wavelength laser. For a high pigmented skin, the 585/1064 nm dual-wavelength laser showed better treatment effect than 595/1064 nm dual-wavelength laser.

  14. Regulatory T Cells in Chronic Graft-Versus-Host Disease After Extracorporeal Photopheresis: Correlation With Skin and Global Organ Responses, and Ability to Taper Steroids.

    Science.gov (United States)

    Denney, Helen A; Whittle, Robert J; Lai, Jennifer; Jacques, Richard M; Taylor, Peter C

    2017-01-01

    Induction of immune tolerance by an increase in regulatory T (Treg) cells after extracorporeal photopheresis (ECP) is thought to contribute to how ECP exerts its therapeutic effect in patients with chronic graft-versus-host disease (cGvHD). We investigated whether percentages and absolute counts of Treg cells changed post-ECP, and examined correlation with response. Absolute counts and % of CD4+ T cells and Treg cells (CD4 + CD25 + FOXP3 + CD127dim/-) were evaluated using flow cytometry in 32 patients with cGvHD treated by ECP for a minimum of 3 months, and up to 12 months. CD4+ or Treg cells at baseline to 12 months post-ECP were compared with changes in skin disease scores or global organ involvement, or the ability to taper steroids, at 14, 28, and 56 weeks. Regulatory T cells % increased significantly above any overall changes in CD4+ % at 6, 9, and 12 months post-ECP. There was no statistically significant association between Treg cells and skin or steroid response, whereas a larger increase in CD4+ count from baseline to 1 to 3 months corresponded to increased odds of being able to reduce steroid dose by 50% or greater at 14 weeks. Skin and global organ responders at 28 weeks had higher median Treg cell counts 3 months post-ECP than nonresponders, as did steroid responders at 56 weeks who were 12 months post-ECP. Regulatory T cell counts and % varied greatly among cGvHD patients, and the increase post-ECP was not significant until 6 months. No clear correlation was found between Treg cells and clinical improvement, suggesting that increases in Treg cell numbers and/or proportions are not driving the mechanism leading to a response after ECP.

  15. Nonlinear dynamics of skin blood flow response to mechanical and thermal stresses in the plantar foot of diabetics with peripheral neuropathy.

    Science.gov (United States)

    Liao, Fuyuan; Jan, Yih-Kuen

    2017-01-01

    Diabetic foot ulcers (DFU) are a major complication in diabetics. Impaired microvascular reactivity is a major contributor to the development of DFU and has been traditionally quantified by time-domain or frequency-domain measures of skin blood flow (SBF). These measures, however, are unable to characterize the changes of nonlinear dynamics of SBF associated with diabetes and peripheral neuropathy. The objective of this study was to investigate altered nonlinear dynamics of skin blood flow in the plantar foot of diabetics with peripheral neuropathy. 18 type 2 diabetics with peripheral neuropathy and 8 healthy controls were recruited. SBF at the first metatarsal head in response to a loading pressure of 300 mmHg and a local heating was measured using laser Doppler flowmetry. A sample entropy approach was used to quantify the degree of regularity of SBF. Our results showed that the regularity degree of SBF in the diabetic foot underwent only small changes during post-occlusive reactive hyperemia and thermally induced biphasic response compared to non-diabetics. SBF of the diabetic foot has higher degree of irregularity during reactive hyperemia because of attenuated myogenic activity, and demonstrated higher regularity during the biphasic response largely due to significantly enhanced cardiac activities. This study suggests that the regularity degree of SBF at the first metatarsal head could be used to assess impaired microvascular reactivity and thus may be used to assess the risk for DFU in diabetics with peripheralneuropathy.

  16. The differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1986-01-01

    Hind feet of group of female rats aged 7, 14 and 52 weeks were X-irradiated at 20, 25 or 30 Gy. Hyperthermia (42.5 0 C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, by immersion in water or fluorocarbon liquid. Results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry'. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37 0 C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5 0 C are close to those obtained in large animal studies and similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent. (author)

  17. Differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W.

    1986-11-01

    Hind feet of group of female rats aged 7, 14 and 52 weeks were X-irradiated at 20, 25 or 30 Gy. Hyperthermia (42.5/sup 0/C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, by immersion in water or fluorocarbon liquid. Results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry'. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37/sup 0/C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5/sup 0/C are close to those obtained in large animal studies and similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent.

  18. Extraction of gelatin from salmon (Salmo salar) fish skin using trypsin-aided process: optimization by Plackett-Burman and response surface methodological approaches.

    Science.gov (United States)

    Fan, HuiYin; Dumont, Marie-Josée; Simpson, Benjamin K

    2017-11-01

    Gelatin from salmon ( Salmo salar ) skin with high molecular weight protein chains ( α -chains) was extracted using trypsin-aided process. Response surface methodology was used to optimise the extraction parameters. Yield, hydroxyproline content and protein electrophoretic profile via sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of gelatin were used as responses in the optimization study. The optimum conditions were determined as: trypsin concentration at 1.49 U/g; extraction temperature at 45 °C; and extraction time at 6 h 16 min. This response surface optimized model was significant and produced an experimental value (202.04 ± 8.64%) in good agreement with the predicted value (204.19%). Twofold higher yields of gelatin with high molecular weight protein chains were achieved in the optimized process with trypsin treatment when compared to the process without trypsin.

  19. The role of variants from the innate immune system genes in tuberculosis and skin test response in a Native American population.

    Science.gov (United States)

    Lindenau, Juliana D; Salzano, Francisco M; Hurtado, Ana M; Hill, Kim R; Hutz, Mara H

    2016-10-01

    Native American populations show higher tuberculosis (TB) mortality and infectivity rates than non-Native populations. Variants in the innate immune system seem to have an important role on TB susceptibility. The role of some innate immune system variants in TB susceptibility and/or skin test response (PPD) were investigated in the Aché, a Native American population. Complement receptor 1 and toll like receptor 9 variants were associated with anergy to PPD and protection to TB, respectively. These findings demonstrate an important role of the innate immune system variants in TB susceptibility. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  20. Aggression in Children with Conduct Problems and Callous-Unemotional Traits: Social Information Processing and Response to Peer Provocation.

    Science.gov (United States)

    Helseth, Sarah A; Waschbusch, Daniel A; King, Sara; Willoughby, Michael T

    2015-11-01

    Callous/unemotional traits (CU) moderate children's conduct problems (CP) in numerous domains, including social functioning. The present study examined whether CU traits also moderate the aggressiveness of children's social information processing (SIP) and responses to varying intensities of peer provocation. Sixty elementary school-age children (46 males) were grouped into those without CP or CU (controls, n = 32), those with CP but not CU (CP-only; n = 14), and those with both CP and CU (CPCU, n = 14). Participants completed a task that measured two aspects of SIP (response generation and hostile attribution bias) and a computerized reaction time task (CRTT) that measured behavior, affect, and communication before and after provocation under instrumental and hostile aggressive conditions. Children with CPCU generated more aggressive responses than controls on measures of SIP. On the CRTT, all children exhibited reactive aggression following high provocation, but only children with CPCU exhibited proactive aggression, and reactive aggression following low provocation; no differences in affect were found. In a series of exploratory analyses, CPCU children communicated antisocially, while CP-only communicated prosocially. Finally, children with CPCU did not seem to hold a grudge following the final instance of provocation, instead gradually returning to baseline like their non-CU peers. These distinct social cognitive and behavioral profiles hint at different etiologies of CP and CPCU, underscoring the variability of aggression in these populations.

  1. Meso-scale modelling of the heat conductivity effect on the shock response of a porous material

    Science.gov (United States)

    Resnyansky, A. D.

    2017-06-01

    Understanding of deformation mechanisms of porous materials under shock compression is important for tailoring material properties at the shock manufacturing of advanced materials from substrate powders and for studying the response of porous materials under shock loading. Numerical set-up of the present work considers a set of solid particles separated by air representing a volume of porous material. Condensed material in the meso-scale set-up is simulated with a viscoelastic rate sensitive material model with heat conduction formulated from the principles of irreversible thermodynamics. The model is implemented in the CTH shock physics code. The meso-scale CTH simulation of the shock loading of the representative volume reveals the mechanism of pore collapse and shows in detail the transition from a high porosity case typical for abnormal Hugoniot response to a moderate porosity case typical for conventional Hugoniot response. Results of the analysis agree with previous analytical considerations and support hypotheses used in the two-phase approach.

  2. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  3. Greater efficiency of water use in poplar clones having a delayed response of mesophyll conductance to drought.

    Science.gov (United States)

    Théroux Rancourt, Guillaume; Éthier, Gilbert; Pepin, Steeve

    2015-02-01

    Improvement of water use efficiency is a key objective to improve the sustainability of cultivated plants, especially fast growing species with high water consumption like poplar. It is well known that water use efficiency (WUE) varies considerably among poplar genotypes, and it was recently suggested that the use of the mesophyll-to-stomatal conductance ratio (gm/gs) would be an appropriate trait to improve WUE. The responses of 7-week-old cuttings of four hybrid poplar clones and one native Balsam poplar (Populus balsamifera L.) to a water stress-recovery cycle were examined to evaluate the relation between the gm/gs ratio and transpiration efficiency (TE), a leaf-level component of WUE. A contrasting gs response to water stress was observed among the five clones, from stomatal closure early on during soil drying up to limited closure in Balsam poplar. However in the hybrids, the decline in gm was consistently delayed by a few days compared with gs. Moreover, in the most water use-efficient hybrids, the recovery following rehydration occurred faster for gm than for gs. Thus, the delay in the response of gm to drought and its faster recovery upon rewatering increased the gm/gs of the hybrids and this ratio scaled positively with TE. Our results support the use of the gm/gs ratio to select genotypes with improved WUE, and the notion that breeding strategies focusing mainly on stomatal responses to soil drying should also look for a strong curvilinearity between net carbon assimilation rate and gs, the indication of a significant increase in gm/gs in the earlier stages of stomatal closure. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  5. Menstrual cycle and skin reactivity

    DEFF Research Database (Denmark)

    Agner, T; Damm, P; Skouby, S O

    1991-01-01

    The hypothesis was tested that a cyclic variation exists in skin reactivity to irritant stimuli. Twenty-nine healthy women with regular menstrual cycles were challenged with sodium lauryl sulfate as an irritant patch test at day 1 and at days 9 through 11 of the menstrual cycle. The skin response...... to the applied irritant stimulus was evaluated by visual scoring and also quantified by measurements of transepidermal water loss, edema formation, and blood flow in the skin. The skin response to challenge with sodium lauryl sulfate was found to be significantly stronger at day 1 than at days 9 through 11...

  6. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  7. Anti-Inflammation Activities of Mycosporine-Like Amino Acids (MAAs in Response to UV Radiation Suggest Potential Anti-Skin Aging Activity

    Directory of Open Access Journals (Sweden)

    Sung-Suk Suh

    2014-10-01

    Full Text Available Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs. In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly, based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells.

  8. Auditory steady-state response thresholds in adults with conductive and mild to moderate sensorineural hearing loss.

    Science.gov (United States)

    Hosseinabadi, Reza; Jafarzadeh, Sadegh

    2015-01-01

    The Auditory steady state response (ASSR) provides a frequency-specific and automatic assessment of hearing sensitivity and is used in infants and difficult-to-test adults. The aim of this study was to compare the ASSR thresholds among various types (normal, conductive, and sensorineural), degree (normal, mild, and moderate), and configuration (flat and sloping) of hearing sensitivity, and measuring the cutoff point between normal condition and hearing loss for different frequencies. This clinical trial was performed in Iran and included patients who were referred from Ear, Nose, and Throat Department. A total of 54 adults (27 with sensorineural hearing loss, 17 with conductive hearing losses, and 10 with normal hearing) were randomly chosen to participate in our study. The type and degree of hearing loss were determined through testing by otoscopy, tympanometry, acoustic reflex, and pure tone audiometry. Then the ASSR was tested at carrier frequencies of 500, 1000, 2000, and 4000 Hz. The ASSR accurately estimates the behavioral thresholds as well as flat and sloping configurations. There was no correlation between types of hearing loss and difference of behavioral and ASSR thresholds (P = 0.69). The difference between ASSR and behavioral thresholds decreased as severity of hearing loss increased. The 40, 35, 30, and 35 dB could be considered as cutoffs between normal hearing and hearing loss for 500, 1000, 2000, and 4000 Hz, respectively. The ASSR can accurately predict the degree and configuration of hearing loss and discriminate the normal hearing from mild or moderate hearing loss and mild from moderate hearing loss, except for 500 Hz. The Air-conducted ASSR could not define the type of hearing loss.

  9. Detecting the differences in responses of stomatal conductance to moisture stresses between deciduous shrubs and Artemisia subshrubs.

    Science.gov (United States)

    Gao, Qiong; Yu, Mei; Zhou, Chan

    2013-01-01

    Shrubs and subshrubs can tolerate wider ranges of moisture stresses in both soil and air than other plant life forms, and thus represent greater nonlinearity and uncertainty in ecosystem physiology. The objectives of this paper are to model shrub/subshrub stomatal conductance by synthesizing the field leaf gas exchanges data of 24 species in China, in order to detect the differences between deciduous shrubs and Artemisia subshrubs in their responses of stomatal conductance to changes in the moisture stresses. We revised a model of stomatal conductance by incorporating the tradeoff between xylem hydraulic efficiency and cavitation loss risk. We then fit the model at the three hierarchical levels: global (pooling all data as a single group), three functional groups (deciduous non-legume shrubs, deciduous legume shrubs, and subshrubs in Artemisia genus), and individual observations (species × sites). Bayesian inference with Markov Chain Monte Carlo method was applied to obtain the model parameters at the three levels. We found that the model at the level of functional groups is a significant improvement over that at the global level, indicating the significant differences in the stomatal behavior among the three functional groups. The differences in tolerance and sensitivities to changes in moisture stresses are the most evident between the shrubs and the subshrubs: The two shrub groups can tolerate much higher soil water stress than the subshrubs. The analysis at the observation level is also a significant improvement over that at the functional group level, indicating great variations within each group. Our analysis offered a clue for the equivocal issue of shrub encroachment into grasslands: While the invasion by the shrubs may be irreversible, the dominance of subshrubs, due to their lower resistance and tolerance to moisture stresses, may be put down by appropriate grassland management.

  10. Delayed-type hypersensitivity skin test responses to PPD and other antigens among BCG-vaccinated HIV-1-infected and healthy children and adolescents.

    Science.gov (United States)

    Costa, Natalia Moriya Xavierda; Albuquerque, Maly de; Lins, Janaína Bacelar Acioli; Alvares-Junior, João Teixeira; Stefani, Mariane Martins de Araújo

    2011-10-01

    Among HIV-1-infected patients, CD4+ T cell counts are well-established markers of cell-mediated immunity. Delayed-type hypersensitivity (DTH) skin tests can be used to evaluate in vivo cell-mediated immunity to common antigens. DTH responses to tuberculin purified protein derivative (PPD), sporotrichin, trichophytin, candidin and streptokinase/streptodornase antigens were assessed. Thirty-six HIV-1-infected children/adolescents and 56 age- and sex-matched HIV-1/HIV-2-seronegative participants were tested. All participants had a BCG scar. Fisher's exact test was used to evaluate significant differences between groups (pPPD positivity prevailed among healthy participants (40/56, 71.4%). PPD reactivity in the HIV-1-positive group was 8.3% (pPPD induration was 2.5mm (range: 2-5mm) in the HIV-1 group and 6.0 mm among healthy participants (range: 3-15 mm). There was no correlation between PPD positivity and age. No correlation between CD4+ T cell counts and DTH reactivity was observed among HIV-1-infected patients. DTH skin test responses, including PPD reactivity, were significantly lower among HIV-1-infected participants compared to healthy controls, which likely reflects advanced disease and T cell depletion.

  11. Research ethics I: Responsible conduct of research (RCR)--historical and contemporary issues pertaining to human and animal experimentation.

    Science.gov (United States)

    Horner, Jennifer; Minifie, Fred D

    2011-02-01

    In this series of articles--Research Ethics I, Research Ethics II, and Research Ethics III--the authors provide a comprehensive review of the 9 core domains for the responsible conduct of research (RCR) as articulated by the Office of Research Integrity. In Research Ethics I, they present a historical overview of the evolution of RCR in the United States then examine the evolution of human and animal experimentation from the birth of scientific medicine through World War II to the present day. They relied on authoritative documents, both historical and contemporary, insightful commentary, and empirical research in order to identify current issues and controversies of potential interest to both faculty and students. The authors have written this article from a historical perspective because they think all readers interested in RCR should appreciate how the history of science and all the good--and harm--it has produced can inform how researchers practice responsible research in the 21st century and beyond.

  12. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  13. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  14. Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.

    Science.gov (United States)

    Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

    2012-03-01

    Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

  15. Exploring the comparative responsiveness of a core set of outcome measures in a school-based conductive education programme.

    Science.gov (United States)

    Wright, F V; Boschen, K; Jutai, J

    2005-05-01

    Conductive education (CE) is a holistic educational system that uses an active cognitive approach to teach individuals with motor disorders to become more functional participants in daily activities. While CE's popularity continues to grow in North America and Europe, its effectiveness has not been established. The lack of definition of responsive outcome measures for evaluation of CE programmes has limited the interpretability of conclusions from earlier studies evaluating effectiveness. To determine which measures from a core set were most responsive to physical, functional and psychosocial changes associated with a school-based CE programme. This was a one-group before and after data collection design using an 8-month follow-up period. We enrolled a referral sample of nine children with cerebral palsy in Kindergarten or Grade 1 (Gross Motor Function Classification System levels 3, 4 or 5). The study took place within a school-based CE programme at a Canadian children's rehabilitation centre. Children participated in a CE full-day class for an entire school year. Physical, functional, psychosocial and participation measures included: Gross Motor Function Measure (GMFM), Quality of Upper Extremity Skills Test (QUEST), Peabody Developmental Motor Scales, Paediatric Evaluation of Disability Inventory (PEDI), Pictorial Scale of Perceived Competence and Social Acceptance for Young Children, Individualized Educational Plan, and Goal Attainment Scaling (GAS). Four children from the study's second year were also evaluated on the Impact on Family Scale (IFS), GAS and School Function Assessment. The Gross Motor Function Measure, QUEST, PEDI (Caregiver Assistance) and IFS were most responsive to change. GAS was useful in documenting and quantifying goals. Problems were encountered in evaluating self-esteem and school participation. Several strong measures of outcome were identified. Further work is needed to find valid and sensitive psychosocial and school participation

  16. Oxidative stress drives CD8+ T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  17. Pseudomonas aeruginosa biofilm aggravates skin inflammatory response in BALB/c mice in a novel chronic wound model

    DEFF Research Database (Denmark)

    Trøstrup, Hannah; Thomsen, Kim; Christophersen, Lars J

    2013-01-01

    model in C3H/HeN and BALB/c mice. The chronic wound was established by an injection of seaweed alginate-embedded P. aeruginosa PAO1 beneath a third-degree thermal lesion providing full thickness skin necrosis, as in human chronic wounds. Cultures revealed growth of PA, and both alginate with or without......Chronic wounds are presumed to persist in the inflammatory state, preventing healing. Emerging evidence indicates a clinical impact of bacterial biofilms in soft tissues, including Pseudomonas aeruginosa (PA) biofilms. To further investigate this, we developed a chronic PA biofilm wound infection...... bacteria organized in clusters, resembling biofilms, and inflammation located adjacent to the PA. The chronic wound infection showed a higher number of PAO1 in the BALB/c mice at day 4 after infection as compared to C3H/HeN mice (p

  18. Complete electric dipole response in 120Sn and 208Pb and implications for neutron skin and symmetry energy

    International Nuclear Information System (INIS)

    Von Neumann-Cosel, Peter

    2015-01-01

    Polarized proton scattering at energies of a few 100 MeV and very forward angles including 0° has been established as a new tool to extract the complete E1 strength distribution in nuclei for excitation energies between about 5 and 20 MeV. A case study of 208 Pb demonstrates excellent agreement with other electromagnetic probes. From the information on the B(E1) strength one can derive the electric dipole dipole polarizability, which is strongly correlated to the neutron skin and to parameters of the symmetry energy. Recently, we have extracted the polarizability of 120 Sn with a comparable precision. The combination of both results further constrains the symmetry energy parameters and presents a challenge for mean-field models, since relativistic and many Skyrme parameterizations cannot reproduce both experimental results simultaneously. (paper)

  19. Comparison of three techniques for evaluating skin erythemal response for determination of sun protection factors of sunscreens: high resolution laser Doppler imaging, colorimetry and visual scoring.

    Science.gov (United States)

    Wilhelm, K P; Kaspar, K; Funkel, O

    2001-04-01

    Sun protection factor (SPF) measurement is based on the determination of the minimal erythema dose (MED). The ratio of doses required to induce a minimal erythema between product-treated and untreated skin is defined as SPF. The aim of this study was to validate the conventionally used visual scoring with two non-invasive methods: high resolution laser Doppler imaging (HR-LDI) and colorimetry. Another goal was to check whether suberythemal reactions could be detected by means of HR-LDI measurements. Four sunscreens were selected. The measurements were made on the back of 10 subjects. A solar simulator SU 5000 (m.u.t., Wedel, Germany) served as radiation source. For the visual assessment, the erythema was defined according to COLIPA as the first perceptible, clearly defined unambiguous redness of the skin. For the colorimetric determination of the erythema, a Chromameter CR 300 (Minolta, Osaka, Japan) was used. The threshold for the colorimetry was chosen according to the COLIPA recommendation as an increase of the redness parameter delta a* = 2.5. For the non-contact perfusion measurements of skin blood flow, a two-dimensional high resolution laser Doppler imager (HR-LDI) (Lisca, Linköping, Sweden) was used. For the HR-LDI measurements, an optimal threshold perfusion needed to be established. For the HR-LDI measurements basal perfusion +1 standard deviation of all basal measurements was found to be a reliable threshold perfusion corresponding to the minimal erythema. Smaller thresholds, which would be necessary for detection of suberythemal responses, did not provide unambiguous data. All three methods, visual scoring, colorimetry and HR-LDI, produced similar SPFs for the test products with a variability of colorimetry are suitable, reliable and observer-independent methods for MED determination. However, they do not provide greater sensitivity and thus do not result in lower UV dose requirements for testing.

  20. Assessing complexity of skin blood flow oscillations in response to locally applied heating and pressure in rats: Implications for pressure ulcer risk

    Science.gov (United States)

    Liao, Fuyuan; O'Brien, William D.; Jan, Yih-Kuen

    2013-10-01

    The objective of this study was to investigate the effects of local heating on the complexity of skin blood flow oscillations (BFO) under prolonged surface pressure in rats. Eleven Sprague-Dawley rats were studied: 7 rats underwent surface pressure with local heating (△t=10 °C) and 4 rats underwent pressure without heating. A pressure of 700 mmHg was applied to the right trochanter area of rats for 3 h. Skin blood flow was measured using laser Doppler flowmetry. The loading period was divided into nonoverlapping 30 min epochs. For each epoch, multifractal detrended fluctuation analysis (MDFA) was utilized to compute DFA coefficients and complexity of endothelial related metabolic, neurogenic, and myogenic frequencies of BFO. The results showed that under surface pressure, local heating led to a significant decrease in DFA coefficients of myogenic frequency during the initial epoch of loading period, a sustained decrease in complexity of myogenic frequency, and a significantly higher degree of complexity of metabolic frequency during the later phase of loading period. Surrogate tests showed that the reduction in complexity of myogenic frequency was associated with a loss of nonlinearity whereas increased complexity of metabolic frequency was associated with enhanced nonlinearity. Our results indicate that increased metabolic activity and decreased myogenic response due to local heating manifest themselves not only in magnitudes of metabolic and myogenic frequencies but also in their structural complexity. This study demonstrates the feasibility of using complexity analysis of BFO to monitor the ischemic status of weight-bearing skin and risk of pressure ulcers.

  1. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  2. Hyperelastic skin

    Science.gov (United States)

    ... is most often seen in people who have Ehlers-Danlos syndrome. People with this disorder have very elastic skin. ... any member of your family been diagnosed with Ehlers-Danlos syndrome? What other symptoms are present? Genetic counseling may ...

  3. Skin Cancer

    Science.gov (Unit