WorldWideScience

Sample records for skin barrier function

  1. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  2. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...

  3. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  4. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  5. Standards for the Protection of Skin Barrier Function.

    Science.gov (United States)

    Giménez-Arnau, Ana

    2016-01-01

    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

  6. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  7. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

  8. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  9. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Effects of industrial detergents on the barrier function of human skin

    DEFF Research Database (Denmark)

    Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

    2000-01-01

    Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

  11. Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

    Science.gov (United States)

    Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

    2000-08-01

    The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

  12. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

    Science.gov (United States)

    Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

    2004-03-01

    Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

  14. Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

    Science.gov (United States)

    Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David

    2014-01-01

    We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

  15. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  16. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  17. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  18. Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

    OpenAIRE

    Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

    2008-01-01

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

  19. Thiolated silicone oils as adhesive skin protectants for improved barrier function.

    Science.gov (United States)

    Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

    2016-06-01

    The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  20. Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

    Science.gov (United States)

    Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

    2012-01-01

    Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

  1. Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

    Science.gov (United States)

    Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

    2018-04-24

    In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

  2. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

    Science.gov (United States)

    Ohno, Yusuke

    2017-01-01

    The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

  4. Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

    NARCIS (Netherlands)

    den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

    2008-01-01

    The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

  5. Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

    Science.gov (United States)

    Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

    2008-11-15

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

  6. Skin barrier composition

    International Nuclear Information System (INIS)

    Osburn, F.G.

    1985-01-01

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)

  7. Skin barrier composition

    Energy Technology Data Exchange (ETDEWEB)

    Osburn, F G

    1985-06-12

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.

  8. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

    NARCIS (Netherlands)

    Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

    2005-01-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

  9. Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

    Science.gov (United States)

    Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

    2017-12-01

    Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

  10. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  11. Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

    Science.gov (United States)

    Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

    2017-02-08

    Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

  12. Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.

    Science.gov (United States)

    Draelos, Zoe D

    2005-01-01

    The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.

  13. Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

    Science.gov (United States)

    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

    2016-09-01

    Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

  14. Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

    Science.gov (United States)

    Kubota, Takahiro

    2012-06-01

    Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

  15. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

  16. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro.

    Science.gov (United States)

    Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees

    2005-10-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.

  17. Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

    DEFF Research Database (Denmark)

    Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

    2007-01-01

    12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

  18. Development of a vernix caseosa substitute : a novel strategy to improve skin barrier function and repair

    NARCIS (Netherlands)

    Rißmann, Robert

    2009-01-01

    Vernix caseosa (VC) is the cheesy, white cream that covers the skin of the human fetus and the newborn. VC is a protective cream, which consists of water containing dead cells that are embedded in lipids. This natural cream is suggested to feature multiple biological functions such as facilitating

  19. A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

    Science.gov (United States)

    Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

    2015-08-01

    The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

  20. Penetration through the Skin Barrier

    DEFF Research Database (Denmark)

    Nielsen, Jesper Bo; Benfeldt, Eva; Holmgaard, Rikke

    2016-01-01

    The skin is a strong and flexible organ with barrier properties essential for maintaining homeostasis and thereby human life. Characterizing this barrier is the ability to prevent some chemicals from crossing the barrier while allowing others, including medicinal products, to pass at varying rates......-through diffusion cells) as well as in vivo methods (microdialysis and microperfusion). Then follows a discussion with examples of how different characteristics of the skin (age, site and integrity) and of the penetrants (size, solubility, ionization, logPow and vehicles) affect the kinetics of percutaneous...

  1. Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

    Science.gov (United States)

    Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

    2013-11-01

    The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  3. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  4. Structure and Function of Your Skin

    Science.gov (United States)

    ... Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . ... in the dermis. What It Does . . . The major function of skin is to provide a barrier between ...

  5. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  6. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  7. Antimicrobial Peptides, Infections and the Skin Barrier

    DEFF Research Database (Denmark)

    Clausen, Maja Lisa; Agner, Tove

    2016-01-01

    The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis and trans......The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis...

  8. Noninvasive evaluation of the barrier properties of the skin

    Directory of Open Access Journals (Sweden)

    Utz S.R.

    2014-09-01

    Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

  9. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Skin barrier disruption by acetone: observations in a hairless mouse skin model

    NARCIS (Netherlands)

    Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

    2009-01-01

    To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term

  12. Alteration of skin hydration and its barrier function by vehicle and permeation enhancers: a study using TGA, FTIR, TEWL and drug permeation as markers.

    Science.gov (United States)

    Shah, D K; Khandavilli, S; Panchagnula, R

    2008-09-01

    Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well

  13. Matching the skin barrier to the skin type.

    Science.gov (United States)

    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  14. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

  15. The structure, function, and importance of ceramides in skin and their use as therapeutic agents in skin-care products.

    Science.gov (United States)

    Meckfessel, Matthew H; Brandt, Staci

    2014-07-01

    Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  16. Penetration of radionuclides across skin barriers of animal skin models in vitro

    International Nuclear Information System (INIS)

    Koprda, V.; Harangozo, M.; Bohacik, L.; Kassai, Z.

    1998-01-01

    In this paper: (i) the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model has been studied, (ii) the biologic structure mostly responsible for the barrier effect was selected and proved, (iii) the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ (the diffusion across the intact skin and the diffusion through the hair channels) was assessed. All experiments were done using radioactive tracers. Experimental arrangement consisted of Franz-type vertical permeation cells used with fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), respectively. 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used in full form (intact), and then with decreasing thickness of horny layer after the skin had been stripped with Scotch type (3M) 5-20 times respectively, or the skin was splitted under 60 degC hot water so that the whole epidermis was removed. The penetrated amounts of ions were found to be proportional to the time at least in the first 7 hours. The permeation resistance of the skin is proportional to the thickness of the horny layer, the principal barrier mostly restricting the flux of ions. The more the skin is stripped, the more enhanced is the penetration of ions. This corroborates the fact that stratum corneum represents the most important barrier function of the whole skin (of rats). The additional diffusion through channels along hairs (follicules) can be of important value also in case of human skin where hair density is many times lower than in the case of the animal models used

  17. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  18. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  19. Impaired Skin Barrier Due to Sebaceous Gland Atrophy in the Latent Stage of Radiation-Induced Skin Injury: Application of Non-Invasive Diagnostic Methods

    Directory of Open Access Journals (Sweden)

    Hyosun Jang

    2018-01-01

    Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.

  20. Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    ) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...

  1. Multifactorial skin barrier deficiency and atopic dermatitis: Essential topics to prevent the atopic march.

    Science.gov (United States)

    Egawa, Gyohei; Kabashima, Kenji

    2016-08-01

    Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  3. Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

    Science.gov (United States)

    Kawano, Ken-Ichi; Umemura, Kazuo

    2013-05-01

    The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

  4. Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

    Science.gov (United States)

    Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

    2015-10-01

    Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

  5. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of a health claim related to flaxseed oil and vitamin E and maintenance of the skin permeability barrier function pursuant to Article 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...

  6. Evaluation of a cyanoacrylate dressing to manage peristomal skin alterations under ostomy skin barrier wafers.

    Science.gov (United States)

    Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet

    2011-01-01

    Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.

  7. Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery

    Science.gov (United States)

    Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.

    2010-01-01

    Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044

  8. Frog skin function revisited

    DEFF Research Database (Denmark)

    Hviid Larsen, Erik; Ramløv, Hans

    2013-01-01

    of the epidermis. These mechanisms have evolved pari passu with life alternating between aquatic and terrestrial habitats associated with permeabilities of the skin controlled by external ion- and osmotic concentrations (loc. cit.). This allows for fast switching of the cutaneous uptake of chloride between active...

  9. Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis

    NARCIS (Netherlands)

    Bogaard, E.H. van den; Bergboer, J.G.M.; Vonk-Bergers, M.; Vlijmen-Willems, I.M. van; Hato, S.V.; Valk, P.G. van der; Schroder, J.M.; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.

    2013-01-01

    Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte-mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular

  10. Skin barrier properties in patients with recessive X-linked ichthyosis

    DEFF Research Database (Denmark)

    Johansen, J D; Ramsing, D; Vejlsgaard, G

    1995-01-01

    Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...

  11. The 24-hour skin hydration and barrier function effects of a hyaluronic 1%, glycerin 5%, and Centella asiatica stem cells extract moisturizing fluid: an intra-subject, randomized, assessor-blinded study.

    Science.gov (United States)

    Milani, Massimo; Sparavigna, Adele

    2017-01-01

    Moisturizing products are commonly used to improve hydration in skin dryness conditions. However, some topical hydrating products could have negative effects on skin barrier function. In addition, hydrating effects of moisturizers are not commonly evaluated up to 24 hours after a single application. Hyaluronic acid (HA) and glycerin are very well-known substances able to improve skin hydration. Centella asiatica extract (CAE) could exert lenitive, anti-inflammatory and reepithelialization actions. Furthermore, CAE could inhibit hyaluronidase enzyme activity, therefore prolonging the effect of HA. A fluid containing HA 1%, glycerin 5% and stem cells CAE has been recently developed (Jaluronius CS [JCS] fluid). To evaluate and compare the 24-hour effects of JCS fluid on skin hydration and on transepidermal water loss (TEWL) in healthy subjects in comparison with the control site. Twenty healthy women, mean age 40 years, were enrolled in an intra-subject (right vs left), randomized, assessor-blinded, controlled, 1-day trial. The primary end points were the skin hydration and TEWL, evaluated at the volar surface of the forearm and in standardized conditions (temperature- and humidity-controlled room: 23°C and 30% of humidity) using a corneometer and a vapometer device at baseline, 1, 8 and 24 hours after JCS fluid application. Measurements were performed by an operator blinded for the treatments. Skin hydration after 24 hours was significantly higher ( P =0.001; Mann-Whitney U test) in the JCS-treated area in comparison with the control site. JCS induced a significant ( P =0.0001) increase in skin hydration at each evaluation time (+59% after 1 hour, +48% after 8 hours and +29% after 24 hours) in comparison with both baseline ( P =0.0001) and non-treated control site ( P =0.001). TEWL after 24 hours was significantly lower ( P =0.049; Mann-Whitney U test) in the JCS-treated area in comparison with the control site (13±4 arbitrary units [AU] vs 16±6 AU). JCS fluid

  12. Effect of glove occlusion on the skin barrier

    DEFF Research Database (Denmark)

    Tiedemann, Daniel; Clausen, Maja Lisa; John, Swen Malthe

    2016-01-01

    that the negative effect of occlusion in itself is limited, and that only extensive and long-term occlusion will cause barrier impairment. However, studies investigating combined effect of occlusion and exposure to soaps/detergents indicate that occlusion significantly enhances the skin barrier damage caused...... by detergents/soaps in a dose-response fashion....

  13. Ion microbeam analysis. Application to the study of the skin barrier and its nano-toxicology

    International Nuclear Information System (INIS)

    Simon, M.

    2009-12-01

    This work is dedicated to the use of ion microbeam irradiation to the study of a complex biological tissue like skin. Up to now, it has been very difficult to detect and track metallic oxides and manufactured nano-particles in biological tissues, most particularly in skin. Thus, it is essential to precise the mechanisms involved in skin barrier function processes face to exogenous agents like nano-particles and to characterize them in biological models in vitro/in vivo. During my work, I have had the opportunity to combine quantitative methods of analysis with high resolution imagery techniques (confocal microscopy, transmission electron microscopy and ion beam analysis) in order to characterize: (i) the skin barrier function of an ex vivo pig ear skin model understanding the ion homeostasis behavior face to different chemical or physical stresses; (ii) the impact on viability, accumulation and intracellular distribution of nano-particles (Titanium Oxides) naked or functionalized with fluorescent dyes (FITC, Rhodamine)

  14. The skin barrier function gene SPINK5 is associated with challenge-proven IgE-mediated food allergy in infants.

    Science.gov (United States)

    Ashley, S E; Tan, H-T T; Vuillermin, P; Dharmage, S C; Tang, M L K; Koplin, J; Gurrin, L C; Lowe, A; Lodge, C; Ponsonby, A-L; Molloy, J; Martin, P; Matheson, M C; Saffery, R; Allen, K J; Ellis, J A; Martino, D

    2017-09-01

    A defective skin barrier is hypothesized to be an important route of sensitization to dietary antigens and may lead to food allergy in some children. Missense mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) skin barrier gene have previously been associated with allergic conditions. To determine whether genetic variants in and around SPINK5 are associated with IgE-mediated food allergy. We genotyped 71 "tag" single nucleotide polymorphisms (tag-SNPs) within a region spanning ~263 kb including SPINK5 (~61 kb) in n=722 (n=367 food-allergic, n=199 food-sensitized-tolerant and n=156 non-food-allergic controls) 12-month-old infants (discovery sample) phenotyped for food allergy with the gold standard oral food challenge. Transepidermal water loss (TEWL) measures were collected at 12 months from a subset (n=150) of these individuals. SNPs were tested for association with food allergy using the Cochran-Mantel-Haenszel test adjusting for ancestry strata. Association analyses were replicated in an independent sample group derived from four paediatric cohorts, total n=533 (n=203 food-allergic, n=330 non-food-allergic), mean age 2.5 years, with food allergy defined by either clinical history of reactivity, 95% positive predictive value (PPV) or challenge, corrected for ancestry by principal components. SPINK5 variant rs9325071 (A⟶G) was associated with challenge-proven food allergy in the discovery sample (P=.001, OR=2.95, CI=1.49-5.83). This association was further supported by replication (P=.007, OR=1.58, CI=1.13-2.20) and by meta-analysis (P=.0004, OR=1.65). Variant rs9325071 is associated with decreased SPINK5 gene expression in the skin in publicly available genotype-tissue expression data, and we generated preliminary evidence for association of this SNP with elevated TEWL also. We report, for the first time, association between SPINK5 variant rs9325071 and challenge-proven IgE-mediated food allergy. © 2017 EAACI and John Wiley and Sons A

  15. Natural Oils for Skin-Barrier Repair: Ancient Compounds Now Backed by Modern Science.

    Science.gov (United States)

    Vaughn, Alexandra R; Clark, Ashley K; Sivamani, Raja K; Shi, Vivian Y

    2018-02-01

    Natural plant oils are commonly used as topical therapy worldwide. They are usually easily accessible and are relatively inexpensive options for skin care. Many natural oils possess specific compounds with antimicrobial, antioxidant, anti-inflammatory, and anti-itch properties, making them attractive alternative and complementary treatments for xerotic and inflammatory dermatoses associated with skin-barrier disruption. Unique characteristics of various oils are important when considering their use for topical skin care. Differing ratios of essential fatty acids are major determinants of the barrier repair benefits of natural oils. Oils with a higher linoleic acid to oleic acid ratio have better barrier repair potential, whereas oils with higher amounts of irritating oleic acid may be detrimental to skin-barrier function. Various extraction methods for oils exist, including cold pressing to make unrefined oils, heat and chemical distillation to make essential oils, and the addition of various chemicals to simulate a specific scent to make fragranced oils. The method of oil processing and refinement is an important component of selecting oil for skin care, and cold pressing is the preferred method of oil extraction as the heat- and chemical-free process preserves beneficial lipids and limits irritating byproducts. This review summarizes evidence on utility of natural plant-based oils in dermatology, particularly in repairing the natural skin-barrier function, with the focus on natural oils, including Olea europaea (olive oil), Helianthus annus (sunflower seed oil), Cocos nucifera (coconut oil), Simmondsia chinesis (jojoba oil), Avena sativa (oat oil), and Argania spinosa (argan oil).

  16. Mechanism for initiation of food allergy: Dependence on skin barrier mutations and environmental allergen costimulation.

    Science.gov (United States)

    Walker, Matthew T; Green, Jeremy E; Ferrie, Ryan P; Queener, Ashley M; Kaplan, Mark H; Cook-Mills, Joan M

    2018-02-15

    Mechanisms for the development of food allergy in neonates are unknown but clearly linked in patient populations to a genetic predisposition to skin barrier defects. Whether skin barrier defects contribute functionally to development of food allergy is unknown. The purpose of the study was to determine whether skin barrier mutations, which are primarily heterozygous in patient populations, contribute to the development of food allergy. Mice heterozygous for the filaggrin (Flg) ft and Tmem79 ma mutations were skin sensitized with environmental and food allergens. After sensitization, mice received oral challenge with food allergen, and then inflammation, inflammatory mediators, and anaphylaxis were measured. We define development of inflammation, inflammatory mediators, and food allergen-induced anaphylaxis in neonatal mice with skin barrier mutations after brief concurrent cutaneous exposure to food and environmental allergens. Moreover, neonates of allergic mothers have increased responses to suboptimal sensitization with food allergens. Importantly, responses to food allergens by these neonatal mice were dependent on genetic defects in skin barrier function and on exposure to environmental allergens. ST2 blockade during skin sensitization inhibited the development of anaphylaxis, antigen-specific IgE, and inflammatory mediators. Neonatal anaphylactic responses and antigen-specific IgE were also inhibited by oral pre-exposure to food allergen, but interestingly, this was blunted by concurrent pre-exposure of the skin to environmental allergen. These studies uncover mechanisms for food allergy sensitization and anaphylaxis in neonatal mice that are consistent with features of human early-life exposures and genetics in patients with clinical food allergy and demonstrate that changes in barrier function drive development of anaphylaxis to food allergen. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  17. Multiphoton STED and FRET in human skin: Resolving the skin barrier

    DEFF Research Database (Denmark)

    Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.

    intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...

  18. LOCALIZATION OF PERMEABILITY BARRIERS IN THE FROG SKIN EPITHELIUM

    Science.gov (United States)

    Martinez-Palomo, A.; Erlij, D.; Bracho, H.

    1971-01-01

    Ruthenium red and colloidal lanthanum were used to determine the site of the structural barriers to diffusion within the intercellular spaces of frog skin epithelium. Electron micrographs show that occluding zonules located at the outer border of the stratum corneum and at the outer layer of the stratum granulosum are true tight junctions since they are impermeable to these tracers. Measurement of 140La uptake by the living skin shows that lanthanum moves across the external surface of the skin readily, into and out of a compartment that has a limited capacity and is bounded on its internal side by a barrier impermeable to lanthanum. Examination of these skins with the electron microscope suggests that the compartment is localized between the external membrane of the cells at the outer layer of the s. granulosum and at the outermost surface of the skin. These observations and other findings described in the literature indicate that the site of the external high resistance barrier of the frog skin is localized at the outer border of the s. granulosum. PMID:4329611

  19. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  20. Disturbed skin barrier in children with chronic kidney disease.

    Science.gov (United States)

    Wojtowicz-Prus, Elzbieta; Kilis-Pstrusinska, Katarzyna; Reich, Adam; Zachwieja, Katarzyna; Miklaszewska, Monika; Szczepanska, Maria; Szepietowski, Jacek C

    2015-02-01

    There are limited data on skin lesions in children with end-stage renal failure. The aim of the study was an evaluation of the skin barrier in children with different stages of chronic kidney disease (CKD). The prevalence of xerosis, its severity, as well as its link selected demographic factors, were examined. The study included 103 children: 72 with CKD stages 3-5 (38 on conservative treatment and 34 on dialysis) and 31 patients with primary monosymptomatic nocturnal enuresis as a control group. Initially, the study subjects described the localisation and severity of dry skin by themselves. Next, clinical evaluation of xerosis, non-invasive corneometric assessment of epidermis moisturising and the measurement of transepidermal water loss were performed. Most CKD children reported dry skin. The problem of xerosis was identified more frequently in patients on dialysis (67.6 %) than on conservative treatment (42.1 %) (p = 0.01). CKD patients divided according to skin dryness did not differ with regards to age, sex, initial kidney disease and CKD duration. Disturbed skin barrier is an important concern of children with CKD, intensifying as the disease progresses. This symptom occurs on early stages of CKD and it should be taken into consideration in the CKD management.

  1. An ex vivo human skin model for studying skin barrier repair.

    Science.gov (United States)

    Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A

    2015-01-01

    In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

  3. Microspectroscopic Confocal Raman and Macroscopic Biophysical Measurements in the in vivo Assessment of the Skin Barrier: Perspective for Dermatology and Cosmetic Sciences

    NARCIS (Netherlands)

    Falcone, D.; Uzunbajakava, N.E.; Varghese, B.; Aquino Santos, G.R. de; Richters, R.J.H.; Kerkhof, P.C.M. van de; Erp, P.E.J. van

    2015-01-01

    Skin barrier function, confined to the stratum corneum, is traditionally evaluated using established, noninvasive biophysical methods like transepidermal water loss, capacitance and conductance. However, these methods neither measure skin molecular composition nor its structure, hindering the actual

  4. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  5. Skin barrier properties in patients with recessive X-linked ichthyosis

    DEFF Research Database (Denmark)

    Johansen, J D; Ramsing, D; Vejlsgaard, G

    1995-01-01

    increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...

  6. Two Ancient Gene Families Are Critical for Maintenance of the Mammalian Skin Barrier in Postnatal Life.

    Science.gov (United States)

    Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M

    2016-07-01

    The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study.

    Science.gov (United States)

    Hahnel, Elisabeth; Blume-Peytavi, Ulrike; Trojahn, Carina; Kottner, Jan

    2017-11-13

    Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Mean age (n = 223) was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%). The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%), of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2%) and of skin tears 6.3% (95% CI: 3.2% - 9.5%). Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis have been detected, that might limit the diagnostic value of skin

  8. Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study

    Directory of Open Access Journals (Sweden)

    Elisabeth Hahnel

    2017-11-01

    Full Text Available Abstract Background Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. Methods This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Results Mean age (n = 223 was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%. The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%, of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2% and of skin tears 6.3% (95% CI: 3.2% - 9.5%. Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Conclusion Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis

  9. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  10. Skin barrier integrity and natural moisturising factor levels after cumulative dermal exposure to alkaline agents in atopic dermatitis

    NARCIS (Netherlands)

    Angelova-Fischer, Irena; Dapic, Irena; Hoek, Anne-Karin; Jakasa, Ivone; Fischer, Tobias W.; Zillikens, Detlef; Kezic, Sanja

    2014-01-01

    Dermal exposure to alkaline agents may lead to skin barrier damage and irritant contact dermatitis. The objective of this study was to investigate the effects of cumulative exposure to 0.5% sodium lauryl sulphate (SLS) and 0.15% NaOH on the barrier function and natural moisturising factor (NMF)

  11. The outcomes of barrier protection in periwound skin and stoma care.

    Science.gov (United States)

    Stephen-Haynes, Jackie

    This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.

  12. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier.

    Directory of Open Access Journals (Sweden)

    Jes Dreier

    Full Text Available In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers.

  13. Metabolic and redox barriers in the skin exposed to drugs and xenobiotics.

    Science.gov (United States)

    Korkina, Liudmila

    2016-01-01

    Growing exposure of human skin to environmental and occupational hazards, to numerous skin care/beauty products, and to topical drugs led to a biomedical concern regarding sustainability of cutaneous chemical defence that is essential for protection against intoxication. Since skin is the largest extra-hepatic drug/xenobiotic metabolising organ where redox-dependent metabolic pathways prevail, in this review, publications on metabolic processes leading to redox imbalance (oxidative stress) and its autocrine/endocrine impact to cutaneous drug/xenobiotic metabolism were scrutinised. Chemical and photo-chemical skin barriers contain metabolic and redox compartments: their protective and homeostatic functions. The review will examine the striking similarity of adaptive responses to exogenous chemical/photo-chemical stressors and endogenous toxins in cutaneous metabolic and redox system; the role(s) of xenobiotics/drugs and phase II enzymes in the endogenous antioxidant defence and maintenance of redox balance; redox regulation of interactions between metabolic and inflammatory responses in skin cells; skin diseases sharing metabolic and redox problems (contact dermatitis, lupus erythematosus, and vitiligo) Due to exceptional the redox dependence of cutaneous metabolic pathways and interaction of redox active metabolites/exogenous antioxidants with drug/xenobiotic metabolism, metabolic tests of topical xenobiotics/drugs should be combined with appropriate redox analyses and performed on 3D human skin models.

  14. Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.

    Science.gov (United States)

    Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A

    2009-08-01

    The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.

  15. Cost-effectiveness of a Ceramide-Infused Skin Barrier Versus a Standard Barrier

    Science.gov (United States)

    Berger, Ariel; Inglese, Gary; Skountrianos, George; Karlsmark, Tonny; Oguz, Mustafa

    2018-01-01

    PURPOSE: To assess the cost-effectiveness of a ceramide-infused skin barrier (CIB) versus other skin barriers (standard of care) among patients who have undergone ostomy creation. DESIGN: Cost-effectiveness analysis, based on a decision-analytic model that was estimated using data from the ADVOCATE (A Study Determining Variances in Ostomy Skin Conditions And The Economic Impact) trial, which investigated stoma-related healthcare costs over 12 weeks among patients who recently underwent fecal ostomy, and from other sources. SUBJECTS AND SETTING: Analysis was based on a hypothetical cohort of 1000 patients who recently underwent fecal ostomy; over a 1-year period, 500 patients were assumed to use CIB and 500 were assumed to use standard of care. METHODS: We adapted a previous economic model to estimate expected 1-year costs and outcomes among persons with a new ostomy assumed to use CIB versus standard of care. Outcomes of interest included peristomal skin complications (PSCs) (up to 2 during the 1-year period of interest) and quality-adjusted life days (QALDs); QALDs vary from 1, indicating a day of perfect health to 0, indicating a day with the lowest possible health (deceased). Subjects were assigned QALDs on a daily basis, with the value of the QALD on any given day based on whether the patient was experiencing a PSC. Costs included those related to skin barriers, ostomy accessories, and care of PSCs. The incremental cost-effectiveness of CIB versus standard of care was estimated as the incremental cost per PSC averted and QALD gained, respectively; net monetary benefit of CIB was also estimated. All analyses were run using the perspective of an Australian payer. RESULTS: On a per-patient basis, use of CIB was expected over a 1-year period to result in 0.16 fewer PSCs, an additional 0.35 QALDs, and a savings of A$180 (Australian dollars, US $137) in healthcare costs all versus standard of care. Management with CIB provided a net monetary benefit (calculated as

  16. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  17. Loss of corneodesmosin leads to severe skin barrier defect, pruritus, and atopy: unraveling the peeling skin disease.

    Science.gov (United States)

    Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

    2010-08-13

    Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.

  18. Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1991-01-01

    Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

  19. Coffee polyphenols extracted from green coffee beans improve skin properties and microcirculatory function.

    Science.gov (United States)

    Fukagawa, Satoko; Haramizu, Satoshi; Sasaoka, Shun; Yasuda, Yuka; Tsujimura, Hisashi; Murase, Takatoshi

    2017-09-01

    Coffee polyphenols (CPPs), including chlorogenic acid, exert various physiological activities. The purpose of this study was to investigate the effects of CPPs on skin properties and microcirculatory function in humans. In this double-blind, placebo-controlled study, 49 female subjects with mildly xerotic skin received either a test beverage containing CPPs (270 mg/100 mL/day) or a placebo beverage for 8 weeks. The ingestion of CPPs significantly lowered the clinical scores for skin dryness, decreased transepidermal water loss, skin surface pH, and increased stratum corneum hydration and the responsiveness of skin blood flow during local warming. Moreover, the amounts of free fatty acids and lactic acid in the stratum corneum significantly increased after the ingestion of CPPs. These results suggest that an 8-week intake of CPPs improve skin permeability barrier function and hydration, with a concomitant improvement in microcirculatory function, leading to efficacy in the alleviation of mildly xerotic skin.

  20. The important role of stratum corneum lipids for the cutaneous barrier function.

    Science.gov (United States)

    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

    2014-03-01

    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Efficacy of a Hand Regimen in Skin Barrier Protection in Individuals With Occupational Irritant Contact Dermatitis.

    Science.gov (United States)

    Jordan, Laura

    2016-11-01

    Occupational irritant contact dermatitis (OICD) is a dif cult and hard to manage condition. It occurs more frequently in certain occupations where contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing heightens the risk. Treatment for OICD includes patient education in addition to physical, topical, and systemic therapies. To review the pathogenesis and treatment options for OICD and evaluate the ef cacy of a selective skin-care regimen involv- ing a hand protectant cream alone as well as combined with a repair cream and speci c cleanser. A single-center open study was performed comprising 42 healthy male and female adult volunteers prone to occupational irritant contact dermatitis due to frequent wet work or contact with detergents. Between day 0 and day 7, subjects applied a hand protectant cream as needed on both hands (at least twice daily). On days 7 to 14, subjects applied a hand protectant cream and cleanser as needed on both hands (at least twice daily) as well as a repair cream each evening. A diary log was given to each volunteer for application control and for a subjective evaluation of daily tolerability. In these subjects prone to occupational irritant contact dermatitis, the hand protectant cream applied during the initial 7-day period was effective in restoring the damaged skin barrier and improving the stratum corneum hydration. A regimen that combined the hand protectant and repair creams with a speci c cleanser during a further 7-day period allowed contin- ued improvement of skin hydration and additional clinical bene ts while respecting the skin barrier function. The results of this study support the use of a 3-step approach for patients who are at risk of repeated exposure to external irritants. J Drugs Dermatol. 2016;15(suppl 11):s81-85..

  2. Barrier function and natural moisturizing factor levels after cumulative exposure to a fruit-derived organic acid and a detergent: different outcomes in atopic and healthy skin and relevance for occupational contact dermatitis in the food industry.

    Science.gov (United States)

    Angelova-Fischer, Irena; Hoek, Anne-Karin; Dapic, Irena; Jakasa, Ivone; Kezic, Sanja; Fischer, Tobias W; Zillikens, Detlef

    2015-12-01

    Fruit-derived organic compounds and detergents are relevant exposure factors for occupational contact dermatitis in the food industry. Although individuals with atopic dermatitis (AD) are at risk for development of occupational contact dermatitis, there have been no controlled studies on the effects of repeated exposure to multiple irritants, relevant for the food industry, in atopic skin. The aim of the study was to investigate the outcomes of repeated exposure to a fruit-derived organic acid and a detergent in AD compared to healthy volunteers. The volunteers were exposed to 2.0% acetic acid (AcA) and/or 0.5% sodium lauryl sulfate (SLS) in controlled tandem repeated irritation test. The outcomes were assessed by measurements of erythema, transepidermal water loss (TEWL) and natural moisturizing factor (NMF) levels. In the AD volunteers, repeated AcA exposure led to barrier disruption and significant TEWL increase; no significant differences after the same exposure in the healthy controls were found. Repeated exposure to SLS and the irritant tandems enhanced the reactions and resulted in a significantly higher increase in TEWL in the AD compared to the control group. Cumulative irritant exposure reduced the NMF levels in both groups. Differences in the severity of irritant-induced barrier impairment in atopic individuals contribute to the risk for occupational contact dermatitis in result of multiple exposures to food-derived irritants and detergents. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Uniting Control Lyapunov and Control Barrier Functions

    NARCIS (Netherlands)

    Romdlony, Zakiyullah; Jayawardhana, Bayu

    2014-01-01

    In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on

  4. Measurement of transepidermal water loss (TEWL) in cats with experimental skin barrier dysfunction using a closed chamber system.

    Science.gov (United States)

    Momota, Yutaka; Shimada, Kenichiro; Gin, Azusa; Matsubara, Takako; Azakami, Daigo; Ishioka, Katsumi; Nakamura, Yuka; Sako, Toshinori

    2016-10-01

    A closed chamber evaporimeter is suitable for measuring transepidermal water loss (TEWL) in cats because of the compact device size, tolerance to sudden movement and short measuring time. TEWL is a representative parameter for skin barrier dysfunction, which is one of the clinical signs of atopic dermatitis in humans and dogs. Measurement of feline TEWL has been reported, but applicability of this parameter has not been validated. The aims of this study were to determine if tape stripping is a valid experimental model in cats for studying TEWL and to determine if a closed chambered system is a suitable measurement tool for cats. Ten clinically normal cats. In order to evaluate variation of the measured values, TEWL was measured at the right and left side of the three clipped regions (axillae, lateral thigh and groin). Subsequently, TEWL was measured using sequential tape stripping of the stratum corneum as a model of acute barrier disruption. The variations between both sides of the three regions showed no significant difference. Sequential tape stripping was associated with increasing values for TEWL. Feline TEWL was shown to reflect changes in the skin barrier in an experimental model using a closed chamber system and has the potential for evaluating skin barrier function in cats with skin diseases. © 2016 ESVD and ACVD.

  5. Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.; Rissmann, R.; van der Coelen, D.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

    2009-01-01

    The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which

  6. NANODERM. Quality of skin as a barrier to ultra-fine particles

    International Nuclear Information System (INIS)

    Kiss, A.Z.; Kertesz, Zs.; Szikszai, Z.; Biro, T.; Czifra, G.; Toth, B.I.; Juhasz, I.; Kiss, B.; Hunyadi, J.

    2007-01-01

    ultra-fine particles on healthy skin. On the other hand, micronised titanium-dioxide particles are internalized by melanocytes and fibroblasts in cell culture. Particles disturb cell viability and proliferation as well as keratinocyte differentiation. Outlook Although this EU project has ended, there are still several questions to be answered. In view of the cellular effects, we are currently investigating the penetration of nanosized particles into skin with impaired barrier function. Long term exposure studies are also required

  7. Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus).

    Science.gov (United States)

    Alves, Ricardo N; Sundell, Kristina S; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M

    2018-06-01

    To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na + , K + -ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier's functional properties mature earlier and are independent of metamorphosis.

  8. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  9. Structural modification of the skin barrier by OH radicals: a reactive molecular dynamics study for plasma medicine

    International Nuclear Information System (INIS)

    Van der Paal, J; Verlackt, C C; Yusupov, M; Neyts, E C; Bogaerts, A

    2015-01-01

    While plasma treatment of skin diseases and wound healing has been proven highly effective, the underlying mechanisms, and more generally the effect of plasma radicals on skin tissue, are not yet completely understood. In this paper, we perform ReaxFF-based reactive molecular dynamics simulations to investigate the interaction of plasma generated OH radicals with a model system composed of free fatty acids, ceramides, and cholesterol molecules. This model system is an approximation of the upper layer of the skin (stratum corneum). All interaction mechanisms observed in our simulations are initiated by H-abstraction from one of the ceramides. This reaction, in turn, often starts a cascade of other reactions, which eventually lead to the formation of aldehydes, the dissociation of ceramides or the elimination of formaldehyde, and thus eventually to the degradation of the skin barrier function. (paper)

  10. Physiological and Molecular Effects of in vivo and ex vivo Mild Skin Barrier Disruption.

    Science.gov (United States)

    Pfannes, Eva K B; Weiss, Lina; Hadam, Sabrina; Gonnet, Jessica; Combardière, Béhazine; Blume-Peytavi, Ulrike; Vogt, Annika

    2018-01-01

    The success of topically applied treatments on skin relies on the efficacy of skin penetration. In order to increase particle or product penetration, mild skin barrier disruption methods can be used. We previously described cyanoacrylate skin surface stripping as an efficient method to open hair follicles, enhance particle penetration, and activate Langerhans cells. We conducted ex vivo and in vivo measurements on human skin to characterize the biological effect and quantify barrier disruption-related inflammation on a molecular level. Despite the known immunostimulatory effects, this barrier disruption and hair follicle opening method was well accepted and did not result in lasting changes of skin physiological parameters, cytokine production, or clinical side effects. Only in ex vivo human skin did we find a discrete increase in IP-10, TGF-β, IL-8, and GM-CSF mRNA. The data underline the safety profile of this method and demonstrate that the procedure per se does not cause substantial inflammation or skin damage, which is also of interest when applied to non-invasive sampling of biomarkers in clinical trials. © 2018 S. Karger AG, Basel.

  11. Functional and morphological studies of photodamaged skin on the hands of middle-aged Japanese golfers.

    Science.gov (United States)

    Kikuchi-Numagami, K; Suetake, T; Yanai, M; Takahashi, M; Tanaka, M; Tagami, H

    2000-06-01

    The skin of golfers' hands provides a suitable model to study the effect of chronic sun exposure, because one of their hands is exposed to the outer environment, especially sunlight, while the other one is always protected by a glove during play. Our purpose was to find out the influence of photodamage on the properties of the skin surface of middle-aged Japanese by using non-invasive methods. We measured hydration state, and water barrier function of the stratum corneum (SC) and the color of the skin of the dorsum of the hands. In a separate study, we evaluated the skin surface contour by using replicas taken from the skin in a slightly stretched or relaxed position. We found a significant decrease in hydration of the skin surface of the exposed skin as compared to that of the protected skin, whereas no such difference was found with transepidermal water loss, a parameter for water barrier function of the SC. Luminance of skin color was also reduced in the sun-exposed skin. Replica analysis revealed that large wrinkles developing in a relaxed position were more prominent on the exposed than on the protected skin, while fine furrows noted in a slightly stretched position were shallower on the former than the latter. The data obtained indicate that the chronically exposed skin of golfers' hands shows morphological and functional changes resulting from long time exposure to the outer environment especially sunlight. Furthermore, bioengineering non-invasive methods are found to be useful to detect early photodamage of the skin in a more quantitative fashion which is rather difficult to demonstrate clinically.

  12. Permanent isolation surface barrier: Functional performance

    International Nuclear Information System (INIS)

    Wing, N.R.

    1993-10-01

    This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release

  13. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  14. Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus)

    KAUST Repository

    Alves, Ricardo N.; Sundell, Kristina S.; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M.

    2018-01-01

    To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.

  15. Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus)

    KAUST Repository

    Alves, Ricardo N.

    2018-02-20

    To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.

  16. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

  17. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

  18. Effect of Fluid Intake on Hydration Status and Skin Barrier Characteristics in Geriatric Patients: An Explorative Study.

    Science.gov (United States)

    Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan

    2018-04-03

    Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.

  19. Barreira cutânea na dermatite atópica Skin barrier in atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Flavia Alvim Sant'Anna Addor

    2010-04-01

    Full Text Available O estudo da barreira cutânea e de suas propriedades ganhou impulso a partir da década de 60, com estudos que apontaram sua resistência de forma isolada e suas propriedades com relação à permeação cutânea. Paralelamente, a descrição dos corpos de Odland auxiliou a compreensão da manutenção da estabilidade da camada córnea. O modelo brick & mortar, em que os corneócitos são os tijolos e o cimento são os lipídeos intercelulares, é o mais aceito, até o momento. Atualmente, há evidências consistentes de que o estrato córneo é uma estrutura metabolicamente ativa e exerce funções adaptativas. A barreira cutânea também tem um papel na resposta inflamatória, com ativação de melanócitos, angiogênese e fibroplasia, cuja intensidade depende, basicamente, da intensidade da agressão. As anormalidades da barreira cutânea da dermatite atópica são clinicamente observáveis pela presença de pele seca, achado muito frequente e significativo, que constitui parâmetro iagnóstico e de acompanhamento. O grau de hidratação da camada córnea, assim como a perda de água transepidérmica (transepidermal water loss - TEWL, estão relacionados com o grau de dano à barreira, constituindo parâmetros biofísicos que permitem acompanhar os pacientes de maneira não invasiva e com maior grau de sensibilidade.Research about the skin barrier and its properties has increased significantly since the 60s, with studies that indicated its resistance when isolated, as well as its particularities in relation to skin permeability. At the same time, description of Odland bodies helped to understand how stratum corneum stability is maintained. The “brick and mortarâ€� model is the most accepted so far. In this analogy, the corneocytes are the bricks and the intercellular lipids are the mortar. Currently, there is concrete evidence that the stratum corneum is an active metabolic structure that holds adaptive functions, interacting

  20. Recovery Effects of Oral Administration of Glucosylceramide and Beet Extract on Skin Barrier Destruction by UVB in Hairless Mice

    Directory of Open Access Journals (Sweden)

    Yoshihiro Tokudome

    2017-10-01

    Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.

  1. Enhancement of percutaneous penetration of aniline and o-toluidine in vitro using skin barrier creams.

    Science.gov (United States)

    Korinth, Gintautas; Lüersen, Lars; Schaller, Karl Heinz; Angerer, Jürgen; Drexler, Hans

    2008-04-01

    Aniline (ANI) and the human carcinogen o-toluidine (OT) are released at the workplace during the production and processing of rubber. Recently, we showed in rubber industry workers that a frequent use of skin barrier creams (SBC) increased the internal exposure of ANI and OT. In the present study, diffusion cells were used to investigate the effects of two SBC and one skin care cream (SCC) on percutaneous penetration of neat ANI and OT as well as of OT from a mixture with a workplace specific lubricant. The experiments were carried out with untreated and with skin creams treated human skin. A considerable percutaneous penetration enhancement of test compounds was observed for treated skin compared with untreated skin; the highest enhancement (mean factors 6.2-12.3) was found for SBC (based on oil in water emulsion) treated skin. The lowest penetration enhancement showed SCC treated skin (mean factors 4.2-9.7). The in vitro data support our findings in workers that the percutaneous absorption of aromatic amines significantly increases in presence of skin creams. The efficacy of skin creams to protect the percutaneous penetration of aromatic amines is not confirmed by our own experiments.

  2. [Impact of wet work on epidermal barrier (tewl and stratum corneum hydration) and skin viscoelasticity in nurses].

    Science.gov (United States)

    Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata

    2014-01-01

    Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.

  3. The multitasking organ: recent insights into skin immune function.

    Science.gov (United States)

    Di Meglio, Paola; Perera, Gayathri K; Nestle, Frank O

    2011-12-23

    The skin provides the first line defense of the human body against injury and infection. By integrating recent findings in cutaneous immunology with fundamental concepts of skin biology, we portray the skin as a multitasking organ ensuring body homeostasis. Crosstalk between the skin and its microbial environment is also highlighted as influencing the response to injury, infection, and autoimmunity. The importance of the skin immune network is emphasized by the identification of several skin-resident cell subsets, each with its unique functions. Lessons learned from targeted therapy in inflammatory skin conditions, such as psoriasis, provide further insights into skin immune function. Finally, we look at the skin as an interacting network of immune signaling pathways exemplified by the development of a disease interactome for psoriasis. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Permeability Barrier and Microstructure of Skin Lipid Membrane Models of Impaired Glucosylceramide Processing

    OpenAIRE

    Sochorov?, Michaela; Sta?kov?, Kl?ra; Pullmannov?, Petra; Kov??ik, Andrej; Zbytovsk?, Jarmila; V?vrov?, Kate?ina

    2017-01-01

    Ceramide (Cer) release from glucosylceramides (GlcCer) is critical for the formation of the skin permeability barrier. Changes in ?-glucocerebrosidase (GlcCer?ase) activity lead to diminished Cer, GlcCer accumulation and structural defects in SC lipid lamellae; however, the molecular basis for this impairment is not clear. We investigated impaired GlcCer-to-Cer processing in human Cer membranes to determine the physicochemical properties responsible for the barrier defects. Minor impairment (...

  5. Controlling the hydration of the skin though the application of occluding barrier creams.

    Science.gov (United States)

    Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard

    2013-03-06

    The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.

  6. Skin Barrier Restoration and Moisturization Using Horse Oil-Loaded Dissolving Microneedle Patches.

    Science.gov (United States)

    Lee, Chisong; Eom, Younghyon Andrew; Yang, Huisuk; Jang, Mingyu; Jung, Sang Uk; Park, Ye Oak; Lee, Si Eun; Jung, Hyungil

    2018-01-01

    Horse oil (HO) has skin barrier restoration and skin-moisturizing effects. Although cream formulations have been used widely and safely, their limited penetration through the stratum corneum is a major obstacle to maximizing the cosmetic efficacy of HO. Therefore, we aimed to encapsulate HO in a cosmetic dissolving microneedle (DMN) for efficient transdermal delivery. To overcome these limitations of skin permeation, HO-loaded DMN (HO-DMN) patches were developed and evaluated for their efficacy and safety using in vitro and clinical studies. Despite the lipophilic nature of HO, the HO-DMN patches had a sharp shape and uniform array, with an average length and tip diameter of 388.36 ± 16.73 and 38.54 ± 5.29 µm, respectively. The mechanical strength of the HO-DMN patches was sufficient (fracture force of 0.29 ± 0.01 N), and they could successfully penetrate pig skin. During the 4-week clinical evaluation, HO-DMN patches caused significant improvements in skin and dermal density, skin elasticity, and moisturization. Additionally, a brief safety assessment showed that the HO-DMN patches induced negligible adverse events. The HO-DMNs are efficient, safe, and convenient for wide use in cosmetic applications for skin barrier restoration and moisturization. © 2018 S. Karger AG, Basel.

  7. Rheological and Functional Properties of Catfish Skin Protein Hydrolysates

    Science.gov (United States)

    Catfish skin is an abundant and underutilized resource that can be used as a unique protein source to make fish skin hydrolysates. The objectives of this study were to: isolating soluble and insoluble proteins from hydrolyzed catfish skin and study the chemical and functional properties of the prote...

  8. Biology and Function of Fetal and Pediatric Skin

    OpenAIRE

    Leung, Alice; Balaji, Swathi; Keswani, Sundeep G

    2013-01-01

    The development of the integumentary system is a series of events, which start in utero and continue throughout life. Although at birth, skin in full-term infants is anatomically mature, functional maturity develops during the first year of life. Pediatric skin transitions again with the onset of puberty. At each stage, there are changes in transepidermal water loss, skin hydration, and skin acidity that define the specific period of development.

  9. Effect of olive and sunflower seed oil on the adult skin barrier: implications for neonatal skin care.

    Science.gov (United States)

    Danby, Simon G; AlEnezi, Tareq; Sultan, Amani; Lavender, Tina; Chittock, John; Brown, Kirsty; Cork, Michael J

    2013-01-01

    Natural oils are advocated and used throughout the world as part of neonatal skin care, but there is an absence of evidence to support this practice. The goal of the current study was to ascertain the effect of olive oil and sunflower seed oil on the biophysical properties of the skin. Nineteen adult volunteers with and without a history of atopic dermatitis were recruited into two randomized forearm-controlled mechanistic studies. The first cohort applied six drops of olive oil to one forearm twice daily for 5 weeks. The second cohort applied six drops of olive oil to one forearm and six drops of sunflower seed oil to the other twice daily for 4 weeks. The effect of the treatments was evaluated by determining stratum corneum integrity and cohesion, intercorneocyte cohesion, moisturization, skin-surface pH, and erythema. Topical application of olive oil for 4 weeks caused a significant reduction in stratum corneum integrity and induced mild erythema in volunteers with and without a history of atopic dermatitis. Sunflower seed oil preserved stratum corneum integrity, did not cause erythema, and improved hydration in the same volunteers. In contrast to sunflower seed oil, topical treatment with olive oil significantly damages the skin barrier, and therefore has the potential to promote the development of, and exacerbate existing, atopic dermatitis. The use of olive oil for the treatment of dry skin and infant massage should therefore be discouraged. These findings challenge the unfounded belief that all natural oils are beneficial for the skin and highlight the need for further research. © 2012 Wiley Periodicals, Inc.

  10. Increased skin barrier disruption by sodium lauryl sulfate in mice expressing a constitutively active STAT6 in T cells.

    Science.gov (United States)

    DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B

    2012-01-01

    Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.

  11. Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2017-12-01

    Full Text Available Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter. Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

  12. Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils.

    Science.gov (United States)

    Lin, Tzu-Kai; Zhong, Lily; Santiago, Juan Luis

    2017-12-27

    Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter). Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

  13. Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2015-06-01

    Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

  14. The effects of using a moldable skin barrier on peristomal skin condition in persons with an ostomy: results of a prospective, observational, multinational study.

    Science.gov (United States)

    Szewczyk, Maria Teresa; Majewska, Grazyna; Cabral, Mary V; Hölzel-Piontek, Karin

    2014-12-01

    Peristomal skin problems are the most commonly experienced physical complication following ostomy surgery and often are caused by leakage or a poorly fitting skin barrier. A prospective, multicenter, observational evaluation of persons with a colostomy, ileostomy, or urostomy was conducted to assess the incidence of peristomal lesions and level of patient satisfaction with moldable skin barriers. Peristomal skin was assessed using the Studio Alterazoni Cutanee Stomale (SACS™) scale, and patients were asked to rate barrier application and usage variables. During a period of 12 months, and using convenience sampling, 561 patients from 90 centers in 3 countries were enrolled: 28 in Germany, 48 in Poland, and 14 in the United States. Participants included 277 new stoma patients (average time since surgery 0.3 months; average age 64.7 ± 12.86 years) who had a colostomy (174), ileostomy (72), or urostomy (10); and 284 patients with an existing stoma (average time since surgery 18.2 months; average age 66 ± 12.62 years) who had a colostomy (174), ileostomy (88), or urostomy (22) who experienced skin complications using a traditional skin barrier (ie, a solid or flexible barrier with precut opening or one requiring cutting an opening to accommodate the stoma). All patients were assessed at baseline and after 1 and 2 months. In the patients with a new stoma, 225 (90.4%) had intact skin at baseline, 239 (95.6%) had intact skin after 2 months, and 98% rated overall satisfaction with the barrier as good or excellent. In the patients with an existing stoma, intact skin was observed in 103 patients (39.5%) at baseline and 225 (86.2%) after 2 months, with 96.5% of patients rating overall satisfaction with the barrier as good or excellent. In this group, the proportion of patients who used accessory products (eg, belt, deodorants, powder) was 73% at baseline and 64.2% at the 2-month follow-up. The moldable skin barriers evaluated were effective in preventing and healing

  15. [Improvement of rosacea treatment based on the morphological and functional features of the skin].

    Science.gov (United States)

    Tsiskarishvili, N V; Katsitadze, A G; Tsiskarishvili, Ts I

    2013-10-01

    Rosacea - a widespread disease sometimes aleak with severe complications, mainly affecting the skin. Irrational and inadequate treatment leads to chronicity of diseases and psychosocial disadaptation of patients. Lately, a clear upward trend in the number of patients in whom in the process of complex treatment manifestations (with the varying degrees of severity) of impaired barrier function of the skin are observed and they need the protection and restoration of the damaged stratum corneum. In patients with rosacea in order to study the function of the facial skin's horny layer we used the skin analyzer BIA (bioimpedance analysis, which in duration of 6 seconds determines the moisture content, oiliness and the softness of the skin) and significant deviations from the norm (decrease in moisture content, fatness and increased roughness) was revealed. These changes were most clearly pronounced in patients with steroid rosacea. To restore the skin barrier the drug "Episofit A" (Laboratory of Evolutionary Dermatology, France) has been used (1-2 times a day for 6 weeks). Evaluation of treatment efficacy was conducted every 2 weeks by means of a scale from 0 to 5 for parameters of dryness, erythema, peeling and expression of subjective feelings. In accordance with received results, using of Episofit A emulsion, especially on the baсkground of long-term treatment with topical steroids, had a pronounced therapeutic effect. Thus, treatment of patients with consideration of morphological and functional features of facial skin, helps to improve the results traditional therapy, and the drug is highly effective means of the new direction in skin care - corneotherapy aimed to reconstruct and protect damaged stratum corneum.

  16. The role of social closeness during tape stripping to facilitate skin barrier recovery: Preliminary findings.

    Science.gov (United States)

    Robinson, Hayley; Ravikulan, Abhimati; Nater, Urs M; Skoluda, Nadine; Jarrett, Paul; Broadbent, Elizabeth

    2017-07-01

    Social support is known to reduce the negative effects of stress on health, but there is mixed evidence for the effects of social support on wound healing. This study aimed to investigate whether undergoing a task designed to promote social closeness with a fellow participant and being paired with that person during a tape-stripping procedure could reduce stress and improve skin barrier recovery compared to going through tape stripping alone. Seventy-two healthy adults were randomized to either a social closeness condition where participants completed a relationship-building task and tape stripping in pairs or a control condition where they completed tape stripping alone. Skin barrier recovery was measured using transepidermal water loss. Salivary cortisol and alpha-amylase were collected at four time points as markers of the endocrine and autonomic stress response. Social closeness had a beneficial effect on skin barrier recovery compared to the control condition, t(54) = 2.86, p = .006, r = .36. Social closeness significantly reduced self-reported stress. The effects of the intervention on skin barrier recovery were moderated by self-reported stress reduction (p = .035). There were no significant differences in cortisol between groups, but alpha-amylase increased significantly more from baseline to after tape stripping in the control group compared to the intervention group. This is the first study to show that social closeness with a person going through a similar unfamiliar procedure can positively influence wound healing. Future research needs to replicate these findings in other wound types and in clinical settings. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  17. Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.

    Directory of Open Access Journals (Sweden)

    Reiko J Tanaka

    Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier

  18. The integumentary system: anatomy, physiology and function of skin.

    Science.gov (United States)

    McLafferty, Ella; Hendry, Charles; Alistair, Farley

    This article, which forms part of the life sciences series, examines the anatomy and physiology of skin, also termed the integumentary system. Skin is composed of two main layers, the epidermis and dermis. The structure of the epidermis and dermis are described and their functions are discussed. Accessory structures, such as nails and hair are also considered. Although many diseases of the skin exist, two common conditions--psoriasis and decubitus ulcers--are described in this article.

  19. Hydration effects on the barrier function of stratum corneum lipids: Raman analysis of ceramides 2, III and 5.

    Science.gov (United States)

    Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette

    2013-11-07

    The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.

  20. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  1. Crossing safety barriers: influence of children's morphological and functional variables.

    Science.gov (United States)

    Cordovil, Rita; Vieira, Filomena; Barreiros, João

    2012-05-01

    Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  2. Dermal toxicity elicited by phthalates: evaluation of skin absorption, immunohistology, and functional proteomics.

    Science.gov (United States)

    Pan, Tai-Long; Wang, Pei-Wen; Aljuffali, Ibrahim A; Hung, Yi-Yun; Lin, Chwan-Fwu; Fang, Jia-You

    2014-03-01

    The toxicity of phthalates is an important concern in the fields of environmental health and toxicology. Dermal exposure via skin care products, soil, and dust is a main route for phthalate delivery. We had explored the effect of topically-applied phthalates on skin absorption and toxicity. Immunohistology, functional proteomics, and Western blotting were employed as methodologies for validating phthalate toxicity. Among 5 phthalates tested, di(2-ethylhexyl)phthalate (DEHP) showed the highest skin reservoir. Only diethyl phthalate (DEP) and dibutyl phthalate (DBP) could penetrate across skin. Strat-M(®) membrane could be used as permeation barrier for predicting phthalate penetration through skin. The accumulation of DEHP in hair follicles was ∼15nmol/cm(2), which was significantly greater than DBP and DEP. DBP induced apoptosis of keratinocytes and fibroblasts via caspase-3 activation. This result was confirmed by downregulation of 14-3-3 and immunohistology of TUNEL. On the other hand, the HSP60 overexpression and immunostaining of COX-2 suggested inflammatory response induced by DEP and DEHP. The proteomic profiling verified the role of calcium homeostasis on skin inflammation. Some proteins investigated in this study can be sensitive biomarkers for dermal toxicity of phthalates. These included HSPs, 14-3-3, and cytokeratin. This work provided novel platforms for examining phthalate toxicity on skin. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Nanocrystal: a novel approach to overcome skin barriers for improved topical drug delivery.

    Science.gov (United States)

    Patel, Viral; Sharma, Om Prakash; Mehta, Tejal

    2018-04-01

    Skin is an important route of drug delivery for the treatment of various dermatological conditions. The advent of nanotechnology is paving the roadmaps for topical drug delivery by providing sustained release as well as maintaining a localized effect, outweighing the toxicity concern. Area covered: This review highlighted the morphology of skin, its barrier nature as well as drug penetration pathways after topical application of formulations. The existing methods to improve topical drug delivery, by infringing or permeating the skin barriers, are discussed. This context concretes the foundation to accentuate the need for the development of nanocrystal-based topical formulation. The mechanism of drug release, immediate as well as sustained release, after topical administration of drug nanocrystals is also elaborated. The special emphasis is given on the breakthrough achieved, in topical drug delivery using drug nanocrystals, so far in the plethora of literature, patents, and products, under clinical trial as well as in the market. Expert opinion: The current research on nanocrystals for topical drug delivery is highlighting the breakthroughs achieved so far. The output of these research envisages that topical nanocrystals based formulations can be a novel strategy for the drugs which are facing solubility, bioavailability and toxicity concerns.

  4. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  5. Examination of the skin barrier repair/wound healing process using a living skin equivalent model and matrix-assisted laser desorption-ionization-mass spectrometry imaging.

    Science.gov (United States)

    Lewis, E E L; Barrett, M R T; Freeman-Parry, L; Bojar, R A; Clench, M R

    2018-04-01

    Examination of the skin barrier repair/wound healing process using a living skin equivalent (LSE) model and matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI) to identify lipids directly involved as potential biomarkers. These biomarkers may be used to determine whether an in vivo wound is going to heal for example if infected. An in vitro LSE model was wounded with a scalpel blade and assessed at day 4 post-wounding by histology and MALDI-MSI. Samples were sectioned at wound site and were either formalin-fixed paraffin-embedded (FFPE) for histology or snapped frozen (FF) for MSI analysis. The combination of using an in vitro wounded skin model with MSI allowed the identification of lipids involved in the skin barrier repair/wound healing process. The technique was able to highlight lipids directly in the wound site and distinguish differences in lipid distribution between the epidermis and wound site. This novel method of coupling an in vitro LSE with MSI allowed in-depth molecular analysis of the skin barrier repair/wound healing process. The technique allowed the identification of lipids directly involved in the skin barrier repair/wound healing process, indicating these biomarkers may be potentially be used within the clinic. These biomarkers will help to determine, which stage of the skin barrier repair/wound healing process the wound is in to provide the best treatment. © 2018 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  6. Effects of UVA (320-400 nm) on the barrier characteristics of the skin

    International Nuclear Information System (INIS)

    McAuliffe, D.J.; Blank, I.H.

    1991-01-01

    The stratum corneum serves as the major barrier to the entrance of most molecules into the skin. In the studies presented here, the effects of UVA radiation (320-400 nm) on the barrier capacity of human stratum corneum were examined. Penetration of a homologous series of primary alcohols through unirradiated (control) and UVA-irradiated (test) human epidermis was determined in vitro. Permeability constants, kp, were calculated. Mean ratios of permeability constants for UVA-irradiated and unirradiated epidermis (mean kp test)/(mean kp control) ranged from 2.3 to 3.0 for methanol and from 2.2 to 2.5 for ethanol. These mean ratios were determined using different pieces of epidermis from the same piece of skin for test and control samples. When kp control and kp test were determined on the same piece of epidermis on successive days, the ratios (kp test/kp control) were similar to the mean ratios determined on different pieces of epidermis. For other primary alcohols, propanol, butanol, hexanol, and heptanol, UVA radiation did not alter their permeability constants significantly. Partition coefficients, Km, were determined for ethanol and heptanol using UVA-irradiated and unirradiated stratum corneum. For ethanol, irradiation resulted in a 1.5 to 2.6 times increase in Km. For heptanol, irradiation caused no change in Km. These results demonstrate that the barrier capacity of stratum corneum for small, polar, primary alcohols is diminished (permeability increases) and for higher molecular weight less polar alcohols, is unaffected by small doses of UVA radiation. This increased permeability of small polar alcohols through human skin may be due to enhanced partitioning into UVA-irradiated stratum corneum, which was not apparent for a higher molecular weight less polar alcohol

  7. Biomimetic shark skin: design, fabrication and hydrodynamic function.

    Science.gov (United States)

    Wen, Li; Weaver, James C; Lauder, George V

    2014-05-15

    Although the functional properties of shark skin have been of considerable interest to both biologists and engineers because of the complex hydrodynamic effects of surface roughness, no study to date has successfully fabricated a flexible biomimetic shark skin that allows detailed study of hydrodynamic function. We present the first study of the design, fabrication and hydrodynamic testing of a synthetic, flexible, shark skin membrane. A three-dimensional (3D) model of shark skin denticles was constructed using micro-CT imaging of the skin of the shortfin mako (Isurus oxyrinchus). Using 3D printing, thousands of rigid synthetic shark denticles were placed on flexible membranes in a controlled, linear-arrayed pattern. This flexible 3D printed shark skin model was then tested in water using a robotic flapping device that allowed us to either hold the models in a stationary position or move them dynamically at their self-propelled swimming speed. Compared with a smooth control model without denticles, the 3D printed shark skin showed increased swimming speed with reduced energy consumption under certain motion programs. For example, at a heave frequency of 1.5 Hz and an amplitude of ± 1 cm, swimming speed increased by 6.6% and the energy cost-of-transport was reduced by 5.9%. In addition, a leading-edge vortex with greater vorticity than the smooth control was generated by the 3D printed shark skin, which may explain the increased swimming speeds. The ability to fabricate synthetic biomimetic shark skin opens up a wide array of possible manipulations of surface roughness parameters, and the ability to examine the hydrodynamic consequences of diverse skin denticle shapes present in different shark species. © 2014. Published by The Company of Biologists Ltd.

  8. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  9. Human skin is protected by four functionally and phenotypically discrete populations of resident and recirculating memory T cells

    NARCIS (Netherlands)

    Watanabe, Rei; Gehad, Ahmed; Yang, Chao; Scott, Laura L.; Teague, Jessica E.; Schlapbach, Christoph; Elco, Christopher P.; Huang, Victor; Matos, Tiago R.; Kupper, Thomas S.; Clark, Rachael A.

    2015-01-01

    The skin of an adult human contains about 20 billion memory T cells. Epithelial barrier tissues are infiltrated by a combination of resident and recirculating T cells in mice, but the relative proportions and functional activities of resident versus recirculating T cells have not been evaluated in

  10. Emu oil-based lotion effects on neonatal skin barrier during transition from intrauterine to extrauterine life

    Directory of Open Access Journals (Sweden)

    Zanardo V

    2017-08-01

    Full Text Available Vincenzo Zanardo,1 David Giarrizzo,2 Francesca Volpe,1 Lara Giliberti,1 Gianluca Straface1 1Division of Perinatal Medicine, Policlinico Abano Terme, Abano Terme, 2CALANTHA Physiology of Lactation Laboratory, Padua, Italy Abstract: Both appropriate hydration and skin surface pH are fundamental in preventing baby skin barrier damage during transition from intrauterine to extrauterine life. However, effects of topical moisturizers on neonatal stratum corneum temperature, pH, hydration, and elasticity have not been scientifically evaluated in vivo. We checked 31 full-term breastfeeding neonates by non-invasive bioengineering method, which is able to evaluate the basal skin barrier (left heel, and assessed at 6±1 hours after birth, and at 1 and 24 hours after emu oil-based topical treatment. The basal skin barrier of right heel (no oil exposure of each newborn was considered as control. We found that a single application of an emu oil-based lotion was effective in improving heel stratum corneum hydration, which increases both skin pH and elasticity without any effect on temperature. Further studies are needed to confirm long-term beneficial effects of this treatment in a very sensitive patient population. Keywords: skin barrier, neonate, emu oil-based lotion, topical treatment

  11. A plant oil-containing pH 4 emulsion improves epidermal barrier structure and enhances ceramide levels in aged skin.

    Science.gov (United States)

    Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P

    2017-06-01

    Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  12. Functional and physiological characteristics of the aging skin.

    Science.gov (United States)

    Farage, Miranda A; Miller, Kenneth W; Elsner, Peter; Maibach, Howard I

    2008-06-01

    As life expectancy in the U.S. increases - and with it the proportion of the aged in the population - appropriate care of elderly skin becomes a medical concern of increasing importance. As skin ages, the intrinsic structural changes that are a natural consequence of passing time are inevitably followed by subsequent physiological changes that affect the skin's ability to function as the interface between internal and external environments. The pH of the skin surface increases with age, increasing its susceptibility to infection. Neurosensory perception of superficial pain is diminished both in intensity and speed of perception (increasing the risk of thermal injury); deep tissue pain, however, may be enhanced. A decline in lipid content as the skin ages inhibits the permeability of nonlipophilic compounds, reducing the efficacy of some topical medications. Allergic and irritant reactions are blunted, as is the inflammatory response, compromising the ability of the aged skin to affect wound repair. These functional impairments (although a predictable consequence of intrinsic structural changes) have the potential to cause significant morbidity in the elderly patient and may, as well, be greatly exacerbated by extrinsic factors like photodamage. As numbers of the elderly increase, medical as well as cosmetic dermatological interventions will be necessary to optimize the quality of life for this segment of the population.

  13. Skin-associated lymphoid tissues (SALT): origins and functions

    International Nuclear Information System (INIS)

    Streilein, J.W.

    1983-01-01

    The skin has an unusual set of immunologic requirements. It is confronted by a specialized set of pathogenic organisms and environmental chemicals that represent a distinctive spectrum of antigenic specificities. Skin is subjected to physicochemical stresses such as irradiation with ultraviolet light that alter dramatically its immunologic properties. It is proposed that nature has provided skin with a unique collection of lymphoid cells, reticular cells, and organized lymphoid organs to deal with these special demands. Evidence in favor of the existence of skin-associated lymphoid tissues (SALT) includes (1) the cutaneous microenvironment is capable on its own of accepting, processing, and presenting nominal antigen; (2) strategically located peripheral lymph nodes are able to accept immunogenic signals derived from skin; (3) subsets of T lymphocytes display differential affinity for skin and its associated peripheral nodes; and (4) acquisition of this affinity by T cells is determined at least in part by differentiation signals received in situ from resident cutaneous cells. Responsibility for the establishment and integration of SALT rests with keratinocytes, Langerhans cells, and immunocompetent lymphocytes, each of which contributes uniquely to the synthesis. Together they provide skin with immune surveillance that effectively prejudices against the development of cutaneous neoplasms and persistent infection with intracellular pathogens. In patients who have been under long-term immunosuppressive therapy, the large majority of nonlymphoid malignancies arise within the skin, rather than other types of tissues. These data suggest that immune surveillance, once thought to be an immune defense operative in all somatic tissues, is a specialized immune function dedicated to the skin and mediated by SALT

  14. The intestinal barrier function and its involvement in digestive disease

    Directory of Open Access Journals (Sweden)

    Eloísa Salvo-Romero

    2015-11-01

    Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

  15. [Basic therapeutics : What are the features of modern personal care products to protect and regenerate the skin barrier?

    Science.gov (United States)

    Daniels, R

    2017-11-01

    It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.

  16. Evaluation of Barrier Skin Cream Effectiveness Against JP-8 Jet Fuel Absorption and Irritation

    Science.gov (United States)

    2009-04-01

    quantify the colorimeter measurements. This system uses spectral chromaticity coordinates and corresponding color- matching functions based on...in the caudal thigh or lumbar muscles and the rabbit was monitored throughout the procedure. Once anesthetized, a baseline visual and colorimeter ...Visual Scoring Technique All barrier creams were scored in 3 ways; by visual scoring described in the Draize method, by colorimeter , and by

  17. Loss of Corneodesmosin Leads to Severe Skin Barrier Defect, Pruritus, and Atopy: Unraveling the Peeling Skin Disease

    OpenAIRE

    Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

    2010-01-01

    Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disea...

  18. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  19. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  20. Establishment and function of tissue-resident innate lymphoid cells in the skin

    Directory of Open Access Journals (Sweden)

    Jie Yang

    2017-03-01

    Full Text Available ABSTRACT Innate lymphoid cells (ILCs are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.

  1. Establishment and function of tissue-resident innate lymphoid cells in the skin.

    Science.gov (United States)

    Yang, Jie; Zhao, Luming; Xu, Ming; Xiong, Na

    2017-07-01

    Innate lymphoid cells (ILCs) are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.

  2. Oral administration of Bifidobacterium breve attenuates UV-induced barrier perturbation and oxidative stress in hairless mice skin.

    Science.gov (United States)

    Ishii, Yuki; Sugimoto, Saho; Izawa, Naoki; Sone, Toshiro; Chiba, Katsuyoshi; Miyazaki, Kouji

    2014-07-01

    Recent studies have shown that some probiotics affect not only the gut but also the skin. However, the effects of probiotics on ultraviolet (UV)-induced skin damage are poorly understood. In this study, we aim to examine whether oral administration of live Bifidobacterium breve strain Yakult (BBY), a typical probiotic, can attenuate skin barrier perturbation caused by UV and reactive oxygen species (ROS) in hairless mice. The mice were orally supplemented with a vehicle only or BBY once a day for nine successive days. Mouse dorsal skin was irradiated with UV from days 6 to 9. The day after the final irradiation, the transepidermal water loss (TEWL), stratum corneum hydration, and oxidation-related factors of the skin were evaluated. We elucidated that BBY prevented the UV-induced increase in TEWL and decrease in stratum corneum hydration. In addition, BBY significantly suppressed the UV-induced increase in hydrogen peroxide levels, oxidation of proteins and lipids, and xanthine oxidase activity in the skin. Conversely, antioxidant capacity did not change regardless of whether BBY was administered or not. In parameters we evaluated, there was a positive correlation between the increase in TEWL and the oxidation levels of proteins and lipids. Our results suggest that oral administration of BBY attenuates UV-induced barrier perturbation and oxidative stress of the skin, and this antioxidative effect is not attributed to enhancement of antioxidant capacity but to the prevention of ROS generation.

  3. The Tritiated Water Skin Barrier Integrity Test: Considerations for Acceptance Criteria with and Without 14C-Octanol.

    Science.gov (United States)

    Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J

    2017-01-01

    A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.

  4. Stabilization with guaranteed safety using Control Lyapunov–Barrier Function

    NARCIS (Netherlands)

    Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu

    2016-01-01

    We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control

  5. The skin microbiota: composition and function in health and disease

    DEFF Research Database (Denmark)

    Brüggemann, Holger

    2016-01-01

    protective function or its immunomodulatory properties. The skin microbiota of the face and upper back is dominated by species of the genera Staphylococcus and Propionibacterium. In particular, the species Propionibacterium acnes (P. acnes) predominately colonizes sebaceous areas. This species has several...... conflicting properties, some of which are mutualistic with potential beneficial effects for skin health while others are potentially harmful for the host, such as P. acnes’ pro-inflammatory activity. Analysis of the population structure of P. acnes highlighted its multiphyletic composition; together...... with comparative genomics data that revealed phylotype-specific differences, the hypothesis arose that certain lineages of P. acnes are health-beneficial while others are drivers of disease. This talk will introduce properties and host-interacting activities of P. acnes and other skin microbes. The talk...

  6. Anomalous Skin Effect for Anisotropic Electron Velocity Distribution Function

    International Nuclear Information System (INIS)

    Igor Kaganovich; Edward Startsev; Gennady Shvets

    2004-01-01

    The anomalous skin effect in a plasma with a highly anisotropic electron velocity distribution function (EVDF) is very different from skin effect in a plasma with the isotropic EVDF. An analytical solution was derived for the electric field penetrated into plasma with the EVDF described as a Maxwellian with two temperatures Tx >> Tz, where x is the direction along the plasma boundary and z is the direction perpendicular to the plasma boundary. The skin layer was found to consist of two distinctive regions of width of order nTx/w and nTz/w, where nTx,z/w = (Tx,z/m)1/2 is the thermal electron velocity and w is the incident wave frequency

  7. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

    Science.gov (United States)

    Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

    2018-02-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Tumor Suppressor Function of CYLD in Nonmelanoma Skin Cancer

    Directory of Open Access Journals (Sweden)

    K. C. Masoumi

    2011-01-01

    Full Text Available Ubiquitin and ubiquitin-related proteins posttranslationally modify substrates, and thereby alter the functions of their targets. The ubiquitination process is involved in various physiological responses, and dysregulation of components of the ubiquitin system has been linked to many diseases including skin cancer. The ubiquitin pathways activated among skin cancers are highly diverse and may reflect the various characteristics of the cancer type. Basal cell carcinoma and squamous cell carcinoma, the most common types of human skin cancer, are instances where the involvement of the deubiquitination enzyme CYLD has been recently highlighted. In basal cell carcinoma, the tumor suppressor protein CYLD is repressed at the transcriptional levels through hedgehog signaling pathway. Downregulation of CYLD in basal cell carcinoma was also shown to interfere with TrkC expression and signaling, thereby promoting cancer progression. By contrast, the level of CYLD is unchanged in squamous cell carcinoma, instead, catalytic inactivation of CYLD in the skin has been linked to the development of squamous cell carcinoma. This paper will focus on the current knowledge that links CYLD to nonmelanoma skin cancers and will explore recent insights regarding CYLD regulation of NF-κB and hedgehog signaling during the development and progression of these types of human tumors.

  9. Tumor Suppressor Function of CYLD in Non melanoma Skin Cancer

    International Nuclear Information System (INIS)

    Masoumi, K. C.; Hallgren, G. S.; Massoumi, R.

    2011-01-01

    Ubiquitin and ubiquitin-related proteins post translationally modify substrates, and thereby alter the functions of their targets. The ubiquitination process is involved in various physiological responses, and dysregulation of components of the ubiquitin system has been linked to many diseases including skin cancer. The ubiquitin pathways activated among skin cancers are highly diverse and may reflect the various characteristics of the cancer type. Basal cell carcinoma and squamous cell carcinoma, the most common types of human skin cancer, are instances where the involvement of the deubiquitination enzyme CYLD has been recently highlighted. In basal cell carcinoma, the tumor suppressor protein CYLD is repressed at the transcriptional levels through hedgehog signaling pathway. Downregulation of CYLD in basal cell carcinoma was also shown to interfere with TrkC expression and signaling, thereby promoting cancer progression. By contrast, the level of CYLD is unchanged in squamous cell carcinoma, instead, catalytic inactivation of CYLD in the skin has been linked to the development of squamous cell carcinoma. This paper will focus on the current knowledge that links CYLD to non melanoma skin cancers and will explore recent insights regarding CYLD regulation of NF-κB and hedgehog signaling during the development and progression of these types of human tumors.

  10. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  11. The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.

    Science.gov (United States)

    Del Rosso, James Q; Kircik, Leon H

    2013-07-01

    Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

  12. Helminth Infection and Commensal Microbiota Drive Early IL-10 Production in the Skin by CD4+ T Cells That Are Functionally Suppressive.

    Directory of Open Access Journals (Sweden)

    David E Sanin

    2015-05-01

    Full Text Available The skin provides an important first line of defence and immunological barrier to invasive pathogens, but immune responses must also be regulated to maintain barrier function and ensure tolerance of skin surface commensal organisms. In schistosomiasis-endemic regions, populations can experience repeated percutaneous exposure to schistosome larvae, however little is known about how repeated exposure to pathogens affects immune regulation in the skin. Here, using a murine model of repeated infection with Schistosoma mansoni larvae, we show that the skin infection site becomes rich in regulatory IL-10, whilst in its absence, inflammation, neutrophil recruitment, and local lymphocyte proliferation is increased. Whilst CD4+ T cells are the primary cellular source of regulatory IL-10, they expressed none of the markers conventionally associated with T regulatory (Treg cells (i.e. FoxP3, Helios, Nrp1, CD223, or CD49b. Nevertheless, these IL-10+ CD4+ T cells in the skin from repeatedly infected mice are functionally suppressive as they reduced proliferation of responsive CD4+ T cells from the skin draining lymph node. Moreover, the skin of infected Rag-/- mice had impaired IL-10 production and increased neutrophil recruitment. Finally, we show that the mechanism behind IL-10 production by CD4+ T cells in the skin is due to a combination of an initial (day 1 response specific to skin commensal bacteria, and then over the following days schistosome-specific CD4+ T cell responses, which together contribute towards limiting inflammation and tissue damage following schistosome infection. We propose CD4+ T cells in the skin that do not express markers of conventional T regulatory cell populations have a significant role in immune regulation after repeated pathogen exposure and speculate that these cells may also help to maintain skin barrier function in the context of repeated percutaneous insult by other skin pathogens.

  13. Oily skin: an overview.

    Science.gov (United States)

    Sakuma, Thais H; Maibach, Howard I

    2012-01-01

    Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

  14. The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier.

    Science.gov (United States)

    Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

    2017-01-01

    The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier.

  15. The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier*

    Science.gov (United States)

    Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

    2017-01-01

    The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier. PMID:29166523

  16. Dietary Cerebroside from Sea Cucumber (Stichopus japonicus): Absorption and Effects on Skin Barrier and Cecal Short-Chain Fatty Acids.

    Science.gov (United States)

    Duan, Jingjing; Ishida, Marina; Aida, Kazuhiko; Tsuduki, Tsuyoshi; Zhang, Jin; Manabe, Yuki; Hirata, Takashi; Sugawara, Tatsuya

    2016-09-21

    Sphingolipids from marine sources have attracted more attention recently because of their distinctive structures and expected functions. In this study, the content and components of cerebroside from sea cucumber Stichopus japonicus were analyzed. The absorption of cerebroside from S. japonicus was investigated with an in vivo lipid absorption assay. The result revealed that S. japonicus is a rich source of cerebroside that contained considerable amounts of odd carbon chain sphingoid bases. The cumulative recoveries of d17:1- and d19:2-containing cerebrosides were 0.31 ± 0.16 and 0.32 ± 0.10%, respectively, for 24 h after administration. To the best of the authors' knowledge, this is the first work that shows sphingolipids from a marine source could be absorbed in vivo and incorporated into ceramides. In addition, dietary supplementation with sea cucumber cerebroside to hairless mouse improved the skin barrier function and increased short-chain fatty acids in cecal contents, which have shown beneficial effects on the host.

  17. Lipid functions in skin: Differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model.

    Science.gov (United States)

    Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna

    2017-09-01

    Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in

  18. The skin function: a factor of anti-metabolic syndrome

    Directory of Open Access Journals (Sweden)

    Zhou Shi-Sheng

    2012-04-01

    Full Text Available Abstract The body’s total antioxidant capacity represents a sum of the antioxidant capacity of various tissues/organs. A decrease in the body’s antioxidant capacity may induce oxidative stress and subsequent metabolic syndrome, a clustering of risk factors for type 2 diabetes and cardiovascular disease. The skin, the largest organ of the body, is one of the major components of the body’s total antioxidant defense system, primarily through its xenobiotic/drug biotransformation system, reactive oxygen species-scavenging system, and sweat glands- and sebaceous glands-mediated excretion system. Notably, unlike other contributors, the skin contribution is variable, depending on lifestyles and ambient temperature or seasonal variations. Emerging evidence suggests that decreased skin’s antioxidant and excretory functions (e.g., due to sedentary lifestyles and low ambient temperature may increase the risk for metabolic syndrome. This review focuses on the relationship between the variability of skin-mediated detoxification and elimination of exogenous and endogenous toxic substances and the development of metabolic syndrome. The potential role of sebum secretion in lipid and cholesterol homeostasis and its impact on metabolic syndrome, and the association between skin disorders (acanthosis nigricans, acne, and burn and metabolic syndrome are also discussed.

  19. Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

    Science.gov (United States)

    Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

    2018-04-26

    Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

  20. Barrier functions for Pucci-Heisenberg operators and applications

    OpenAIRE

    Cutri , Alessandra; Tchou , Nicoletta

    2007-01-01

    International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...

  1. Human skin is protected by four functionally and phenotypically discrete populations of resident and recirculating memory T cells

    Science.gov (United States)

    Watanabe, Rei; Gehad, Ahmed; Yang, Chao; Campbell, Laura; Teague, Jessica E.; Schlapbach, Christoph; Elco, Christopher; Huang, Victor; Matos, Tiago R.; Kupper, Thomas S.; Clark, Rachael A.

    2015-01-01

    The skin of an adult human contains approximately 20 billion memory T cells. Epithelial barrier tissues are infiltrated by a combination of resident and recirculating T cells in mice but the relative proportions and functional activities of resident versus recirculating T cells have not been evaluated in human skin. We discriminated resident from recirculating T cells in human engrafted mice and lymphoma patients using alemtuzumab, a medication that depletes recirculating T cells from skin, and then analyzed these T cell populations in healthy human skin. All non-recirculating resident memory T cells (TRM) expressed CD69, but the majority were CD4+, CD103− and located in the dermis, in contrast to studies in mice. Both CD4+ and CD8+ CD103+ TRM were enriched in the epidermis, had potent effector functions and had a limited proliferative capacity compared to CD103− TRM. TRM of both types had more potent effector functions than recirculating T cells. Induction of CD103 on human T cells was enhanced by keratinocyte contact, depended on TGFβ and was independent of T cell keratinocyte adhesive interactions. We observed two distinct populations of recirculating T cells, CCR7+/L-selectin+ central memory T cells (TCM) and CCR7+/L-selectin− T cells, which we term migratory memory T cells (TMM). Circulating skin-tropic TMM were intermediate in cytokine production between TCM and effector memory T cells. In patients with cutaneous T cell lymphoma, malignant TCM and TMM induced distinct inflammatory skin lesions and TMM were depleted more slowly from skin after alemtuzumab, suggesting TMM may recirculate more slowly. In summary, human skin is protected by four functionally distinct populations of T cells, two resident and two recirculating, with differing territories of migration and distinct functional activities. PMID:25787765

  2. Safety barriers and safety functions a comparison of different applications

    International Nuclear Information System (INIS)

    Harms-Ringdahl, L.

    1998-01-01

    A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)

  3. Functional analyses of the skin surface of the areola mammae: comparison between healthy adult male and female subjects and between healthy individuals and patients with atopic dermatitis.

    Science.gov (United States)

    Kikuchi, K; Tagami, H; Akaraphanth, R; Aiba, S

    2011-01-01

    Although the nipple and areola of the breast constitute a unique and prominent area on the chest, so far no study has been done on the functional properties of their skin surfaces. To study the stratum corneum (SC) covering the areola using noninvasive methods. Eighteen adult healthy subjects comprising nine men and nine women and 18 age- and sex-matched patients with atopic dermatitis (AD), none of whom had visible skin lesions, participated in the study. Transepidermal water loss (TEWL), skin surface hydration and skin surface lipid levels were measured on the areola and adjacent breast skin. The size of the skin surface corneocytes of these skin regions was assessed. All the healthy subjects showed significantly higher TEWL accompanied by smaller sized corneocytes on the areola than on the adjacent breast skin. Only female subjects revealed a significantly higher skin surface hydration state together with significantly increased skin surface lipid levels on the areola than on the adjacent breast skin. These sex differences were observed even in patients with AD. Comparison between healthy individuals and the patients with AD demonstrated higher TEWL, decreased skin surface hydration state and lower skin surface lipid levels associated with smaller sized corneocytes in the areola in the patients with AD, especially in male patients. In adults, the SC barrier function and SC water-binding capacity of the areola were functionally poorer than in the adjacent skin, being covered by smaller sized corneocytes and lower amounts of skin surface lipids, especially in men and in patients with AD. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.

  4. Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    ) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months...

  5. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

    DEFF Research Database (Denmark)

    Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

    2006-01-01

    most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

  6. Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

    Directory of Open Access Journals (Sweden)

    Johan Agren

    2010-01-01

    Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

  7. Skin barrier disruption by sodium lauryl sulfate-exposure alters the expressions of involucrin, transglutaminase 1, profilaggrin, and kallikreins during the repair phase in human skin in vivo.

    Science.gov (United States)

    Törmä, Hans; Lindberg, Magnus; Berne, Berit

    2008-05-01

    Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.

  8. Permeability of skin and oral mucosa to water and horseradish peroxidase as related to the thickness of the permeability barrier

    International Nuclear Information System (INIS)

    Squier, C.A.; Hall, B.K.

    1985-01-01

    The permeability of porcine skin and keratinized and nonkeratinized oral mucosa to tritium-labeled water and horseradish peroxidase (HRPO) was determined using perfusion chambers. Small blocks from each tissue were also incubated with HRPO and the extent of penetration visualized microscopically; this enabled measurements to be made of the thickness of the permeability barrier to this water-soluble tracer. Results obtained after inverting the oral mucosa in the chambers or adding metabolic inhibitors indicated that both compounds diffuse across the tissue. The permeability constants derived directly in the study showed that skin was less permeable than oral mucosa and that the floor of the mouth was significantly more permeable than all other regions. When these constants were normalized in terms of a standard permeability barrier thickness and the different tissues compared, the values obtained for skin were again less than those of the oral regions but, of these, the buccal mucosa was significantly higher. The difference in permeability between epidermis and keratinized oral epithelium may be due to differences in the volume density of membrane-coating granules known to exist between the tissues; differences between the oral mucosal regions may reflect differences in the nature of the intercellular barrier material

  9. Water vapour loss measurements on human skin.

    NARCIS (Netherlands)

    Valk, Petrus Gerardus Maria van der

    1984-01-01

    In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions

  10. From microscopic to macroscopic dynamics in mean-field theory: effect of neutron skin on fusion barrier and dissipation

    Energy Technology Data Exchange (ETDEWEB)

    Lacroix, D

    2001-07-01

    In this work, we introduce a method to reduce the microscopic mean-field theory to a classical macroscopic dynamics at the initial stage of fusion reaction. We show that TDHF (Time-dependent Hartree-Fock) could be a useful tool to infer information on the fusion barrier as well as on one-body dissipation effect. We apply the reduction of information to the case of head-on reaction between a {sup 16}O and {sup 16,22,24,28}O in order to quantify the effect of neutron skin on fusion. We show that the precise determination of fusion barrier requires, in addition to the relative distance between center of mass, the introduction of an additional collective coordinate that explicitly breaks the neutron-proton symmetry. With this additional collective variable, we obtain a rather precise determination of the barrier position, height and diffuseness as well as one-body friction. (author)

  11. Excellent Aesthetic and Functional Outcome After Fractionated Carbon Dioxide Laser Skin Graft Revision Surgery: Case Report and Review of Laser Skin Graft Revision Techniques.

    Science.gov (United States)

    Ho, Derek; Jagdeo, Jared

    2015-11-01

    Skin grafts are utilized in dermatology to reconstruct a defect secondary to surgery or trauma of the skin. Common indications for skin grafts include surgical removal of cutaneous malignancies, replacement of tissue after burns or lacerations, and hair transplantation in alopecia. Skin grafts may be cosmetically displeasing, functionally limiting, and significantly impact patient's quality-of-life. There is limited published data regarding skin graft revision to enhance aesthetics and function. Here, we present a case demonstrating excellent aesthetic and functional outcome after fractionated carbon dioxide (CO2) laser skin graft revision surgery and review of the medical literature on laser skin graft revision techniques.

  12. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier

    DEFF Research Database (Denmark)

    Dreier, Jes; Sørensen, Jens A; Brewer, Jonathan R

    2016-01-01

    In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS) to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human...... skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED) images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm...... liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers...

  13. Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

    Directory of Open Access Journals (Sweden)

    David eBueno

    2014-10-01

    Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

  14. The Effects of Anthrax Lethal Toxin on Host Barrier Function

    Directory of Open Access Journals (Sweden)

    David M. Frucht

    2011-06-01

    Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

  15. The effect of low dose ionizing radiation on homeostasis and functional integrity in an organotypic human skin model

    Energy Technology Data Exchange (ETDEWEB)

    Neubeck, Claere von [German Cancer Consortium DKTK partner site Dresden, OncoRay - National Center for Radiation Research in Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Technische Universität Dresden, Fetscherstrasse 74, 01307 Dresden (Germany); German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Geniza, Matthew J. [Molecular and Cellular Biology Program, Oregon State University, Corvallis OR 97331 (United States); Kauer, Paula M.; Robinson, R. Joe; Chrisler, William B. [Health Impacts and Exposure Science, Pacific Northwest National Laboratory, Richland WA 99352 (United States); Sowa, Marianne B., E-mail: marianne.sowa@pnnl.gov [Health Impacts and Exposure Science, Pacific Northwest National Laboratory, Richland WA 99352 (United States)

    2015-05-15

    Highlights: • Low doses of high LET radiation influence skin homeostasis. • Effects on proliferation and differentiation profiles are LET dependent. • Skin barrier function is not compromised following low dose exposure. - Abstract: Outside the protection of Earth's atmosphere, astronauts are exposed to low doses of high linear energy transfer (LET) radiation. Future NASA plans for deep space missions or a permanent settlement on the moon are limited by the health risks associated with space radiation exposures. There is a paucity of direct epidemiological data for low dose exposures to space radiation-relevant high LET ions. Health risk models are used to estimate the risk for such exposures, though these models are based on high dose experiments. There is increasing evidence, however, that low and high dose exposures result in different signaling events at the molecular level, and may involve different response mechanisms. Further, despite their low abundance, high LET particles have been identified as the major contributor to health risk during manned space flight. The human skin is exposed in every external radiation scenario, making it an ideal epithelial tissue model in which to study radiation induced effects. Here, we exposed an in vitro three dimensional (3-D) human organotypic skin tissue model to low doses of high LET oxygen (O), silicon (Si) and iron (Fe) ions. We measured proliferation and differentiation profiles in the skin tissue and examined the integrity of the skin's barrier function. We discuss the role of secondary particles in changing the proportion of cells receiving a radiation dose, emphasizing the possible impact on radiation-induced health issues in astronauts.

  16. Crossing the entropy barrier of dynamical zeta functions

    International Nuclear Information System (INIS)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)

  17. Crossing the entropy barrier of dynamical zeta functions

    Energy Technology Data Exchange (ETDEWEB)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

  18. The rational design of biomimetic skin barrier lipid formulations using biophysical methods.

    Science.gov (United States)

    Bulsara, P A; Varlashkin, P; Dickens, J; Moore, D J; Rawlings, A V; Clarke, M J

    2017-04-01

    The focus of this communication was to study phospholipid-structured emulsions whose phase behaviour is modified with monoalkyl fatty amphiphiles. Ideally, these systems would mimic key physical and structural attributes observed in human stratum corneum (SC) so that they better alleviate xerotic skin conditions. Phosphatidylcholine-structured emulsions were prepared, and their phase behaviour modified with monoalkyl fatty amphiphiles. The effect of molecular volume, acyl chain length and head-group interactions was studied using a combination of physical methods. Water vapour transmission rate (WVTR) was used as a primary test to assess occlusive character. Changes in the vibrational modes observed in Fourier transform infrared (FTIR) spectroscopy and bilayer spacing measured by X-ray diffraction (XRD) were then applied to elucidate the lateral and lamellar microstructural characteristics in the systems. Water vapour transmission rate demonstrated that as the phosphatidylcholine acyl chain length increased from C14, to C18, to C22, there was a corresponding increase in occlusive character. The addition of monoalkyl fatty amphiphiles such as behenic acid, behenyl alcohol or cetostearyl alcohol to a base formulation incorporating dipalmitoyl and distearoylphosphatidylcholine (C18) was seen to further increase barrier characteristics of the emulsions. FTIR methods used to probe lipid-chain conformational ordering demonstrated that as phosphatidylcholine acyl chain lengths increased, there was a corresponding improvement in acyl chain ordering, with an increase in thermal transition temperatures. The addition of a monoalkyl fatty amphiphile resulted in conformational order and thermal transition temperature improvements trending towards those observed in stratum corneum. FTIR also demonstrated that systems containing behenic acid or behenyl alcohol exhibited features associated with orthorhombic character. X-ray diffraction data showed that addition of monoalkyl fatty

  19. Drug Delivery Through the Skin: Molecular Simulations of Barrier Lipids to Design more Effective Noninvasive Dermal and Transdermal Delivery Systems for Small Molecules Biologics and Cosmetics

    Energy Technology Data Exchange (ETDEWEB)

    J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari

    2011-12-31

    The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.

  20. Comfort and microbial barrier properties of garments worn next to the skin

    Science.gov (United States)

    Kopitar, D.; Rogina-Car, B.; Skenderi, Z.

    2017-10-01

    Compared with viscose fibre, modal fibre is characterized by some advantageous properties such as higher dry and wet tenacities, higher wet modulus, lower water retention capacity and lower level of swelling. Impact of different knitted fabric structure made of cotton and 97 % CMD/3 % EL fibres on thermo-physiological comfort and microbial barrier properties were investigated. All knitted fabrics have very good physiological properties. The microbial barrier permeability of knitted fabric after extreme contamination with bacterial spores in dry state showed that double jersey offered more effective microbial barrier than the single jersey knitted fabrics respectively the greater thickness of double jersey knitted fabric provide more difficult barrier to bacterial spores to pass. In wet state all knitted fabrics have more effective microbial barrier which could be explained by cellulose fibres swelling. In wet state 97 % CMD/3 % EL single jersey knitted fabric have more effective microbial barrier then cotton double and single jersey knitted fabrics.

  1. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    DEFF Research Database (Denmark)

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

    2010-01-01

    BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

  2. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  3. The functional relevance of polyploidization in the skin.

    Science.gov (United States)

    Trakala, Marianna; Malumbres, Marcos

    2014-02-01

    Cell proliferation and differentiation are tightly coupled through the regulation of the cell division cycle. To preserve specific functional properties in differentiated cells, distinct variants of the basic mitotic cell cycle are used in various mammalian tissues, leading to the formation of polyploid cells. In this issue of Experimental Dermatology, Gandarillas and Freije discuss the evidences for polyploidization in keratinocytes, a process whose physiological relevance is now becoming evident. A better evaluation of these unconventional cell cycles is required not only to improve our understanding of the development and structure of the epidermis but also for future therapies against skin diseases. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Blood-aqueous Barrier Function in a Patient With Choroideremia

    Directory of Open Access Journals (Sweden)

    Muh-Shy Chen

    2010-02-01

    Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.

  5. Applications of peanut skins as a functional food ingredient

    Science.gov (United States)

    Peanut skins are a low-value byproduct of the peanut industry, with hundreds of thousands of tons being produced annually. Following their removal during the preparation of common peanut products, peanut skins are either discarded or used as a minor component of animal feed. Recent studies have fo...

  6. Functional Food Market Development in Serbia: Motivations and Barriers

    Directory of Open Access Journals (Sweden)

    Žaklina Stojanović

    2013-11-01

    Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

  7. Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers

    International Nuclear Information System (INIS)

    Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang

    2006-01-01

    The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied

  8. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  9. Sleep Restriction Impairs Blood–Brain Barrier Function

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping

    2014-01-01

    The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222

  10. Sleep restriction impairs blood-brain barrier function.

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

    2014-10-29

    The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

  11. Hataedock treatment has preventive therapeutic effects for atopic dermatitis through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice.

    Science.gov (United States)

    Cha, Ho-Yeol; Ahn, Sang-Hyun; Cheon, Jin-Hong; Park, Sun-Young; Kim, Kibong

    2017-07-12

    Hataedock treatment is traditionally used for the purpose of preventing the future skin disease by feeding herbal extracts to the newborn in traditional Chinese and Korean medicine. This study investigated the preventive therapeutic effects of Hataedock (HTD) treatment for atopic dermatitis (AD) through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice. To the HTD treatment group, the extract of Coptis japonica Makino and Glycyrrhiza uralensis Fischer, which analyzed with High Performance Liquid Chromatography (HPLC)-fingerprint for quality consistency, was administered orally to the 3-week-old mice before inducing AD. After that, Dermatophagoides farinae was applied except the control group to induce AD-like skin lesions. We confirmed the effects of HTD on morphological changes, protection of skin barrier, regulation of Th2 differentiation, inflammation regulation and induction of apoptosis through histochemistry, immunohistochemistry, and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. HTD effectively reduced edema, angiogenesis and skin lesion. HTD also increased the levels of liver X receptor (LXR) and filaggrin but decreased the level of protein kinase C (PKC) (pprotection of skin barrier. Therefore, HTD may have potential applications for alternative and preventive treatment in the management of AD. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  12. 3D bioprinting of functional human skin: production and in vivo analysis.

    Science.gov (United States)

    Cubo, Nieves; Garcia, Marta; Del Cañizo, Juan F; Velasco, Diego; Jorcano, Jose L

    2016-12-05

    Significant progress has been made over the past 25 years in the development of in vitro-engineered substitutes that mimic human skin, either to be used as grafts for the replacement of lost skin, or for the establishment of in vitro human skin models. In this sense, laboratory-grown skin substitutes containing dermal and epidermal components offer a promising approach to skin engineering. In particular, a human plasma-based bilayered skin generated by our group, has been applied successfully to treat burns as well as traumatic and surgical wounds in a large number of patients in Spain. There are some aspects requiring improvements in the production process of this skin; for example, the relatively long time (three weeks) needed to produce the surface required to cover an extensive burn or a large wound, and the necessity to automatize and standardize a process currently performed manually. 3D bioprinting has emerged as a flexible tool in regenerative medicine and it provides a platform to address these challenges. In the present study, we have used this technique to print a human bilayered skin using bioinks containing human plasma as well as primary human fibroblasts and keratinocytes that were obtained from skin biopsies. We were able to generate 100 cm 2 , a standard P100 tissue culture plate, of printed skin in less than 35 min (including the 30 min required for fibrin gelation). We have analysed the structure and function of the printed skin using histological and immunohistochemical methods, both in 3D in vitro cultures and after long-term transplantation to immunodeficient mice. In both cases, the generated skin was very similar to human skin and, furthermore, it was indistinguishable from bilayered dermo-epidermal equivalents, handmade in our laboratories. These results demonstrate that 3D bioprinting is a suitable technology to generate bioengineered skin for therapeutical and industrial applications in an automatized manner.

  13. Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer.

    Science.gov (United States)

    Berger, Antoine; Regueiro, Carlos; Hijal, Tarek; Pasquier, David; De La Fuente, Cristina; Le Tinier, Florence; Coche-Dequeant, Bernard; Lartigau, Eric; Moyal, Dominique; Seité, Sophie; Bensadoun, René-Jean

    2018-01-01

    As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant) for breast cancer. Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation) before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low). Average age was 60 years (range: 34-85). Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031). Positive physician's opinion on product use was more frequent for high (66.6%) versus low (32%) users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

  14. Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer

    Directory of Open Access Journals (Sweden)

    Antoine Berger

    2018-01-01

    Full Text Available Purpose: As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant for breast cancer. Methods: Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low. Results: Average age was 60 years (range: 34-85. Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031. Positive physician’s opinion on product use was more frequent for high (66.6% versus low (32% users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. Conclusions: These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

  15. Homozygous ALOXE3 Nonsense Variant Identified in a Patient with Non-Bullous Congenital Ichthyosiform Erythroderma Complicated by Superimposed Bullous Majocchi’s Granuloma: The Consequences of Skin Barrier Dysfunction

    Directory of Open Access Journals (Sweden)

    Tao Wang

    2015-09-01

    Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.

  16. Functional Anatomy and Oncologic Barriers of the Larynx.

    Science.gov (United States)

    Mor, Niv; Blitzer, Andrew

    2015-08-01

    Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Development of a stratum corneum substitute for in vitro percutaneous penetration studies : a skin barrier model comprising synthetic stratum corneum lipids

    NARCIS (Netherlands)

    Jager, Miranda Wilhelmina de

    2006-01-01

    The research outlined in this thesis was focused on the development of a skin barrier model, which can substitute for stratum corneum in diffusion studies. This so-called stratum corneum substitute (SCS) was prepared with reconstituted SC lipids (cholesterol, free fatty acids and ceramides) on a

  18. Utilization of Peanut Skin Extracts as Functional Food Ingredients

    Science.gov (United States)

    Peanut skins are a by-product of the blanching industry that have not been utilized to their full potential. They have been found to contain significant quantities of compounds containing phenolic moieties such as catechins, procyanidins, and other polyphenols that have positive associations with h...

  19. Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.

    Science.gov (United States)

    McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L

    2014-04-01

    This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.

  20. Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

    Science.gov (United States)

    Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

    2018-01-21

    Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  2. SKIN CARE IN INFANTS

    Directory of Open Access Journals (Sweden)

    I. N. Zakharova

    2014-01-01

    Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.

  3. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  4. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  5. Methamphetamine Effects on Blood-Brain Barrier Structure and Function

    Directory of Open Access Journals (Sweden)

    Nicole Alia Northrop

    2015-03-01

    Full Text Available Methamphetamine (Meth is a widely abuse psychostimulant. Traditionally, studies have focused on the neurotoxic effects of Meth on monoaminergic neurotransmitter terminals. Recently, both in vitro and in vivo studies have investigated the effects of Meth on the BBB and found that Meth produces a decrease in BBB structural proteins and an increase in BBB permeability to various molecules. Moreover, preclinical studies are validated by clinical studies in which human Meth users have increased concentrations of toxins in the brain. Therefore, this review will focus on the structural and functional disruption of the BBB caused by Meth and the mechanisms that contribute to Meth-induced BBB disruption. The review will reveal that the mechanisms by which Meth damages dopamine and serotonin terminals are similar to the mechanisms by which the blood-brain barrier (BBB is damaged. Furthermore, this review will cover the factors that are known to potentiate the effects of Meth on the BBB, such as stress and HIV, both of which are co-morbid conditions associated with Meth abuse. Overall, the goal of this review is to demonstrate that the scope of damage produced by Meth goes beyond damage to monoaminergic neurotransmitter systems to include BBB disruption as well as provide a rationale for investigating therapeutics to treat Meth-induced BBB disruption. Since a breach of the BBB can have a multitude of consequences, therapies directed towards the treatment of BBB disruption may help to ameliorate the long-term neurodegeneration and cognitive deficits produced by Meth and possibly even Meth addiction.

  6. Application of protease technology in dermatology: rationale for incorporation into skin care with initial observations on formulations designed for skin cleansing, maintenance of hydration, and restoration of the epidermal permeability barrier.

    Science.gov (United States)

    Del Rosso, James Q

    2013-06-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article.

  7. Application of Protease Technology in Dermatology: Rationale for Incorporation into Skin Care with Initial Observations on Formulations Designed for Skin Cleansing, Maintenance of Hydration, and Restoration of the Epidermal Permeability Barrier

    OpenAIRE

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also ...

  8. Reconstructed human epidermis: A model to study the barrier function

    Energy Technology Data Exchange (ETDEWEB)

    Barbotteau, Y. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Gontier, E. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Barberet, P. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Cappadoro, M. [Institut de recherche Pierre FABRE, 31320 Castanet Tolosan (France); De Wever, B. [Institut de recherche Pierre FABRE, 31320 Castanet Tolosan (France); Habchi, C. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Incerti, S. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Mavon, A. [SkinEthic Laboratories, 45 rue St. Philippe, 06000 Nice (France); Moretto, P. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France)]. E-mail: moretto@cenbg.in2p3.fr; Pouthier, T. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Smith, R.W. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Ynsa, M.D. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France)

    2005-04-01

    The use of in vitro reconstructed human epidermis (RHE) by the cosmetic and pharmaceutical industries is increasing because of its similar physiological mechanisms to native human skin. With the advent of ethic laws on animal experimentation, RHE provides an helpful alternative for the test of formulations. The aim of this study is to check that the RHE mineral status is comparable to that of human native skin by investigating the elemental distributions in the epidermis strata. In addition, possible deleterious effects of the transport on the epidermis ionic content were studied by nuclear microscopy.

  9. Reconstructed human epidermis: A model to study the barrier function

    International Nuclear Information System (INIS)

    Barbotteau, Y.; Gontier, E.; Barberet, P.; Cappadoro, M.; De Wever, B.; Habchi, C.; Incerti, S.; Mavon, A.; Moretto, P.; Pouthier, T.; Smith, R.W.; Ynsa, M.D.

    2005-01-01

    The use of in vitro reconstructed human epidermis (RHE) by the cosmetic and pharmaceutical industries is increasing because of its similar physiological mechanisms to native human skin. With the advent of ethic laws on animal experimentation, RHE provides an helpful alternative for the test of formulations. The aim of this study is to check that the RHE mineral status is comparable to that of human native skin by investigating the elemental distributions in the epidermis strata. In addition, possible deleterious effects of the transport on the epidermis ionic content were studied by nuclear microscopy

  10. Functional electrospun fibers for the treatment of human skin wounds.

    Science.gov (United States)

    Wang, Jing; Windbergs, Maike

    2017-10-01

    Wounds are trauma induced defects of the human skin involving a multitude of endogenous biochemical events and cellular reactions of the immune system. The healing process is extremely complex and affected by the patient's physiological conditions, potential implications like infectious pathogens and inflammation as well as external factors. Due to increasing incidence of chronic wounds and proceeding resistance of infection pathogens, there is a strong need for effective therapeutic wound care. In this context, electrospun fibers with diameters in the nano- to micrometer range gain increasing interest. While resembling the structure of the native human extracellular matrix, such fiber mats provide physical and mechanical protection (including protection against bacterial invasion). At the same time, the fibers allow for gas exchange and prevent occlusion of the wound bed, thus facilitating wound healing. In addition, drugs can be incorporated within such fiber mats and their release can be adjusted by the material and dimensions of the individual fibers. The review gives a comprehensive overview about the current state of electrospun fibers for therapeutic application on skin wounds. Different materials as well as fabrication techniques are introduced including approaches for incorporation of drugs into or drug attachment onto the fiber surface. Against the background of wound pathophysiology and established therapy approaches, the therapeutic potential of electrospun fiber systems is discussed. A specific focus is set on interactions of fibers with skin cells/tissues as well as wound pathogens and strategies to modify and control them as key aspects for developing effective wound therapeutics. Further, advantages and limitations of controlled drug delivery from fiber mats to skin wounds are discussed and a future perspective is provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The skin: The many functions of fish integument

    Science.gov (United States)

    Elliott, Diane G.; Farrell, Anthony P.

    2011-01-01

    The integument or skin is the envelope that not only separates and protects a fish from its environment, but also provides the means through which most contacts with the outer world are made. It is a large organ and is continuous with the linings of all body openings, and also covers the fins. Fish integument is a multifunctional organ, and its components may serve important roles in protection, communication, sensory perception, locomotion, respiration, ion regulation, excretion, and thermal regulation.

  12. A nuclide transfer model for barriers of the seabed repository using response function

    International Nuclear Information System (INIS)

    Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo

    1996-01-01

    A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)

  13. Age-related changes in expression and function of Toll-like receptors in human skin

    Science.gov (United States)

    Iram, Nousheen; Mildner, Michael; Prior, Marion; Petzelbauer, Peter; Fiala, Christian; Hacker, Stefan; Schöppl, Alice; Tschachler, Erwin; Elbe-Bürger, Adelheid

    2012-01-01

    Toll-like receptors (TLRs) initiate innate immune responses and direct subsequent adaptive immunity. They play a major role in cutaneous host defense against micro-organisms and in the pathophysiology of several inflammatory skin diseases. To understand the role of TLRs in the acquisition of immunological competence, we conducted a comprehensive study to evaluate TLR expression and function in the developing human skin before and after birth and compared it with adults. We found that prenatal skin already expresses the same spectrum of TLRs as adult skin. Strikingly, many TLRs were significantly higher expressed in prenatal (TLRs 1-5) and infant and child (TLRs 1 and 3) skin than in adult skin. Surprisingly, neither dendritic cell precursors in prenatal skin nor epidermal Langerhans cells and dermal dendritic cells in adult skin expressed TLRs 3 and 6, whereas the staining pattern and intensity of both TLRs in fetal basal keratinocytes was almost comparable to those of adults. Stimulation of primary human keratinocytes from fetal, neonatal and adult donors with selected TLR agonists revealed that the synthetic TLR3 ligand poly (I:C) specifically, mimicking viral double-stranded RNA, induced a significantly enhanced secretion of CXCL8/IL8, CXCL10/IP-10 and TNFα in fetal and neonatal keratinocytes compared with adult keratinocytes. This study demonstrates quantitative age-specific modifications in TLR expression and innate skin immune reactivity in response to TLR activation. Thus, antiviral innate immunity already in prenatal skin may contribute to protect the developing human body from viral infections in utero in a scenario where the adaptive immune system is not yet fully functional. PMID:23034637

  14. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

  15. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    International Nuclear Information System (INIS)

    Svenson, Ola

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses

  16. ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

    Science.gov (United States)

    Di, Anke; Mehta, Dolly; Malik, Asrar B

    2016-09-01

    Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Functional restoration of penis with partial defect by scrotal skin flap.

    Science.gov (United States)

    Zhao, Yue-Qiang; Zhang, Jie; Yu, Mo-Sheng; Long, Dao-Chou

    2009-11-01

    We investigated a reconstructive method with better sensory and erectile function for partial penile defects and report our long-term results of surgical correction using scrotal skin flaps. We retrospectively analyzed the records of 18 patients with penile defects referred to us between 1992 and 2007. All cases were treated with a scrotal skin flap initially to repair the secondary defect after penile elongation. Of the 18 cases treated during the 15-year period the mechanism of primary injury was circumcision in 3, animal bite in 9 and penile tumor dissection in 6. Penile elongation, division of the suspensory ligament and scrotal skin flaps achieved penile augmentation and enhancement. Six cases were treated with a bilateral scrotal skin flap supplied by the anterior scrotal artery and 12 were repaired with a total anterior scrotal skin flap supplied by the anterior and posterior scrotal arteries. Penile length in the flaccid and erectile states was obviously increased postoperatively (p <0.05). All patients were followed 1 to 9 years (mean 2.3) postoperatively. Deep and superficial sensation recovered and erectile function was retained. Of the 18 patients 15 reported satisfied sexual intercourse during the 0.5 to 5-year followup. The method of correcting partial penile defect using scrotal skin flaps is effective and simple according to our long-term experience. This method achieves reasonable cosmesis and penile length in most cases with better sensory and erectile function.

  18. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    Science.gov (United States)

    ZHAO, HENGGUANG; LI, SHUANG; LUO, FULING; TAN, QIAN; LI, HUI; ZHOU, WEIKANG

    2015-01-01

    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  19. Tests of potential functional barriers for laminated multilayer food packages. Part I: Low molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R

    2000-08-01

    The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.

  20. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.

    NARCIS (Netherlands)

    Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.

    2001-01-01

    Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,

  1. Skin moisturization mechanisms: new data.

    Science.gov (United States)

    Bonté, F

    2011-05-01

    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  2. Structure and Function of Skin: The Application of THz Radiation in Dermatology

    Science.gov (United States)

    Jo, Seong Jin; Kwon, Oh Sang

    Skin, the largest organ of human being, is a soft membrane covering the exterior of the body. It protects the host from mechanical injuries, toxic materials, pathogenic organisms, and so on. Although its basic function is protection from the environment like this, it is not a simple and static shield but a complex and dynamic organ which performs important roles in maintaining the homeostasis of the body. Skin controls evaporation to prevent massive water loss, and regulates body temperature by controlling the blood flow of skin and perspiration [1]. It is responsible for the synthesis of vitamin D and a storage center for lipid and water. In addition, skin contains nerve endings and provides sensation for temperature, touch, pressure, and vibration.

  3. No Sting Barrier Film to Protect Skin in Adult Patients: Findings From a Scoping Review With Implications for Evidence-Based Practice.

    Science.gov (United States)

    Micheli, Chiara; Palese, Alvisa; Canzan, Federica; Ambrosi, Elisa

    2017-10-01

    In the industrialized world, approximately 1-1.5% of the population has received treatments for skin lesions. In the 1990s, a polymeric barrier film called the No Sting Barrier Film (NSBF) was developed as an alternative to petrolatum-based ointments and zinc oxide formulas. To date, few studies have explored the effectiveness of NSBF in protecting skin integrity. To map the methods, fields and outcomes used to produce evidence on NSBF effectiveness. A scoping review was performed in 2015. A search strategy for identifying relevant studies was designed and performed. Systematic reviews, meta-analyses, randomized controlled trials, controlled clinical trials, and comparative studies for all types of interventions were included; research conducted in any clinical context was eligible for inclusion. Studies were selected by two reviewers; data extraction and analysis also was performed by two reviewers and disagreements were discussed. Six studies were included. NSBF's potential as a skin protector was investigated with respect to (a) chronic wounds (pressure ulcers or vascular leg ulcers); (b) urinary or fecal incontinence; and (c) post-mastectomy irradiation. The principal clinical outcomes investigated were, respectively: (a) wound healing, wound exudates and erythema control; (b) incidence of incontinence-associated dermatitis and skin reactions; and (c) intensity of pruritus and skin reactions. Pain and comfort were measured in all clinical applications. The main process outcomes investigated were: (a) ease of application, (b) application and removal time, and (c) costs. Zinc oxide and petroleum formulations were the most common comparison interventions in research on chronic ulcers and incontinence; sorbolene cream and topical corticosteroids were the most frequent comparisons in the context of post-mastectomy irradiation. NBSF may be used for peri-wound skin protection in patients with chronic wounds, with urinary or fecal incontinence and for women undergoing

  4. Ultraviolet A photosensitivity profile of dexchlorpheniramine maleate and promethazine-based creams: Anti-inflammatory, antihistaminic, and skin barrier protection properties.

    Science.gov (United States)

    Facchini, Gustavo; Eberlin, Samara; Clerici, Stefano Piatto; Alves Pinheiro, Ana Lucia Tabarini; Costa, Adilson

    2017-12-01

    Unwanted side effects such as dryness, hypersensitivity, and cutaneous photosensitivity are challenge for adherence and therapeutical success for patients using treatments for inflammatory and allergic skin response. In this study, we compared the effects of two dermatological formulations, which are used in inflammatory and/or allergic skin conditions: dexchlorpheniramine maleate (DCP; 10 mg/g) and promethazine (PTZ; 20 mg/g). We evaluated both formulations for phototoxicity potential, skin irritation, anti-inflammatory and antihistaminic abilities, and skin barrier repair in vitro and ex vivo using the standard OECD test guideline n° 432, the ECVAM protocol n° 78, and cultured skin explants from a healthy patient. Ultraviolet A was chosen as exogenous agent to induce allergic and inflammatory response. Both PTZ and DCP promoted increases in interleukin-1 (IL-1) synthesis in response to ultraviolet A (UVA) radiation compared to control. However, the increase observed with PTZ was significantly greater than the DCP, indicating that the latter has a lower irritant potential. DCP also demonstrated a protective effect on UVA-induced leukotriene B4 and nuclear factor kappa B (NF-κB) synthesis. Conversely, PTZ demonstrates more robust UVA antihistaminic activity. Likewise, PTZ promoted a significantly greater increase in the production of involucrin and keratin 14, both associated with protective skin barrier property. In conclusion, these data suggest possible diverging UVA response mechanisms of DCP and PTZ, which gives greater insight into the contrasting photosensitizing potential between DCP and PTZ observed in the patients. © 2017 Wiley Periodicals, Inc.

  5. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  6. Quality of skin as a barrier to ultra-fine particles. Contribution of the IBA group to the NANODERM EU-5 project in 2003-2004

    International Nuclear Information System (INIS)

    Kertesz, Zs.; Szikszai, Z.; Kiss, A.Z.

    2004-01-01

    Complete text of publication follows. Micronised titanium-, zinc- or silicon-oxide is a widely used physical photoprotective agent as a component of various cosmetic products. Due to the small particle size (down to 15 nm) it is supposed, that the particles may pass through the uppermost horny skin layer, and penetrate into deeper vital skin layers. However, only a few experiments have been carried out on its penetration through the human epidermal barrier and its possible biological effects in vivo and in vitro, using the tape stripping method which has no lateral and limited depth resolution. A consortium consisting of 12 European universities and scientific institutes has been established under the leadership of the Fakultat fuer Physik und Geowissenchaft Universitat Leipzig, whose goal is to get quantitative information on the penetration of ultrafine particles in all strata of skin, on their penetration pathways as well as on their impact on human health [1]. The IBA group of the Atomki takes part in this project as a subcontractor of the Department of Dermatology, University of Debrecen, Hungary. Ion microscopy, electron microscopy and autoradiography are used to trace the penetration of the nanoparticles into the skin layers, molecular and cell-biological methods are applied to assess the skin response and activation of dermal cells. The IBA group of the Atomki takes part in WP3: Ion Microscopy Work Package together with five other nuclear microprobe laboratories. The participants provide quantitative elemental composition in all strata of skin with detection limits of about 1 μg/g and lateral resolution of 1-2 μm by applying various ion beam analytical techniques. Samples investigated by ion microscopy are 14-16 μm thick cryo-fixed freeze-dried sections of porcine and human skin. Since the sample preparation requires completely different treatment for ion microscopy than for conventional microscopy, the members of the IBA group, who already have

  7. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  8. Lipid functions in skin: differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model

    OpenAIRE

    Kendall, Alexandra; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke; Harwood, John L.; Nicolaou, Anna

    2017-01-01

    Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, deri...

  9. [Advances in the research of function of Merkel cells in tactile formation of skin].

    Science.gov (United States)

    You, X; Wei, Z R

    2018-01-20

    Skin is the largest sense organ of human, with many mechanoreceptor cells under epidermis or dermis of skin and Merkel cell is one of them. It has been confirmed that Merkel cells play an important role in the process of mechanical transmission of mammalian soft tactile stimulation. Researches showed that Merkel cells had close relation to tactile formation and functioned by Merkel cell-neurite complexes and ion channels Piezo2. This article reviews Merkel cells and the function, problem and prospect of Merkel cells in tactile formation.

  10. The biological mechanisms and behavioral functions of opsin-based light detection by the skin

    Directory of Open Access Journals (Sweden)

    Jennifer L Kelley

    2016-08-01

    Full Text Available Light detection not only forms the basis of vision (via visual retinal photoreceptors, but can also occur in other parts of the body, including many non-rod/non-cone ocular cells, the pineal complex, the deep brain, and the skin. Indeed, many of the photopigments (an opsin linked to a light-sensitive 11-cis retinal chromophore that mediate color vision in the eyes of vertebrates are also present in the skin of animals such as reptiles, amphibians, crustaceans and fishes (with related photoreceptive molecules present in cephalopods, providing a localized mechanism for light detection across the surface of the body. This form of non-visual photosensitivity may be particularly important for animals that can change their coloration by altering the dispersion of pigments within the chromatophores (pigment containing cells of the skin. Thus, skin coloration may be directly color matched or tuned to both the luminance and spectral properties of the local background environment, thereby facilitating behavioral functions such as camouflage, thermoregulation, and social signaling. This review examines the diversity and sensitivity of opsin-based photopigments present in the skin and considers their putative functional roles in mediating animal behavior. Furthermore, it discusses the potential underlying biochemical and molecular pathways that link shifts in environmental light to both photopigment expression and chromatophore photoresponses. Although photoreception that occurs independently of image formation remains poorly understood, this review highlights the important role of non-visual light detection in facilitating the multiple functions of animal coloration.

  11. THE IMPACT OF ULTRAVIOLET IRRADIATION ON MORPHO-FUNCTIONAL STATE OF SKIN IN GUINEA PIGS.

    Science.gov (United States)

    Myronchenko, S; Naumova, O; Zvyagintseva, T

    2016-11-01

    The purpose of this study was to assess the impact of ultraviolet irradiation (UV) on morphological and functional condition of the skin in guinea pigs. The study involved 30 albino guinea pigs weighing 400-500 g subjected to local exposure to UV irradiation. Control group consisted of intact guinea pigs. Histological studies of the skin were carried out at different stages of the trial (2 hours, 4 hours, 3 days, 8 days following the exposure). Microscopic examination showed morphological signs of acute inflammation in the skin of animals within the first three days following the exposure to UV irradiation. Within 2 hours following the exposure to UV irradiation these changes were minimal with signs of mild exudative changes. In 4 hours after the exposure histological changes increased. The specimens were also found to contain altered apoptotic keratinocytes (sunburn cells). Histopathological changes persisted and reached maximum severity by the 3rd day. Within post-erythema period (the 8th day) proliferative, hyperplastic, degenerative and dystrophic changes in the skin persisted. The prolonged nature of the changes in the skin is suggestive of the development of chronic inflammation in the skin of guinea pigs subjected to local exposure to UV irradiation.

  12. Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

    Science.gov (United States)

    Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

    2016-08-01

    OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Circadian rhythms on skin function of hairless rats: light and thermic influences.

    Science.gov (United States)

    Flo, Ana; Díez-Noguera, Antoni; Calpena, Ana C; Cambras, Trinitat

    2014-03-01

    Circadian rhythms are present in most functions of living beings. We have demonstrated the presence of circadian rhythms in skin variables (transepidermal water loss, TEWL; stratum corneum hydration, SCH; and skin temperature) in hairless rats under different environmental conditions of light and temperature. Circadian rhythms in TEWL and SCH showed mean amplitudes of about 20% and 14% around the mean, respectively, and appeared under light-dark cycles as well as under constant darkness. Environmental temperature was able to override TEWL, but not SCH rhythm, evidencing the dependency of TEWL on the temperature. Mean daily values of TEWL and SCH, and also the amplitude of TEWL rhythm, increased with the age of the animal. Under constant light, situation that induces arrhythmicity in rats, SCH and TEWL were inversely correlated. The results suggest the importance to take into account the functional skin rhythms in research in dermatological sciences. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. THE SKIN | Functional morphology of the integumentary system in fishes

    Science.gov (United States)

    Elliott, D.G.; Farrell, Anthony P.

    2011-01-01

    The integument that covers the outer surface of a fish’s body and fins is a multifunctional organ, with morphological features highly adapted to carry out these functions. The integument consists of two layers. The outer layer, the epidermis, is essentially cellular in structure, comprised of a multilayered epithelium that usually includes specialized cells. The inner layer, the dermis, is primarily a fibrous structure with relatively few cells, although it may contain scales, nerves, blood vessels, adipose tissue, and pigment cells.

  15. The Drosophila blood-brain barrier: Development and function of a glial endothelium

    Directory of Open Access Journals (Sweden)

    Stefanie eLimmer

    2014-11-01

    Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  16. The Drosophila blood-brain barrier: development and function of a glial endothelium.

    Science.gov (United States)

    Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian

    2014-01-01

    The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  17. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

  18. Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Directory of Open Access Journals (Sweden)

    Hee Soon Shin

    2015-01-01

    Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  19. Single blinded, randomized, placebo-controlled study on the effects of ciclosporin on cutaneous barrier function and immunological response in atopic beagles.

    Science.gov (United States)

    White, Amelia G; Santoro, Domenico; Ahrens, Kim; Marsella, Rosanna

    2018-03-01

    Ciclosporin (CsA) is a common treatment for canine atopic dermatitis (cAD). cAD is a very common skin disease with a multifactorial pathogenesis due to complex interactions between the host and the environment. The purpose of this study was to describe the physical and immunological effects of CsA in cAD using a canine model of AD. Fourteen beagles were enrolled; seven received CsA orally every 24 h for 28 days, and seven received placebo. All dogs were exposed to relevant allergens, house dust mite solution, one day prior to treatment and once weekly thereafter for 28 consecutive days. Canine atopic dermatitis extent and severity index-03 (CADESI-03) and skin biopsies were performed on day 0, 14, and 28. Quantitative RT-PCR was used to determine levels of cutaneous cytokines and barrier function markers. Indirect immunofluorescence was used to determine protein expression and distribution of nuclear messengers, barrier function and inflammatory [thymic stromal lymphopoietin (TSLP)] markers. The data were tested for normality and then the upaired two samples Student's t-test and the repeated measurements ANOVA, followed by the Dunnett's Multiple Comparison Test as post-hoc analysis, were performed. A P value of immunologic milieu or barrier markers despite evident improvement of physical signs in the treatment group. Although this study confirmed the usefulness of CsA for the treatment of cAD, a clear involvement of CsA on some of the currently known immunological alterations present in cAD was not determined. However, it is important to note that there was no measurable exacerbation of skin barrier dysfunction secondary to CsA administration in this model. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Skin and scales of teleost fish: Simple structure but high performance and multiple functions

    Science.gov (United States)

    Vernerey, Franck J.; Barthelat, Francois

    2014-08-01

    Natural and man-made structural materials perform similar functions such as structural support or protection. Therefore they rely on the same types of properties: strength, robustness, lightweight. Nature can therefore provide a significant source of inspiration for new and alternative engineering designs. We report here some results regarding a very common, yet largely unknown, type of biological material: fish skin. Within a thin, flexible and lightweight layer, fish skins display a variety of strain stiffening and stabilizing mechanisms which promote multiple functions such as protection, robustness and swimming efficiency. We particularly discuss four important features pertaining to scaled skins: (a) a strongly elastic tensile behavior that is independent from the presence of rigid scales, (b) a compressive response that prevents buckling and wrinkling instabilities, which are usually predominant for thin membranes, (c) a bending response that displays nonlinear stiffening mechanisms arising from geometric constraints between neighboring scales and (d) a robust structure that preserves the above characteristics upon the loss or damage of structural elements. These important properties make fish skin an attractive model for the development of very thin and flexible armors and protective layers, especially when combined with the high penetration resistance of individual scales. Scaled structures inspired by fish skin could find applications in ultra-light and flexible armor systems, flexible electronics or the design of smart and adaptive morphing structures for aerospace vehicles.

  1. Direct 3D cell-printing of human skin with functional transwell system.

    Science.gov (United States)

    Kim, Byoung Soo; Lee, Jung-Seob; Gao, Ge; Cho, Dong-Woo

    2017-06-06

    Three-dimensional (3D) cell-printing has been emerging as a promising technology with which to build up human skin models by enabling rapid and versatile design. Despite the technological advances, challenges remain in the development of fully functional models that recapitulate complexities in the native tissue. Moreover, although several approaches have been explored for the development of biomimetic human skin models, the present skin models based on multistep fabrication methods using polydimethylsiloxane chips and commercial transwell inserts could be tackled by leveraging 3D cell-printing technology. In this paper, we present a new 3D cell-printing strategy for engineering a 3D human skin model with a functional transwell system in a single-step process. A hybrid 3D cell-printing system was developed, allowing for the use of extrusion and inkjet modules at the same time. We began by revealing the significance of each module in engineering human skin models; by using the extrusion-dispensing module, we engineered a collagen-based construct with polycaprolactone (PCL) mesh that prevented the contraction of collagen during tissue maturation; the inkjet-based dispensing module was used to uniformly distribute keratinocytes. Taking these features together, we engineered a human skin model with a functional transwell system; the transwell system and fibroblast-populated dermis were consecutively fabricated by using the extrusion modules. Following this process, keratinocytes were uniformly distributed onto the engineered dermis by the inkjet module. Our transwell system indicates a supportive 3D construct composed of PCL, enabling the maturation of a skin model without the aid of commercial transwell inserts. This skin model revealed favorable biological characteristics that included a stabilized fibroblast-stretched dermis and stratified epidermis layers after 14 days. It was also observed that a 50 times reduction in cost was achieved and 10 times less medium was

  2. Reliability of candida skin test in the evaluation of T-cell function in ...

    African Journals Online (AJOL)

    Background: Both standardized and non-standardized candida skin tests are used in clinical practice for functional in-vivo assessment of cellular immunity with variable results and are considered not reliable under the age of 1 year. We sought to investigate the reliability of using manually prepared candida intradermal test ...

  3. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  4. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    International Nuclear Information System (INIS)

    Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

    2013-01-01

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

  5. Barrier protective use of skin care to prevent chemotherapy-induced cutaneous symptoms and to maintain quality of life in patients with breast cancer

    Directory of Open Access Journals (Sweden)

    Wohlrab J

    2014-08-01

    Full Text Available Johannes Wohlrab,1 Nikola Bangemann,2 Anke Kleine-Tebbe,3 Marc Thill,4,5 Sherko Kümmel,6 Eva-Maria Grischke,7 Rainer Richter,8 Sophie Seite,9 Diana Lüftner10 1Martin Luther University Halle-Wittenberg, Department of Dermatology and Venereology, Halle (Saale, 2Interdisciplinary Breast Centre, University Hospital Charité Berlin, Campus Benjamin Franklin, Berlin, Germany, 3Breast Centre DRK Hospital, Berlin, 4Breast Centre University of Lübeck, Department of Gynaecology and Obstetrics, Lübeck, 5Department of Gynaecology and Obstetrics, Agaplesion Markus Hospital, Frankfurt am Main, 6Breast Centre and Clinic of Senology, Hospital Essen-Mitte, Essen, 7Breast Centre University of Tübingen, Department of Gynaecology, Tübingen, 8L'Oréal, Deutschland GmbH, Düsseldorf, 9La Roche-Posay, Dermatological Laboratories, Asnières, France; 10University Hospital Charité Berlin, Campus Benjamin Franklin, Department of Hematology, Oncology and Tumour Immunology, Berlin, Germany Purpose: Chemotherapy with anthracyclines, taxanes, or alkylating agents often causes cutaneous side effects. Nonspecific inhibition of the proliferative activity of keratinocytes has antidifferentiation effects that lead to defects in the barrier function and, thus, to dry, itchy, and irritable skin. These cutaneous symptoms reduce the quality of life of the patients considerably. Conditioning with topical application of niacinamide uses the cytoprotective and barrier stabilizing effect of vitamin B3. Patients and methods: A multicenter randomized crossover study investigated the influence of the test preparation on the quality of life compared to standard care for 73 patients with breast cancer undergoing adjuvant or neoadjuvant cytostatic therapy. Primary target parameter was the Dermatology Life Quality Index with its respective subscales after 6 weeks of a twice-daily application of the respective preparations. Additionally, specific symptoms such as pruritus, dryness, and

  6. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  7. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  8. A search for parameters of universal sub-barrier fusion excitation function

    Energy Technology Data Exchange (ETDEWEB)

    Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

    2016-11-15

    Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

  9. Mechanical properties of striped bass fish skin: Evidence of an exotendon function of the stratum compactum.

    Science.gov (United States)

    Szewciw, Lawrence; Barthelat, Francois

    2017-09-01

    Teleost fish skin is a multifunctional natural material with high penetration resistance owing to specialized puncture mechanisms of both the individual scale and the intact scaled integument. In this paper, we explore the possible additional role of the skin in fish undulatory locomotion by examining the structural and mechanical properties of the dermal stratum (s.) compactum layer of striped bass (Morone saxatilis) skin. The structure, mechanical response and function of s. compactum was investigated by combining several methods: optical microscopy and histology, tensile tests on descaled skin specimens in different anatomical locations and orientations, puncture tests, and flexural tests on whole fish with disruption of the s. compactum. Local histological features of the s. compactum, such as collagen fiber angle and degree of crimping, were shown to explain corresponding patterns determined for the tensile properties of the skin along the long axis of the fish, including changes in stiffness, strength and locking strain at stiffening. The fish bending tests demonstrated a tendon-like response of the whole fish and a significant contribution of the s. compactum to the flexural stiffness of the fish. Collectively, the findings show that the s. compactum is a strong tissue with a tendon-like nonlinear response, and which provides an appreciable mechanical protection against sharp puncture and lacerations. Our results also support the theory of an exotendon function of the s. compactum in teleost fish skin. These findings may inspire the design of new multifunctional protective and locomotory systems for a variety of engineering applications. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Impact of chemical peeling combined with negative pressure on human skin.

    Science.gov (United States)

    Kim, S J; Kang, I J; Shin, M K; Jeong, K H; Baek, J H; Koh, J S; Lee, S J

    2016-10-01

    In vivo changes in skin barrier function after chemical peeling with alpha hydroxyacids (AHAs) have been previously reported. However, the additional effects of physical treatment with chemical agents on skin barrier function have not been adequately studied. This study measured the degree of acute skin damage and the time required for skin barrier repair using non-invasive bioengineering methods in vivo with human skin to investigate the additional effect of a 4% AHA chemical jet accelerated at supersonic velocities. Thirteen female subjects (average age: 29.54 ± 4.86 years) participated in this study. The faces of the subjects were divided into half according to the block randomization design and were then assigned to receive AHA peeling alone or AHA peeling combined with pneumatic pressure on each side of the face. Transepidermal water loss (TEWL), skin colour and skin blood flow were evaluated at baseline and at 30 min, 2, 5 and 7 days after treatment. The TEWL and skin blood flow were significantly increased after 30 min in chemodermabrasion compared with chemical peeling alone (P peeling alone (P < 0.05). Chemodermabrasion can temporarily impair skin barriers, but it is estimated that it can enhance the skin barrier function after 7 days compared to the use of a chemical agent alone. In addition, chemodermabrasion has a more effective impact in the dermis and relatively preserves the skin barrier. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  11. Barrier and system performances within a safety case: their functioning and evolution with time

    International Nuclear Information System (INIS)

    Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.

    2002-01-01

    The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

  12. Studies on the protection effects of functional foods for skin immune system from radiation damage

    International Nuclear Information System (INIS)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In

    2007-07-01

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. · Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment · Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice · Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells · Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-α, GM-CSF) - Inhibition of c-kit, tryptase, FcεRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  13. Studies on the protection effects of functional foods for skin immune system from radiation damage

    Energy Technology Data Exchange (ETDEWEB)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In [Sunchon National University, Sunchon (Korea, Republic of)

    2007-07-15

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. centre dot Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment centre dot Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice centre dot Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells centre dot Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-alpha, GM-CSF) - Inhibition of c-kit, tryptase, FcepsilonRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  14. Functions of an engineered barrier system for a nuclear waste repository in basalt

    International Nuclear Information System (INIS)

    Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.

    1980-01-01

    Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance

  15. Xanes and SR-XRF Study of Skin as a Barrier to Ultra-Fine Nanocrystals of TiO2

    International Nuclear Information System (INIS)

    Kwiatek, W.M.; Lekki, J.; Stachura, Z.; Hanson, A.; Ablett, J.

    2007-01-01

    Nanocrystalline TiO 2 is commonly used in cosmetic industry as a photoprotective agent. With recent advances in nanomaterial processing, the size of TiO 2 crystals decreased into the nanometre regime. There is no satisfactory evidence that crystals of such small size are harmless to the human population. An EU project NANODERM has been launched where several techniques have been applied to investigate the possibility of particle penetration through the protective horny layer into vital skin regions. Skin biopsies of the animal and human skin have been collected after exposition to formulations containing TiO 2 nanocrystals. The Ti depth distributions were measured by electron and ion microscopy. The microscopy studies did not detect penetration into vital tissue of healthy skin what does not exclude a possibility that TiO 2 could penetrate pathological skin with lowered barrier efficiency. Due to literature the physical effect of the UV irradiation of the TiO 2 nanoparticle is the shift from 4 th to 3 rd oxidation state of the Ti. Titanium at 3 rd oxidation state interact with environment producing free radicals and Reactive Oxygen Species. In order to quantify the oxidation state shift, XANES experiments were carried out with commercially available TiO 2 nanocrystals (6 - 100 nm size), both in anatase and rutile phase. The samples were irradiated with X-rays with, and without accompanying UV illumination at the NSLS X27A beam line. The corresponding XANES spectra were registered and the absorption edge was compared in UV - illuminated and not illuminated spectra. A shift of about 1 eV in the absorption edge position of the rutile sample exposed to UVA light (365 nm, 20 mW/cm 2 ) has been measured and attributed to the changed electron configuration. However, the direction of the shift detected in measured samples was opposite to the expected. (author)

  16. Quality of life and female sexual function after skinning vulvectomy with split-thickness skin graft in women with vulvar intraepithelial neoplasia or vulvar Paget disease.

    Science.gov (United States)

    Lavoué, V; Lemarrec, A; Bertheuil, N; Henno, S; Mesbah, H; Watier, E; Levêque, J; Morcel, K

    2013-12-01

    Vulvar intraepithelial neoplasia (VIN) and vulvar Paget disease are managed with either vulvectomy, destructive treatments (laser, antimitotic drugs) or immunostimulants. All these options are associated with functional complications. The purpose of this study was to evaluate the surgical technique consisting of skinning vulvectomy with split-thickness skin graft, and its effect on overall quality of life and sexual function. A retrospective study was conducted on thirteen patients who underwent skinning vulvectomy with split-thickness skin graft between 1999 and 2009. Overall quality of life and sexual function were assessed with the Medical Outcome Study Short Form 36 (MOS SF-36) and Female Sexual Function Index (FSFI), respectively. The median age of patients was 54 (range: 33-77) years. Three patients had Paget disease and 10 patients had VIN lesions. The excision margins were clear in 46% of cases. The incidence of occult cancer was 31%. The mean follow-up period was 77 (±35) months. Four patients experienced a relapse of their intraepithelial disease. The mean disease-free survival was 58 (±44) months. There was no significant difference in MOS SF-36 scores between the study population and the general population. The patients assessed with the FSFI regained normal sexual function after the surgical procedure. Skinning vulvectomy with split-thickness skin graft is a feasible technique yielding good results in terms of quality of life and sexual function. It enables occult cancer to be diagnosed in patients with VIN or Paget disease. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Comparison of blood flow and cell function in ischemic skin flaps

    International Nuclear Information System (INIS)

    Bean, D.; Rees, R.S.; O'Leary, J.P.; Lynch, J.B.

    1984-01-01

    Cellular function and blood flow in acute, steroid-treated, and surgically delayed random skin flaps have been examined. In these studies, the period following flap elevation could be divided into early (0-2 hr), intermediate (4-6 hr), and late (12 hr) periods of ischemia, based on the cutaneous blood flow and cellular function measured by thallium-201 uptake. There was a close correlation between blood flow and cellular function during the early period of ischemia which became worse with time. Blood flow studies demonstrated a significant difference between the early and intermediate periods of ischemia which was abolished by surgical delay. Improvement in cellular function was accomplished by improved blood flow in the surgically delayed flaps, while steroid-treated flaps enhanced cellular metabolism by another mechanism. Cellular function approximated blood flow during the early and immediate period of ischemia. Steroids may augment cellular function without improving blood flow, while surgical delay improves cellular function by improving blood flow

  18. Lactobacillus frumenti Facilitates Intestinal Epithelial Barrier Function Maintenance in Early-Weaned Piglets

    Science.gov (United States)

    Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua

    2018-01-01

    Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance

  19. The blood-brain barrier and oncology : new insights into function and modulation

    NARCIS (Netherlands)

    Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE

    2000-01-01

    The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the

  20. Modelling of migration from multi-layers and functional barriers: Estimation of parameters

    NARCIS (Netherlands)

    Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.

    2006-01-01

    Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment

  1. Skin graft - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

  2. Investigation on large-area fabrication of vivid shark skin with superior surface functions

    Science.gov (United States)

    Chen, Huawei; Zhang, Xin; Ma, Lingxi; Che, Da; Zhang, Deyuan; Sudarshan, T. S.

    2014-10-01

    Shark skin has attracted worldwide attention because of its superior drag reduction, antifouling performance induced from its unique surface morphology. Although the vivid shark skin has been fabricated by a bio-replicated micro-imprinting approach in previous studies and superior drag reduction effect has been validated in water tunnel, continuous large-area fabrication is still an obstacle to wide apply. In this paper, one novel bio-replication coating technology is proposed for large-area transfer of shark skin based on rapid UV curable paint. Apart from design of coating system, bio-replication accuracy of surface morphology was validated about 97% by comparison between shark skin template and coating surface morphology. Finally, the drag reduction and anti-fouling function of coating surface were tested in water tunnel and open algae pond respectively. Drag reduction rate of coating surface was validated about 12% higher and anti-fouling was proved to about hundred times ameliorate, all of which are more excellent than simple 2D riblet surface.

  3. Radiation dosages absorbed by the skin during videofluorographic examination of velopharyngeal function

    International Nuclear Information System (INIS)

    Ohara, Hirotoshi; Ogata, Hisao; Nakajima, Tatsuo; Sone, Kiyoaki

    2008-01-01

    Radiographic assessment has become essential in examining the function of the soft palate and pharyngeal walls in patients with velopharyngeal insufficiency. However, in our search of the literature, there was no report on the exposure dose during videofluorographic examination of velopharyngeal function in Japan. Radiation dosages from videofluorography were measured by attaching a glass dosimeter to the submental skin in 17 patients undergoing examination of velopharyngeal function. Sixteen patients underwent a complete videofluorographic examination. For these 16 patients, the mean time of examination was 96.4 sec; the mean radiation dosage absorbed by the skin was 14.4 mGy, equivalent to approximately 7 standard skull x-rays and lower than that during other fluoroscopic procedures. This dose was also lower than the threshold dose at which the skin damage occurs. In light of increasing concern among the general public over radiation exposure, we consider that these data should provide useful information to patients being asked to give informed consent for this examination. (author)

  4. Efficacy of a shower cream and a lotion with skin-identical lipids in healthy subjects with atopic dry skin.

    Science.gov (United States)

    Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria

    2018-05-10

    Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.

  5. Functional Assessment and Behavioral Treatment of Skin Picking in a Teenage Girl With Prader-Willi Syndrome

    NARCIS (Netherlands)

    Radstaake, M.; Didden, H.C.M.; Bolio, M.M.L.; Lang, R.B.; Lancioni, G.E.; Curfs, L.M.G.

    2011-01-01

    Skin picking is common in individuals with Prader-Willi Syndrome (PWS) but few treatment studies exist. This study reports the successful functional behavioral assessment (FBA) and treatment of skin picking in a 16-year-old female with PWS. A treatment package based on FBA results consisted of

  6. Functions of fish skin: flexural stiffness and steady swimming of longnose gar, Lepisosteus osseus

    Science.gov (United States)

    Long; Hale; Mchenry; Westneat

    1996-01-01

    The functions of fish skin during swimming remain enigmatic. Does skin stiffen the body and alter the propagation of the axial undulatory wave? To address this question, we measured the skin's in situ flexural stiffness and in vivo mechanical role in the longnose gar Lepisosteus osseus. To measure flexural stiffness, dead gar were gripped and bent in a device that measured applied bending moment (N m) and the resulting midline curvature (m-1). From these values, the flexural stiffness of the body (EI in N m2) was calculated before and after sequential alterations of skin structure. Cutting of the dermis between two caudal scale rows significantly reduced the flexural stiffness of the body and increased the neutral zone of curvature, a region of bending without detectable stiffness. Neither bending property was significantly altered by the removal of a caudal scale row. These alterations in skin structure were also made in live gar and the kinematics of steady swimming was measured before and after each treatment. Cutting of the dermis between two caudal scale rows, performed under anesthesia, changed the swimming kinematics of the fish: tailbeat frequency (Hz) and propulsive wave speed (body lengths per second, L s-1) decreased, while the depth (in L) of the trailing edge of the tail increased. The decreases in tailbeat frequency and wave speed are consistent with predictions of the theory of forced, harmonic vibrations; wave speed, if equated with resonance frequency, is proportional to the square root of a structure's stiffness. While it did not significantly reduce the body's flexural stiffness, surgical removal of a caudal scale row resulted in increased tailbeat amplitude and the relative total hydrodynamic power. In an attempt to understand the specific function of the scale row, we propose a model in which a scale row resists medio-lateral force applied by a single myomere, thus functioning to enhance mechanical advantage for bending. Finally, surgical

  7. Dietary Yeast Cell Wall Extract Alters the Proteome of the Skin Mucous Barrier in Atlantic Salmon (Salmo salar: Increased Abundance and Expression of a Calreticulin-Like Protein.

    Directory of Open Access Journals (Sweden)

    Giulia Micallef

    Full Text Available In order to improve fish health and reduce use of chemotherapeutants in aquaculture production, the immunomodulatory effect of various nutritional ingredients has been explored. In salmon, there is evidence that functional feeds can reduce the abundance of sea lice. This study aimed to determine if there were consistent changes in the skin mucus proteome that could serve as a biomarker for dietary yeast cell wall extract. The effect of dietary yeast cell wall extract on the skin mucus proteome of Atlantic salmon was examined using two-dimensional gel electrophoresis. Forty-nine spots showed a statistically significant change in their normalised volumes between the control and yeast cell wall diets. Thirteen spots were successfully identified by peptide fragment fingerprinting and LC-MS/MS and these belonged to a variety of functions and pathways. To assess the validity of the results from the proteome approach, the gene expression of a selection of these proteins was studied in skin mRNA from two different independent feeding trials using yeast cell wall extracts. A calreticulin-like protein increased in abundance at both the protein and transcript level in response to dietary yeast cell wall extract. The calreticulin-like protein was identified as a possible biomarker for yeast-derived functional feeds since it showed the most consistent change in expression in both the mucus proteome and skin transcriptome. The discovery of such a biomarker is expected to quicken the pace of research in the application of yeast cell wall extracts.

  8. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

    DEFF Research Database (Denmark)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

    2013-01-01

    antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

  9. The effect of environmental humidity and temperature on skin barrier function and dermatitis

    DEFF Research Database (Denmark)

    Engebretsen, K A; Johansen, J D; Kezic, S

    2016-01-01

    existing dermatoses. We searched the literature for studies that evaluated the mechanisms behind this phenomenon. Commonly used meteorological terms such as absolute humidity, relative humidity and dew point are explained. Furthermore, we review the negative effect of low humidity, low temperatures...

  10. Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

    NARCIS (Netherlands)

    Notman, Rebecca; Anwar, Jamshed; Briels, Willem J.; Noro, Massimo G.; den Otter, Wouter K.

    2008-01-01

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO)

  11. Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

    Science.gov (United States)

    Patching, Simon G

    2017-03-01

    Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

  12. Characteristics of functional state of arteriolar and venular skin microvessels in patients with essential arterial hypertension.

    Science.gov (United States)

    Fedorovich, Andrey A; Rogoza, Anatoly N; Chikhladze, Novella M

    2014-05-01

    The aim of the study was to evaluate the vasomotor activity of skin precapillary arterioles, depending on the condition of blood outflow from the capillary bed in patients with essential arterial hypertension (AH). The study included 30 normotensive subjects (NT) and 63 patients with AH, who were tested with a laser Doppler flowmetry with wavelet analysis of blood flow oscillations on the right forearm and ambulatory blood pressure monitoring (ABPM) on the left shoulder. Antihypertensive therapy was stopped for all patients 14 days prior to the experiment or AH was diagnosed for the first time. The hypertensive patients were divided into 2 groups, depending on the amplitude of the respiratory blood flow oscillations in skin microvessels. The first group included 30 patients without blood outflow violations of the capillary bed (AHVN), the second group consisted of 33 patients with various intensity of functional disorders in venular sector of microvasculature (AHVS). If the value of the amplitude of blood flow oscillations can be related to the tone" definition, then AHVN patients have a significant increase in neurogenic component of vascular tone (phypertensive patients can have significant differences in the functional state of microvessels. The assessment of the initial skin microvasculatory regulatory mechanism status could potentially be useful for individual choice of antihypertensive therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Science.gov (United States)

    Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

    2016-01-01

    Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.

  14. Direct Genesis of Functional Rodent and Human Schwann Cells from Skin Mesenchymal Precursors

    Directory of Open Access Journals (Sweden)

    Matthew P. Krause

    2014-07-01

    Full Text Available Recent reports of directed reprogramming have raised questions about the stability of cell lineages. Here, we have addressed this issue, focusing upon skin-derived precursors (SKPs, a dermally derived precursor cell. We show by lineage tracing that murine SKPs from dorsal skin originate from mesenchymal and not neural crest-derived cells. These mesenchymally derived SKPs can, without genetic manipulation, generate functional Schwann cells, a neural crest cell type, and are highly similar at the transcriptional level to Schwann cells isolated from the peripheral nerve. This is not a mouse-specific phenomenon, since human SKPs that are highly similar at the transcriptome level can be made from neural crest-derived facial and mesodermally derived foreskin dermis and the foreskin SKPs can make myelinating Schwann cells. Thus, nonneural crest-derived mesenchymal precursors can differentiate into bona fide peripheral glia in the absence of genetic manipulation, suggesting that developmentally defined lineage boundaries are more flexible than widely thought.

  15. Mathematical models to describe iontophoretic transport in vitro and in vivo and the effect of current application on the skin barrier.

    Science.gov (United States)

    Gratieri, Taís; Kalia, Yogeshvar N

    2013-02-01

    The architecture and composition of the stratum corneum make it a particularly effective barrier against the topical and transdermal delivery of hydrophilic molecules and ions. As a result, different strategies have been explored in order to expand the range of therapeutic agents that can be administered by this route. Iontophoresis involves the application of a small electric potential to increase transport into and across the skin. Since current flow is preferentially via transport pathways with at least some aqueous character, it is ideal for hydrosoluble molecules containing ionisable groups. Hence, the physicochemical properties that limit partitioning and passive diffusion through the intercellular lipid matrix are beneficial for electrically-assisted delivery. The presence of fixed ionisable groups in the skin (pI 4-4.5) means that application of the electric field results in a convective solvent flow (i.e., electroosmosis) in the direction of ion motion so as to neutralise membrane charge. Hence, under physiological conditions, cation electrotransport is due to both electromigration and electroosmosis-their relative contribution depends on the formulation conditions and the physicochemical properties of the permeant. Different mathematical models have been developed to provide a theoretical framework in order to explain iontophoretic transport kinetics. They usually involve solutions of the Nernst-Planck equation - using either the constant field (Goldman) or electroneutrality (Nernst) approximations - with or without terms for the convective solvent flow component. Investigations have also attempted to elucidate the nature of ion transport pathways and to explain the effect of current application on the electrical properties of the skin-more specifically, the stratum corneum. These studies have led to the development of different equivalent circuit models. These range from simple parallel arrangements of a resistor and a capacitor to the inclusion of the

  16. Proton nuclear magnetic resonance study on the barrier function of pig corneal epithelium and endothelium

    International Nuclear Information System (INIS)

    Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.

    1995-01-01

    Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)

  17. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2016-05-01

    Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  19. Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

    Science.gov (United States)

    Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

    2016-01-01

    Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

  20. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  1. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  2. Concerted regulation of retinal pigment epithelium basement membrane and barrier function by angiocrine factors.

    Science.gov (United States)

    Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique

    2017-05-19

    The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.

  3. Internal resistor of multi-functional tunnel barrier for selectivity and switching uniformity in resistive random access memory.

    Science.gov (United States)

    Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang

    2014-01-01

    In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.

  4. Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice

    Science.gov (United States)

    Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo

    2013-01-01

    The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809

  5. Endothelium-Derived 5-Methoxytryptophan Protects Endothelial Barrier Function by Blocking p38 MAPK Activation.

    Directory of Open Access Journals (Sweden)

    Ling-Yun Chu

    Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.

  6. Prolonged phonation impairs the integrity and barrier function of porcine vocal fold epithelium: a preliminary study.

    Science.gov (United States)

    Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J

    2018-04-18

    Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.

  7. Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

    Science.gov (United States)

    Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

    2009-05-01

    Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

  8. Functions and requirements for subsurface barriers used in support of single-shell tank waste retrieval

    International Nuclear Information System (INIS)

    Lowe, S.S.

    1993-01-01

    The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers

  9. Characteristics of histocompatibility barriers in congenis strains of mice. III. Passive enhancement of skin allografts in x-irradiated hosts

    International Nuclear Information System (INIS)

    Cantrell, J.L.; Kaliss, N.; Hildemann, W.H.

    1975-01-01

    Passive immunological enhancement of skin allografts was investigated in three donor-host combinations of congenic mice disparate at non-H-2 loci. Serum against the graft donor was derived from mice that had received donor strain lymphoid cells as neonates, and thereby were rendered specifically tolerant of a skin allograft. We refer to this serum as ''allograft-tolerant'' serum. Each strain combination was chosen to provide only two non-H-2 histoincompatibilities present in the donor and absent in the host. The differences are categorized as immunogenetically strong, moderate, or weak, on the basis of skin allograft survival times. With passively administered allograft-tolerant serum, significantly prolonged graft survivals were noted for the weakest combination only. Combined treatment with sublethal x-irradiation and allograft-tolerant serum significantly prolonged graft survival in both the moderate and weak combinations, with the largest effect present in the weakest disparity. A hyperimmune alloantiserum (produced in adults) directed against the graft donor prolonged allograft survival in the strongest disparity when given in combination with irradiation. In this combination, graft survival time was increased in hosts exposed to x-ray alone, but joint treatment with x-ray and the alloantiserum gave the largest increment. In contrast, combined treatment with the serum and an antithymocyte alloantiserum did not affect graft survival times. Treatment with both radiation and antithymocyte serum did not prolong graft survival beyond that in mice given only x-radiation. Immunological enhancement with central inhibition is assumed as the mechanism underlying prolonged graft survival, and it is suggested that a population of thymus-derived killer cells, sensitive to x-irradiation, is required for normal graft rejection. (U.S.)

  10. Effects of various vehicles on skin hydration in vivo.

    Science.gov (United States)

    Wiedersberg, S; Leopold, C S; Guy, R H

    2009-01-01

    The stratum corneum, the outermost layer of the skin, regulates the passive loss of water to the environment. Furthermore, it is well accepted that drug penetration is influenced by skin hydration, which may be manipulated by the application of moisturizing or oleaginous vehicles. Measurements of transepidermal water loss (TEWL), and of skin hydration using a corneometer, were used to assess the effect of different vehicles on stratum corneum barrier function in vivo in human volunteers. A microemulsion significantly increased skin hydration relative to a reference vehicle based on medium chain triglycerides; in contrast, Transcutol(R) lowered skin hydration. TEWL measurements confirmed these observations. Copyright 2009 S. Karger AG, Basel.

  11. [Skin hydration and hydrating products].

    Science.gov (United States)

    Duplan, H; Nocera, T

    2018-05-01

    One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

  12. Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

    Science.gov (United States)

    Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

    2015-01-01

    Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

  13. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

    2015-10-01

    Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

  14. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  15. Skin autofluorescence is associated with renal function and cardiovascular diseases in pre-dialysis chronic kidney disease patients.

    Science.gov (United States)

    Tanaka, Kenichi; Tani, Yoshihiro; Asai, Jun; Nemoto, Fumihiko; Kusano, Yuki; Suzuki, Hodaka; Hayashi, Yoshimitsu; Asahi, Koichi; Katoh, Tetsuo; Miyata, Toshio; Watanabe, Tsuyoshi

    2011-01-01

    Tissue accumulation of advanced glycation end-products (AGE) is thought to be a contributing factor to the progression of cardiovascular disease (CVD). Skin autofluorescence, a non-invasive measure of AGE accumulation using autofluorescence of the skin under ultraviolet light, has shown associations with CVD in haemodialysis patients. The present study aimed to evaluate relationships of skin autofluorescence to renal function as well as CVD in pre-dialysis patients with chronic kidney disease (CKD). Subjects in this cross-sectional analysis comprised 304 pre-dialysis CKD patients [median age, 62.0 years; median estimated glomerular filtration rate (eGFR), 54.3 mL/min/1.73 m(2); diabetes, n = 81 (26.6%)]. AGE accumulation in skin was assessed by skin autofluorescence using an autofluorescence reader. Relationships between skin autofluorescence, eGFR, CVD history and other parameters were evaluated. Skin autofluorescence correlated negatively with eGFR (r = -0.42, P skin autofluorescence with age, presence of diabetes, eGFR and CVD history in CKD patients (R(2) = 30%). Age, male gender, smoking history, skin autofluorescence and eGFR were significantly correlated with CVD history, and multiple logistic regression analysis identified age [odds ratio (OR), 1.09; 95% confidence interval (CI), 1.03-1.15; P skin autofluorescence (OR, 3.74; 95%CI, 1.54-9.24; P skin autofluorescence increased as GFR decreased and was related to CVD history in CKD patients. Non-invasive autofluorescence readers may provide potential markers for clinical risk assessment in pre-dialysis CKD patients.

  16. Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.

    Science.gov (United States)

    Segger, Dörte; Matthies, Andreas; Saldeen, Tom

    2008-01-01

    To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.

  17. A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

    Energy Technology Data Exchange (ETDEWEB)

    Graham, Peter H., E-mail: peter.graham@sesiahs.health.nsw.gov.au [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Plant, Natalie; Graham, Jennifer L.; Browne, Lois [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Borg, Martin [Department of Radiation Oncology, Royal Adelaide Hospital (Australia); Capp, Anne [Department of Radiation Oncology, Mater Hospital, Newcastle, New South Wales (Australia); Delaney, Geoff P. [Cancer Care Centre, Liverpool Hospital, Liverpool, New South Wales (Australia); Harvey, Jennifer [Mater Hospital, South Brisbane, Queensland (Australia); Kenny, Lisbeth [Royal Brisbane Hospital, Herston, Queensland (Australia); Francis, Michael [Andrew Love Cancer Centre, Geelong (Australia); Zissiadis, Yvonne [Department of Radiation Oncology, Royal Perth Hospital, Perth (Australia)

    2013-05-01

    Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.

  18. A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

    International Nuclear Information System (INIS)

    Graham, Peter H.; Plant, Natalie; Graham, Jennifer L.; Browne, Lois; Borg, Martin; Capp, Anne; Delaney, Geoff P.; Harvey, Jennifer; Kenny, Lisbeth; Francis, Michael; Zissiadis, Yvonne

    2013-01-01

    Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies

  19. p75 Neurotrophin Receptor in the Skin: Beyond Its Neurotrophic Function.

    Science.gov (United States)

    Pincelli, Carlo

    2017-01-01

    p75 neurotrophin receptor (p75 NTR ), also known as CD271, is the low-affinity receptor that, together with the tyrosine kinase receptor tropomyosin-receptor kinase (Trk), mediate neurotrophin (NT) functions. Beside their classic role in skin innervation, NT and their receptors constitute a complex cutaneous network associated with a number of autocrine and paracrine activities. In this context, the role of p75 NTR is becoming more and more important. This review will focus on the intriguing functions of p75 NTR in healthy and diseased skin. First, p75 NTR counterbalances the proliferative and survival activities of its cognate receptor Trk by inducing keratinocyte apoptosis. In addition, p75 NTR identifies an early transit-amplifying (TA) keratinocyte population and plays a critical role in keratinocyte stem cell transition to its progeny as well as in epidermal differentiation. p75 NTR is absent in psoriatic TA cells, thus rendering these cells resistant to apoptosis. On the other hand, p75 NTR infection restores NT-induced apoptosis in psoriatic keratinocytes. Taken together, these results provide evidence for a critical role of p75 NTR in epidermal homeostasis, while its lack may account for the TA defect in psoriasis. While the issue of p75 NTR as a marker of melanoma initiating cells is still to be solved, there is strong evidence that downregulation of this receptor is a precondition to melanoma invasion and metastasis in vitro and in vivo . All in all, this review points to p75 NTR as a major actor in both physiologic and pathologic conditions at the skin level.

  20. Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

    Directory of Open Access Journals (Sweden)

    Selina Beasley

    2014-01-01

    Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

  1. Improving Dispersion and Barrier Properties of Polyketone/Graphene Nanoplatelet Composites via Noncovalent Functionalization Using Aminopyrene.

    Science.gov (United States)

    Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young

    2017-08-23

    A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.

  2. Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

    DEFF Research Database (Denmark)

    Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

    2017-01-01

    Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

  3. Barriers and Facilitators to Implementing Functional Family Therapy in a Community Setting: Client and Practitioner Perspectives.

    Science.gov (United States)

    McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John

    2017-10-01

    While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.

  4. Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

    Science.gov (United States)

    Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

    2018-01-02

    Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

  5. Biosensor Technology Reveals the Disruption of the Endothelial Barrier Function and the Subsequent Death of Blood Brain Barrier Endothelial Cells to Sodium Azide and Its Gaseous Products.

    Science.gov (United States)

    Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott

    2017-09-21

    Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.

  6. Gelatin hydrolysates from farmed Giant catfish skin using alkaline proteases and its antioxidative function of simulated gastro-intestinal digestion.

    Science.gov (United States)

    Ketnawa, Sunantha; Martínez-Alvarez, Oscar; Benjakul, Soottawat; Rawdkuen, Saroat

    2016-02-01

    This work aims to evaluate the ability of different alkaline proteases to prepare active gelatin hydrolysates. Fish skin gelatin was hydrolysed by visceral alkaline-proteases from Giant catfish, commercial trypsin, and Izyme AL®. All antioxidant activity indices of the hydrolysates increased with increasing degree of hydrolysis (Pfish skin, could serve as a potential source of functional food ingredients for health promotion. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  8. Functional and morphological changes in pig skin after single or fractionated doses in x rays

    International Nuclear Information System (INIS)

    Young, C.M.A.; Hopewell, J.W.

    1982-01-01

    The flank skin of pigs has been treated with either single or fractionated doses of x-irradiation. A single dose (2070 cGy) was compared with treatment given as 6 fractions in 18 days (6f/18 days; 3780 cGy) or 30 fractions in 39 days (30f/39 days; 8000 cGy). The doses were selected on the basis that similar levels of late tissue damage would result. Radiation induced changes in the skin were assessed by observing the skin reactions and by the measurement of isotope clearance (functional study), relative field contraction, dermal and epidermal thickness and dermal vascular density (morphological studies). In the three treatment groups the early radiation reaction varied considerably. In the first wave reaction (3 to 6 weeks after treatment) bright red erythema was recorded in many fields but moist desquamation developed only in the 30f/39 days treatment group. The second wave (10-16 weeks) was characterized by an ischemic mauve/dusky reaction. Dermal necrosis developed in 50% of the single dose fields. In the 30f/39 days regimen persistent moist desquamation progressed to dermal necrosis. Neither desquamation nor necrosis developed after 6f/18 days. Different levels of vascular damage in the dermis were assessed using an isotope clearance technique; for example in the early reaction significant changes were recorded in the papillary dermis (faster clearance) prior to the development of moist desquamation (30f/39 days) and in the reticular dermis (slower clearance) before necrosis (single dose). Changes in clearance rates have been correlated with changes in the vascular density and thickness of the dermis. Between 26 and 52 weeks (the late reaction) relative field contraction was slightly greater in the 30f/39 days group than in the other treatment groups

  9. Functional and structural alterations of epithelial barrier properties of rat ileum following X-irradiation

    International Nuclear Information System (INIS)

    Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.

    2004-01-01

    Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)

  10. Collaborative learning to unlock investments for functional ecological infrastructure: Bridging barriers in social-ecological systems in South Africa

    CSIR Research Space (South Africa)

    Angelstam, P

    2017-05-01

    Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...

  11. Chromium-induced skin damage among Taiwanese cement workers.

    Science.gov (United States)

    Chou, Tzu-Chieh; Wang, Po-Chih; Wu, Jyun-De; Sheu, Shiann-Cherng

    2016-10-01

    Little research has been done on the relationships between chromium exposure, skin barrier function, and other hygienic habits in cement workers. Our purpose was to investigate chromium-induced skin barrier disruption due to cement exposure among cement workers. One hundred and eight cement workers were recruited in this study. Urinary chromium concentration was used to characterize exposure levels. The biological exposure index was used to separate high and low chromium exposure. Transepidermal water loss (TEWL) was used to assess the skin barrier function. TEWL was significantly increased in workers with high chromium exposure levels than those with low chromium exposure levels (p = 0.048). A positive correlation was also found between urinary chromium concentration and TEWL (R = 0.28, p = 0.004). After adjusting for smoking status and glove use, a significant correlation between urinary chromium concentrations and TEWL remained. Moreover, workers who smoked and had a high chromium exposure had significantly increased TEWL compared to nonsmokers with low chromium exposure (p = 0.01). Skin barrier function of cement workers may have been disrupted by chromium in cement, and smoking might significantly enhance such skin barrier perturbation with chromium exposure. Decreased chromium skin exposure and smoking cessation should be encouraged at work. © The Author(s) 2015.

  12. Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

    Directory of Open Access Journals (Sweden)

    Golo Storch

    2016-07-01

    Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

  13. War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

    Science.gov (United States)

    Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

    2014-12-01

    Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  15. Nanoscale alterations of corneocytes indicate skin disease

    NARCIS (Netherlands)

    Franz, J.; Beutel, M.; Gevers, K.; Kramer, A.; Thyssen, J. P.; Kezic, S.; Riethmüller, C.

    2016-01-01

    The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here, we extended

  16. Collagen/chitosan based two-compartment and bi-functional dermal scaffolds for skin regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng [Department of Plastic Surgery and Burns, Shenzhen Second People' s Hospital, Shenzhen 518035 (China); Wang, Mingbo [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); She, Zhending [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shenzhen Lando Biomaterials Co., Ltd., Shenzhen 518057 (China); Fan, Kunwu; Xu, Cheng [Department of Plastic Surgery and Burns, Shenzhen Second People' s Hospital, Shenzhen 518035 (China); Chu, Bin; Chen, Changsheng [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shi, Shengjun, E-mail: shengjunshi@yahoo.com [The Burns Department of Zhujiang Hospital, Southern Medical University, Guangzhou 510280 (China); Tan, Rongwei, E-mail: tanrw@landobiom.com [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shenzhen Lando Biomaterials Co., Ltd., Shenzhen 518057 (China)

    2015-07-01

    Inspired from the sophisticated bilayer structures of natural dermis, here, we reported collagen/chitosan based two-compartment and bi-functional dermal scaffolds. Two functions refer to mediating rapid angiogenesis based on recombinant human vascular endothelial growth factor (rhVEGF) and antibacterial from gentamicin, which were encapsulated in PLGA microspheres. The gentamicin and rhVEGF encapsulated PLGA microspheres were further combined with collagen/chitosan mixtures in low (lower layer) and high (upper layer) concentrations, and molded to generate the two-compartment and bi-functional scaffolds. Based on morphology and pore structure analyses, it was found that the scaffold has a distinct double layered porous and connective structure with PLGA microspheres encapsulated. Statistical analysis indicated that the pores in the upper layer and in the lower layer have great variations in diameter, indicative of a two-compartment structure. The release profiles of gentamicin and rhVEGF exceeded 28 and 49 days, respectively. In vitro culture of mouse fibroblasts showed that the scaffold can facilitate cell adhesion and proliferation. Moreover, the scaffold can obviously inhibit proliferation of Staphylococcus aureus and Serratia marcescens, exhibiting its unique antibacterial effect. The two-compartment and bi-functional dermal scaffolds can be a promising candidate for skin regeneration. - Highlights: • The dermal scaffold is inspired from the bilayer structures of natural dermis. • The dermal scaffold has two-compartment structures. • The dermal scaffold containing VEGF and gentamicin encapsulated PLGA microspheres • The dermal scaffold can facilitate cell adhesion and proliferation.

  17. Collagen/chitosan based two-compartment and bi-functional dermal scaffolds for skin regeneration

    International Nuclear Information System (INIS)

    Wang, Feng; Wang, Mingbo; She, Zhending; Fan, Kunwu; Xu, Cheng; Chu, Bin; Chen, Changsheng; Shi, Shengjun; Tan, Rongwei

    2015-01-01

    Inspired from the sophisticated bilayer structures of natural dermis, here, we reported collagen/chitosan based two-compartment and bi-functional dermal scaffolds. Two functions refer to mediating rapid angiogenesis based on recombinant human vascular endothelial growth factor (rhVEGF) and antibacterial from gentamicin, which were encapsulated in PLGA microspheres. The gentamicin and rhVEGF encapsulated PLGA microspheres were further combined with collagen/chitosan mixtures in low (lower layer) and high (upper layer) concentrations, and molded to generate the two-compartment and bi-functional scaffolds. Based on morphology and pore structure analyses, it was found that the scaffold has a distinct double layered porous and connective structure with PLGA microspheres encapsulated. Statistical analysis indicated that the pores in the upper layer and in the lower layer have great variations in diameter, indicative of a two-compartment structure. The release profiles of gentamicin and rhVEGF exceeded 28 and 49 days, respectively. In vitro culture of mouse fibroblasts showed that the scaffold can facilitate cell adhesion and proliferation. Moreover, the scaffold can obviously inhibit proliferation of Staphylococcus aureus and Serratia marcescens, exhibiting its unique antibacterial effect. The two-compartment and bi-functional dermal scaffolds can be a promising candidate for skin regeneration. - Highlights: • The dermal scaffold is inspired from the bilayer structures of natural dermis. • The dermal scaffold has two-compartment structures. • The dermal scaffold containing VEGF and gentamicin encapsulated PLGA microspheres • The dermal scaffold can facilitate cell adhesion and proliferation

  18. Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.

    Science.gov (United States)

    Mitragotri, Samir

    2013-01-01

    Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.

  19. Skin-inspired hydrogel-elastomer hybrids with robust interfaces and functional microstructures

    Science.gov (United States)

    Yuk, Hyunwoo; Zhang, Teng; Parada, German Alberto; Liu, Xinyue; Zhao, Xuanhe

    2016-06-01

    Inspired by mammalian skins, soft hybrids integrating the merits of elastomers and hydrogels have potential applications in diverse areas including stretchable and bio-integrated electronics, microfluidics, tissue engineering, soft robotics and biomedical devices. However, existing hydrogel-elastomer hybrids have limitations such as weak interfacial bonding, low robustness and difficulties in patterning microstructures. Here, we report a simple yet versatile method to assemble hydrogels and elastomers into hybrids with extremely robust interfaces (interfacial toughness over 1,000 Jm-2) and functional microstructures such as microfluidic channels and electrical circuits. The proposed method is generally applicable to various types of tough hydrogels and diverse commonly used elastomers including polydimethylsiloxane Sylgard 184, polyurethane, latex, VHB and Ecoflex. We further demonstrate applications enabled by the robust and microstructured hydrogel-elastomer hybrids including anti-dehydration hydrogel-elastomer hybrids, stretchable and reactive hydrogel-elastomer microfluidics, and stretchable hydrogel circuit boards patterned on elastomer.

  20. Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice

    Science.gov (United States)

    Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua

    2012-01-01

    AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548

  1. A Lactobacillus mutant capable of accumulating long-chain polyphosphates that enhance intestinal barrier function.

    Science.gov (United States)

    Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio

    2016-05-01

    Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.

  2. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Directory of Open Access Journals (Sweden)

    Xiang Ling

    Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may

  3. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  4. Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries

    KAUST Repository

    Huang, Jing-Kai

    2018-01-04

    Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.

  5. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  6. Additive impairment of the barrier function and irritation by biogenic amines and sodium lauryl sulphate: a controlled in vivo tandem irritation study.

    Science.gov (United States)

    Fluhr, J W; Kelterer, D; Fuchs, S; Kaatz, M; Grieshaber, R; Kleesz, P; Elsner, P

    2005-01-01

    Biogenic amines are potential irritants e.g. in fish-, meat-, milk- and egg-processing professions like cooks, butchers and bakers. The aim of this study was to test the irritative and barrier-disrupting properties of the biogenic amines ammonium hydroxide (AM), dimethylamine (DMA) and trimethylamine (TMA). A repeated sequential irritation of 30 min twice per day was performed over a total of 4 days (tandem repeated irritation test) on the back of 20 healthy volunteers of both sexes with AM, DMA, TMA and sodium lauryl sulphate (SLS). The epidermal barrier function was assessed with a Tewameter TM 210, stratum corneum surface pH was measured with a Skin-pH-Meter 900, inflammation was assessed with a Chromameter CR-300 on the a* axis for redness and a visual score was recorded. All tested biogenic amines (AM, DMA and TMA) induced a barrier disruption and a pH increase paralleled with a 1-day-delayed onset of inflammatory signs. These effects were further enhanced and accelerated by a sequential application of SLS together with the biogenic amines, and inflammation occurred earlier than with the single compounds. Acetic acid (AA) in contrast did only show mild barrier disruption and no significant inflammatory signs. Our system allowed a ranking of the different compounds in their irritative potential in the tandem irritation with SLS: SLS > NaOH > TMA > AA > AM > DMA. The results are suggestive that in the food-processing industry the simultaneous contact with biogenic amines and harmful detergents like SLS should be minimized. Copyright 2005 S. Karger AG, Basel.

  7. The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

    2009-09-01

    A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

  8. Amino Acid Profile, Group of Functional and Molecular Weight Distribution of Goat Skin Gelatin That Produced Through Acid Process

    Directory of Open Access Journals (Sweden)

    Muhammad Irfan Said

    2012-02-01

    Full Text Available Gelatin is a product of hydrolysis of collagen protein from animals that are partially processed.  Gelatin used in food and non food industries.  Gelatin is produced when many import of raw skins and bones of pigs and cows.  Goat skins potential as a raw material substitution that still doubt its halal. Process production of gelatin determine the properties of gelatin. The objectives of this research were to determine amino acid profile, group of functional and molecular weight distribution of gelatin made from goat skins which was produced through a process of acid. The skin of male Bligon goat, 1.5 to 2.5 year old was used as raw materials. Process production of gelatin was using acid type acetic acid (CH3COOH 0.5 M (v/v as curing material. The experimental design applied in this study and commercial gelatin was used as control. The results showed that gelatin produced from goat skin through the process of acid had properties identical with commercial gelatin. It can be concluded that the gelatin has the potential substitute product of commercial gelatin. Keywords: collagen, gelatin, goat skin, curing, acid process

  9. Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions

    Directory of Open Access Journals (Sweden)

    Milos Mihajlovic

    2017-11-01

    Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.

  10. Employment status, employment functioning, and barriers to employment among VA primary care patients.

    Science.gov (United States)

    Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia

    2016-03-15

    Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.

  11. Experimental fusion excitation functions and derived barrier distributions for heavy ion systems involving prolate and oblate target nuclei

    International Nuclear Information System (INIS)

    Bierman, J.D.; Chan, P.; Liang, J.F.; Kelly, M.P.; Sonzogni, A.A.; Vandenbosch, R.

    1996-01-01

    Fusion excitation functions spanning the entire barrier region in 1 MeV energy steps for the two systems 40 Ca + 192 Os, 194 Pt are presented. The results of fission fragment angular distribution measurements for fusion-fission of 40 Ca + 197 Au at several projectile energies within the barrier region are also presented. The fusion data is of high enough precision to allow for extraction of the distribution of fusion barriers from the second differential of the product of E and σ. Basic coupled channels calculations which are in quite good agreement with the data are shown and discussed

  12. Fulfillment of the long-term safety functions by the different barriers during the main time frames after repository closure

    International Nuclear Information System (INIS)

    Preter, P. de; Lalieux, Ph.

    2002-01-01

    In general terms the basis long-term safety functions of a disposal system (i.e. the engineered barrier system, including the waste forms and the host rock) are the functions that the system as a whole or its constituents must fulfill in order to assure an adequate level of long-term radiological safety. The long-term safety functions of a disposal system constitute a generic and methodological tool that can be used in a double sense. In the first place these functions provide an a priori instrument for designing the system: the implementer must ensure that these safety functions are fulfilled by a series of robust system barriers and components. These functions can also be used as an a posteriori means to describe and assess in general terms the functioning of the system. In this way they are an important qualitative element to help to support the safety case and to identify further R and D priorities. By providing a general description of system functioning they are also a communication tool to stakeholders who are less familiar with the details of a safety case. Instead of limiting the description to a multi-barrier system, the safety functions enable to better explain how the different barriers contribute to one or more safety functions and by which processes this is performed. By doing so the system description moves from multi-barrier to multi-function. The aim of this paper is to provide such a general description of the system functioning for the Belgian case of deep disposal of high-level waste (mainly spent fuel or vitrified waste from fuel reprocessing) in the Boom Clay, o poorly-indurated argillaceous formation. From the detailed safety and performance evaluations the main time frames after repository closure are identified. Each time frame relates to a period during which the successive safety functions play a key role. Also, in each time frame the radiological impact on the environment is distinctly different. (authors)

  13. Alterations in Factors Involved in Differentiation and Barrier Function in the Epithelium in Oral and Genital Lichen Planus.

    Science.gov (United States)

    Danielsson, Karin; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin

    2017-02-08

    Lichen planus is a chronic recurrent inflammatory disease affecting both skin and mucosa, mainly in oral and/or genital regions. Keratinocytes go through a well-regulated process of proliferation and differentiation, alterations in which may result in defects in the protective epithelial barrier. Long-term barrier impairment might lead to chronic inflammation. In order to broaden our understanding of the differentiation process in mucosal lichen planus, we mapped the expression of 4 factors known to be involved in differentiation. Biopsies were collected from oral and genital lichen planus lesions and normal controls. Altered expression of all 4 factors in epithelium from lichen planus lesions was found, clearly indicating disturbed epithelial differentiation in lichen planus lesions.

  14. Efficacy of transgene expression in porcine skin as a function of electrode choice

    DEFF Research Database (Denmark)

    Gotholf, Anita; Mahmood, Faisad; Dagnæs-Hansen, Frederik

    2011-01-01

    , have mainly been performed in rodents and the body of evidence on electrode choice and optimal pulsing conditions is limited. We therefore tested plate and needle electrodes in vivo in porcine skin, which resembles human skin in structure. The luciferase (pCMV-Luc) gene was injected intradermally...... and subsequently electroporated. Simultaneously, studies with gene electrotransfer to porcine skin using plasmids coding for green fluorescent protein (GFP) and betagalactosidase were performed. Interestingly, we found needle electrodes to be more efficient than plate electrodes (p..., our data support that needle electrodes should be used in human clinical studies of gene electrotransfer to skin for improved expression....

  15. Alteration of intestinal barrier function during activity-based anorexia in mice.

    Science.gov (United States)

    Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse

    2014-12-01

    Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  16. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Science.gov (United States)

    Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti

    2016-01-01

    Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  17. Intestinal epithelial barrier function and tight junction proteins with heat and exercise

    DEFF Research Database (Denmark)

    Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

    2016-01-01

    A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or "leaky" intestinal tight junction barrier allows augmented perme...

  18. Version 1.1 of the international spinal cord injury skin and thermoregulation function basic data set

    DEFF Research Database (Denmark)

    Biering-Sørensen, F; Alexander, M S; van Asbeck, F W A

    2017-01-01

    ' or 'stages' with 'categories'; therefore, the word 'category' is used instead of 'grade' or 'stage'. CONCLUSIONS: Impracticable measurements have been adjusted and new terminology adopted. All are to be found on ISCoS website: http://www.iscos.org.uk/international-sci-skin-and-thermoregulation-function-data-sets....

  19. Barriers to Medical Compassion as a Function of Experience and Specialization: Psychiatry, Pediatrics, Internal Medicine, Surgery, and General Practice.

    Science.gov (United States)

    Fernando, Antonio T; Consedine, Nathan S

    2017-06-01

    Compassion is an expectation of patients, regulatory bodies, and physicians themselves. Most research has, however, studied compassion fatigue rather than compassion itself and has concentrated on the role of the physician. The Transactional Model of Physician Compassion suggests that physician, patient, external environment, and clinical factors are all relevant. Because these factors vary both across different specialities and among physicians with differing degrees of experience, barriers to compassion are also likely to vary. We describe barriers to physician compassion as a function of specialization (psychiatry, general practice, surgery, internal medicine, and pediatrics) and physician experience. We used a cross-sectional study using demographic data, specialization, practice parameters, and the Barriers to Physician Compassion Questionnaire. Nonrandom convenience sampling was used to recruit 580 doctors, of whom 444 belonged to the targeted speciality groups. The sample was characterized before conducting a factorial Multivariate Analysis of Covariance and further post hoc analyses. A 5 (speciality grouping) × 2 (more vs. less physician experience) Multivariate Analysis of Covariance showed that the barriers varied as a function of both speciality and experience. In general, psychiatrists reported lower barriers, whereas general practitioners and internal medicine specialists generally reported greater barriers. Barriers were generally greater among less experienced doctors. Documenting and investigating barriers to compassion in different speciality groups have the potential to broaden current foci beyond the physician and inform interventions aimed at enhancing medical compassion. In addition, certain aspects of the training or practice of psychiatry that enhance compassion may mitigate barriers to compassion in other specialities. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  20. Stratum corneum hydration and skin surface pH in patients with atopic dermatitis.

    Science.gov (United States)

    Knor, Tanja; Meholjić-Fetahović, Ajša; Mehmedagić, Aida

    2011-01-01

    Atopic dermatitis (AD) is a chronically relapsing skin disease with genetic predisposition, which occurs most frequently in preschool children. It is considered that dryness and pruritus, which are always present in AD, are in correlation with degradation of the skin barrier function. Measurement of hydration and pH value of the stratum corneum is one of the noninvasive methods for evaluation of skin barrier function. The aim of the study was to assess skin barrier function by measuring stratum corneum hydration and skin surface pH of the skin with lesions, perilesional skin and uninvolved skin in AD patients, and skin in a healthy control group. Forty-two patients were included in the study: 21 young and adult AD patients and 21 age-matched healthy controls. Capacitance, which is correlated with hydration of stratum corneum and skin surface pH were measured on the forearm in the above areas by SM810/CM820/pH900 combined units (Courage AND Khazaka, Germany). The mean value of water capacitance measured in AD patients was 44.1 ± 11.6 AU (arbitrary units) on the lesions, 60.2 ± 12.4 AU on perilesional skin and 67.2 ± 8.8 AU on uninvolved skin. In healthy controls, the mean value was 74.1 ± 9.2 AU. The mean pH value measured in AD patients was 6.13 ± 0.52 on the lesions, 5.80 ± 0.41 on perilesional skin, and 5.54 ± 0.49 on uninvolved skin. In control group, the mean pH of the skin surface was 5.24 ± 0.40. The values of both parameters measured on lesional skin were significantly different (capacitance decreased and pH increased) from the values recorded on perilesional skin and uninvolved skin. The same held for the relation between perilesional and uninvolved skin. According to study results, the uninvolved skin of AD patients had significantly worse values of the measured parameters as compared with control group. The results of this study suggested the skin barrier function to be degraded in AD patients, which is specifically expressed in lesional skin.

  1. Tests of potential functional barriers for laminated multilayer food packages. Part II: Medium molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Rijk, R

    2000-09-01

    Experiments were performed to characterize the kinetics of the permeation of different medium molecular weight model permeants: bisphenol A, warfarin and anthracene, from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick orientated polypropylene--OPP) into the food simulants olive oil and 3% (w/v) acetic acid. The characterization of permeation kinetics generally observed the permeation models previously reported to explain the experimental permeation results obtained for a low molecular weight group of model permeants. In general, the model permeants exhibited behaviour consistent with their relative molecular weights with respect to (a) the time taken to attain steady-state permeation into the food simulant in which they were more soluble, (b) their subsequent steady-state permeation rates, and (c) their partition between liquid paraffin and the OPP membrane.

  2. The effect of fucoidan on intestinal flora and intestinal barrier function in rats with breast cancer.

    Science.gov (United States)

    Xue, Meilan; Ji, Xinqiang; Liang, Hui; Liu, Ying; Wang, Bing; Sun, Lingling; Li, Weiwei

    2018-02-21

    Recent research studies have shown that the intestinal flora are related to the occurrence and progress of breast cancer. This study investigates the effect of fucoidan on intestinal flora and intestinal barrier function in rats with 7,12-dimethylbenz[a]anthracene (DMBA)-induced breast cancers. Sixty female Sprague-Dawley rats were randomly assigned to the control group, the model group, and the F1 and F2 groups, which were fed fucoidan at concentrations of 200 and 400 mg per kg bw (body weight), respectively. Intestinal histopathological analysis was performed and 16S rDNA high-throughput sequencing was used to provide an overview of the intestinal flora composition. The contents of d-lactic acid (d-LA), diamine oxidase (DAO) and endotoxin in plasma were detected by ELISA. Expression levels of the tight junction (TJ) proteins, phosphorylated p38 MAPK and ERK1/2 were measured using western blotting. Our results suggested that the intestinal wall of the model group was damaged. However, after fucoidan intervention, the villi were gradually restored. ELISA showed that the levels of plasma endotoxin, d-LA and DAO decreased in the F1 and F2 groups compared to those in the model group. Fucoidan treatment also increased the expressions of ZO-1, occludin, claudin-1 and claudin-8. Furthermore, the expression levels of phosphorylated p38 MAPK and ERK1/2 were upregulated in fucoidan treatment groups. The results of 16S rDNA high-throughput sequencing indicated that fucoidan increased the diversity of the intestinal microbiota and induced changes in microbial composition, with the increased Bacteroidetes/Firmicutes phylum ratio. In conclusion, the supplement of fucoidan could improve the fecal microbiota composition and repair the intestinal barrier function. The study suggested the use of fucoidan as an intestinal flora modulator for potential prevention of breast cancer.

  3. Friction of human skin against smooth and rough glass as a function of the contact pressure

    NARCIS (Netherlands)

    Derler, S.; Gerhardt, L.C.; Lenz, A.; Bertaux, E.; Hadad, M.

    2009-01-01

    The friction behaviour of human skin was studied by combining friction measurements using a tri-axial force plate with skin contact area measurements using a pressure sensitive film. Four subjects carried out friction measurement series, in which they rubbed the index finger pad and the edge of the

  4. International spinal cord injury skin and thermoregulation function basic data set

    DEFF Research Database (Denmark)

    Karlsson, Annette; Krassioukov, A; Alexander, M S

    2012-01-01

    To create an international spinal cord injury (SCI) skin and thermoregulation basic data set within the framework of the International SCI Data Sets.......To create an international spinal cord injury (SCI) skin and thermoregulation basic data set within the framework of the International SCI Data Sets....

  5. Effects of high-altitude exercise training on contractile function of rat skinned cardiomyocyte.

    Science.gov (United States)

    Cazorla, O; Aït Mou, Y; Goret, L; Vassort, G; Dauzat, M; Lacampagne, A; Tanguy, S; Obert, P

    2006-09-01

    Previous studies have questioned whether there is an improved cardiac function after high-altitude training. Accordingly, the present study was designed specifically to test whether this apparent blunted response of the whole heart to training can be accounted for by altered mechanical properties at the cellular level. Adult rats were trained for 5 weeks under normoxic (N, NT for sedentary and trained animals, respectively) or hypobaric hypoxic (H, HT) conditions. Cardiac morphology and function were evaluated by echocardiography. Calcium Ca2+ sensitivity of the contractile machinery was estimated in skinned cardiomyocytes isolated from the left ventricular (LV) sub-epicardium (Epi) and sub-endocardium (Endo) at short and long sarcomere lengths (SL). Cardiac remodelling was harmonious (increase in wall thickness with chamber dilatation) in NT rats and disharmonious (hypertrophy without chamber dilatation) in HT rats. Contrary to NT rats, HT rats did not exhibit enhancement in global cardiac performance evaluated by echocardiography. Stretch- dependent Ca2+ sensitization of the myofilaments (cellular index of the Frank-Starling mechanism) increased from Epi to Endo in N rats. Training in normoxic conditions further increased this stretch-dependent Ca2+ sensitization. Chronic hypoxia did not significantly affect myofibrilar Ca2+ sensitivity. In contrast, high-altitude training decreased Ca2+ sensitivity of the myofilaments at both SL, mostly in Endo cells, resulting in a loss of the transmural gradient of the stretch-dependent Ca2+ sensitization. Expression of myosin heavy chain isoforms was affected both by training and chronic hypoxia but did not correlate with mechanical data. Training at sea level increased the transmural gradient of stretch-dependent Ca2+ sensitization of the myofilaments, accounting for an improved Frank-Starling mechanism. High-altitude training depressed myofilament response to Ca2+, especially in the Endo layer. This led to a reduction in

  6. The biology of skin wetness perception and its implications in manual function and for reproducing complex somatosensory signals in neuroprosthetics.

    Science.gov (United States)

    Filingeri, Davide; Ackerley, Rochelle

    2017-04-01

    Our perception of skin wetness is generated readily, yet humans have no known receptor (hygroreceptor) to signal this directly. It is easy to imagine the sensation of water running over our hands or the feel of rain on our skin. The synthetic sensation of wetness is thought to be produced from a combination of specific skin thermal and tactile inputs, registered through thermoreceptors and mechanoreceptors, respectively. The present review explores how thermal and tactile afference from the periphery can generate the percept of wetness centrally. We propose that the main signals include information about skin cooling, signaled primarily by thinly myelinated thermoreceptors, and rapid changes in touch, through fast-conducting, myelinated mechanoreceptors. Potential central sites for integration of these signals, and thus the perception of skin wetness, include the primary and secondary somatosensory cortices and the insula cortex. The interactions underlying these processes can also be modeled to aid in understanding and engineering the mechanisms. Furthermore, we discuss the role that sensing wetness could play in precision grip and the dexterous manipulation of objects. We expand on these lines of inquiry to the application of the knowledge in designing and creating skin sensory feedback in prosthetics. The addition of real-time, complex sensory signals would mark a significant advance in the use and incorporation of prosthetic body parts for amputees in everyday life. NEW & NOTEWORTHY Little is known about the underlying mechanisms that generate the perception of skin wetness. Humans have no specific hygroreceptor, and thus temperature and touch information combine to produce wetness sensations. The present review covers the potential mechanisms leading to the perception of wetness, both peripherally and centrally, along with their implications for manual function. These insights are relevant to inform the design of neuroengineering interfaces, such as sensory

  7. Investigating the Potential Barrier Function of Nanostructured Materials Formed in Engineered Barrier Systems (EBS) Designed for Nuclear Waste Isolation.

    Science.gov (United States)

    Cuevas, Jaime; Ruiz, Ana Isabel; Fernández, Raúl

    2018-02-21

    Clay and cement are known nano-colloids originating from natural processes or traditional materials technology. Currently, they are used together as part of the engineered barrier system (EBS) to isolate high-level nuclear waste (HLW) metallic containers in deep geological repositories (DGR). The EBS should prevent radionuclide (RN) migration into the biosphere until the canisters fail, which is not expected for approximately 10 3  years. The interactions of cementitious materials with bentonite swelling clay have been the scope of our research team at the Autonomous University of Madrid (UAM) with participation in several European Union (EU) projects from 1998 up to now. Here, we describe the mineral and chemical nature and microstructure of the alteration rim generated by the contact between concrete and bentonite. Its ability to buffer the surrounding chemical environment may have potential for further protection against RN migration. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Hand and finger dexterity as a function of skin temperature, EMG, and ambient condition.

    Science.gov (United States)

    Chen, Wen-Lin; Shih, Yuh-Chuan; Chi, Chia-Fen

    2010-06-01

    This article examines the changes in skin temperature (finger, hand, forearm), manual performance (hand dexterity and strength), and forearm surface electromyograph (EMG) through 40-min, 11 degrees C water cooling followed by 15-min, 34 degrees C water rewarming; additionally, it explores the relationship between dexterity and the factors of skin temperature, EMG, and ambient condition. Hand exposure in cold conditions is unavoidable and significantly affects manual performance. Two tasks requiring gross and fine dexterity were designed, namely, nut loosening and pin insertion, respectively. The nested-factorial design includes factors of gender, participant (nested within gender), immersion duration, muscle type (for EMG), and location (for skin temperature). The responses are changes in dexterity, skin temperature, normalized amplitude of EMG, and grip strength. Finally, factor analysis and stepwise regression are used to explore factors affecting hand and finger dexterity. Dexterity, EMG, and skin temperature fell with prolonged cooling, but the EMG of the flexor digitorum superficialis remained almost unchanged during the nut loosening task. All responses but the forearm skin temperature recovered to the baseline level at the end of rewarming. The three factors extracted by factor analysis are termed skin temperature, ambient condition, and EMG. They explain approximately two thirds of the variation of the linear models for both dexterities, and the factor of skin temperature is the most influential. Sustained cooling and warming significantly decreases and increases finger, hand, and forearm skin temperature. Dexterity, strength, and EMG are positively correlated to skin temperature. Therefore, keeping the finger, hand, and forearm warm is important to maintaining hand performance. The findings could be helpful to building safety guidelines for working in cold environments.

  9. Melatonin, mitochondria, and the skin.

    Science.gov (United States)

    Slominski, Andrzej T; Zmijewski, Michal A; Semak, Igor; Kim, Tae-Kang; Janjetovic, Zorica; Slominski, Radomir M; Zmijewski, Jaroslaw W

    2017-11-01

    The skin being a protective barrier between external and internal (body) environments has the sensory and adaptive capacity to maintain local and global body homeostasis in response to noxious factors. An important part of the skin response to stress is its ability for melatonin synthesis and subsequent metabolism through the indolic and kynuric pathways. Indeed, melatonin and its metabolites have emerged as indispensable for physiological skin functions and for effective protection of a cutaneous homeostasis from hostile environmental factors. Moreover, they attenuate the pathological processes including carcinogenesis and other hyperproliferative/inflammatory conditions. Interestingly, mitochondria appear to be a central hub of melatonin metabolism in the skin cells. Furthermore, substantial evidence has accumulated on the protective role of the melatonin against ultraviolet radiation and the attendant mitochondrial dysfunction. Melatonin and its metabolites appear to have a modulatory impact on mitochondrion redox and bioenergetic homeostasis, as well as the anti-apoptotic effects. Of note, some metabolites exhibit even greater impact than melatonin alone. Herein, we emphasize that melatonin-mitochondria axis would control integumental functions designed to protect local and perhaps global homeostasis. Given the phylogenetic origin and primordial actions of melatonin, we propose that the melatonin-related mitochondrial functions represent an evolutionary conserved mechanism involved in cellular adaptive response to skin injury and repair.

  10. Electrochemical monitoring of native catalase activity in skin using skin covered oxygen electrode.

    Science.gov (United States)

    Nocchi, Sarah; Björklund, Sebastian; Svensson, Birgitta; Engblom, Johan; Ruzgas, Tautgirdas

    2017-07-15

    A skin covered oxygen electrode, SCOE, was constructed with the aim to study the enzyme catalase, which is part of the biological antioxidative system present in skin. The electrode was exposed to different concentrations of H 2 O 2 and the amperometric current response was recorded. The observed current is due to H 2 O 2 penetration through the outermost skin barrier (referred to as the stratum corneum, SC) and subsequent catalytic generation of O 2 by catalase present in the underlying viable epidermis and dermis. By tape-stripping the outermost skin layers we demonstrate that SC is a considerable diffusion barrier for H 2 O 2 penetration. Our experiments also indicate that skin contains a substantial amount of catalase, which is sufficient to detoxify H 2 O 2 that reaches the viable epidermis after exposure of skin to high concentrations of peroxide (0.5-1mM H 2 O 2 ). Further, we demonstrate that the catalase activity is reduced at acidic pH, as compared with the activity at pH 7.4. Finally, experiments with often used penetration enhancer thymol shows that this compound interferes with the catalase reaction. Health aspect of this is briefly discussed. Summarizing, the results of this work show that the SCOE can be utilized to study a broad spectrum of issues involving the function of skin catalase in particular, and the native biological antioxidative system in skin in general. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Physiochemical and functional properties of tiger puffer (Takifugu rubripes) skin gelatin as affected by extraction conditions.

    Science.gov (United States)

    Pan, Jinfeng; Li, Qi; Jia, Hui; Xia, Lining; Jin, Wengang; Shang, Meijun; Xu, Chang; Dong, Xiuping

    2018-04-01

    The study investigated physiochemical and functional properties of gelatins from tiger puffer skin (GTPS) extracted with warm-water method at 45, 55 and 65°C for 3, 6 and 12h. GTPS45 exhibited strong γ-, β-, α1- and α2-chains, but they faded with the presence of fragments (<80KDa) in other GTPS. As the increase of temperature and time, amide I and A were shifted to higher wavenumber and their amplitudes in GTPS65-12 decreased. Lightness declined while redness and yellowness were enhanced. Gel strength was in a range of 144.5-79.8g, where it of GTPS45-3 was the highest while it of GTPS65-12 was the lowest (p<0.05), coincided with the longer relaxation time of T 22 for immobilized water. Decline in gelling and melting temperature was observed when temperature and time increased. EAI and ESI increased as time prolonged or temperature climbed (p<0.05), in agreement with the form of emulsion droplet by microscopy. Both category and level of volatile compounds increased GTPS65-12 and 55-12 compared with those in GTPS45-12. Results suggest that temperature and time greatly affect the properties of GTPS. To ensure good properties, GTPS should be extracted at a temperature of 45-55°C for less than 12h. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. PACAP system evolution and its role in melanophore function in teleost fish skin.

    Science.gov (United States)

    Cardoso, João C R; Félix, Rute C; Martins, Rute S T; Trindade, Marlene; Fonseca, Vera G; Fuentes, Juan; Power, Deborah M

    2015-08-15

    Pituitary adenylate cyclase-activating polypeptide (PACAP) administered to tilapia melanophores ex-vivo causes significant pigment aggregation and this is a newly identified function for this peptide in fish. The G-protein coupled receptors (GPCRs), adcyap1r1a (encoding Pac1a) and vipr2a (encoding Vpac2a), are the only receptors in melanophores with appreciable levels of expression and are significantly (p < 0.05) down-regulated in the absence of light. Vpac2a is activated exclusively by peptide histidine isoleucine (PHI), which suggests that Pac1a mediates the melanin aggregating effect of PACAP on melanophores. Paradoxically activation of Pac1a with PACAP caused a rise in cAMP, which in fish melanophores is associated with melanin dispersion. We hypothesise that the duplicate adcyap1ra and vipr2a genes in teleosts have acquired a specific role in skin and that the melanin aggregating effect of PACAP results from the interaction of Pac1a with Ramp that attenuates cAMP-dependent PKA activity and favours the Ca(2+)/Calmodulin dependent pathway. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Physiochemical and functional properties of chum salmon (Oncorhynchus keta) skin gelatin extracted at different temperatures.

    Science.gov (United States)

    Liu, Yang; Xia, Lining; Jia, Hui; Li, Qi; Jin, Wengang; Dong, Xiuping; Pan, Jinfeng

    2017-12-01

    Aquatic source gelatins are gaining more attention due to the advantages in safety and religion acceptability compared with mammalian sources. For understanding the effects of extracting temperature on gelatins from chum salmon (Oncorhynchus keta) skins (GCSS), gelatins were extracted at temperatures from 40 to 90°C and the physiochemical properties of GCSS were investigated. GCSS yield increased while imino acids content declined as the increase of temperature. GCSS40, 50 and 60 showed strong β-, α1- and α2-chains but the three faded in GCSS70, 80 and 90, with the presence of low molecular weight fragments. Amides A, I and III were shifted to higher wavenumber in GCSS70, 80 and 90 compared with that of GCSS40, 50 and 60. X-ray diffraction showed lower intensity of peak at 7° in GCSS80 and 90 than in the other GCSS. Gel strength declined while a*, b* and ΔE* value increased as temperature increased. Foam expansion and stability of GCSS40, 50 and 60 were lower than those of GCSS70, 80 and 90. Emulsion activity and stability decreased as temperature increased. Extracting temperature greatly affected yield, molecular composition and functionalities of GCSS. A temperature lower than 50°C is recommended for GCSS extraction. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  14. Ex vivo generation of a functional and regenerative wound epithelium from axolotl (Ambystoma mexicanum) skin.

    Science.gov (United States)

    Ferris, Donald R; Satoh, Akira; Mandefro, Berhan; Cummings, Gillian M; Gardiner, David M; Rugg, Elizabeth L

    2010-10-01

    Urodele amphibians (salamanders) are unique among adult vertebrates in their ability to regenerate structurally complete and fully functional limbs. Regeneration is a stepwise process that requires interactions between keratinocytes, nerves and fibroblasts. The formation of a wound epithelium covering the amputation site is an early and necessary event in the process but the molecular mechanisms that underlie the role of the wound epithelium in regeneration remain unclear. We have developed an ex vivo model that recapitulates many features of in vivo wound healing. The model comprises a circular explant of axolotl (Ambystoma mexicanum) limb skin with a central circular, full thickness wound. Re-epithelialization of the wound area is rapid (typically <11 h) and is dependent on metalloproteinase activity. The ex vivo wound epithelium is viable, responds to neuronal signals and is able to participate in ectopic blastema formation and limb regeneration. This ex vivo model provides a reproducible and tractable system in which to study the cellular and molecular events that underlie wound healing and regeneration. © 2010 The Authors. Journal compilation © 2010 Japanese Society of Developmental Biologists.

  15. Polymicrobial sepsis impairs bystander recruitment of effector cells to infected skin despite optimal sensing and alarming function of skin resident memory CD8 T cells.

    Directory of Open Access Journals (Sweden)

    Derek B Danahy

    2017-09-01

    Full Text Available Sepsis is a systemic infection that enhances host vulnerability to secondary infections normally controlled by T cells. Using CLP sepsis model, we observed that sepsis induces apoptosis of circulating memory CD8 T-cells (TCIRCM and diminishes their effector functions, leading to impaired CD8 T-cell mediated protection to systemic pathogen re-infection. In the context of localized re-infections, tissue resident memory CD8 T-cells (TRM provide robust protection in a variety of infectious models. TRM rapidly 'sense' infection in non-lymphoid tissues and 'alarm' the host by enhancing immune cell recruitment to the site of the infection to accelerate pathogen clearance. Here, we show that compared to pathogen-specific TCIRCM, sepsis does not invoke significant numerical decline of Vaccinia virus induced skin-TRM keeping their effector functions (e.g., Ag-dependent IFN-γ production intact. IFN-γ-mediated recruitment of immune cells to the site of localized infection was, however, reduced in CLP hosts despite TRM maintaining their 'sensing and alarming' functions. The capacity of memory CD8 T-cells in the septic environment to respond to inflammatory cues and arrive to the site of secondary infection/antigen exposure remained normal suggesting T-cell-extrinsic factors contributed to the observed lesion. Mechanistically, we showed that IFN-γ produced rapidly during sepsis-induced cytokine storm leads to reduced IFN-γR1 expression on vascular endothelium. As a consequence, decreased expression of adhesion molecules and/or chemokines (VCAM1 and CXCL9 on skin endothelial cells in response to TRM-derived IFN-γ was observed, leading to sub-optimal bystander-recruitment of effector cells and increased susceptibility to pathogen re-encounter. Importantly, as visualized by intravital 2-photon microscopy, exogenous administration of CXCL9/10 was sufficient to correct sepsis-induced impairments in recruitment of effector cells at the localized site of TRM

  16. Quantifying rates of cell migration and cell proliferation in co-culture barrier assays reveals how skin and melanoma cells interact during melanoma spreading and invasion.

    Science.gov (United States)

    Haridas, Parvathi; Penington, Catherine J; McGovern, Jacqui A; McElwain, D L Sean; Simpson, Matthew J

    2017-06-21

    Malignant spreading involves the migration of cancer cells amongst other native cell types. For example, in vivo melanoma invasion involves individual melanoma cells migrating through native skin, which is composed of several distinct subpopulations of cells. Here, we aim to quantify how interactions between melanoma and fibroblast cells affect the collective spreading of a heterogeneous population of these cells in vitro. We perform a suite of circular barrier assays that includes: (i) monoculture assays with fibroblast cells; (ii) monoculture assays with SK-MEL-28 melanoma cells; and (iii) a series of co-culture assays initiated with three different ratios of SK-MEL-28 melanoma cells and fibroblast cells. Using immunostaining, detailed cell density histograms are constructed to illustrate how the two subpopulations of cells are spatially arranged within the spreading heterogeneous population. Calibrating the solution of a continuum partial differential equation to the experimental results from the monoculture assays allows us to estimate the cell diffusivity and the cell proliferation rate for the melanoma and the fibroblast cells, separately. Using the parameter estimates from the monoculture assays, we then make a prediction of the spatial spreading in the co-culture assays. Results show that the parameter estimates obtained from the monoculture assays lead to a reasonably accurate prediction of the spatial arrangement of the two subpopulations in the co-culture assays. Overall, the spatial pattern of spreading of the melanoma cells and the fibroblast cells is very similar in monoculture and co-culture conditions. Therefore, we find no clear evidence of any interactions other than cell-to-cell contact and crowding effects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Skin pattern structure and function of juvenile ages of Chameleo chameleon

    Directory of Open Access Journals (Sweden)

    Yosra A. Fouda

    2017-03-01

    Full Text Available Little is known about the skin structure of juvenile chameleon especially its sensory function of their integumentary structure. Fifteen juvenile Chameleo chameleon are collected from Abu Rawash, Northern area of Giza, Egypt during Summer of 2015. It is belong to the order Squamata, family, Chamaeleonidae. Three ages are used in the present study and categorized according to the morphological criteria of head, abdomen and limb lengths. Dorsal abdominal surfaces are covered with abdominal scales of varying sizes either conical or elliptical-structures, regularly arranged in rows and imbricated with each other. Each scale possessed one cylindrical lenticular epidermal sense organ containing heavy sensillia. Histologically, the scales are characterized by wider conical surfaces and intermingled with another one by hinge region. The epidermal layer of outer scale surface is composed of five-layered stratified squamous epithelium including the stratum germinativum, intermediate zone of stratum spinosum and granulosum, α-keratin layer, β-keratin layer and outer superficial Oberhaütchen. Melanosomes are abundant in the intermediate zone as well as in the peripheral dermal layer underneath stratum germinativum layer. The melanosomes possessed long cellular processes with their content of melanin granules underneath the epidermis. The dermis is composed of upper collagenous and inner compact layer. Semithin sections revealed the presence of fibroblast cells, collagenous fibrils, nerve axons, melanosomes and mast cells in the connective tissue core. Increased immunoreaction of cytokeratin is observed in the epidermal layers of G3; meanwhile, an increased proliferation of epidermal and dermal cells was detected in G1. Transmission electron microscopy exhibited striking formation of dermal sense organs containing neuronal cells of both oligodendrocytes and Schwann cells with myelinated and unmyelinated nerve axons ensheathed externally by thin

  18. An empirical orthogonal function analysis of ocean shoreline location on the Virginia barrier islands

    Science.gov (United States)

    Haluska, J. D.

    2017-12-01

    Shoreline change along the Eastern Atlantic shore of Virginia has been studied for the individual barrier islands but not as an integrated system. This study combines the Atlantic shoreline locations for eleven barrier islands obtained from LANDSAT 5, 7, and 8 images. Approximately 250 shoreline locations over a 24-year period from Jan 1990 to Dec 2014 were extracted from the digitized shoreline data at 338 transects. The resulting 338 by 250 matrix was analyzed by the empirical orthogonal function (EOF) technique. The first four principal components (PC) explained 86 percent of the sample variance. Since the data was not detrended, the first PC was the overall trend of the data with a discontinuity in 2004-2005. The 2004-2005 interval included storm events and large shoreline changes. PCs 2 to 4 reflect the effects of El Nino events and tropical and non-tropical storms. Eigenvectors 1 to 4 all show the effects of the nine inlets in the island group. Eigenvector (EV) 1 explains 59 percent of the shoreline spatial variance and shows the largest changes at the northern and southern island ends. EVs 2 to 4 reflect the pattern of EV1 but at sequentially smaller percentages of the spatial variance. As a group, the eleven islands are losing ocean side shoreline. The lone exception is Hog Island. Sea level had the strongest correlation with the shoreline loss trend of PC1. The coefficient of determination was 0.41. The NAO and MEI also correlated with PC1 with correlations of determination of 0.05 and 0.12 respectively. These confidence level for the three factors was better than 99 percent. Sea level also correlated with PC3 and PC4. The PCs as a group show that the year intervals 2004-2005 and 2009-2010 had large effects on the shoreline change pattern for the island group. EVs 1 to 4 had the highest range of shoreline change at the island ends indicating the effect the changes of the inlets have on the adjacent islands. The smaller islands as a group had a higher level

  19. Efficacy of transgene expression in porcine skin as a function of electrode choice

    DEFF Research Database (Denmark)

    Gothelf, A; Mahmood, Faisal; Dagnaes-Hansen, Frederik

    2011-01-01

    , have mainly been performed in rodents and the body of evidence on electrode choice and optimal pulsing conditions is limited. We therefore tested plate and needle electrodes in vivo in porcine skin, which resembles human skin in structure. The luciferase (pCMV-Luc) gene was injected intradermally...... and subsequently electroporated. Simultaneously, studies with gene electrotransfer to porcine skin using plasmids coding for green fluorescent protein (GFP) and betagalactosidase were performed. Interestingly, we found needle electrodes to be more efficient than plate electrodes (p...

  20. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Directory of Open Access Journals (Sweden)

    Xinxin Liu

    Full Text Available Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3 expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001. Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05 and a reduction in transepithelial electrical resistance (TEER by 180.0% (p<0.001. While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05. Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  1. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  2. Novel Functionally Graded Thermal Barrier Coatings in Coal-Fired Power Plant Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [Indiana Univ., Indianapolis, IN (United States)

    2016-11-01

    This project presents a detailed investigation of a novel functionally graded coating material, pyrochlore oxide, for thermal barrier coating (TBC) in gas turbines used in coal-fired power plants. Thermal barrier coatings are refractory materials deposited on gas turbine components, which provide thermal protection for metallic components at operating conditions. The ultimate goal of this research is to develop a manufacturing process to produce the novel low thermal conductivity and high thermal stability pyrochlore oxide based coatings with improved high-temperature durability. The current standard TBC, yttria stabilized zirconia (YSZ), has service temperatures limited to <1200°C, due to sintering and phase transition at higher temperatures. In contrast, pyrochlore oxide, e.g., lanthanum zirconate (La2Zr2O7, LZ), has demonstrated lower thermal conductivity and better thermal stability, which are crucial to high temperature applications, such as gas turbines used in coal-fired power plants. Indiana University – Purdue University Indianapolis (IUPUI) has collaborated with Praxair Surface Technologies (PST), and Changwon National University in South Korea to perform the proposed research. The research findings are critical to the extension of current TBCs to a broader range of high-temperature materials and applications. Several tasks were originally proposed and accomplished, with additional new opportunities identified during the course of the project. In this report, a description of the project tasks, the main findings and conclusions are given. A list of publications and presentations resulted from this research is listed in the Appendix at the end of the report.

  3. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Science.gov (United States)

    Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

    2017-01-01

    Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

  4. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Directory of Open Access Journals (Sweden)

    Siming Yang

    2017-08-01

    Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

  5. Oxygen functionalization of MWCNTs in RF-dielectric barrier discharge Ar/O2 plasma

    Science.gov (United States)

    Abdel-Fattah, E.; Ogawa, D.; Nakamura, K.

    2017-07-01

    The oxygenation of multi-wall carbon nanotubes (MWCNTs) was performed via a radio frequency dielectric barrier discharge (RF-DBD) in an Ar/{{\\text{H}}2}\\text{O} plasma mixture. The relative intensity of the Ar/{{\\text{O}}2} plasma species was characterized by optical emission spectroscopy (OES). The effects of treatment time, RF power and oxygen gas percentage on the chemical composition and surface morphology of MWCNTs were investigated by means of x-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy and field emission scanning electron microscopy (FE-SEM). The results of FTIR and XPS revealed the presence of oxygen-containing functional groups on the MWCNTs treated in an Ar/{{\\text{O}}2} plasma at an RF power of 50 W and pressure of 400 Pa. The amount of oxygen functional groups (C=O, C-O, and O-COO) also increased by increasing treatment time up to 6 min, but slightly decreased when treatment time was increased by 10 min. The increase of oxygen gas percentage in the plasma mixture does not affect the oxygen content in the treated MWCNTs. Meanwhile, MWCNTs treated at high power (80 W) showed a reduction in oxygen functional groups in comparison with low RF power conditions. The Raman analysis was consistent with the XPS and FTIR results. The integrity of the nanotube patterns also remained damaged as observed by FE-SEM images. The MWCNTs treated in RF-DBD using the Ar/{{\\text{O}}2} plasma mixture showed improved dispersibility in deionized water. A correlation between the OES data and the observed surface characterization for an improved understanding of the functionalization of MWCNTs in Ar/{{\\text{O}}2} plasma was presented.

  6. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    Science.gov (United States)

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function.

    Science.gov (United States)

    Sina, Christian; Kemper, Claudia; Derer, Stefanie

    2018-06-01

    The complement system is part of innate sensor and effector systems such as the Toll-like receptors (TLRs). It recognizes and quickly systemically and/or locally respond to microbial-associated molecular patterns (MAMPs) with a tailored defense reaction. MAMP recognition by intestinal epithelial cells (IECs) and appropriate immune responses are of major importance for the maintenance of intestinal barrier function. Enterocytes highly express various complement components that are suggested to be pivotal for proper IEC function. Appropriate activation of the intestinal complement system seems to play an important role in the resolution of chronic intestinal inflammation, while over-activation and/or dysregulation may worsen intestinal inflammation. Mice deficient for single complement components suffer from enhanced intestinal inflammation mimicking the phenotype of patients with chronic inflammatory bowel disease (IBD) such as Crohn's disease (CD) or ulcerative colitis (UC). However, the mechanisms leading to complement expression in IECs seem to differ markedly between UC and CD patients. Hence, how IECs, intestinal bacteria and epithelial cell expressed complement components interact in the course of IBD still remains to be mostly elucidated to define potential unique patterns contributing to the distinct subtypes of intestinal inflammation observed in CD and UC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Functional significance of periostin in excisional skin repair: Is the devil in the detail?

    OpenAIRE

    Elliott, Christopher G.; Kim, Shawna S.; Hamilton, Douglas W.

    2012-01-01

    In the past year, three papers have been published exploring the role of the matricellular protein periostin in excisional skin repair. These papers all show a delay in wound closure and the kinetics of this delay are strikingly similar across the three reports. The similarities between these papers end, however, when each investigates the mechanism through which periostin influences skin repair. Three proposed mechanisms have been identified: (1) myofibroblast differentiation, (2) keratinocy...

  9. Quantification of changes in skin hydration and sebum after tape stripping using infrared spectroscopy

    Science.gov (United States)

    Ezerskaia, A.; Pereira, S. F.; Urbach, H. P.; Varghese, B.

    2017-02-01

    Skin barrier function relies on well balanced water and lipid system of stratum corneum. Optimal hydration and oiliness levels are indicators of skin health and integrity. We demonstrate an accurate and sensitive depth profiling of stratum corneum sebum and hydration levels using short wave infrared spectroscopy in the spectral range around 1720 nm. We demonstrate that short wave infrared spectroscopic technique combined with tape stripping can provide morequantitative and more reliable skin barrier function information in the low hydration regime, compared to conventional biophysical methods.

  10. Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

    Science.gov (United States)

    Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

    2016-06-01

    Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

  11. Excreted/secreted Trichuris suis products reduce barrier function and suppress inflammatory cytokine production of intestinal epithelial cells

    DEFF Research Database (Denmark)

    Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.

    2014-01-01

    The administration of helminths is considered a promising strategy for the treatment of autoimmune diseases due to their immunomodulatory properties. Currently, the application of the helminth Trichuris suis as a treatment for Crohn's disease is being studied in large multi-center clinical trials....... The intestinal epithelium forms an efficient barrier between the intestinal lumen containing the microbial flora and helminths, and dendritic cells (DCs) present in the lamina propria that determine the TH response. Here, we investigated how excreted/secreted (E/S) products of T. suis affect the barrier function...... of intestinal epithelial cells (IECs) in order to reach the DCs and modulate the immune response. We show that T. suis E/S products reduce the barrier function and the expression of the tight junction proteins EMP-1 and claudin-4 in IEC CMT93/69 monolayers in a glycan-dependent manner. This resulted...

  12. The cutaneous citadel: a holistic view of skin and immunity.

    Science.gov (United States)

    Spellberg, B

    2000-06-23

    Human skin has 4 major functions: endogenous homeostasis (e.g. regulation of body temperature and fluid balance), metabolism (e.g. Vitamin D synthesis), sensory input, and to serve as a barrier to external threats (e.g. infection, mechanical injury, ultraviolet light). It is the latter function which concerns this review, for the skin's remarkable success in protecting the human body from the outside world is a major component of our immune system. The eminent pathologist, Virchow, whose work in the mid 19th century revolutionized many aspects of medical understanding, viewed the skin as an effective but inanimate barrier (1). However, recent technologies have elucidated a highly complex, dynamic interplay between the skin and other members of the immune system.

  13. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  14. Study of the Wigner function at the device boundaries in one-dimensional single- and double-barrier structures

    International Nuclear Information System (INIS)

    Savio, Andrea; Poncet, Alain

    2011-01-01

    In this work, we compute the Wigner distribution function on one-dimensional devices from wave functions generated by solving the Schroedinger equation. Our goal is to investigate certain issues that we encountered in implementing Wigner transport equation solvers, such as the large discrepancies observed between the boundary conditions and the solution in the neighborhood of the boundaries. By evaluating the Wigner function without solving the Wigner transport equation, we intend to ensure that the actual boundary conditions are consistent with those commonly applied in literature. We study both single- and double-barrier unbiased structures. We use simple potential profiles, so that we can compute the wave functions analytically for better accuracy. We vary a number of structure geometry, material, meshing, and numerical parameters, among which are the contact length, the barrier height, the number of incident wave functions, and the numerical precision used for the computations, and we observe how the Wigner function at the device boundaries is affected. For the double-barrier structures, we look at the density matrix function and we study a model for the device transmission spectrum which helps explain the lobelike artifacts that we observe on the Wigner function.

  15. International guidelines for the in vivo assessment of skin properties in non-clinical settings

    DEFF Research Database (Denmark)

    du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz

    2013-01-01

    There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, repre......, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings....

  16. Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

    Science.gov (United States)

    Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

    2017-11-01

    Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function

  17. Investigation of the functional lifetime of TRISOPLASTr in relation to chemical compositions of pore water solutions in barriers

    NARCIS (Netherlands)

    Boels, D.; Beest, te H.; Zweers, H.; Groeneveld, P.

    2003-01-01

    Trisoplastr is a mixture of sand, bentonite and a polymer, used amongst others as landfill cover as well as barriers. Its permeability is generally lower than 1-2 x 10-11 m/s. Trisoplast keeps its functionality even in contact with different kinds of liquids, is not susceptible to cyclic drying and

  18. Functional C1q is present in the skin mucus of Siberian sturgeon (Acipenser baerii).

    Science.gov (United States)

    Fan, Chunxin; Wang, Jian; Zhang, Xuguang; Song, Jiakun

    2015-01-01

    The skin mucus of fish acts as the first line of self-protection against pathogens in the aquatic environment and comprises a number of innate immune components. However, the presence of the critical classical complement component C1q, which links the innate and adaptive immune systems of mammalians, has not been explored in a primitive actinopterygian fish. In this study, we report that C1q is present in the skin mucus of the Siberian sturgeon (Acipenser baerii). The skin mucus was able to inhibit the growth of Escherichia coli. The bacteriostatic activity of the skin mucus was reduced by heating and by pre-incubation with EDTA or mouse anti-human C1q antibody. We also detected C1q protein in skin mucus using the western blot procedure and isolated a cDNA that encodes the Siberian sturgeon C1qC, which had 44.7-51.4% identity with C1qCs in teleosts and tetrapods. A phylogenetic analysis revealed that Siberian sturgeon C1qC lies at the root of the actinopterygian branch and is separate from the tetrapod branch. The C1qC transcript was expressed in many tissues as well as in skin. Our data indicate that C1q is present in the skin mucus of the Siberian sturgeon to protect against water-borne bacteria, and the C1qC found in the sturgeon may represent the primitive form of teleost and tetrapod C1qCs. © 2014 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.

  19. Effects of carprofen on the integrity and barrier function of canine colonic mucosa.

    Science.gov (United States)

    Briere, Catherine A; Hosgood, Giselle; Morgan, Timothy W; Hedlund, Cheryl S; Hicks, Merrin; McConnico, Rebecca S

    2008-02-01

    To measure effects of carprofen on conductance and permeability to mannitol and histologic appearance in canine colonic mucosa. Colonic mucosa from 13 mature mixed-breed dogs. Procedures-Sections of mucosa from the transverse colon and proximal and distal portions of the descending colon were obtained immediately after dogs were euthanized. Sections were mounted in Ussing chambers. Carprofen (400 microg/mL) was added to the bathing solution for treated sections. Conductance was calculated at 15-minute intervals for 240 minutes. Flux of mannitol was calculated for three 1-hour periods. Histologic examination of sections was performed after experiments concluded. Conductance was graphed against time for each chamber, and area under each curve was calculated. Conductance X time, flux of mannitol, and frequency distribution of histologic findings were analyzed for an effect of region and carprofen. Carprofen significantly increased mean conductance X time, compared with values for control (untreated) sections for all regions of colon. Carprofen significantly increased mean flux of mannitol from period 1 to period 2 and from period 2 to period 3 for all regions of colon. Carprofen caused a significant proportion of sections to have severe sloughing of cells and erosions involving >or= 10% of the epithelium, compared with control sections. Carprofen increased in vitro conductance and permeability to mannitol in canine colonic mucosa. Carprofen resulted in sloughing of cells and erosion of the colonic mucosa. These findings suggested that carprofen can compromise the integrity and barrier function of the colonic mucosa of dogs.

  20. The blood-brain barrier: structure, function and therapeutic approaches to cross it.

    Science.gov (United States)

    Tajes, Marta; Ramos-Fernández, Eva; Weng-Jiang, Xian; Bosch-Morató, Mònica; Guivernau, Biuse; Eraso-Pichot, Abel; Salvador, Bertrán; Fernàndez-Busquets, Xavier; Roquer, Jaume; Muñoz, Francisco J

    2014-08-01

    The blood-brain barrier (BBB) is constituted by a specialized vascular endothelium that interacts directly with astrocytes, neurons and pericytes. It protects the brain from the molecules of the systemic circulation but it has to be overcome for the proper treatment of brain cancer, psychiatric disorders or neurodegenerative diseases, which are dramatically increasing as the population ages. In the present work we have revised the current knowledge on the cellular structure of the BBB and the different procedures utilized currently and those proposed to cross it. Chemical modifications of the drugs, such as increasing their lipophilicity, turn them more prone to be internalized in the brain. Other mechanisms are the use of molecular tools to bind the drugs such as small immunoglobulins, liposomes or nanoparticles that will act as Trojan Horses favoring the drug delivery in brain. This fusion of the classical pharmacology with nanotechnology has opened a wide field to many different approaches with promising results to hypothesize that BBB will not be a major problem for the new generation of neuroactive drugs. The present review provides an overview of all state-of-the-art of the BBB structure and function, as well as of the classic strategies and these appeared in recent years to deliver drugs into the brain for the treatment of Central Nervous System (CNS) diseases.

  1. EMMPRIN Modulates Epithelial Barrier Function through a MMP–Mediated Occludin Cleavage

    Science.gov (United States)

    Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E.

    2011-01-01

    Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. PMID:21777561

  2. AKAP12 mediates barrier functions of fibrotic scars during CNS repair.

    Directory of Open Access Journals (Sweden)

    Jong-Ho Cha

    Full Text Available The repair process after CNS injury shows a well-organized cascade of three distinct stages: inflammation, new tissue formation, and remodeling. In the new tissue formation stage, various cells migrate and form the fibrotic scar surrounding the lesion site. The fibrotic scar is known as an obstacle for axonal regeneration in the remodeling stage. However, the role of the fibrotic scar in the new tissue formation stage remains largely unknown. We found that the number of A-kinase anchoring protein 12 (AKAP12-positive cells in the fibrotic scar was increased over time, and the cells formed a structure which traps various immune cells. Furthermore, the AKAP12-positive cells strongly express junction proteins which enable the structure to function as a physical barrier. In in vivo validation, AKAP12 knock-out (KO mice showed leakage from a lesion, resulting from an impaired structure with the loss of the junction complex. Consistently, focal brain injury in the AKAP12 KO mice led to extended inflammation and more severe tissue damage compared to the wild type (WT mice. Accordingly, our results suggest that AKAP12-positive cells in the fibrotic scar may restrict excessive inflammation, demonstrating certain mechanisms that could underlie the beneficial actions of the fibrotic scar in the new tissue formation stage during the CNS repair process.

  3. Macleaya cordata Extract Decreased Diarrhea Score and Enhanced Intestinal Barrier Function in Growing Piglets

    Directory of Open Access Journals (Sweden)

    Gang Liu

    2016-01-01

    Full Text Available Macleaya cordata extract is of great scientific and practical interest to researchers, due to its antimicrobial and anti-inflammatory responses within experimental animals. This study was designed to determine the diarrhea score and innate immunity of growing piglets after they had received Macleaya cordata extract supplements. A total of 240 growing pigs were randomly assigned to one of three dietary treatments, with 8 replicates per treatment and 10 piglets per replicate. All pigs received a basal diet containing similar amounts of nutrients. The three treatments were a control (no additive, an antibiotic (200 mg/kg colistin, and the Macleaya cordata extract supplement group (40 mg/kg Macleaya cordata extract. The diarrhea score was calculated after D 28. The jejunal samples were obtained from five piglets selected randomly from each treatment on D 28. In comparison with the control group, the dietary Macleaya cordata extract and colistin group demonstrated a substantially decreased diarrhea score. The introduction of Macleaya cordata extract supplements to the diet significantly increased volumes of ZO-1 and claudin-1, particularly in comparison with the pigs in the control group (P<0.05. The findings indicate that Macleaya cordata extract does enhance intestinal barrier function in growing piglets and that it could be used as a viable substitute for antibiotics.

  4. Instrumental evaluation of anti-aging effects of cosmetic formulations containing palmitoyl peptides, Silybum marianum seed oil, vitamin E and other functional ingredients on aged human skin.

    Science.gov (United States)

    Hahn, Hyung Jin; Jung, Ho Jung; Schrammek-Drusios, Med Christine; Lee, Sung Nae; Kim, Ji-Hyun; Kwon, Seung Bin; An, In-Sook; An, Sungkwan; Ahn, Kyu Joong

    2016-08-01

    Anti-aging cosmetics are widely used for improving signs of aged skin such as skin wrinkles, decreased elasticity, low dermal density and yellow skin tone. The present study evaluated the effects of cosmetic formulations, eye cream and facial cream, containing palmitoyl peptides, Silybum marianum ( S. marianum ) seed oil, vitamin E and other functional ingredients on the improvement of facial wrinkles, elasticity, dermal density and skin tone after 4 weeks period of application on aged human skin. Healthy volunteers (n=20) with aged skin were recruited to apply the test materials facially twice per day for 4 weeks. Skin wrinkles, elasticity, dermal density and skin tone were measured instrumentally for assessing the improvement of skin aging. All the measurements were conducted prior to the application of test materials and at 2 and 4 weeks of treatment. Crow's feet wrinkles were decreased 5.97% after 2 weeks of test material application and 14.07% after 4 weeks of application in comparison of pre-application. Skin elasticity was increased 6.81% after 2 weeks and 8.79% after 4 weeks. Dermal density was increased 16.74% after 2 weeks and 27.63% after 4 weeks. With the L* value indicating skin brightness and the a* value indicating erythema (redness), the results showed that brightness was increased 1.70% after 2 weeks and 2.14% after 4 weeks, and erythema was decreased 10.45% after 2 weeks and 22.39% after 4 weeks. Hence, the test materials appear to exert some degree of anti-aging effects on aged human skin. There were no abnormal skin responses from the participants during the trial period. We conclude that the facial and eye cream containing palmitoyl peptides and S. marianum seed oil, vitamin E and other ingredients have effects on the improvement of facial wrinkles, elasticity, dermal density and skin tone.

  5. 3D skin length deformation of lower body during knee joint flexion for the practical application of functional sportswear.

    Science.gov (United States)

    Choi, Jiyoung; Hong, Kyunghi

    2015-05-01

    With the advent of 3D technology in the design process, a tremendous amount of scanned data is available. However, it is difficult to trace the quantitative skin deformation of a designated location on the 3D body surface data during movement. Without identical landmarks or reflective markers, tracing the same reference points on the different body postures is not easy because of the complex shape change of the body. To find the least deformed location on the body, which is regarded as the optimal position of seams for the various lengths of functional compression pants, landmarks were directly marked on the skin of six subjects and scanned during knee joint flexion. Lines of non-extension (LoNE) and maximum stretch (LoMS) were searched for, both by tracing landmarks and newly drawn guidelines based on ratio division in various directions. Considering the waist as the anchoring position of the pants, holistic changes were quantified and visualized from the waistline in lengthwise and curvilinear deformation along the dermatomes of the lower body for various lengths of pants. Widthwise and unit area skin deformation data of the skin were also provided as guidelines for further use such as streamlined pants or design of other local wearing devices. Copyright © 2014 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  6. Version 1.1 of the international spinal cord injury skin and thermoregulation function basic data set.

    Science.gov (United States)

    Biering-Sørensen, F; Alexander, M S; van Asbeck, F W A; Donovan, W; Krassioukov, A; Post, M W M

    2017-06-01

    To describe the changes made to the international spinal cord injury (SCI) skin and thermoregulation function basic data set in version 1.1. International. An international working group reviewed suggested changes to the international SCI skin and thermoregulation function basic data set version 1.0. These changes were discussed and the agreed changes were made. Subsequently, the recommended adjustments were circulated for review to the International Spinal Cord Society (ISCoS) Executive and Scientific Committees, the American Spinal Injury Association (ASIA) Board, around 40 national and international societies, and to interested individuals who had signed up wishing to have the opportunity to review. In addition, the suggested changes were displayed at the ISCoS and ASIA websites for at least a month for possible comments. The recommendation 'largest diameter, including undermining' is changed to: 'Largest undermining', and a description of how to measure this is inserted. The 'smallest opening diameter' is changed to: 'Width' as the maximum dimension perpendicular to the length axis. In the literature, there is a tendency to replace 'grades' or 'stages' with 'categories'; therefore, the word 'category' is used instead of 'grade' or 'stage'. Impracticable measurements have been adjusted and new terminology adopted. All are to be found on ISCoS website: http://www.iscos.org.uk/international-sci-skin-and-thermoregulation-function-data-sets.

  7. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  8. I. Fission Probabilities, Fission Barriers, and Shell Effects. II. Particle Structure Functions

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Kexing [Univ. of California, Berkeley, CA (United States)

    1999-05-01

    In Part I, fission excitation functions of osmium isotopes 185,186, 187, 189 Os produced in 3He +182,183, 184, 186W reactions, and of polonium isotopes 209,210, 211, 212Po produced in 3He/4He + 206, 207, 208Pb reactions, were measured with high precision. These excitation functions have been analyzed in detail based upon the transition state formalism. The fission barriers, and shell effects for the corresponding nuclei are extracted from the detailed analyses. A novel approach has been developed to determine upper limits of the transient time of the fission process. The upper limits are constrained by the fission probabilities of neighboring isotopes. The upper limits for the transient time set with this new method are 15x 10–21 sec and 25x 10–21 sec for 0s and Po compound nuclei, respectively. In Part II, we report on a search for evidence of the optical modulations in the energy spectra of alpha particles emitted from hot compound nuclei. The optical modulations are expected to arise from the ~-particle interaction with the rest of the nucleus as the particle prepares to exit. Some evidence for the modulations has been observed in the alpha spectra measured in the 3He-induced reactions, 3He + natAg in particular. The identification of the modulations involves a technique that subtracts the bulk statistical background from the measured alpha spectra, in order for the modulations to become visible in the residuals. Due to insufficient knowledge of the background spectra, however, the presented evidence should only be regarded as preliminary and tentative.

  9. Identification of blood-brain barrier function following subarachnoid hemorrhage in rats at different stages

    Institute of Scientific and Technical Information of China (English)

    Zongyi Xie; Weiwei Shen; Ying Ma; Yuan Cheng

    2008-01-01

    BACKGROUND: Recent studies have indicated that blood-brain barrier (BBB) disruption following subarachnoid hemorrhage (SAH) significantly correlates with the development of brain injury and poor prognosis of patients subjected to SAH. OBJECTIVE: To investigate both functional and structural changes related to BBB in various phases after SAH in rats through quantitative and qualitative methods.DESIGN, TIME AND SETTING: This experiment, a completely randomized design and controlled experiment, was performed at the Department of Neurosurgery, the Second Affiliated Hospital of Chongqing University of Medical Sciences from June 2006 to March 2007.MATERIALS: A total of 128 female, healthy, Sprague-Dawley rats were selected for this study. Main reagents and instruments: Evans Blue dye (Sigma Company, USA), fluorescence spectrophotometer (Shimadzu Company, Japan), and transmission electron microscope (Olympus Company, Japan). MAIN OUTCOME MEASURES: Brain tissue water content was determined by the wet-dry method. BBB permeability in the cerebral cortex was determined by Evans Blue dye and fluorescent spectrophotometer. The ultrastructural changes in BBB were observed with transmission electron microscope.RESULTS: Compared with the sham-operated group, SAH induced a significant increase in brain water content between 24 and 60 hours (F = 888.32, P 0.05). Electron microscopy demonstrated only a mild perivascular edema at 24 hours after SAH. By 36 hours, a notable perivascular edema was associated with a collapse of the capillary. Astrocytic endfeet surrounding the capillary were prominently swollen in the edematous areas. The above-mentioned abnormal ultrastructural changes in the BBB were reversed by 72 hours after SAH. No obvious morphological changes in the BBB were detected in the sham-operated rats.CONCLUSION: These results directly suggest that SAH could induce rapid changes in BBB function and structure during the acute phases of BBB breakdown. Moreover, these dynamic

  10. The Human Skin Barrier Is Organized as Stacked Bilayers of Fully Extended Ceramides with Cholesterol Molecules Associated with the Ceramide Sphingoid Moiety

    DEFF Research Database (Denmark)

    Iwai, Ichiro; Han, Hongmei; Hollander, Lianne den

    2012-01-01

    not previously described in a biological system-stacked bilayers of fully extended ceramides (CERs) with cholesterol molecules associated with the CER sphingoid moiety. This arrangement rationalizes the skin's low permeability toward water and toward hydrophilic and lipophilic substances, as well as the skin...

  11. Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

    Science.gov (United States)

    Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

    2016-01-01

    Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

  12. Permeability measurement of some barrier materials as a function of temperature and pressure

    International Nuclear Information System (INIS)

    Maqsood, M.; Faisal, S.; Ali, J.; Usman, A.; Alamgir, K.; Farooq, K.

    2011-01-01

    Barrier materials possess the ability to restrict the passage of gases, vapors, and organic liquids through their boundaries. These barrier materials have large number of applications in industry and scientific research. To measure the permeability of barrier materials, a specific gas flow system has been developed, pure helium gas is used to measure the back ground reading through SS-316. The permeability and break-through time has been measured through Inconel X-750, NBR and Viton below and above the atmospheric pressure and at different temperatures 20 deg. C, 40 deg. C and 70 deg. C. (author)

  13. Near infrared spectroscopy evaluation of bladder function: the impact of skin pigmentation on detection of physiologic change during voiding

    Science.gov (United States)

    Shadgan, Babak; Stothers, Lynn; Molavi, Behnam; Mutabazi, Sharif; Mukisa, Ronald; Macnab, Andrew

    2015-02-01

    Background: Prior research indicates the epidermal pigment layer of human skin (Melanin) has a significant absorption coefficient in the near infra-red (NIR) region; hence attenuation of light in vivo is a potential confounder for NIR spectroscopy (NIRS). A NIRS method developed for transcutaneous evaluation of bladder function is being investigated as a means of improving the burden of bladder disease in sub-Saharan Africa. This required development of a simple wireless NIRS device suitable for use as a screening tool in patients with pigmented skin where the NIR light emitted would penetrate through the epidermal pigment layer and return in sufficient quantity to provide effective monitoring. Methods: Two healthy subjects, one with pigmented skin and one with fair skin, were monitored as they voided spontaneously using the prototype transcutaneous NIRS device positioned over the bladder. The device was a self-contained wireless unit with light emitting diodes (wavelengths 760 and 850 nanometres) and interoptode distance of 4cm. The raw optical data were transmitted to a laptop where graphs of chromophore change were generated with proprietary software and compared between the subjects and with prior data from asymptomatic subjects. Results: Serial monitoring was successful in both subjects. Voiding volumes varied between 350 and 380 cc. In each subject the patterns of chromophore change, trend and magnitude of change were similar and matched the physiologic increase in total and oxygenated hemoglobin recognized to occur in normal bladder contraction during voiding. Conclusions: Skin pigmentation does not compromise the ability of transcutaneous NIRS to interrogate physiologic change in the bladder during bladder contraction in healthy subjects.

  14. Addressing barriers to eco-innovation: Exploring the finance mobilisation functions of institutional innovation intermediaries

    NARCIS (Netherlands)

    Polzin, Friedemann; Flotow, von Paschen; Klerkx, L.W.A.

    2016-01-01

    This research article explores the role of institutional innovation intermediaries in accelerating the commercialisation of (clean) technologies. Drawing on the finance and innovation intermediaries literatures, we show that financial barriers to eco-innovation can be partly overcome by particular

  15. Functional cloning of a gp100-reactive T-cell receptor from vitiligo patient skin

    NARCIS (Netherlands)

    Klarquist, Jared; Eby, Jonathan M.; Henning, Steven W.; Li, Mingli; Wainwright, Derek A.; Westerhof, Wiete; Luiten, Rosalie M.; Nishimura, Michael I.; Le Poole, I. Caroline

    2016-01-01

    We isolated gp100-reactive T cells from perilesional skin of a patient with progressive vitiligo with superior reactivity toward melanoma cells compared with tumor-infiltrating lymphocytes 1520, a melanoma-derived T-cell line reactive with the same cognate peptide. After dimer enrichment and limited

  16. Functional effects of the DCM mutant Gly159Asp troponin C in skinned muscle fibres

    DEFF Research Database (Denmark)

    Preston, Laura C; Lipscomb, Simon; Robinson, Paul

    2006-01-01

    We recently reported a dilated cardiomyopathy (DCM) causing mutation in a novel disease gene, TNNC1, which encodes cardiac troponin C (TnC). We have determined how this mutation, Gly159Asp, affects contractile regulation when incorporated into muscle fibres. Endogenous troponin in rabbit skinned...

  17. Psychological stress exerts an adjuvant effect on skin dendritic cell functions in vivo.

    Science.gov (United States)

    Saint-Mezard, Pierre; Chavagnac, Cyril; Bosset, Sophie; Ionescu, Marius; Peyron, Eric; Kaiserlian, Dominique; Nicolas, Jean-Francois; Bérard, Frédéric

    2003-10-15

    Psychological stress affects the pathophysiology of infectious, inflammatory, and autoimmune diseases. However, the mechanisms by which stress could modulate immune responses in vivo are poorly understood. In this study, we report that application of a psychological stress before immunization exerts an adjuvant effect on dendritic cell (DC), resulting in increased primary and memory Ag-specific T cell immune responses. Acute stress dramatically enhanced the skin delayed-type hypersensitivity reaction to haptens, which is mediated by CD8(+) CTLs. This effect was due to increased migration of skin DCs, resulting in augmented CD8(+) T cell priming in draining lymph nodes and enhanced recruitment of CD8(+) T cell effectors in the skin upon challenge. This adjuvant effect of stress was mediated by norepinephrine (NE), but not corticosteroids, as demonstrated by normalization of the skin delayed-type hypersensitivity reaction and DC migratory properties following selective depletion of NE. These results suggest that release of NE by sympathetic nerve termini during a psychological stress exerts an adjuvant effect on DC by promoting enhanced migration to lymph nodes, resulting in increased Ag-specific T cell responses. Our findings may open new ways in the treatment of inflammatory diseases, e.g., psoriasis, allergic contact dermatitis, and atopic dermatitis.

  18. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  19. Loss-of-function mutations in CAST cause peeling skin, leukonychia, acral punctate keratoses, cheilitis, and knuckle pads.

    Science.gov (United States)

    Lin, Zhimiao; Zhao, Jiahui; Nitoiu, Daniela; Scott, Claire A; Plagnol, Vincent; Smith, Frances J D; Wilson, Neil J; Cole, Christian; Schwartz, Mary E; McLean, W H Irwin; Wang, Huijun; Feng, Cheng; Duo, Lina; Zhou, Eray Yihui; Ren, Yali; Dai, Lanlan; Chen, Yulan; Zhang, Jianguo; Xu, Xun; O'Toole, Edel A; Kelsell, David P; Yang, Yong

    2015-03-05

    Calpastatin is an endogenous specific inhibitor of calpain, a calcium-dependent cysteine protease. Here we show that loss-of-function mutations in calpastatin (CAST) are the genetic causes of an autosomal-recessive condition characterized by generalized peeling skin, leukonychia, acral punctate keratoses, cheilitis, and knuckle pads, which we propose to be given the acronym PLACK syndrome. In affected individuals with PLACK syndrome from three families of different ethnicities, we identified homozygous mutations (c.607dup, c.424A>T, and c.1750delG) in CAST, all of which were predicted to encode truncated proteins (p.Ile203Asnfs∗8, p.Lys142∗, and p.Val584Trpfs∗37). Immunohistochemistry shows that staining of calpastatin is reduced in skin from affected individuals. Transmission electron microscopy revealed widening of intercellular spaces with chromatin condensation and margination in the upper stratum spinosum in lesional skin, suggesting impaired intercellular adhesion as well as keratinocyte apoptosis. A significant increase of apoptotic keratinocytes was also observed in TUNEL assays. In vitro studies utilizing siRNA-mediated CAST knockdown revealed a role for calpastatin in keratinocyte adhesion. In summary, we describe PLACK syndrome, as a clinical entity of defective epidermal adhesion, caused by loss-of-function mutations in CAST. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  20. Use of radial basis functions for meshless numerical solutions applied to financial engineering barrier options

    Directory of Open Access Journals (Sweden)

    Gisele Tessari Santos

    2009-08-01

    Full Text Available A large number of financial engineering problems involve non-linear equations with non-linear or time-dependent boundary conditions. Despite available analytical solutions, many classical and modified forms of the well-known Black-Scholes (BS equation require fast and accurate numerical solutions. This work introduces the radial basis function (RBF method as applied to the solution of the BS equation with non-linear boundary conditions, related to path-dependent barrier options. Furthermore, the diffusional method for solving advective-diffusive equations is explored as to its effectiveness to solve BS equations. Cubic and Thin-Plate Spline (TPS radial basis functions were employed and evaluated as to their effectiveness to solve barrier option problems. The numerical results, when compared against analytical solutions, allow affirming that the RBF method is very accurate and easy to be implemented. When the RBF method is applied, the diffusional method leads to the same results as those obtained from the classical formulation of Black-Scholes equation.Muitos problemas de engenharia financeira envolvem equações não-lineares com condições de contorno não-lineares ou dependentes do tempo. Apesar de soluções analíticas disponíveis, várias formas clássicas e modificadas da conhecida equação de Black-Scholes (BS requerem soluções numéricas rápidas e acuradas. Este trabalho introduz o método de função de base radial (RBF aplicado à solução da equação BS com condições de contorno não-lineares relacionadas a opções de barreira dependentes da trajetória. Além disso, explora-se o método difusional para solucionar equações advectivo-difusivas quanto à sua efetividade para solucionar equações BS. Utilizam-se funções de base radial Cúbica e Thin-Plate Spline (TPS, aplicadas à solução de problemas de opções de barreiras. Os resultados numéricos, quando comparados com as soluções analíticas, permitem afirmar

  1. Next generation human skin constructs as advanced tools for drug development.

    Science.gov (United States)

    Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela

    2017-11-01

    Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various

  2. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  3. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...... modulated the oxidative stress response transcription factor Nrf-2 and its downstream effector haem-oxygenase (HO-1), possibly through the amelioration of the environmental stress induced by the plastic surface of the culturing flasks. Therefore, it is important to consider the role of ECM in modulating...

  4. Age-related percutaneous penetration part 1: skin factors.

    Science.gov (United States)

    Konda, S; Meier-Davis, S R; Cayme, B; Shudo, J; Maibach, H I

    2012-05-01

    Changes in the skin that occur in the elderly may put them at increased risk for altered percutaneous penetration from pharmacotherapy along with potential adverse effects. Skin factors that may have a role in age-related percutaneous penetration include blood flow, pH, skin thickness, hair and pore density, and the content and structure of proteins, glycosaminoglycans (GAGs), water, and lipids. Each factor is examined as a function of increasing age along with its potential impact on percutaneous penetration. Additionally, topical drugs that successfully overcome the barrier function of the skin can still fall victim to cutaneous metabolism, thereby producing metabolites that may have increased or decreased activity. This overview discusses the current data and highlights the importance of further studies to evaluate the impact of skin factors in age-related percutaneous penetration.

  5. Ensemble averaged structure–function relationship for nanocrystals: effective superparamagnetic Fe clusters with catalytically active Pt skin [Ensemble averaged structure-function relationship for composite nanocrystals: magnetic bcc Fe clusters with catalytically active fcc Pt skin

    Energy Technology Data Exchange (ETDEWEB)

    Petkov, Valeri [Central Michigan University, Mt. Pleasant, MI (United States); Prasai, Binay [Central Michigan University, Mt. Pleasant, MI (United States); Shastri, Sarvjit [Argonne National Lab. (ANL), Argonne, IL (United States). X-ray Science Division; Park, Hyun-Uk [Sungkyunkwan University, Suwon (Korea). Department of Chemistry; Kwon, Young-Uk [Sungkyunkwan University, Suwon (Korea). Department of Chemistry; Skumryev, Vassil [Institucio Catalana de Recerca i Estudis Avançats (ICREA), Barcelona (Spain); Universitat Autònoma de Barcelona (Spain). Department of Physics

    2017-09-12

    Practical applications require the production and usage of metallic nanocrystals (NCs) in large ensembles. Besides, due to their cluster-bulk solid duality, metallic NCs exhibit a large degree of structural diversity. This poses the question as to what atomic-scale basis is to be used when the structure–function relationship for metallic NCs is to be quantified precisely. In this paper, we address the question by studying bi-functional Fe core-Pt skin type NCs optimized for practical applications. In particular, the cluster-like Fe core and skin-like Pt surface of the NCs exhibit superparamagnetic properties and a superb catalytic activity for the oxygen reduction reaction, respectively. We determine the atomic-scale structure of the NCs by non-traditional resonant high-energy X-ray diffraction coupled to atomic pair distribution function analysis. Using the experimental structure data we explain the observed magnetic and catalytic behavior of the NCs in a quantitative manner. Lastly, we demonstrate that NC ensemble-averaged 3D positions of atoms obtained by advanced X-ray scattering techniques are a very proper basis for not only establishing but also quantifying the structure–function relationship for the increasingly complex metallic NCs explored for practical applications.

  6. Electrical measurement of the hydration state of the skin surface in vivo.

    Science.gov (United States)

    Tagami, H

    2014-09-01

    Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.

  7. Impedance analysis of GPCR-mediated changes in endothelial barrier function: overview and fundamental considerations for stable and reproducible measurements.

    Science.gov (United States)

    Stolwijk, Judith A; Matrougui, Khalid; Renken, Christian W; Trebak, Mohamed

    2015-10-01

    The past 20 years has seen significant growth in using impedance-based assays to understand the molecular underpinning of endothelial and epithelial barrier function in response to physiological agonists and pharmacological and toxicological compounds. Most studies on barrier function use G protein-coupled receptor (GPCR) agonists which couple to fast and transient changes in barrier properties. The power of impedance-based techniques such as electric cell-substrate impedance sensing (ECIS) resides in its ability to detect minute changes in cell layer integrity label-free and in real-time ranging from seconds to days. We provide a comprehensive overview of the biophysical principles, applications, and recent developments in impedance-based methodologies. Despite extensive application of impedance analysis in endothelial barrier research, little attention has been paid to data analysis and critical experimental variables, which are both essential for signal stability and reproducibility. We describe the rationale behind common ECIS data presentation and interpretation and illustrate practical guidelines to improve signal intensity by adapting technical parameters such as electrode layout, monitoring frequency, or parameter (resistance versus impedance magnitude). Moreover, we discuss the impact of experimental parameters, including cell source, liquid handling, and agonist preparation on signal intensity and kinetics. Our discussions are supported by experimental data obtained from human microvascular endothelial cells challenged with three GPCR agonists, thrombin, histamine, and sphingosine-1-phosphate.

  8. Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells.

    Science.gov (United States)

    Liu, Hao-Yu; Roos, Stefan; Jonsson, Hans; Ahl, David; Dicksved, Johan; Lindberg, Jan Erik; Lundh, Torbjörn

    2015-04-01

    Heat shock proteins (HSPs) are a set of highly conserved proteins that can serve as intestinal gate keepers in gut homeostasis. Here, effects of a probiotic, Lactobacillus rhamnosus GG (LGG), and two novel porcine isolates, Lactobacillus johnsonii strain P47-HY and Lactobacillus reuteri strain P43-HUV, on cytoprotective HSP expression and gut barrier function, were investigated in a porcine IPEC-J2 intestinal epithelial cell line model. The IPEC-J2 cells polarized on a permeable filter exhibited villus-like cell phenotype with development of apical microvilli. Western blot analysis detected HSP expression in IPEC-J2 and revealed that L. johnsonii and L. reuteri strains were able to significantly induce HSP27, despite high basal expression in IPEC-J2, whereas LGG did not. For HSP72, only the supernatant of L. reuteri induced the expression, which was comparable to the heat shock treatment, which indicated that HSP72 expression was more stimulus specific. The protective effect of lactobacilli was further studied in IPEC-J2 under an enterotoxigenic Escherichia coli (ETEC) challenge. ETEC caused intestinal barrier destruction, as reflected by loss of cell-cell contact, reduced IPEC-J2 cell viability and transepithelial electrical resistance, and disruption of tight junction protein zonula occludens-1. In contrast, the L. reuteri treatment substantially counteracted these detrimental effects and preserved the barrier function. L. johnsonii and LGG also achieved barrier protection, partly by directly inhibiting ETEC attachment. Together, the results indicate that specific strains of Lactobacillus can enhance gut barrier function through cytoprotective HSP induction and fortify the cell protection against ETEC challenge through tight junction protein modulation and direct interaction with pathogens. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  9. Skin-derived mesenchymal stem cells help restore function to ovaries in a premature ovarian failure mouse model.

    Directory of Open Access Journals (Sweden)

    Dongmei Lai

    Full Text Available Skin-derived mesenchymal stem cells (SMSCs can differentiate into the three embryonic germ layers. For this reason, they are considered a powerful tool for therapeutic cloning and offer new possibilities for tissue therapy. Recent studies showed that skin-derived stem cells can differentiate into cells expressing germ-cell specific markers in vitro and form oocytes in vivo. The idea that SMSCs may be suitable for the treatment of intractable diseases or traumatic tissue damage has attracted attention. To determine the ability of SMSCs to reactivate injured ovaries, a mouse model with ovaries damaged by busulfan and cyclophosphamide was developed and is described here. Female skin-derived mesenchymal stem cells (F-SMSCs and male skin-derived mesenchymal stem cells (M-SMSCs from red fluorescence protein (RFP transgenic adult mice were used to investigate the restorative effects of SMSCs on ovarian function. Significant increases in total body weight and the weight of reproductive organs were observed in the treated animals. Both F-SMSCs and M-SMSCs were shown to be capable of partially restoring fertility in chemotherapy-treated females. Immunostaining with RFP and anti-Müllerian hormone (AMH antibodies demonstrated that the grafted SMSCs survived, migrated to the recipient ovaries. After SMSCs were administered to the treated mice, real-time PCR showed that the expression levels of pro-inflammatory cytokines TNF-α, TGF-β, IL-8, IL-6, IL-1β, and IFNγ were significantly lower in the ovaries than in the untreated controls. Consistent with this observation, expression of oogenesis marker genes Nobox, Nanos3, and Lhx8 increased in ovaries of SMSCs-treated mice. These findings suggest that SMSCs may play a role within the ovarian follicle microenvironment in restoring the function of damaged ovaries and could be useful in reproductive health.

  10. Gentle cleansing and moisturizing for patients with atopic dermatitis and sensitive skin.

    Science.gov (United States)

    Cheong, Wai Kwong

    2009-01-01

    Atopic dermatitis is a common condition characterized by pruritus, inflammation, and dryness of the skin. Inflammation disrupts the barrier function of the stratum corneum, predisposing the skin to be dry, and increases susceptibility to irritants and secondary bacterial infection. Sensitive skin is common, reported by 40-50% of women and 30% of men in the US, Europe, and Japan. Basic requirements in managing eczema and sensitive skin include effective cleansers that do not compromise skin barrier integrity, alleviation of skin dryness, and restoration of skin barrier function through the use of therapeutic moisturizers. The selection of a skin cleanser is therefore an important part of managing these conditions. Studies have reported clinical improvement with the use of soap-free cleansers in combination with topical treatments. While topical corticosteroids and immunosuppressive agents are mainstays of treatment for atopic dermatitis, therapeutic moisturizers are important adjuncts. Moisturizers improve skin hydration, reduce susceptibility to irritation, restore the integrity of the stratum corneum, and enhance the efficacy of topical corticosteroids.

  11. p120-catenin mediates inflammatory responses in the skin

    DEFF Research Database (Denmark)

    Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

    2006-01-01

    but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

  12. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

    Directory of Open Access Journals (Sweden)

    Benjamin B. Williams

    2015-08-01

    Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

  13. Mechanism of protection of transepithelial barrier function by Lactobacillus salivarius: strain dependence and attenuation by bacteriocin production.

    Science.gov (United States)

    Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W

    2012-11-01

    Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.

  14. HIV-1 impairs human retinal pigment epithelial barrier function: possible association with the pathogenesis of HIV-associated retinopathy.

    Science.gov (United States)

    Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen

    2014-07-01

    The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.

  15. Melanin-concentrating hormone and its receptor are expressed and functional in human skin.

    Science.gov (United States)

    Hoogduijn, Martin J; Ancans, Janis; Suzuki, Itaru; Estdale, Siân; Thody, Anthony J

    2002-08-23

    In this study, we have demonstrated the presence of melanin-concentrating hormone (MCH) and melanin-concentrating hormone receptor (MCHR1) transcripts in human skin. Sequence analysis confirmed that the transcripts of both genes were identical to those previously found in human brain. In culture, endothelial cells showed pro-MCH expression whereas no signal was found in keratinocytes, melanocytes, and fibroblasts. MCHR1 expression was restricted to melanocytes and melanoma cells. Stimulation of cultured human melanocytes with MCH reduced the alpha-MSH-induced increase in cAMP production. Furthermore, the melanogenic actions of alpha-MSH were inhibited by MCH. We propose that the MCH/MCHR1 signalling system is present in human skin and may have a role with the melanocortins in regulating the melanocyte.

  16. Surface protection in bio-shields via a functional soft skin layer: Lessons from the turtle shell.

    Science.gov (United States)

    Shelef, Yaniv; Bar-On, Benny

    2017-09-01

    The turtle shell is a functional bio-shielding element, which has evolved naturally to provide protection against predator attacks that involve biting and clawing. The near-surface architecture of the turtle shell includes a soft bi-layer skin coating - rather than a hard exterior - which functions as a first line of defense against surface damage. This architecture represents a novel type of bio-shielding configuration, namely, an inverse structural-mechanical design, rather than the hard-coated bio-shielding elements identified so far. In the current study, we used experimentally based structural modeling and FE simulations to analyze the mechanical significance of this unconventional protection architecture in terms of resistance to surface damage upon extensive indentations. We found that the functional bi-layer skin of the turtle shell, which provides graded (soft-softer-hard) mechanical characteristics to the bio-shield exterior, serves as a bumper-buffer mechanism. This material-level adaptation protects the inner core from the highly localized indentation loads via stress delocalization and extensive near-surface plasticity. The newly revealed functional bi-layer coating architecture can potentially be adapted, using synthetic materials, to considerably enhance the surface load-bearing capabilities of various engineering configurations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Acute effects of coffee on skin blood flow and microvascular function.

    Science.gov (United States)

    Tesselaar, Erik; Nezirevic Dernroth, Dzeneta; Farnebo, Simon

    2017-11-01

    Studies on the acute effects of coffee on the microcirculation have shown contradicting results. This study aimed to investigate if intake of caffeine-containing coffee changes blood flow and microvascular reactivity in the skin. We measured acute changes in cutaneous vascular conductance (CVC) in the forearm and the tip of the finger, the microvascular response to transdermal iontophoresis of acetylcholine (ACh) and sodium nitroprusside (SNP) and post-occlusive reactive hyperemia (PORH) in the skin, after intake of caffeinated or decaffeinated coffee. Vasodilatation during iontophoresis of ACh was significantly stronger after intake of caffeinated coffee compared to after intake of decaffeinated coffee (1.26±0.20PU/mmHg vs. 1.13±0.38PU/mmHg, Pcoffee. After intake of caffeinated coffee, a more pronounced decrease in CVC in the fingertip was observed compared to after intake of decaffeinated coffee (-1.36PU/mmHg vs. -0.52PU/mmHg, P=0.002). Caffeine, as ingested by drinking caffeinated coffee acutely improves endothelium-dependent microvascular responses in the forearm skin, while endothelium-independent responses to PORH and SNP iontophoresis are not affected. Blood flow in the fingertip decreases markedly during the first hour after drinking caffeinated coffee compared to decaffeinated coffee. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Histochemistry and functional organization of the dorsal skin of Ancistrus dolichopterus (Siluriformes: Loricariidae

    Directory of Open Access Journals (Sweden)

    Tarun K. Garg

    Full Text Available The structural organization and histo-cytochemical features of dorsal skin of Ancistrus dolichopterus (acari bodo are the main focus of this work. The epidermis, dermis and subcutis are the principal layers of the skin. The epidermis mainly consists of epithelial and mucous cells. Interspersed between them are lymphocytes, pigment cells, eosinophilic granular cells (EGC, and the taste buds as sensory structures. The high number of EGCs is implicated in general and specific immunological defense from pathogenic bacteria and multicellular parasites. The epithelial cells and mucous cells contain glycoproteins with oxidizable vicinal diols, carboxyl groups and O-sulphate esters and their high secretory activity is correlated with the bottom dwelling habit of this species. A thick stratum laxum contains overlapping osteoderms bearing denticles, and the stratum compactum make the integument thicker to help the fish in negative buoyancy for maneuvering near the bottom and protection. The entire body surface is covered by conical, backwardly directed denticles. These are composed of a dentine cone, surrounding a pulp cavity with the top covered by mineralized cap, and are the true homologues of teeth. These structures provide effective protection from abrasion and enemies. These structural peculiarities and histochemical features indicate additional physiological role of the skin of A. dolichopterus.

  19. The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

    Directory of Open Access Journals (Sweden)

    Adam Paré

    Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

  20. Functionally gradient materials for thermal barrier coatings in advanced gas turbine systems

    Energy Technology Data Exchange (ETDEWEB)

    Banovic, S.W.; Barmak, K.; Chan, H.M. [Lehigh Univ., Bethlehem, PA (United States)] [and others

    1995-10-01

    New designs for advanced gas turbine engines for power production are required to have higher operating temperatures in order to increase efficiency. However, elevated temperatures will increase the magnitude and severity of environmental degradation of critical turbine components (e.g. combustor parts, turbine blades, etc{hor_ellipsis}). To offset this problem, the usage of thermal barrier coatings (TBCs) has become popular by allowing an increase in maximum inlet temperatures for an operating engine. Although thermal barrier technology is over thirty years old, the principle failure mechanism is the spallation of the ceramic coating at or near the ceramic/bond coat interface. Therefore, it is desirable to develop a coating that combines the thermal barrier qualities of the ceramic layer and the corrosion protection by the metallic bond coat without the detrimental effects associated with the localization of the ceramic/metal interface to a single plane.

  1. Probabilistic migration modelling focused on functional barrier efficiency and low migration concepts in support of risk assessment.

    Science.gov (United States)

    Brandsch, Rainer

    2017-10-01

    Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.

  2. Intestinal infection with Giardia spp. reduces epithelial barrier function in a myosin light chain kinase-dependent fashion.

    Science.gov (United States)

    Scott, Kevin G-E; Meddings, Jonathon B; Kirk, David R; Lees-Miller, Susan P; Buret, André G

    2002-10-01

    Giardiasis causes malabsorptive diarrhea, and symptoms can be present in the absence of any significant morphologic injury to the intestinal mucosa. The effects of giardiasis on epithelial permeability in vivo remain unknown, and the role of T cells and myosin light chain kinase (MLCK) in altered intestinal barrier function is unclear. This study was conducted to determine whether Giardia spp. alters intestinal permeability in vivo, to assess whether these abnormalities are dependent on T cells, and to assess the role of MLCK in altered epithelial barrier function. Immunocompetent and isogenic athymic mice were inoculated with axenic Giardia muris trophozoites or sterile vehicle (control), then assessed for trophozoite colonization and gastrointestinal permeability. Mechanistic studies using nontransformed human duodenal epithelial monolayers (SCBN) determined the effects of Giardia on myosin light chain (MLC) phosphorylation, transepithelial fluorescein isothiocyanate-dextran fluxes, cytoskeletal F-actin, tight junctional zonula occludens-1 (ZO-1), and MLCK. Giardia infection caused a significant increase in small intestinal, but not gastric or colonic, permeability that correlated with trophozoite colonization in both immunocompetent and athymic mice. In vitro, Giardia increased permeability and phosphorylation of MLC and reorganized F-actin and ZO-1. These alterations were abolished with an MLCK inhibitor. Disruption of small intestinal barrier function is T cell independent, disappears on parasite clearance, and correlates with reorganization of cytoskeletal F-actin and tight junctional ZO-1 in an MLCK-dependent fashion.

  3. Non-invasive assessment of barrier integrity and function of the human gut

    NARCIS (Netherlands)

    Grootjans, J.; Thuijls, G.; Verdam, F.J.; Derikx, J.P.M.; Lenaerts, K.; Buurman, W.A.

    2010-01-01

    Over the past decades evidence has been accumulating that intestinal barrier integrity loss plays a key role in the development and perpetuation of a variety of disease states including inflammatory bowel disease and celiac disease, and is a key player in the onset of sepsis and multiple organ

  4. Systems pharmacology and blood-brain barrier functionality in Parkinson's disease

    NARCIS (Netherlands)

    Ravenstijn, Paulien Gerarda Maria

    2009-01-01

    Parkinson’s disease is a progressive neurodegenerative disease, which is composed of many components, each caused by interplay of a number of genetic and nongenetic causes. As the blood-brain barrier (BBB) is a key player in the relationship between plasma and brain pharmacokinetics, the influences

  5. The acyl-CoA binding protein is required for normal epidermal barrier function in mice

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Bek, Signe; Marcher, Ann-Britt

    2012-01-01

    (+/+) and ACBP(-/-) mice showed very similar composition, except for a significant and specific decrease in the very long chain free fatty acids (VLC-FFA) in stratum corneum of ACBP(-/-) mice. This finding indicates that ACBP is critically involved in the processes that lead to production of stratum corneum VLC......The acyl-CoA binding protein (ACBP) is a 10 kDa intracellular protein expressed in all eukaryotic species. Mice with targeted disruption of Acbp (ACBP(-/-) mice) are viable and fertile but present a visible skin and fur phenotype characterized by greasy fur and development of alopecia and scaling...... with age. Morphology and development of skin and appendages are normal in ACBP(-/-) mice; however, the stratum corneum display altered biophysical properties with reduced proton activity and decreased water content. Mass spectrometry analyses of lipids from epidermis and stratum corneum of ACBP...

  6. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-09-29

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  7. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    International Nuclear Information System (INIS)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-01-01

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  8. Skin layer mechanics

    NARCIS (Netherlands)

    Geerligs, M.

    2010-01-01

    The human skin is composed of several layers, each with an unique structure and function. Knowledge about the mechanical behavior of these skin layers is important for clinical and cosmetic research, such as the development of personal care products and the understanding of skin diseases. Until

  9. Deposition and characterization of plasma sprayed Ni-5A1/ magnesia stabilized zirconia based functionally graded thermal barrier coating

    International Nuclear Information System (INIS)

    Baig, M N; Khalid, F A

    2014-01-01

    Thermal barrier coatings (TBCs) are employed to protect hot section components in industrial and aerospace gas turbine engines. Conventional TBCs frequently fail due to high residual stresses and difference between coefficient of thermal expansion (CTE) of the substrate and coatings. Functionally graded thermal barrier coatings (FG-TBCs) with gradual variation in composition have been proposed to minimize the problem. In this work, a five layered functionally graded thermal barrier coating system was deposited by atmospheric plasma spray (APS) technique on Nimonic 90 substrates using Ni-5Al as bond coat (BC) and magnesia stabilized zirconia as top coat (TC). The coatings were characterized by SEM, EDS, XRD and optical profilometer. Microhardness and coefficient of thermal expansion of the five layers deposited as individual coatings were also measured. The deposited coating system was oxidized at 800°C. SEM analysis showed that five layers were successfully deposited by APS to produce a FG-TBC. The results also showed that roughness (Ra) of the individual layers decreased with an increase in TC content in the coatings. It was found that microhardness and CTE values gradually changed from bond coat to cermet layers to top coat. The oxidized coated sample revealed parabolic behavior and changes in the surface morphology and composition of coating

  10. Nanoscale alterations of corneocytes indicate skin disease

    DEFF Research Database (Denmark)

    Franz, J; Beutel, M; Gevers, K

    2016-01-01

    BACKGROUND: The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here...... dermatitis, a common inflammatory skin condition. CONCLUSION: The presence of these corneocyte-nanostructures might be used as a diagnostic parameter for skin disorders - even in cases below a clinical threshold....

  11. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2013 . Scientific Opinion on the substantiation of a health claim related to VeriSol ® P and a change in skin elasticity leading to an improvement in skin function pursuant to Article 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    related to VeriSol®P and a change in skin elasticity leading to an improvement in skin function. The Panel considers that the food, VeriSol®P, which is the subject of the health claim, is sufficiently characterised. The claimed effect proposed by the applicant is “maintenance of skin health, as indicated...... by an increased skin elasticity and a reduction of wrinkles volume”. The target population proposed by the applicant is the general adult population. The Panel considers that a change in skin elasticity leading to an improvement in skin function is a beneficial physiological effect. The applicant presented two...... of VeriSol®P and a change in skin elasticity leading to an improvement in skin function. © European Food Safety Authority, 2013...

  12. Factors that Affected Functional Outcome After a Delayed Excision and Split-Thickness Skin Graft on the Dorsal Side of Burned Hands.

    Science.gov (United States)

    Shichinohe, Ryuji; Yamamoto, Yuhei; Kawashima, Kunihiro; Kimura, Chu; Ono, Kentaro; Horiuchi, Katsumi; Yoshida, Tetsunori; Murao, Naoki; Hayashi, Toshihiko; Funayama, Emi; Oyama, Akihiko; Furukawa, Hiroshi

    Early excision and skin grafting is the principle treatment for a burned hand although there are occasions when it cannot be done such as severe general condition, delayed consultation, and the lack of a definitive assessment of burn depth. This study analyzes the factors that affected function after a delayed excision and skin graft for hands with a deep dermal burn. This study retrospectively evaluated 43 burned hands that required a delayed excision and split-thickness skin graft on the dorsal side. Cases were required to only have split-thickness skin grafting from the dorsum of the hand and fingers distally to at least the proximal interphalangeal joint at least 8 days after the injury. The hands were divided into two functional categories: Functional category A, normal or nearly normal joint movements, and functional category B, abnormal joint movements. Demographic data were assessed statistically by a univariate analysis following a multiple regression analysis by a stepwise selection. A significant difference was observed between the groups in the number of days from grafting to complete wound healing of the graft site and with or without an escharotomy in the analysis. These parameters were statistically significant predictors of functional category B. The functional outcome of a burned hand after a delayed excision and split-thickness skin graft on the dorsal side became degraded depending on the number of days from grafting to complete wound healing. Cases that underwent an escharotomy also showed deterioration in function.

  13. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat

    NARCIS (Netherlands)

    Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.

    2010-01-01

    Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading

  14. Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies

    Directory of Open Access Journals (Sweden)

    Singh Varinderjit

    2015-01-01

    Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.

  15. A Perspective on the Interplay of Ultraviolet-Radiation, Skin Microbiome and Skin Resident Memory TCRαβ+ Cells

    Directory of Open Access Journals (Sweden)

    VijayKumar Patra

    2018-05-01

    Full Text Available The human skin is known to be inhabited by diverse microbes, including bacteria, fungi, viruses, archaea, and mites. This microbiome exerts a protective role against infections by promoting immune development and inhibiting pathogenic microbes to colonize skin. One of the factors having an intense effect on the skin and its resident microbes is ultraviolet-radiation (UV-R. UV-R can promote or inhibit the growth of microbes on the skin and modulate the immune system which can be either favorable or harmful. Among potential UV-R targets, skin resident memory T cells (TRM stand as well positioned immune cells at the forefront within the skin. Both CD4+ or CD8+ αβ TRM cells residing permanently in peripheral tissues have been shown to play prominent roles in providing accelerated and long-lived specific immunity, tissue homeostasis, wound repair. Nevertheless, their response upon UV-R exposure or signals from microbiome are poorly understood compared to resident TCRγδ cells. Skin TRM survive for long periods of time and are exposed to innumerable antigens during lifetime. The interplay of TRM with skin residing microbes may be crucial in pathophysiology of various diseases including psoriasis, atopic dermatitis and polymorphic light eruption. In this article, we share our perspective about how UV-R may directly shape the persistence, phenotype, specificity, and function of skin TRM; and moreover, whether UV-R alters barrier function, leading to microbial-specific skin TRM, disrupting the healthy balance between skin microbiome and skin immune cells, and resulting in chronic inflammation and diseased skin.

  16. Nanorobotic investigation identifies novel visual, structural and functional correlates of autoimmune pathology in a blistering skin disease model.

    Directory of Open Access Journals (Sweden)

    Kristina Seiffert-Sinha

    Full Text Available There remain major gaps in our knowledge regarding the detailed mechanisms by which autoantibodies mediate damage at the tissue level. We have undertaken novel strategies at the interface of engineering and clinical medicine to integrate nanoscale visual and structural data using nanorobotic atomic force microscopy with cell functional analyses to reveal previously unattainable details of autoimmune processes in real-time. Pemphigus vulgaris is a life-threatening autoimmune blistering skin condition in which there is disruption of desmosomal cell-cell adhesion structures that are associated with the presence of antibodies directed against specific epithelial proteins including Desmoglein (Dsg 3. We demonstrate that pathogenic (blister-forming anti-Dsg3 antibodies, distinct from non-pathogenic (non-blister forming anti-Dsg3 antibodies, alter the structural and functional properties of keratinocytes in two sequential steps--an initial loss of cell adhesion and a later induction of apoptosis-related signaling pathways, but not full apoptotic cell death. We propose a "2-Hit" model for autoimmune disruption associated with skin-specific pathogenic autoantibodies. These data provide unprecedented details of autoimmune processes at the tissue level and offer a novel conceptual framework for understanding the action of self-reactive antibodies.

  17. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  19. The Roles of Vitamin C in Skin Health.

    Science.gov (United States)

    Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M

    2017-08-12

    The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.

  20. Family functioning and illness perception of parents of children with atopic dermatitis, living without skin symptoms, but with psychosomatic symptoms.

    Science.gov (United States)

    Rodríguez-Orozco, Alain R; Kanán-Cedeño, E G; Guillén Martínez, E; Campos Garibay, M J

    2011-03-01

    Emotional factors and a recurrent psychosomatic environment, have been implicated in the evolution of atopic dermatitis. These, in turn, affect the disease. This study was under taken to evaluate the functioning of families with a child that has atopic dermatitis without skin symptoms and the parents' perceptions of their child's disease.Semi-quantitative and cross-sectional study in which questionnaires were applied: one to study family functioning (Espejel et al. scale) and the second to determine aspects of parental perception of their child's atopic dermatitis. Pearson's correlation was used to analyze the correlation between the categories of the Family Function Scale.The most affected categories of family functioning were authority, handling of disruptive conduct, communication, and negative affect. The most significant positive correlations between the categories of family functioning were: authority and support, r=0.867, pparents, 66.4% thought that the pharmacotherapy used for their child's atopic dermatitis was not effective, and 33.3% of parents stated that the disease had affected their child's daily activities.In families of children with atopic dermatitis, various family environment factors facilitate the recurrence of symptoms even when no cutaneous lesions have been found on the child. The identification and use of family resources to face this disease are aspects that should be taken into consideration during the psychotherapeutic management of these families, putting emphasis on the most affected functional categories of these families in a strategy that should be implanted in a multi-disciplinary context.

  1. DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.

    Science.gov (United States)

    Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim

    2017-12-01

    In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.

  2. Contactless diagnostics of biophysical parameters of skin and blood on the basis of approximating functions for radiation fluxes scattered by skin

    Energy Technology Data Exchange (ETDEWEB)

    Lisenko, S A; Kugeiko, M M [Belarusian State University, Minsk (Belarus)

    2014-03-28

    Approximating expressions are derived to calculate spectral and spatial characteristics of diffuse reflection of light from a two-layer medium mimicking human skin. The effectiveness of the use of these expressions in the optical diagnosis of skin biophysical parameters (tissue scattering parameters, concentration of melanin in the epidermis, concentration of total haemoglobin and bilirubin in the tissues of the dermis) and content of haemoglobin derivatives in blood (oxy-, deoxy-, met-, carboxy- and sulfhaemoglobin) is analysed numerically. The methods are proposed to determine in realtime these parameters without contact of the measuring instrument with the patient's body. (biophotonics)

  3. Contactless diagnostics of biophysical parameters of skin and blood on the basis of approximating functions for radiation fluxes scattered by skin

    Science.gov (United States)

    Lisenko, S. A.; Kugeiko, M. M.

    2014-03-01

    Approximating expressions are derived to calculate spectral and spatial characteristics of diffuse reflection of light from a two-layer medium mimicking human skin. The effectiveness of the use of these expressions in the optical diagnosis of skin biophysical parameters (tissue scattering parameters, concentration of melanin in the epidermis, concentration of total haemoglobin and bilirubin in the tissues of the dermis) and content of haemoglobin derivatives in blood (oxy-, deoxy-, met-, carboxy- and sulfhaemoglobin) is analysed numerically. The methods are proposed to determine in realtime these parameters without contact of the measuring instrument with the patient's body.

  4. Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

    Science.gov (United States)

    Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

    2013-01-01

    Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

  5. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  6. Modulatory effects of the fruits of Tribulus terrestris L. on the function of atopic dermatitis-related calcium channels, Orai1 and TRPV3

    Directory of Open Access Journals (Sweden)

    Joo Hyun Nam

    2016-07-01

    Conclusions: Our results suggest that T. terrestris extract may have a therapeutic potential for recovery of abnormal skin barrier pathologies in atopic dermatitis through modulating the activities of calcium ion channels, Orai1 and TRPV3. This is the first study to report the modulatory effect of a medicinal plant on the function of ion channels in skin barrier.

  7. Experimental skin carcinoma by UVB application

    Directory of Open Access Journals (Sweden)

    Andrada Iftode

    2016-12-01

    Full Text Available OBJECTIVES AND BACKGROUND The aim of this research study was to evaluate the harmful effects at skin level induced by concomitant and repeated exposure to three toxic agents: UVB radiation, DMBA and TPA. MATERIALS AND METHODS Experimental mice were divided in thw following groups (n=5 mice/group: group 1 – healthy mice, group 2 – mice exposed to UVB – radiation and topical administration of acetone and group 3 – mice exposed to UVB – radiation and topical application of DMBA and TPA solutions (phase I - double tumor initiation and phase II - tumor promotion. RESULTS Application of these compounds led to the development of skin papilloma and to significant changes in skin parameters. CONCLUSIONS The barrier