Composite of microgels and lipids as biofilm to restore skin barrier function

NARCIS (Netherlands)

Oudshoorn, M.H.M.

2008-01-01

The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

Science.gov (United States)

van Smeden, Jeroen; Bouwstra, Joke A

2016-01-01

Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

Herbal medicines that benefit epidermal permeability barrier function

Directory of Open Access Journals (Sweden)

Lizhi Hu

2015-06-01

Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

Science.gov (United States)

Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

2012-01-01

Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

Science.gov (United States)

Kubota, Takahiro

2012-06-01

Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

Skin barrier disruption by acetone: observations in a hairless mouse skin model

NARCIS (Netherlands)

Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

2009-01-01

To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term

Multifactorial skin barrier deficiency and atopic dermatitis: Essential topics to prevent the atopic march.

Science.gov (United States)

Egawa, Gyohei; Kabashima, Kenji

2016-08-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

Science.gov (United States)

Ohno, Yusuke

2017-01-01

The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

Science.gov (United States)

Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

2017-08-01

Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

DEFF Research Database (Denmark)

Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...

Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

Science.gov (United States)

Kawano, Ken-Ichi; Umemura, Kazuo

2013-05-01

The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

Structure and Function of Your Skin

Science.gov (United States)

... Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . ... in the dermis. What It Does . . . The major function of skin is to provide a barrier between ...

Defective channels lead to an impaired skin barrier.

Science.gov (United States)

Blaydon, Diana C; Kelsell, David P

2014-10-15

Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

Science.gov (United States)

Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

2018-04-24

In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

The structure, function, and importance of ceramides in skin and their use as therapeutic agents in skin-care products.

Science.gov (United States)

Meckfessel, Matthew H; Brandt, Staci

2014-07-01

Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Antimicrobial Peptides, Infections and the Skin Barrier

DEFF Research Database (Denmark)

Clausen, Maja Lisa; Agner, Tove

2016-01-01

The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis and trans......The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis...

Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.

Science.gov (United States)

Draelos, Zoe D

2005-01-01

The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.

Penetration of radionuclides across skin barriers of animal skin models in vitro

International Nuclear Information System (INIS)

Koprda, V.; Harangozo, M.; Bohacik, L.; Kassai, Z.

1998-01-01

In this paper: (i) the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model has been studied, (ii) the biologic structure mostly responsible for the barrier effect was selected and proved, (iii) the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ (the diffusion across the intact skin and the diffusion through the hair channels) was assessed. All experiments were done using radioactive tracers. Experimental arrangement consisted of Franz-type vertical permeation cells used with fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), respectively. 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used in full form (intact), and then with decreasing thickness of horny layer after the skin had been stripped with Scotch type (3M) 5-20 times respectively, or the skin was splitted under 60 degC hot water so that the whole epidermis was removed. The penetrated amounts of ions were found to be proportional to the time at least in the first 7 hours. The permeation resistance of the skin is proportional to the thickness of the horny layer, the principal barrier mostly restricting the flux of ions. The more the skin is stripped, the more enhanced is the penetration of ions. This corroborates the fact that stratum corneum represents the most important barrier function of the whole skin (of rats). The additional diffusion through channels along hairs (follicules) can be of important value also in case of human skin where hair density is many times lower than in the case of the animal models used

Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

Science.gov (United States)

Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

2016-09-01

Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

NARCIS (Netherlands)

Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

2005-01-01

The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

Impaired Skin Barrier Due to Sebaceous Gland Atrophy in the Latent Stage of Radiation-Induced Skin Injury: Application of Non-Invasive Diagnostic Methods

Directory of Open Access Journals (Sweden)

Hyosun Jang

2018-01-01

Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.

Penetration through the Skin Barrier

DEFF Research Database (Denmark)

Nielsen, Jesper Bo; Benfeldt, Eva; Holmgaard, Rikke

2016-01-01

The skin is a strong and flexible organ with barrier properties essential for maintaining homeostasis and thereby human life. Characterizing this barrier is the ability to prevent some chemicals from crossing the barrier while allowing others, including medicinal products, to pass at varying rates......-through diffusion cells) as well as in vivo methods (microdialysis and microperfusion). Then follows a discussion with examples of how different characteristics of the skin (age, site and integrity) and of the penetrants (size, solubility, ionization, logPow and vehicles) affect the kinetics of percutaneous...

Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery

Science.gov (United States)

Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.

2010-01-01

Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044

Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

Science.gov (United States)

Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

2008-11-15

Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

Science.gov (United States)

Han, Seung Hoon; Park, Ji Woong

2017-11-01

The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

Skin barrier composition

International Nuclear Information System (INIS)

Osburn, F.G.

1985-01-01

A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)

Skin barrier composition

Energy Technology Data Exchange (ETDEWEB)

Osburn, F G

1985-06-12

A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.

An ex vivo human skin model for studying skin barrier repair.

Science.gov (United States)

Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A

2015-01-01

In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro.

Science.gov (United States)

Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees

2005-10-01

The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.

Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

NARCIS (Netherlands)

den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

2008-01-01

The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

Skin barrier properties in patients with recessive X-linked ichthyosis

DEFF Research Database (Denmark)

Johansen, J D; Ramsing, D; Vejlsgaard, G

1995-01-01

Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...

Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study

Directory of Open Access Journals (Sweden)

Elisabeth Hahnel

2017-11-01

Full Text Available Abstract Background Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. Methods This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Results Mean age (n = 223 was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%. The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%, of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2% and of skin tears 6.3% (95% CI: 3.2% - 9.5%. Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Conclusion Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis

Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study.

Science.gov (United States)

Hahnel, Elisabeth; Blume-Peytavi, Ulrike; Trojahn, Carina; Kottner, Jan

2017-11-13

Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Mean age (n = 223) was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%). The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%), of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2%) and of skin tears 6.3% (95% CI: 3.2% - 9.5%). Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis have been detected, that might limit the diagnostic value of skin

Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis

NARCIS (Netherlands)

Bogaard, E.H. van den; Bergboer, J.G.M.; Vonk-Bergers, M.; Vlijmen-Willems, I.M. van; Hato, S.V.; Valk, P.G. van der; Schroder, J.M.; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.

2013-01-01

Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte-mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular

Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

Science.gov (United States)

Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

2010-01-01

Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

The important role of stratum corneum lipids for the cutaneous barrier function.

Science.gov (United States)

van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

2014-03-01

The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

Mechanism for initiation of food allergy: Dependence on skin barrier mutations and environmental allergen costimulation.

Science.gov (United States)

Walker, Matthew T; Green, Jeremy E; Ferrie, Ryan P; Queener, Ashley M; Kaplan, Mark H; Cook-Mills, Joan M

2018-02-15

Mechanisms for the development of food allergy in neonates are unknown but clearly linked in patient populations to a genetic predisposition to skin barrier defects. Whether skin barrier defects contribute functionally to development of food allergy is unknown. The purpose of the study was to determine whether skin barrier mutations, which are primarily heterozygous in patient populations, contribute to the development of food allergy. Mice heterozygous for the filaggrin (Flg) ft and Tmem79 ma mutations were skin sensitized with environmental and food allergens. After sensitization, mice received oral challenge with food allergen, and then inflammation, inflammatory mediators, and anaphylaxis were measured. We define development of inflammation, inflammatory mediators, and food allergen-induced anaphylaxis in neonatal mice with skin barrier mutations after brief concurrent cutaneous exposure to food and environmental allergens. Moreover, neonates of allergic mothers have increased responses to suboptimal sensitization with food allergens. Importantly, responses to food allergens by these neonatal mice were dependent on genetic defects in skin barrier function and on exposure to environmental allergens. ST2 blockade during skin sensitization inhibited the development of anaphylaxis, antigen-specific IgE, and inflammatory mediators. Neonatal anaphylactic responses and antigen-specific IgE were also inhibited by oral pre-exposure to food allergen, but interestingly, this was blunted by concurrent pre-exposure of the skin to environmental allergen. These studies uncover mechanisms for food allergy sensitization and anaphylaxis in neonatal mice that are consistent with features of human early-life exposures and genetics in patients with clinical food allergy and demonstrate that changes in barrier function drive development of anaphylaxis to food allergen. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

DEFF Research Database (Denmark)

Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

2010-01-01

chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

Natural Oils for Skin-Barrier Repair: Ancient Compounds Now Backed by Modern Science.

Science.gov (United States)

Vaughn, Alexandra R; Clark, Ashley K; Sivamani, Raja K; Shi, Vivian Y

2018-02-01

Natural plant oils are commonly used as topical therapy worldwide. They are usually easily accessible and are relatively inexpensive options for skin care. Many natural oils possess specific compounds with antimicrobial, antioxidant, anti-inflammatory, and anti-itch properties, making them attractive alternative and complementary treatments for xerotic and inflammatory dermatoses associated with skin-barrier disruption. Unique characteristics of various oils are important when considering their use for topical skin care. Differing ratios of essential fatty acids are major determinants of the barrier repair benefits of natural oils. Oils with a higher linoleic acid to oleic acid ratio have better barrier repair potential, whereas oils with higher amounts of irritating oleic acid may be detrimental to skin-barrier function. Various extraction methods for oils exist, including cold pressing to make unrefined oils, heat and chemical distillation to make essential oils, and the addition of various chemicals to simulate a specific scent to make fragranced oils. The method of oil processing and refinement is an important component of selecting oil for skin care, and cold pressing is the preferred method of oil extraction as the heat- and chemical-free process preserves beneficial lipids and limits irritating byproducts. This review summarizes evidence on utility of natural plant-based oils in dermatology, particularly in repairing the natural skin-barrier function, with the focus on natural oils, including Olea europaea (olive oil), Helianthus annus (sunflower seed oil), Cocos nucifera (coconut oil), Simmondsia chinesis (jojoba oil), Avena sativa (oat oil), and Argania spinosa (argan oil).

Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

Science.gov (United States)

Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

2017-02-08

Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

Science.gov (United States)

Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

2013-11-01

The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

Science.gov (United States)

Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

2015-08-01

The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

OpenAIRE

Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

2008-01-01

Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

Ion microbeam analysis. Application to the study of the skin barrier and its nano-toxicology

International Nuclear Information System (INIS)

Simon, M.

2009-12-01

This work is dedicated to the use of ion microbeam irradiation to the study of a complex biological tissue like skin. Up to now, it has been very difficult to detect and track metallic oxides and manufactured nano-particles in biological tissues, most particularly in skin. Thus, it is essential to precise the mechanisms involved in skin barrier function processes face to exogenous agents like nano-particles and to characterize them in biological models in vitro/in vivo. During my work, I have had the opportunity to combine quantitative methods of analysis with high resolution imagery techniques (confocal microscopy, transmission electron microscopy and ion beam analysis) in order to characterize: (i) the skin barrier function of an ex vivo pig ear skin model understanding the ion homeostasis behavior face to different chemical or physical stresses; (ii) the impact on viability, accumulation and intracellular distribution of nano-particles (Titanium Oxides) naked or functionalized with fluorescent dyes (FITC, Rhodamine)

Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

NARCIS (Netherlands)

Eweje, M.O.

2016-01-01

The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

Multiphoton STED and FRET in human skin: Resolving the skin barrier

DEFF Research Database (Denmark)

Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.

intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...

Matching the skin barrier to the skin type.

Science.gov (United States)

Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

DEFF Research Database (Denmark)

Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

Evaluation of a cyanoacrylate dressing to manage peristomal skin alterations under ostomy skin barrier wafers.

Science.gov (United States)

Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet

2011-01-01

Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.

Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.

Science.gov (United States)

Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A

2009-08-01

The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.

LOCALIZATION OF PERMEABILITY BARRIERS IN THE FROG SKIN EPITHELIUM

Science.gov (United States)

Martinez-Palomo, A.; Erlij, D.; Bracho, H.

1971-01-01

Ruthenium red and colloidal lanthanum were used to determine the site of the structural barriers to diffusion within the intercellular spaces of frog skin epithelium. Electron micrographs show that occluding zonules located at the outer border of the stratum corneum and at the outer layer of the stratum granulosum are true tight junctions since they are impermeable to these tracers. Measurement of 140La uptake by the living skin shows that lanthanum moves across the external surface of the skin readily, into and out of a compartment that has a limited capacity and is bounded on its internal side by a barrier impermeable to lanthanum. Examination of these skins with the electron microscope suggests that the compartment is localized between the external membrane of the cells at the outer layer of the s. granulosum and at the outermost surface of the skin. These observations and other findings described in the literature indicate that the site of the external high resistance barrier of the frog skin is localized at the outer border of the s. granulosum. PMID:4329611

Skin barrier properties in patients with recessive X-linked ichthyosis

DEFF Research Database (Denmark)

Johansen, J D; Ramsing, D; Vejlsgaard, G

1995-01-01

increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...

The outcomes of barrier protection in periwound skin and stoma care.

Science.gov (United States)

Stephen-Haynes, Jackie

This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

Science.gov (United States)

Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

2017-01-01

Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

Science.gov (United States)

Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

2015-10-01

Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

DEFF Research Database (Denmark)

Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

2007-01-01

12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

Science.gov (United States)

Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

2015-03-01

The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

Cost-effectiveness of a Ceramide-Infused Skin Barrier Versus a Standard Barrier

Science.gov (United States)

Berger, Ariel; Inglese, Gary; Skountrianos, George; Karlsmark, Tonny; Oguz, Mustafa

2018-01-01

PURPOSE: To assess the cost-effectiveness of a ceramide-infused skin barrier (CIB) versus other skin barriers (standard of care) among patients who have undergone ostomy creation. DESIGN: Cost-effectiveness analysis, based on a decision-analytic model that was estimated using data from the ADVOCATE (A Study Determining Variances in Ostomy Skin Conditions And The Economic Impact) trial, which investigated stoma-related healthcare costs over 12 weeks among patients who recently underwent fecal ostomy, and from other sources. SUBJECTS AND SETTING: Analysis was based on a hypothetical cohort of 1000 patients who recently underwent fecal ostomy; over a 1-year period, 500 patients were assumed to use CIB and 500 were assumed to use standard of care. METHODS: We adapted a previous economic model to estimate expected 1-year costs and outcomes among persons with a new ostomy assumed to use CIB versus standard of care. Outcomes of interest included peristomal skin complications (PSCs) (up to 2 during the 1-year period of interest) and quality-adjusted life days (QALDs); QALDs vary from 1, indicating a day of perfect health to 0, indicating a day with the lowest possible health (deceased). Subjects were assigned QALDs on a daily basis, with the value of the QALD on any given day based on whether the patient was experiencing a PSC. Costs included those related to skin barriers, ostomy accessories, and care of PSCs. The incremental cost-effectiveness of CIB versus standard of care was estimated as the incremental cost per PSC averted and QALD gained, respectively; net monetary benefit of CIB was also estimated. All analyses were run using the perspective of an Australian payer. RESULTS: On a per-patient basis, use of CIB was expected over a 1-year period to result in 0.16 fewer PSCs, an additional 0.35 QALDs, and a savings of A$180 (Australian dollars, US $137) in healthcare costs all versus standard of care. Management with CIB provided a net monetary benefit (calculated as

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of a health claim related to flaxseed oil and vitamin E and maintenance of the skin permeability barrier function pursuant to Article 13(5) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...

Effect of glove occlusion on the skin barrier

DEFF Research Database (Denmark)

Tiedemann, Daniel; Clausen, Maja Lisa; John, Swen Malthe

2016-01-01

that the negative effect of occlusion in itself is limited, and that only extensive and long-term occlusion will cause barrier impairment. However, studies investigating combined effect of occlusion and exposure to soaps/detergents indicate that occlusion significantly enhances the skin barrier damage caused...... by detergents/soaps in a dose-response fashion....

Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

Directory of Open Access Journals (Sweden)

Pasricha J

1991-01-01

Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus).

Science.gov (United States)

Alves, Ricardo N; Sundell, Kristina S; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M

2018-06-01

To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na + , K + -ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier's functional properties mature earlier and are independent of metamorphosis.

Recovery Effects of Oral Administration of Glucosylceramide and Beet Extract on Skin Barrier Destruction by UVB in Hairless Mice

Directory of Open Access Journals (Sweden)

Yoshihiro Tokudome

2017-10-01

Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.

The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2011-01-01

therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2011-01-01

therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

Disturbed skin barrier in children with chronic kidney disease.

Science.gov (United States)

Wojtowicz-Prus, Elzbieta; Kilis-Pstrusinska, Katarzyna; Reich, Adam; Zachwieja, Katarzyna; Miklaszewska, Monika; Szczepanska, Maria; Szepietowski, Jacek C

2015-02-01

There are limited data on skin lesions in children with end-stage renal failure. The aim of the study was an evaluation of the skin barrier in children with different stages of chronic kidney disease (CKD). The prevalence of xerosis, its severity, as well as its link selected demographic factors, were examined. The study included 103 children: 72 with CKD stages 3-5 (38 on conservative treatment and 34 on dialysis) and 31 patients with primary monosymptomatic nocturnal enuresis as a control group. Initially, the study subjects described the localisation and severity of dry skin by themselves. Next, clinical evaluation of xerosis, non-invasive corneometric assessment of epidermis moisturising and the measurement of transepidermal water loss were performed. Most CKD children reported dry skin. The problem of xerosis was identified more frequently in patients on dialysis (67.6 %) than on conservative treatment (42.1 %) (p = 0.01). CKD patients divided according to skin dryness did not differ with regards to age, sex, initial kidney disease and CKD duration. Disturbed skin barrier is an important concern of children with CKD, intensifying as the disease progresses. This symptom occurs on early stages of CKD and it should be taken into consideration in the CKD management.

Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

Science.gov (United States)

Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

2017-12-18

The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

Directory of Open Access Journals (Sweden)

Montserrat Rojo de la Vega

2017-12-01

Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

Skin barrier integrity and natural moisturising factor levels after cumulative dermal exposure to alkaline agents in atopic dermatitis

NARCIS (Netherlands)

Angelova-Fischer, Irena; Dapic, Irena; Hoek, Anne-Karin; Jakasa, Ivone; Fischer, Tobias W.; Zillikens, Detlef; Kezic, Sanja

2014-01-01

Dermal exposure to alkaline agents may lead to skin barrier damage and irritant contact dermatitis. The objective of this study was to investigate the effects of cumulative exposure to 0.5% sodium lauryl sulphate (SLS) and 0.15% NaOH on the barrier function and natural moisturising factor (NMF)

The effects of using a moldable skin barrier on peristomal skin condition in persons with an ostomy: results of a prospective, observational, multinational study.

Science.gov (United States)

Szewczyk, Maria Teresa; Majewska, Grazyna; Cabral, Mary V; Hölzel-Piontek, Karin

2014-12-01

Peristomal skin problems are the most commonly experienced physical complication following ostomy surgery and often are caused by leakage or a poorly fitting skin barrier. A prospective, multicenter, observational evaluation of persons with a colostomy, ileostomy, or urostomy was conducted to assess the incidence of peristomal lesions and level of patient satisfaction with moldable skin barriers. Peristomal skin was assessed using the Studio Alterazoni Cutanee Stomale (SACS™) scale, and patients were asked to rate barrier application and usage variables. During a period of 12 months, and using convenience sampling, 561 patients from 90 centers in 3 countries were enrolled: 28 in Germany, 48 in Poland, and 14 in the United States. Participants included 277 new stoma patients (average time since surgery 0.3 months; average age 64.7 ± 12.86 years) who had a colostomy (174), ileostomy (72), or urostomy (10); and 284 patients with an existing stoma (average time since surgery 18.2 months; average age 66 ± 12.62 years) who had a colostomy (174), ileostomy (88), or urostomy (22) who experienced skin complications using a traditional skin barrier (ie, a solid or flexible barrier with precut opening or one requiring cutting an opening to accommodate the stoma). All patients were assessed at baseline and after 1 and 2 months. In the patients with a new stoma, 225 (90.4%) had intact skin at baseline, 239 (95.6%) had intact skin after 2 months, and 98% rated overall satisfaction with the barrier as good or excellent. In the patients with an existing stoma, intact skin was observed in 103 patients (39.5%) at baseline and 225 (86.2%) after 2 months, with 96.5% of patients rating overall satisfaction with the barrier as good or excellent. In this group, the proportion of patients who used accessory products (eg, belt, deodorants, powder) was 73% at baseline and 64.2% at the 2-month follow-up. The moldable skin barriers evaluated were effective in preventing and healing

Hydration effects on the barrier function of stratum corneum lipids: Raman analysis of ceramides 2, III and 5.

Science.gov (United States)

Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette

2013-11-07

The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.

The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

Science.gov (United States)

Draelos, Zoe D

2006-07-01

Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

Two Ancient Gene Families Are Critical for Maintenance of the Mammalian Skin Barrier in Postnatal Life.

Science.gov (United States)

Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M

2016-07-01

The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Physiological and Molecular Effects of in vivo and ex vivo Mild Skin Barrier Disruption.

Science.gov (United States)

Pfannes, Eva K B; Weiss, Lina; Hadam, Sabrina; Gonnet, Jessica; Combardière, Béhazine; Blume-Peytavi, Ulrike; Vogt, Annika

2018-01-01

The success of topically applied treatments on skin relies on the efficacy of skin penetration. In order to increase particle or product penetration, mild skin barrier disruption methods can be used. We previously described cyanoacrylate skin surface stripping as an efficient method to open hair follicles, enhance particle penetration, and activate Langerhans cells. We conducted ex vivo and in vivo measurements on human skin to characterize the biological effect and quantify barrier disruption-related inflammation on a molecular level. Despite the known immunostimulatory effects, this barrier disruption and hair follicle opening method was well accepted and did not result in lasting changes of skin physiological parameters, cytokine production, or clinical side effects. Only in ex vivo human skin did we find a discrete increase in IP-10, TGF-β, IL-8, and GM-CSF mRNA. The data underline the safety profile of this method and demonstrate that the procedure per se does not cause substantial inflammation or skin damage, which is also of interest when applied to non-invasive sampling of biomarkers in clinical trials. © 2018 S. Karger AG, Basel.

Establishment and function of tissue-resident innate lymphoid cells in the skin

Directory of Open Access Journals (Sweden)

Jie Yang

2017-03-01

Full Text Available ABSTRACT Innate lymphoid cells (ILCs are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.

Establishment and function of tissue-resident innate lymphoid cells in the skin.

Science.gov (United States)

Yang, Jie; Zhao, Luming; Xu, Ming; Xiong, Na

2017-07-01

Innate lymphoid cells (ILCs) are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.

Microspectroscopic Confocal Raman and Macroscopic Biophysical Measurements in the in vivo Assessment of the Skin Barrier: Perspective for Dermatology and Cosmetic Sciences

NARCIS (Netherlands)

Falcone, D.; Uzunbajakava, N.E.; Varghese, B.; Aquino Santos, G.R. de; Richters, R.J.H.; Kerkhof, P.C.M. van de; Erp, P.E.J. van

2015-01-01

Skin barrier function, confined to the stratum corneum, is traditionally evaluated using established, noninvasive biophysical methods like transepidermal water loss, capacitance and conductance. However, these methods neither measure skin molecular composition nor its structure, hindering the actual

Metabolic and redox barriers in the skin exposed to drugs and xenobiotics.

Science.gov (United States)

Korkina, Liudmila

2016-01-01

Growing exposure of human skin to environmental and occupational hazards, to numerous skin care/beauty products, and to topical drugs led to a biomedical concern regarding sustainability of cutaneous chemical defence that is essential for protection against intoxication. Since skin is the largest extra-hepatic drug/xenobiotic metabolising organ where redox-dependent metabolic pathways prevail, in this review, publications on metabolic processes leading to redox imbalance (oxidative stress) and its autocrine/endocrine impact to cutaneous drug/xenobiotic metabolism were scrutinised. Chemical and photo-chemical skin barriers contain metabolic and redox compartments: their protective and homeostatic functions. The review will examine the striking similarity of adaptive responses to exogenous chemical/photo-chemical stressors and endogenous toxins in cutaneous metabolic and redox system; the role(s) of xenobiotics/drugs and phase II enzymes in the endogenous antioxidant defence and maintenance of redox balance; redox regulation of interactions between metabolic and inflammatory responses in skin cells; skin diseases sharing metabolic and redox problems (contact dermatitis, lupus erythematosus, and vitiligo) Due to exceptional the redox dependence of cutaneous metabolic pathways and interaction of redox active metabolites/exogenous antioxidants with drug/xenobiotic metabolism, metabolic tests of topical xenobiotics/drugs should be combined with appropriate redox analyses and performed on 3D human skin models.

Coffee polyphenols extracted from green coffee beans improve skin properties and microcirculatory function.

Science.gov (United States)

Fukagawa, Satoko; Haramizu, Satoshi; Sasaoka, Shun; Yasuda, Yuka; Tsujimura, Hisashi; Murase, Takatoshi

2017-09-01

Coffee polyphenols (CPPs), including chlorogenic acid, exert various physiological activities. The purpose of this study was to investigate the effects of CPPs on skin properties and microcirculatory function in humans. In this double-blind, placebo-controlled study, 49 female subjects with mildly xerotic skin received either a test beverage containing CPPs (270 mg/100 mL/day) or a placebo beverage for 8 weeks. The ingestion of CPPs significantly lowered the clinical scores for skin dryness, decreased transepidermal water loss, skin surface pH, and increased stratum corneum hydration and the responsiveness of skin blood flow during local warming. Moreover, the amounts of free fatty acids and lactic acid in the stratum corneum significantly increased after the ingestion of CPPs. These results suggest that an 8-week intake of CPPs improve skin permeability barrier function and hydration, with a concomitant improvement in microcirculatory function, leading to efficacy in the alleviation of mildly xerotic skin.

Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

Science.gov (United States)

Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

2017-01-01

Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

Measurement of transepidermal water loss (TEWL) in cats with experimental skin barrier dysfunction using a closed chamber system.

Science.gov (United States)

Momota, Yutaka; Shimada, Kenichiro; Gin, Azusa; Matsubara, Takako; Azakami, Daigo; Ishioka, Katsumi; Nakamura, Yuka; Sako, Toshinori

2016-10-01

A closed chamber evaporimeter is suitable for measuring transepidermal water loss (TEWL) in cats because of the compact device size, tolerance to sudden movement and short measuring time. TEWL is a representative parameter for skin barrier dysfunction, which is one of the clinical signs of atopic dermatitis in humans and dogs. Measurement of feline TEWL has been reported, but applicability of this parameter has not been validated. The aims of this study were to determine if tape stripping is a valid experimental model in cats for studying TEWL and to determine if a closed chambered system is a suitable measurement tool for cats. Ten clinically normal cats. In order to evaluate variation of the measured values, TEWL was measured at the right and left side of the three clipped regions (axillae, lateral thigh and groin). Subsequently, TEWL was measured using sequential tape stripping of the stratum corneum as a model of acute barrier disruption. The variations between both sides of the three regions showed no significant difference. Sequential tape stripping was associated with increasing values for TEWL. Feline TEWL was shown to reflect changes in the skin barrier in an experimental model using a closed chamber system and has the potential for evaluating skin barrier function in cats with skin diseases. © 2016 ESVD and ACVD.

Functional and morphological studies of photodamaged skin on the hands of middle-aged Japanese golfers.

Science.gov (United States)

Kikuchi-Numagami, K; Suetake, T; Yanai, M; Takahashi, M; Tanaka, M; Tagami, H

2000-06-01

The skin of golfers' hands provides a suitable model to study the effect of chronic sun exposure, because one of their hands is exposed to the outer environment, especially sunlight, while the other one is always protected by a glove during play. Our purpose was to find out the influence of photodamage on the properties of the skin surface of middle-aged Japanese by using non-invasive methods. We measured hydration state, and water barrier function of the stratum corneum (SC) and the color of the skin of the dorsum of the hands. In a separate study, we evaluated the skin surface contour by using replicas taken from the skin in a slightly stretched or relaxed position. We found a significant decrease in hydration of the skin surface of the exposed skin as compared to that of the protected skin, whereas no such difference was found with transepidermal water loss, a parameter for water barrier function of the SC. Luminance of skin color was also reduced in the sun-exposed skin. Replica analysis revealed that large wrinkles developing in a relaxed position were more prominent on the exposed than on the protected skin, while fine furrows noted in a slightly stretched position were shallower on the former than the latter. The data obtained indicate that the chronically exposed skin of golfers' hands shows morphological and functional changes resulting from long time exposure to the outer environment especially sunlight. Furthermore, bioengineering non-invasive methods are found to be useful to detect early photodamage of the skin in a more quantitative fashion which is rather difficult to demonstrate clinically.

Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus)

KAUST Repository

Alves, Ricardo N.; Sundell, Kristina S.; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M.

2018-01-01

To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.

Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus)

KAUST Repository

Alves, Ricardo N.

2018-02-20

To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.

Examination of the skin barrier repair/wound healing process using a living skin equivalent model and matrix-assisted laser desorption-ionization-mass spectrometry imaging.

Science.gov (United States)

Lewis, E E L; Barrett, M R T; Freeman-Parry, L; Bojar, R A; Clench, M R

2018-04-01

Examination of the skin barrier repair/wound healing process using a living skin equivalent (LSE) model and matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI) to identify lipids directly involved as potential biomarkers. These biomarkers may be used to determine whether an in vivo wound is going to heal for example if infected. An in vitro LSE model was wounded with a scalpel blade and assessed at day 4 post-wounding by histology and MALDI-MSI. Samples were sectioned at wound site and were either formalin-fixed paraffin-embedded (FFPE) for histology or snapped frozen (FF) for MSI analysis. The combination of using an in vitro wounded skin model with MSI allowed the identification of lipids involved in the skin barrier repair/wound healing process. The technique was able to highlight lipids directly in the wound site and distinguish differences in lipid distribution between the epidermis and wound site. This novel method of coupling an in vitro LSE with MSI allowed in-depth molecular analysis of the skin barrier repair/wound healing process. The technique allowed the identification of lipids directly involved in the skin barrier repair/wound healing process, indicating these biomarkers may be potentially be used within the clinic. These biomarkers will help to determine, which stage of the skin barrier repair/wound healing process the wound is in to provide the best treatment. © 2018 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Controlling the hydration of the skin though the application of occluding barrier creams.

Science.gov (United States)

Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard

2013-03-06

The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.

Alteration of skin hydration and its barrier function by vehicle and permeation enhancers: a study using TGA, FTIR, TEWL and drug permeation as markers.

Science.gov (United States)

Shah, D K; Khandavilli, S; Panchagnula, R

2008-09-01

Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well

Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin

NARCIS (Netherlands)

Oudshoorn, M.H.M.; Rissmann, R.; van der Coelen, D.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

2009-01-01

The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which

[Improvement of rosacea treatment based on the morphological and functional features of the skin].

Science.gov (United States)

Tsiskarishvili, N V; Katsitadze, A G; Tsiskarishvili, Ts I

2013-10-01

Rosacea - a widespread disease sometimes aleak with severe complications, mainly affecting the skin. Irrational and inadequate treatment leads to chronicity of diseases and psychosocial disadaptation of patients. Lately, a clear upward trend in the number of patients in whom in the process of complex treatment manifestations (with the varying degrees of severity) of impaired barrier function of the skin are observed and they need the protection and restoration of the damaged stratum corneum. In patients with rosacea in order to study the function of the facial skin's horny layer we used the skin analyzer BIA (bioimpedance analysis, which in duration of 6 seconds determines the moisture content, oiliness and the softness of the skin) and significant deviations from the norm (decrease in moisture content, fatness and increased roughness) was revealed. These changes were most clearly pronounced in patients with steroid rosacea. To restore the skin barrier the drug "Episofit A" (Laboratory of Evolutionary Dermatology, France) has been used (1-2 times a day for 6 weeks). Evaluation of treatment efficacy was conducted every 2 weeks by means of a scale from 0 to 5 for parameters of dryness, erythema, peeling and expression of subjective feelings. In accordance with received results, using of Episofit A emulsion, especially on the baсkground of long-term treatment with topical steroids, had a pronounced therapeutic effect. Thus, treatment of patients with consideration of morphological and functional features of facial skin, helps to improve the results traditional therapy, and the drug is highly effective means of the new direction in skin care - corneotherapy aimed to reconstruct and protect damaged stratum corneum.

Efficacy of a shower cream and a lotion with skin-identical lipids in healthy subjects with atopic dry skin.

Science.gov (United States)

Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria

2018-05-10

Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.

Effect of Fluid Intake on Hydration Status and Skin Barrier Characteristics in Geriatric Patients: An Explorative Study.

Science.gov (United States)

Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan

2018-04-03

Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.

Skin Barrier Restoration and Moisturization Using Horse Oil-Loaded Dissolving Microneedle Patches.

Science.gov (United States)

Lee, Chisong; Eom, Younghyon Andrew; Yang, Huisuk; Jang, Mingyu; Jung, Sang Uk; Park, Ye Oak; Lee, Si Eun; Jung, Hyungil

2018-01-01

Horse oil (HO) has skin barrier restoration and skin-moisturizing effects. Although cream formulations have been used widely and safely, their limited penetration through the stratum corneum is a major obstacle to maximizing the cosmetic efficacy of HO. Therefore, we aimed to encapsulate HO in a cosmetic dissolving microneedle (DMN) for efficient transdermal delivery. To overcome these limitations of skin permeation, HO-loaded DMN (HO-DMN) patches were developed and evaluated for their efficacy and safety using in vitro and clinical studies. Despite the lipophilic nature of HO, the HO-DMN patches had a sharp shape and uniform array, with an average length and tip diameter of 388.36 ± 16.73 and 38.54 ± 5.29 µm, respectively. The mechanical strength of the HO-DMN patches was sufficient (fracture force of 0.29 ± 0.01 N), and they could successfully penetrate pig skin. During the 4-week clinical evaluation, HO-DMN patches caused significant improvements in skin and dermal density, skin elasticity, and moisturization. Additionally, a brief safety assessment showed that the HO-DMN patches induced negligible adverse events. The HO-DMNs are efficient, safe, and convenient for wide use in cosmetic applications for skin barrier restoration and moisturization. © 2018 S. Karger AG, Basel.

Water vapour loss measurements on human skin.

NARCIS (Netherlands)

Valk, Petrus Gerardus Maria van der

1984-01-01

In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions

Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.

Directory of Open Access Journals (Sweden)

Reiko J Tanaka

Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier

Emu oil-based lotion effects on neonatal skin barrier during transition from intrauterine to extrauterine life

Directory of Open Access Journals (Sweden)

Zanardo V

2017-08-01

Full Text Available Vincenzo Zanardo,1 David Giarrizzo,2 Francesca Volpe,1 Lara Giliberti,1 Gianluca Straface1 1Division of Perinatal Medicine, Policlinico Abano Terme, Abano Terme, 2CALANTHA Physiology of Lactation Laboratory, Padua, Italy Abstract: Both appropriate hydration and skin surface pH are fundamental in preventing baby skin barrier damage during transition from intrauterine to extrauterine life. However, effects of topical moisturizers on neonatal stratum corneum temperature, pH, hydration, and elasticity have not been scientifically evaluated in vivo. We checked 31 full-term breastfeeding neonates by non-invasive bioengineering method, which is able to evaluate the basal skin barrier (left heel, and assessed at 6±1 hours after birth, and at 1 and 24 hours after emu oil-based topical treatment. The basal skin barrier of right heel (no oil exposure of each newborn was considered as control. We found that a single application of an emu oil-based lotion was effective in improving heel stratum corneum hydration, which increases both skin pH and elasticity without any effect on temperature. Further studies are needed to confirm long-term beneficial effects of this treatment in a very sensitive patient population. Keywords: skin barrier, neonate, emu oil-based lotion, topical treatment

[Impact of wet work on epidermal barrier (tewl and stratum corneum hydration) and skin viscoelasticity in nurses].

Science.gov (United States)

Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata

2014-01-01

Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.

Loss of corneodesmosin leads to severe skin barrier defect, pruritus, and atopy: unraveling the peeling skin disease.

Science.gov (United States)

Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

2010-08-13

Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.

Chromium-induced skin damage among Taiwanese cement workers.

Science.gov (United States)

Chou, Tzu-Chieh; Wang, Po-Chih; Wu, Jyun-De; Sheu, Shiann-Cherng

2016-10-01

Little research has been done on the relationships between chromium exposure, skin barrier function, and other hygienic habits in cement workers. Our purpose was to investigate chromium-induced skin barrier disruption due to cement exposure among cement workers. One hundred and eight cement workers were recruited in this study. Urinary chromium concentration was used to characterize exposure levels. The biological exposure index was used to separate high and low chromium exposure. Transepidermal water loss (TEWL) was used to assess the skin barrier function. TEWL was significantly increased in workers with high chromium exposure levels than those with low chromium exposure levels (p = 0.048). A positive correlation was also found between urinary chromium concentration and TEWL (R = 0.28, p = 0.004). After adjusting for smoking status and glove use, a significant correlation between urinary chromium concentrations and TEWL remained. Moreover, workers who smoked and had a high chromium exposure had significantly increased TEWL compared to nonsmokers with low chromium exposure (p = 0.01). Skin barrier function of cement workers may have been disrupted by chromium in cement, and smoking might significantly enhance such skin barrier perturbation with chromium exposure. Decreased chromium skin exposure and smoking cessation should be encouraged at work. © The Author(s) 2015.

Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

DEFF Research Database (Denmark)

Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

2010-01-01

BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

Impact of chemical peeling combined with negative pressure on human skin.

Science.gov (United States)

Kim, S J; Kang, I J; Shin, M K; Jeong, K H; Baek, J H; Koh, J S; Lee, S J

2016-10-01

In vivo changes in skin barrier function after chemical peeling with alpha hydroxyacids (AHAs) have been previously reported. However, the additional effects of physical treatment with chemical agents on skin barrier function have not been adequately studied. This study measured the degree of acute skin damage and the time required for skin barrier repair using non-invasive bioengineering methods in vivo with human skin to investigate the additional effect of a 4% AHA chemical jet accelerated at supersonic velocities. Thirteen female subjects (average age: 29.54 ± 4.86 years) participated in this study. The faces of the subjects were divided into half according to the block randomization design and were then assigned to receive AHA peeling alone or AHA peeling combined with pneumatic pressure on each side of the face. Transepidermal water loss (TEWL), skin colour and skin blood flow were evaluated at baseline and at 30 min, 2, 5 and 7 days after treatment. The TEWL and skin blood flow were significantly increased after 30 min in chemodermabrasion compared with chemical peeling alone (P peeling alone (P < 0.05). Chemodermabrasion can temporarily impair skin barriers, but it is estimated that it can enhance the skin barrier function after 7 days compared to the use of a chemical agent alone. In addition, chemodermabrasion has a more effective impact in the dermis and relatively preserves the skin barrier. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier.

Directory of Open Access Journals (Sweden)

Jes Dreier

Full Text Available In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers.

Structural modification of the skin barrier by OH radicals: a reactive molecular dynamics study for plasma medicine

International Nuclear Information System (INIS)

Van der Paal, J; Verlackt, C C; Yusupov, M; Neyts, E C; Bogaerts, A

2015-01-01

While plasma treatment of skin diseases and wound healing has been proven highly effective, the underlying mechanisms, and more generally the effect of plasma radicals on skin tissue, are not yet completely understood. In this paper, we perform ReaxFF-based reactive molecular dynamics simulations to investigate the interaction of plasma generated OH radicals with a model system composed of free fatty acids, ceramides, and cholesterol molecules. This model system is an approximation of the upper layer of the skin (stratum corneum). All interaction mechanisms observed in our simulations are initiated by H-abstraction from one of the ceramides. This reaction, in turn, often starts a cascade of other reactions, which eventually lead to the formation of aldehydes, the dissociation of ceramides or the elimination of formaldehyde, and thus eventually to the degradation of the skin barrier function. (paper)

Helminth Infection and Commensal Microbiota Drive Early IL-10 Production in the Skin by CD4+ T Cells That Are Functionally Suppressive.

Directory of Open Access Journals (Sweden)

David E Sanin

2015-05-01

Full Text Available The skin provides an important first line of defence and immunological barrier to invasive pathogens, but immune responses must also be regulated to maintain barrier function and ensure tolerance of skin surface commensal organisms. In schistosomiasis-endemic regions, populations can experience repeated percutaneous exposure to schistosome larvae, however little is known about how repeated exposure to pathogens affects immune regulation in the skin. Here, using a murine model of repeated infection with Schistosoma mansoni larvae, we show that the skin infection site becomes rich in regulatory IL-10, whilst in its absence, inflammation, neutrophil recruitment, and local lymphocyte proliferation is increased. Whilst CD4+ T cells are the primary cellular source of regulatory IL-10, they expressed none of the markers conventionally associated with T regulatory (Treg cells (i.e. FoxP3, Helios, Nrp1, CD223, or CD49b. Nevertheless, these IL-10+ CD4+ T cells in the skin from repeatedly infected mice are functionally suppressive as they reduced proliferation of responsive CD4+ T cells from the skin draining lymph node. Moreover, the skin of infected Rag-/- mice had impaired IL-10 production and increased neutrophil recruitment. Finally, we show that the mechanism behind IL-10 production by CD4+ T cells in the skin is due to a combination of an initial (day 1 response specific to skin commensal bacteria, and then over the following days schistosome-specific CD4+ T cell responses, which together contribute towards limiting inflammation and tissue damage following schistosome infection. We propose CD4+ T cells in the skin that do not express markers of conventional T regulatory cell populations have a significant role in immune regulation after repeated pathogen exposure and speculate that these cells may also help to maintain skin barrier function in the context of repeated percutaneous insult by other skin pathogens.

The 24-hour skin hydration and barrier function effects of a hyaluronic 1%, glycerin 5%, and Centella asiatica stem cells extract moisturizing fluid: an intra-subject, randomized, assessor-blinded study.

Science.gov (United States)

Milani, Massimo; Sparavigna, Adele

2017-01-01

Moisturizing products are commonly used to improve hydration in skin dryness conditions. However, some topical hydrating products could have negative effects on skin barrier function. In addition, hydrating effects of moisturizers are not commonly evaluated up to 24 hours after a single application. Hyaluronic acid (HA) and glycerin are very well-known substances able to improve skin hydration. Centella asiatica extract (CAE) could exert lenitive, anti-inflammatory and reepithelialization actions. Furthermore, CAE could inhibit hyaluronidase enzyme activity, therefore prolonging the effect of HA. A fluid containing HA 1%, glycerin 5% and stem cells CAE has been recently developed (Jaluronius CS [JCS] fluid). To evaluate and compare the 24-hour effects of JCS fluid on skin hydration and on transepidermal water loss (TEWL) in healthy subjects in comparison with the control site. Twenty healthy women, mean age 40 years, were enrolled in an intra-subject (right vs left), randomized, assessor-blinded, controlled, 1-day trial. The primary end points were the skin hydration and TEWL, evaluated at the volar surface of the forearm and in standardized conditions (temperature- and humidity-controlled room: 23°C and 30% of humidity) using a corneometer and a vapometer device at baseline, 1, 8 and 24 hours after JCS fluid application. Measurements were performed by an operator blinded for the treatments. Skin hydration after 24 hours was significantly higher ( P =0.001; Mann-Whitney U test) in the JCS-treated area in comparison with the control site. JCS induced a significant ( P =0.0001) increase in skin hydration at each evaluation time (+59% after 1 hour, +48% after 8 hours and +29% after 24 hours) in comparison with both baseline ( P =0.0001) and non-treated control site ( P =0.001). TEWL after 24 hours was significantly lower ( P =0.049; Mann-Whitney U test) in the JCS-treated area in comparison with the control site (13±4 arbitrary units [AU] vs 16±6 AU). JCS fluid

Lipid functions in skin: Differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model.

Science.gov (United States)

Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna

2017-09-01

Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in

The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier.

Science.gov (United States)

Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

2017-01-01

The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier.

The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier*

Science.gov (United States)

Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

2017-01-01

The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier. PMID:29166523

Increased skin barrier disruption by sodium lauryl sulfate in mice expressing a constitutively active STAT6 in T cells.

Science.gov (United States)

DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B

2012-01-01

Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.

Comparison of structure and organization of cutaneous lipids in a reconstructed skin model and human skin: spectroscopic imaging and chromatographic profiling.

Science.gov (United States)

Tfayli, Ali; Bonnier, Franck; Farhane, Zeineb; Libong, Danielle; Byrne, Hugh J; Baillet-Guffroy, Arlette

2014-06-01

The use of animals for scientific research is increasingly restricted by legislation, increasing the demand for human skin models. These constructs present comparable bulk lipid content to human skin. However, their permeability is significantly higher, limiting their applicability as models of barrier function, although the molecular origins of this reduced barrier function remain unclear. This study analyses the stratum corneum (SC) of one such commercially available reconstructed skin model (RSM) compared with human SC by spectroscopic imaging and chromatographic profiling. Total lipid composition was compared by chromatographic analysis (HPLC). Raman spectroscopy was used to evaluate the conformational order, lateral packing and distribution of lipids in the surface and skin/RSM sections. Although HPLC indicates that all SC lipid classes are present, significant differences are observed in ceramide profiles. Raman imaging demonstrated that the RSM lipids are distributed in a non-continuous matrix, providing a better understanding of the limited barrier function. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The Tritiated Water Skin Barrier Integrity Test: Considerations for Acceptance Criteria with and Without 14C-Octanol.

Science.gov (United States)

Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J

2017-01-01

A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.

The role of social closeness during tape stripping to facilitate skin barrier recovery: Preliminary findings.

Science.gov (United States)

Robinson, Hayley; Ravikulan, Abhimati; Nater, Urs M; Skoluda, Nadine; Jarrett, Paul; Broadbent, Elizabeth

2017-07-01

Social support is known to reduce the negative effects of stress on health, but there is mixed evidence for the effects of social support on wound healing. This study aimed to investigate whether undergoing a task designed to promote social closeness with a fellow participant and being paired with that person during a tape-stripping procedure could reduce stress and improve skin barrier recovery compared to going through tape stripping alone. Seventy-two healthy adults were randomized to either a social closeness condition where participants completed a relationship-building task and tape stripping in pairs or a control condition where they completed tape stripping alone. Skin barrier recovery was measured using transepidermal water loss. Salivary cortisol and alpha-amylase were collected at four time points as markers of the endocrine and autonomic stress response. Social closeness had a beneficial effect on skin barrier recovery compared to the control condition, t(54) = 2.86, p = .006, r = .36. Social closeness significantly reduced self-reported stress. The effects of the intervention on skin barrier recovery were moderated by self-reported stress reduction (p = .035). There were no significant differences in cortisol between groups, but alpha-amylase increased significantly more from baseline to after tape stripping in the control group compared to the intervention group. This is the first study to show that social closeness with a person going through a similar unfamiliar procedure can positively influence wound healing. Future research needs to replicate these findings in other wound types and in clinical settings. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.

Science.gov (United States)

Mitragotri, Samir

2013-01-01

Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.

The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.

Science.gov (United States)

Del Rosso, James Q; Kircik, Leon H

2013-07-01

Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

2018-04-26

Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

Gentle cleansing and moisturizing for patients with atopic dermatitis and sensitive skin.

Science.gov (United States)

Cheong, Wai Kwong

2009-01-01

Atopic dermatitis is a common condition characterized by pruritus, inflammation, and dryness of the skin. Inflammation disrupts the barrier function of the stratum corneum, predisposing the skin to be dry, and increases susceptibility to irritants and secondary bacterial infection. Sensitive skin is common, reported by 40-50% of women and 30% of men in the US, Europe, and Japan. Basic requirements in managing eczema and sensitive skin include effective cleansers that do not compromise skin barrier integrity, alleviation of skin dryness, and restoration of skin barrier function through the use of therapeutic moisturizers. The selection of a skin cleanser is therefore an important part of managing these conditions. Studies have reported clinical improvement with the use of soap-free cleansers in combination with topical treatments. While topical corticosteroids and immunosuppressive agents are mainstays of treatment for atopic dermatitis, therapeutic moisturizers are important adjuncts. Moisturizers improve skin hydration, reduce susceptibility to irritation, restore the integrity of the stratum corneum, and enhance the efficacy of topical corticosteroids.

Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

Directory of Open Access Journals (Sweden)

Johan Agren

2010-01-01

Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

Acyl-CoA binding protein and epidermal barrier function

DEFF Research Database (Denmark)

Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

2014-01-01

The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

NANODERM. Quality of skin as a barrier to ultra-fine particles

International Nuclear Information System (INIS)

Kiss, A.Z.; Kertesz, Zs.; Szikszai, Z.; Biro, T.; Czifra, G.; Toth, B.I.; Juhasz, I.; Kiss, B.; Hunyadi, J.

2007-01-01

ultra-fine particles on healthy skin. On the other hand, micronised titanium-dioxide particles are internalized by melanocytes and fibroblasts in cell culture. Particles disturb cell viability and proliferation as well as keratinocyte differentiation. Outlook Although this EU project has ended, there are still several questions to be answered. In view of the cellular effects, we are currently investigating the penetration of nanosized particles into skin with impaired barrier function. Long term exposure studies are also required

Barreira cutânea na dermatite atópica Skin barrier in atopic dermatitis

Directory of Open Access Journals (Sweden)

Flavia Alvim Sant'Anna Addor

2010-04-01

Full Text Available O estudo da barreira cutânea e de suas propriedades ganhou impulso a partir da década de 60, com estudos que apontaram sua resistência de forma isolada e suas propriedades com relação à permeação cutânea. Paralelamente, a descrição dos corpos de Odland auxiliou a compreensão da manutenção da estabilidade da camada córnea. O modelo brick & mortar, em que os corneócitos são os tijolos e o cimento são os lipídeos intercelulares, é o mais aceito, até o momento. Atualmente, há evidências consistentes de que o estrato córneo é uma estrutura metabolicamente ativa e exerce funções adaptativas. A barreira cutânea também tem um papel na resposta inflamatória, com ativação de melanócitos, angiogênese e fibroplasia, cuja intensidade depende, basicamente, da intensidade da agressão. As anormalidades da barreira cutânea da dermatite atópica são clinicamente observáveis pela presença de pele seca, achado muito frequente e significativo, que constitui parâmetro iagnóstico e de acompanhamento. O grau de hidratação da camada córnea, assim como a perda de água transepidérmica (transepidermal water loss - TEWL, estão relacionados com o grau de dano à barreira, constituindo parâmetros biofísicos que permitem acompanhar os pacientes de maneira não invasiva e com maior grau de sensibilidade.Research about the skin barrier and its properties has increased significantly since the 60s, with studies that indicated its resistance when isolated, as well as its particularities in relation to skin permeability. At the same time, description of Odland bodies helped to understand how stratum corneum stability is maintained. The “brick and mortarâ€� model is the most accepted so far. In this analogy, the corneocytes are the bricks and the intercellular lipids are the mortar. Currently, there is concrete evidence that the stratum corneum is an active metabolic structure that holds adaptive functions, interacting

A plant oil-containing pH 4 emulsion improves epidermal barrier structure and enhances ceramide levels in aged skin.

Science.gov (United States)

Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P

2017-06-01

Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Permeability Barrier and Microstructure of Skin Lipid Membrane Models of Impaired Glucosylceramide Processing

OpenAIRE

Sochorov?, Michaela; Sta?kov?, Kl?ra; Pullmannov?, Petra; Kov??ik, Andrej; Zbytovsk?, Jarmila; V?vrov?, Kate?ina

2017-01-01

Ceramide (Cer) release from glucosylceramides (GlcCer) is critical for the formation of the skin permeability barrier. Changes in ?-glucocerebrosidase (GlcCer?ase) activity lead to diminished Cer, GlcCer accumulation and structural defects in SC lipid lamellae; however, the molecular basis for this impairment is not clear. We investigated impaired GlcCer-to-Cer processing in human Cer membranes to determine the physicochemical properties responsible for the barrier defects. Minor impairment (...

Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

Science.gov (United States)

Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

2005-08-01

The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

Nanocrystal: a novel approach to overcome skin barriers for improved topical drug delivery.

Science.gov (United States)

Patel, Viral; Sharma, Om Prakash; Mehta, Tejal

2018-04-01

Skin is an important route of drug delivery for the treatment of various dermatological conditions. The advent of nanotechnology is paving the roadmaps for topical drug delivery by providing sustained release as well as maintaining a localized effect, outweighing the toxicity concern. Area covered: This review highlighted the morphology of skin, its barrier nature as well as drug penetration pathways after topical application of formulations. The existing methods to improve topical drug delivery, by infringing or permeating the skin barriers, are discussed. This context concretes the foundation to accentuate the need for the development of nanocrystal-based topical formulation. The mechanism of drug release, immediate as well as sustained release, after topical administration of drug nanocrystals is also elaborated. The special emphasis is given on the breakthrough achieved, in topical drug delivery using drug nanocrystals, so far in the plethora of literature, patents, and products, under clinical trial as well as in the market. Expert opinion: The current research on nanocrystals for topical drug delivery is highlighting the breakthroughs achieved so far. The output of these research envisages that topical nanocrystals based formulations can be a novel strategy for the drugs which are facing solubility, bioavailability and toxicity concerns.

Efficacy of a Hand Regimen in Skin Barrier Protection in Individuals With Occupational Irritant Contact Dermatitis.

Science.gov (United States)

Jordan, Laura

2016-11-01

Occupational irritant contact dermatitis (OICD) is a dif cult and hard to manage condition. It occurs more frequently in certain occupations where contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing heightens the risk. Treatment for OICD includes patient education in addition to physical, topical, and systemic therapies. To review the pathogenesis and treatment options for OICD and evaluate the ef cacy of a selective skin-care regimen involv- ing a hand protectant cream alone as well as combined with a repair cream and speci c cleanser. A single-center open study was performed comprising 42 healthy male and female adult volunteers prone to occupational irritant contact dermatitis due to frequent wet work or contact with detergents. Between day 0 and day 7, subjects applied a hand protectant cream as needed on both hands (at least twice daily). On days 7 to 14, subjects applied a hand protectant cream and cleanser as needed on both hands (at least twice daily) as well as a repair cream each evening. A diary log was given to each volunteer for application control and for a subjective evaluation of daily tolerability. In these subjects prone to occupational irritant contact dermatitis, the hand protectant cream applied during the initial 7-day period was effective in restoring the damaged skin barrier and improving the stratum corneum hydration. A regimen that combined the hand protectant and repair creams with a speci c cleanser during a further 7-day period allowed contin- ued improvement of skin hydration and additional clinical bene ts while respecting the skin barrier function. The results of this study support the use of a 3-step approach for patients who are at risk of repeated exposure to external irritants. J Drugs Dermatol. 2016;15(suppl 11):s81-85..

Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

Science.gov (United States)

Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

2012-01-01

Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

Oily skin: an overview.

Science.gov (United States)

Sakuma, Thais H; Maibach, Howard I

2012-01-01

Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

Human skin is protected by four functionally and phenotypically discrete populations of resident and recirculating memory T cells

NARCIS (Netherlands)

Watanabe, Rei; Gehad, Ahmed; Yang, Chao; Scott, Laura L.; Teague, Jessica E.; Schlapbach, Christoph; Elco, Christopher P.; Huang, Victor; Matos, Tiago R.; Kupper, Thomas S.; Clark, Rachael A.

2015-01-01

The skin of an adult human contains about 20 billion memory T cells. Epithelial barrier tissues are infiltrated by a combination of resident and recirculating T cells in mice, but the relative proportions and functional activities of resident versus recirculating T cells have not been evaluated in

Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

Directory of Open Access Journals (Sweden)

Tzu-Kai Lin

2015-06-01

Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

Development of a vernix caseosa substitute : a novel strategy to improve skin barrier function and repair

NARCIS (Netherlands)

Rißmann, Robert

2009-01-01

Vernix caseosa (VC) is the cheesy, white cream that covers the skin of the human fetus and the newborn. VC is a protective cream, which consists of water containing dead cells that are embedded in lipids. This natural cream is suggested to feature multiple biological functions such as facilitating

Hataedock treatment has preventive therapeutic effects for atopic dermatitis through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice.

Science.gov (United States)

Cha, Ho-Yeol; Ahn, Sang-Hyun; Cheon, Jin-Hong; Park, Sun-Young; Kim, Kibong

2017-07-12

Hataedock treatment is traditionally used for the purpose of preventing the future skin disease by feeding herbal extracts to the newborn in traditional Chinese and Korean medicine. This study investigated the preventive therapeutic effects of Hataedock (HTD) treatment for atopic dermatitis (AD) through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice. To the HTD treatment group, the extract of Coptis japonica Makino and Glycyrrhiza uralensis Fischer, which analyzed with High Performance Liquid Chromatography (HPLC)-fingerprint for quality consistency, was administered orally to the 3-week-old mice before inducing AD. After that, Dermatophagoides farinae was applied except the control group to induce AD-like skin lesions. We confirmed the effects of HTD on morphological changes, protection of skin barrier, regulation of Th2 differentiation, inflammation regulation and induction of apoptosis through histochemistry, immunohistochemistry, and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. HTD effectively reduced edema, angiogenesis and skin lesion. HTD also increased the levels of liver X receptor (LXR) and filaggrin but decreased the level of protein kinase C (PKC) (pprotection of skin barrier. Therefore, HTD may have potential applications for alternative and preventive treatment in the management of AD. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

The Roles of Vitamin C in Skin Health.

Science.gov (United States)

Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M

2017-08-12

The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.

Effect of olive and sunflower seed oil on the adult skin barrier: implications for neonatal skin care.

Science.gov (United States)

Danby, Simon G; AlEnezi, Tareq; Sultan, Amani; Lavender, Tina; Chittock, John; Brown, Kirsty; Cork, Michael J

2013-01-01

Natural oils are advocated and used throughout the world as part of neonatal skin care, but there is an absence of evidence to support this practice. The goal of the current study was to ascertain the effect of olive oil and sunflower seed oil on the biophysical properties of the skin. Nineteen adult volunteers with and without a history of atopic dermatitis were recruited into two randomized forearm-controlled mechanistic studies. The first cohort applied six drops of olive oil to one forearm twice daily for 5 weeks. The second cohort applied six drops of olive oil to one forearm and six drops of sunflower seed oil to the other twice daily for 4 weeks. The effect of the treatments was evaluated by determining stratum corneum integrity and cohesion, intercorneocyte cohesion, moisturization, skin-surface pH, and erythema. Topical application of olive oil for 4 weeks caused a significant reduction in stratum corneum integrity and induced mild erythema in volunteers with and without a history of atopic dermatitis. Sunflower seed oil preserved stratum corneum integrity, did not cause erythema, and improved hydration in the same volunteers. In contrast to sunflower seed oil, topical treatment with olive oil significantly damages the skin barrier, and therefore has the potential to promote the development of, and exacerbate existing, atopic dermatitis. The use of olive oil for the treatment of dry skin and infant massage should therefore be discouraged. These findings challenge the unfounded belief that all natural oils are beneficial for the skin and highlight the need for further research. © 2012 Wiley Periodicals, Inc.

Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils.

Science.gov (United States)

Lin, Tzu-Kai; Zhong, Lily; Santiago, Juan Luis

2017-12-27

Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter). Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

The effect of low dose ionizing radiation on homeostasis and functional integrity in an organotypic human skin model

Energy Technology Data Exchange (ETDEWEB)

Neubeck, Claere von [German Cancer Consortium DKTK partner site Dresden, OncoRay - National Center for Radiation Research in Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Technische Universität Dresden, Fetscherstrasse 74, 01307 Dresden (Germany); German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Geniza, Matthew J. [Molecular and Cellular Biology Program, Oregon State University, Corvallis OR 97331 (United States); Kauer, Paula M.; Robinson, R. Joe; Chrisler, William B. [Health Impacts and Exposure Science, Pacific Northwest National Laboratory, Richland WA 99352 (United States); Sowa, Marianne B., E-mail: marianne.sowa@pnnl.gov [Health Impacts and Exposure Science, Pacific Northwest National Laboratory, Richland WA 99352 (United States)

2015-05-15

Highlights: • Low doses of high LET radiation influence skin homeostasis. • Effects on proliferation and differentiation profiles are LET dependent. • Skin barrier function is not compromised following low dose exposure. - Abstract: Outside the protection of Earth's atmosphere, astronauts are exposed to low doses of high linear energy transfer (LET) radiation. Future NASA plans for deep space missions or a permanent settlement on the moon are limited by the health risks associated with space radiation exposures. There is a paucity of direct epidemiological data for low dose exposures to space radiation-relevant high LET ions. Health risk models are used to estimate the risk for such exposures, though these models are based on high dose experiments. There is increasing evidence, however, that low and high dose exposures result in different signaling events at the molecular level, and may involve different response mechanisms. Further, despite their low abundance, high LET particles have been identified as the major contributor to health risk during manned space flight. The human skin is exposed in every external radiation scenario, making it an ideal epithelial tissue model in which to study radiation induced effects. Here, we exposed an in vitro three dimensional (3-D) human organotypic skin tissue model to low doses of high LET oxygen (O), silicon (Si) and iron (Fe) ions. We measured proliferation and differentiation profiles in the skin tissue and examined the integrity of the skin's barrier function. We discuss the role of secondary particles in changing the proportion of cells receiving a radiation dose, emphasizing the possible impact on radiation-induced health issues in astronauts.

Stratum corneum hydration and skin surface pH in patients with atopic dermatitis.

Science.gov (United States)

Knor, Tanja; Meholjić-Fetahović, Ajša; Mehmedagić, Aida

2011-01-01

Atopic dermatitis (AD) is a chronically relapsing skin disease with genetic predisposition, which occurs most frequently in preschool children. It is considered that dryness and pruritus, which are always present in AD, are in correlation with degradation of the skin barrier function. Measurement of hydration and pH value of the stratum corneum is one of the noninvasive methods for evaluation of skin barrier function. The aim of the study was to assess skin barrier function by measuring stratum corneum hydration and skin surface pH of the skin with lesions, perilesional skin and uninvolved skin in AD patients, and skin in a healthy control group. Forty-two patients were included in the study: 21 young and adult AD patients and 21 age-matched healthy controls. Capacitance, which is correlated with hydration of stratum corneum and skin surface pH were measured on the forearm in the above areas by SM810/CM820/pH900 combined units (Courage AND Khazaka, Germany). The mean value of water capacitance measured in AD patients was 44.1 ± 11.6 AU (arbitrary units) on the lesions, 60.2 ± 12.4 AU on perilesional skin and 67.2 ± 8.8 AU on uninvolved skin. In healthy controls, the mean value was 74.1 ± 9.2 AU. The mean pH value measured in AD patients was 6.13 ± 0.52 on the lesions, 5.80 ± 0.41 on perilesional skin, and 5.54 ± 0.49 on uninvolved skin. In control group, the mean pH of the skin surface was 5.24 ± 0.40. The values of both parameters measured on lesional skin were significantly different (capacitance decreased and pH increased) from the values recorded on perilesional skin and uninvolved skin. The same held for the relation between perilesional and uninvolved skin. According to study results, the uninvolved skin of AD patients had significantly worse values of the measured parameters as compared with control group. The results of this study suggested the skin barrier function to be degraded in AD patients, which is specifically expressed in lesional skin.

The cutaneous citadel: a holistic view of skin and immunity.

Science.gov (United States)

Spellberg, B

2000-06-23

Human skin has 4 major functions: endogenous homeostasis (e.g. regulation of body temperature and fluid balance), metabolism (e.g. Vitamin D synthesis), sensory input, and to serve as a barrier to external threats (e.g. infection, mechanical injury, ultraviolet light). It is the latter function which concerns this review, for the skin's remarkable success in protecting the human body from the outside world is a major component of our immune system. The eminent pathologist, Virchow, whose work in the mid 19th century revolutionized many aspects of medical understanding, viewed the skin as an effective but inanimate barrier (1). However, recent technologies have elucidated a highly complex, dynamic interplay between the skin and other members of the immune system.

Dermal toxicity elicited by phthalates: evaluation of skin absorption, immunohistology, and functional proteomics.

Science.gov (United States)

Pan, Tai-Long; Wang, Pei-Wen; Aljuffali, Ibrahim A; Hung, Yi-Yun; Lin, Chwan-Fwu; Fang, Jia-You

2014-03-01

The toxicity of phthalates is an important concern in the fields of environmental health and toxicology. Dermal exposure via skin care products, soil, and dust is a main route for phthalate delivery. We had explored the effect of topically-applied phthalates on skin absorption and toxicity. Immunohistology, functional proteomics, and Western blotting were employed as methodologies for validating phthalate toxicity. Among 5 phthalates tested, di(2-ethylhexyl)phthalate (DEHP) showed the highest skin reservoir. Only diethyl phthalate (DEP) and dibutyl phthalate (DBP) could penetrate across skin. Strat-M(®) membrane could be used as permeation barrier for predicting phthalate penetration through skin. The accumulation of DEHP in hair follicles was ∼15nmol/cm(2), which was significantly greater than DBP and DEP. DBP induced apoptosis of keratinocytes and fibroblasts via caspase-3 activation. This result was confirmed by downregulation of 14-3-3 and immunohistology of TUNEL. On the other hand, the HSP60 overexpression and immunostaining of COX-2 suggested inflammatory response induced by DEP and DEHP. The proteomic profiling verified the role of calcium homeostasis on skin inflammation. Some proteins investigated in this study can be sensitive biomarkers for dermal toxicity of phthalates. These included HSPs, 14-3-3, and cytokeratin. This work provided novel platforms for examining phthalate toxicity on skin. Copyright © 2013 Elsevier Ltd. All rights reserved.

Enhancement of percutaneous penetration of aniline and o-toluidine in vitro using skin barrier creams.

Science.gov (United States)

Korinth, Gintautas; Lüersen, Lars; Schaller, Karl Heinz; Angerer, Jürgen; Drexler, Hans

2008-04-01

Aniline (ANI) and the human carcinogen o-toluidine (OT) are released at the workplace during the production and processing of rubber. Recently, we showed in rubber industry workers that a frequent use of skin barrier creams (SBC) increased the internal exposure of ANI and OT. In the present study, diffusion cells were used to investigate the effects of two SBC and one skin care cream (SCC) on percutaneous penetration of neat ANI and OT as well as of OT from a mixture with a workplace specific lubricant. The experiments were carried out with untreated and with skin creams treated human skin. A considerable percutaneous penetration enhancement of test compounds was observed for treated skin compared with untreated skin; the highest enhancement (mean factors 6.2-12.3) was found for SBC (based on oil in water emulsion) treated skin. The lowest penetration enhancement showed SCC treated skin (mean factors 4.2-9.7). The in vitro data support our findings in workers that the percutaneous absorption of aromatic amines significantly increases in presence of skin creams. The efficacy of skin creams to protect the percutaneous penetration of aromatic amines is not confirmed by our own experiments.

[Basic therapeutics : What are the features of modern personal care products to protect and regenerate the skin barrier?

Science.gov (United States)

Daniels, R

2017-11-01

It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.

The skin barrier function gene SPINK5 is associated with challenge-proven IgE-mediated food allergy in infants.

Science.gov (United States)

Ashley, S E; Tan, H-T T; Vuillermin, P; Dharmage, S C; Tang, M L K; Koplin, J; Gurrin, L C; Lowe, A; Lodge, C; Ponsonby, A-L; Molloy, J; Martin, P; Matheson, M C; Saffery, R; Allen, K J; Ellis, J A; Martino, D

2017-09-01

A defective skin barrier is hypothesized to be an important route of sensitization to dietary antigens and may lead to food allergy in some children. Missense mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) skin barrier gene have previously been associated with allergic conditions. To determine whether genetic variants in and around SPINK5 are associated with IgE-mediated food allergy. We genotyped 71 "tag" single nucleotide polymorphisms (tag-SNPs) within a region spanning ~263 kb including SPINK5 (~61 kb) in n=722 (n=367 food-allergic, n=199 food-sensitized-tolerant and n=156 non-food-allergic controls) 12-month-old infants (discovery sample) phenotyped for food allergy with the gold standard oral food challenge. Transepidermal water loss (TEWL) measures were collected at 12 months from a subset (n=150) of these individuals. SNPs were tested for association with food allergy using the Cochran-Mantel-Haenszel test adjusting for ancestry strata. Association analyses were replicated in an independent sample group derived from four paediatric cohorts, total n=533 (n=203 food-allergic, n=330 non-food-allergic), mean age 2.5 years, with food allergy defined by either clinical history of reactivity, 95% positive predictive value (PPV) or challenge, corrected for ancestry by principal components. SPINK5 variant rs9325071 (A⟶G) was associated with challenge-proven food allergy in the discovery sample (P=.001, OR=2.95, CI=1.49-5.83). This association was further supported by replication (P=.007, OR=1.58, CI=1.13-2.20) and by meta-analysis (P=.0004, OR=1.65). Variant rs9325071 is associated with decreased SPINK5 gene expression in the skin in publicly available genotype-tissue expression data, and we generated preliminary evidence for association of this SNP with elevated TEWL also. We report, for the first time, association between SPINK5 variant rs9325071 and challenge-proven IgE-mediated food allergy. © 2017 EAACI and John Wiley and Sons A

Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils

Directory of Open Access Journals (Sweden)

Tzu-Kai Lin

2017-12-01

Full Text Available Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter. Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

Oral administration of Bifidobacterium breve attenuates UV-induced barrier perturbation and oxidative stress in hairless mice skin.

Science.gov (United States)

Ishii, Yuki; Sugimoto, Saho; Izawa, Naoki; Sone, Toshiro; Chiba, Katsuyoshi; Miyazaki, Kouji

2014-07-01

Recent studies have shown that some probiotics affect not only the gut but also the skin. However, the effects of probiotics on ultraviolet (UV)-induced skin damage are poorly understood. In this study, we aim to examine whether oral administration of live Bifidobacterium breve strain Yakult (BBY), a typical probiotic, can attenuate skin barrier perturbation caused by UV and reactive oxygen species (ROS) in hairless mice. The mice were orally supplemented with a vehicle only or BBY once a day for nine successive days. Mouse dorsal skin was irradiated with UV from days 6 to 9. The day after the final irradiation, the transepidermal water loss (TEWL), stratum corneum hydration, and oxidation-related factors of the skin were evaluated. We elucidated that BBY prevented the UV-induced increase in TEWL and decrease in stratum corneum hydration. In addition, BBY significantly suppressed the UV-induced increase in hydrogen peroxide levels, oxidation of proteins and lipids, and xanthine oxidase activity in the skin. Conversely, antioxidant capacity did not change regardless of whether BBY was administered or not. In parameters we evaluated, there was a positive correlation between the increase in TEWL and the oxidation levels of proteins and lipids. Our results suggest that oral administration of BBY attenuates UV-induced barrier perturbation and oxidative stress of the skin, and this antioxidative effect is not attributed to enhancement of antioxidant capacity but to the prevention of ROS generation.

[Skin hydration and hydrating products].

Science.gov (United States)

Duplan, H; Nocera, T

2018-05-01

One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

Effects of UVA (320-400 nm) on the barrier characteristics of the skin

International Nuclear Information System (INIS)

McAuliffe, D.J.; Blank, I.H.

1991-01-01

The stratum corneum serves as the major barrier to the entrance of most molecules into the skin. In the studies presented here, the effects of UVA radiation (320-400 nm) on the barrier capacity of human stratum corneum were examined. Penetration of a homologous series of primary alcohols through unirradiated (control) and UVA-irradiated (test) human epidermis was determined in vitro. Permeability constants, kp, were calculated. Mean ratios of permeability constants for UVA-irradiated and unirradiated epidermis (mean kp test)/(mean kp control) ranged from 2.3 to 3.0 for methanol and from 2.2 to 2.5 for ethanol. These mean ratios were determined using different pieces of epidermis from the same piece of skin for test and control samples. When kp control and kp test were determined on the same piece of epidermis on successive days, the ratios (kp test/kp control) were similar to the mean ratios determined on different pieces of epidermis. For other primary alcohols, propanol, butanol, hexanol, and heptanol, UVA radiation did not alter their permeability constants significantly. Partition coefficients, Km, were determined for ethanol and heptanol using UVA-irradiated and unirradiated stratum corneum. For ethanol, irradiation resulted in a 1.5 to 2.6 times increase in Km. For heptanol, irradiation caused no change in Km. These results demonstrate that the barrier capacity of stratum corneum for small, polar, primary alcohols is diminished (permeability increases) and for higher molecular weight less polar alcohols, is unaffected by small doses of UVA radiation. This increased permeability of small polar alcohols through human skin may be due to enhanced partitioning into UVA-irradiated stratum corneum, which was not apparent for a higher molecular weight less polar alcohol

Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.

Science.gov (United States)

Segger, Dörte; Matthies, Andreas; Saldeen, Tom

2008-01-01

To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.

Homozygous ALOXE3 Nonsense Variant Identified in a Patient with Non-Bullous Congenital Ichthyosiform Erythroderma Complicated by Superimposed Bullous Majocchi’s Granuloma: The Consequences of Skin Barrier Dysfunction

Directory of Open Access Journals (Sweden)

Tao Wang

2015-09-01

Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.

Quantification of changes in skin hydration and sebum after tape stripping using infrared spectroscopy

Science.gov (United States)

Ezerskaia, A.; Pereira, S. F.; Urbach, H. P.; Varghese, B.

2017-02-01

Skin barrier function relies on well balanced water and lipid system of stratum corneum. Optimal hydration and oiliness levels are indicators of skin health and integrity. We demonstrate an accurate and sensitive depth profiling of stratum corneum sebum and hydration levels using short wave infrared spectroscopy in the spectral range around 1720 nm. We demonstrate that short wave infrared spectroscopic technique combined with tape stripping can provide morequantitative and more reliable skin barrier function information in the low hydration regime, compared to conventional biophysical methods.

Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

Science.gov (United States)

Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

2016-01-01

Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

The menstrual cycle and the skin.

Science.gov (United States)

Raghunath, R S; Venables, Z C; Millington, G W M

2015-03-01

Perimenstrual exacerbations of dermatoses are commonly recognized, yet our knowledge of the underlying pathophysiological mechanisms remains imperfect. Research into the effects of oestrogen on the skin has provided evidence to suggest that oestrogen is associated with increases in skin thickness and dermal water content, improved barrier function, and enhanced wound healing. Research into the effects of progesterone suggests that the presence of various dermatoses correlates with peak levels of progesterone. Dermatoses that are exacerbated perimenstrually include acne, psoriasis, atopic eczema and irritant dermatitis, and possibly also erythema multiforme. Exacerbations occur at the peak levels of progesterone in the menstrual cycle. Underlying mechanisms include reduced immune and barrier functions as a result of cyclical fluctuations in oestrogen and/or progesterone. Autoimmune progesterone and oestrogen dermatitis are the best-characterized examples of perimenstrual cutaneous reactions to hormones produced during the menstrual cycle. In this review, we describe the current understanding of the menstrual cycle, and its effect on the skin and cutaneous disorders. © 2015 British Association of Dermatologists.

Skin moisturization mechanisms: new data.

Science.gov (United States)

Bonté, F

2011-05-01

The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Human skin is protected by four functionally and phenotypically discrete populations of resident and recirculating memory T cells

Science.gov (United States)

Watanabe, Rei; Gehad, Ahmed; Yang, Chao; Campbell, Laura; Teague, Jessica E.; Schlapbach, Christoph; Elco, Christopher; Huang, Victor; Matos, Tiago R.; Kupper, Thomas S.; Clark, Rachael A.

2015-01-01

The skin of an adult human contains approximately 20 billion memory T cells. Epithelial barrier tissues are infiltrated by a combination of resident and recirculating T cells in mice but the relative proportions and functional activities of resident versus recirculating T cells have not been evaluated in human skin. We discriminated resident from recirculating T cells in human engrafted mice and lymphoma patients using alemtuzumab, a medication that depletes recirculating T cells from skin, and then analyzed these T cell populations in healthy human skin. All non-recirculating resident memory T cells (TRM) expressed CD69, but the majority were CD4+, CD103− and located in the dermis, in contrast to studies in mice. Both CD4+ and CD8+ CD103+ TRM were enriched in the epidermis, had potent effector functions and had a limited proliferative capacity compared to CD103− TRM. TRM of both types had more potent effector functions than recirculating T cells. Induction of CD103 on human T cells was enhanced by keratinocyte contact, depended on TGFβ and was independent of T cell keratinocyte adhesive interactions. We observed two distinct populations of recirculating T cells, CCR7+/L-selectin+ central memory T cells (TCM) and CCR7+/L-selectin− T cells, which we term migratory memory T cells (TMM). Circulating skin-tropic TMM were intermediate in cytokine production between TCM and effector memory T cells. In patients with cutaneous T cell lymphoma, malignant TCM and TMM induced distinct inflammatory skin lesions and TMM were depleted more slowly from skin after alemtuzumab, suggesting TMM may recirculate more slowly. In summary, human skin is protected by four functionally distinct populations of T cells, two resident and two recirculating, with differing territories of migration and distinct functional activities. PMID:25787765

Electrical measurement of the hydration state of the skin surface in vivo.

Science.gov (United States)

Tagami, H

2014-09-01

Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.

The multitasking organ: recent insights into skin immune function.

Science.gov (United States)

Di Meglio, Paola; Perera, Gayathri K; Nestle, Frank O

2011-12-23

The skin provides the first line defense of the human body against injury and infection. By integrating recent findings in cutaneous immunology with fundamental concepts of skin biology, we portray the skin as a multitasking organ ensuring body homeostasis. Crosstalk between the skin and its microbial environment is also highlighted as influencing the response to injury, infection, and autoimmunity. The importance of the skin immune network is emphasized by the identification of several skin-resident cell subsets, each with its unique functions. Lessons learned from targeted therapy in inflammatory skin conditions, such as psoriasis, provide further insights into skin immune function. Finally, we look at the skin as an interacting network of immune signaling pathways exemplified by the development of a disease interactome for psoriasis. Copyright © 2011 Elsevier Inc. All rights reserved.

Electrochemical monitoring of native catalase activity in skin using skin covered oxygen electrode.

Science.gov (United States)

Nocchi, Sarah; Björklund, Sebastian; Svensson, Birgitta; Engblom, Johan; Ruzgas, Tautgirdas

2017-07-15

A skin covered oxygen electrode, SCOE, was constructed with the aim to study the enzyme catalase, which is part of the biological antioxidative system present in skin. The electrode was exposed to different concentrations of H 2 O 2 and the amperometric current response was recorded. The observed current is due to H 2 O 2 penetration through the outermost skin barrier (referred to as the stratum corneum, SC) and subsequent catalytic generation of O 2 by catalase present in the underlying viable epidermis and dermis. By tape-stripping the outermost skin layers we demonstrate that SC is a considerable diffusion barrier for H 2 O 2 penetration. Our experiments also indicate that skin contains a substantial amount of catalase, which is sufficient to detoxify H 2 O 2 that reaches the viable epidermis after exposure of skin to high concentrations of peroxide (0.5-1mM H 2 O 2 ). Further, we demonstrate that the catalase activity is reduced at acidic pH, as compared with the activity at pH 7.4. Finally, experiments with often used penetration enhancer thymol shows that this compound interferes with the catalase reaction. Health aspect of this is briefly discussed. Summarizing, the results of this work show that the SCOE can be utilized to study a broad spectrum of issues involving the function of skin catalase in particular, and the native biological antioxidative system in skin in general. Copyright © 2017 Elsevier B.V. All rights reserved.

Wound-Healing Studies in Cornea and Skin: Parallels, Differences and Opportunities.

Science.gov (United States)

Bukowiecki, Anne; Hos, Deniz; Cursiefen, Claus; Eming, Sabine A

2017-06-12

The cornea and the skin are both organs that provide the outer barrier of the body. Both tissues have developed intrinsic mechanisms that protect the organism from a wide range of external threats, but at the same time also enable rapid restoration of tissue integrity and organ-specific function. The easy accessibility makes the skin an attractive model system to study tissue damage and repair. Findings from skin research have contributed to unravelling novel fundamental principles in regenerative biology and the repair of other epithelial-mesenchymal tissues, such as the cornea. Following barrier disruption, the influx of inflammatory cells, myofibroblast differentiation, extracellular matrix synthesis and scar formation present parallel repair mechanisms in cornea and skin wound healing. Yet, capillary sprouting, while pivotal in proper skin wound healing, is a process that is rather associated with pathological repair of the cornea. Understanding the parallels and differences of the cellular and molecular networks that coordinate the wound healing response in skin and cornea are likely of mutual importance for both organs with regard to the development of regenerative therapies and understanding of the disease pathologies that affect epithelial-mesenchymal interactions. Here, we review the principal events in corneal wound healing and the mechanisms to restore corneal transparency and barrier function. We also refer to skin repair mechanisms and their potential implications for regenerative processes in the cornea.

Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

DEFF Research Database (Denmark)

Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

2006-01-01

most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

SKIN CARE IN INFANTS

Directory of Open Access Journals (Sweden)

I. N. Zakharova

2014-01-01

Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.

Personnel decontamination and preventive skin care

International Nuclear Information System (INIS)

Henning, Klaus; Gojowczyk, Peter

2010-01-01

Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

Science.gov (United States)

Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

2013-01-01

Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

Single blinded, randomized, placebo-controlled study on the effects of ciclosporin on cutaneous barrier function and immunological response in atopic beagles.

Science.gov (United States)

White, Amelia G; Santoro, Domenico; Ahrens, Kim; Marsella, Rosanna

2018-03-01

Ciclosporin (CsA) is a common treatment for canine atopic dermatitis (cAD). cAD is a very common skin disease with a multifactorial pathogenesis due to complex interactions between the host and the environment. The purpose of this study was to describe the physical and immunological effects of CsA in cAD using a canine model of AD. Fourteen beagles were enrolled; seven received CsA orally every 24 h for 28 days, and seven received placebo. All dogs were exposed to relevant allergens, house dust mite solution, one day prior to treatment and once weekly thereafter for 28 consecutive days. Canine atopic dermatitis extent and severity index-03 (CADESI-03) and skin biopsies were performed on day 0, 14, and 28. Quantitative RT-PCR was used to determine levels of cutaneous cytokines and barrier function markers. Indirect immunofluorescence was used to determine protein expression and distribution of nuclear messengers, barrier function and inflammatory [thymic stromal lymphopoietin (TSLP)] markers. The data were tested for normality and then the upaired two samples Student's t-test and the repeated measurements ANOVA, followed by the Dunnett's Multiple Comparison Test as post-hoc analysis, were performed. A P value of immunologic milieu or barrier markers despite evident improvement of physical signs in the treatment group. Although this study confirmed the usefulness of CsA for the treatment of cAD, a clear involvement of CsA on some of the currently known immunological alterations present in cAD was not determined. However, it is important to note that there was no measurable exacerbation of skin barrier dysfunction secondary to CsA administration in this model. Copyright © 2018 Elsevier B.V. All rights reserved.

Biology and Function of Fetal and Pediatric Skin

OpenAIRE

Leung, Alice; Balaji, Swathi; Keswani, Sundeep G

2013-01-01

The development of the integumentary system is a series of events, which start in utero and continue throughout life. Although at birth, skin in full-term infants is anatomically mature, functional maturity develops during the first year of life. Pediatric skin transitions again with the onset of puberty. At each stage, there are changes in transepidermal water loss, skin hydration, and skin acidity that define the specific period of development.

Age-related percutaneous penetration part 1: skin factors.

Science.gov (United States)

Konda, S; Meier-Davis, S R; Cayme, B; Shudo, J; Maibach, H I

2012-05-01

Changes in the skin that occur in the elderly may put them at increased risk for altered percutaneous penetration from pharmacotherapy along with potential adverse effects. Skin factors that may have a role in age-related percutaneous penetration include blood flow, pH, skin thickness, hair and pore density, and the content and structure of proteins, glycosaminoglycans (GAGs), water, and lipids. Each factor is examined as a function of increasing age along with its potential impact on percutaneous penetration. Additionally, topical drugs that successfully overcome the barrier function of the skin can still fall victim to cutaneous metabolism, thereby producing metabolites that may have increased or decreased activity. This overview discusses the current data and highlights the importance of further studies to evaluate the impact of skin factors in age-related percutaneous penetration.

Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

Science.gov (United States)

Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

2009-05-01

Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

Permeability of skin and oral mucosa to water and horseradish peroxidase as related to the thickness of the permeability barrier

International Nuclear Information System (INIS)

Squier, C.A.; Hall, B.K.

1985-01-01

The permeability of porcine skin and keratinized and nonkeratinized oral mucosa to tritium-labeled water and horseradish peroxidase (HRPO) was determined using perfusion chambers. Small blocks from each tissue were also incubated with HRPO and the extent of penetration visualized microscopically; this enabled measurements to be made of the thickness of the permeability barrier to this water-soluble tracer. Results obtained after inverting the oral mucosa in the chambers or adding metabolic inhibitors indicated that both compounds diffuse across the tissue. The permeability constants derived directly in the study showed that skin was less permeable than oral mucosa and that the floor of the mouth was significantly more permeable than all other regions. When these constants were normalized in terms of a standard permeability barrier thickness and the different tissues compared, the values obtained for skin were again less than those of the oral regions but, of these, the buccal mucosa was significantly higher. The difference in permeability between epidermis and keratinized oral epithelium may be due to differences in the volume density of membrane-coating granules known to exist between the tissues; differences between the oral mucosal regions may reflect differences in the nature of the intercellular barrier material

Ultraviolet A photosensitivity profile of dexchlorpheniramine maleate and promethazine-based creams: Anti-inflammatory, antihistaminic, and skin barrier protection properties.

Science.gov (United States)

Facchini, Gustavo; Eberlin, Samara; Clerici, Stefano Piatto; Alves Pinheiro, Ana Lucia Tabarini; Costa, Adilson

2017-12-01

Unwanted side effects such as dryness, hypersensitivity, and cutaneous photosensitivity are challenge for adherence and therapeutical success for patients using treatments for inflammatory and allergic skin response. In this study, we compared the effects of two dermatological formulations, which are used in inflammatory and/or allergic skin conditions: dexchlorpheniramine maleate (DCP; 10 mg/g) and promethazine (PTZ; 20 mg/g). We evaluated both formulations for phototoxicity potential, skin irritation, anti-inflammatory and antihistaminic abilities, and skin barrier repair in vitro and ex vivo using the standard OECD test guideline n° 432, the ECVAM protocol n° 78, and cultured skin explants from a healthy patient. Ultraviolet A was chosen as exogenous agent to induce allergic and inflammatory response. Both PTZ and DCP promoted increases in interleukin-1 (IL-1) synthesis in response to ultraviolet A (UVA) radiation compared to control. However, the increase observed with PTZ was significantly greater than the DCP, indicating that the latter has a lower irritant potential. DCP also demonstrated a protective effect on UVA-induced leukotriene B4 and nuclear factor kappa B (NF-κB) synthesis. Conversely, PTZ demonstrates more robust UVA antihistaminic activity. Likewise, PTZ promoted a significantly greater increase in the production of involucrin and keratin 14, both associated with protective skin barrier property. In conclusion, these data suggest possible diverging UVA response mechanisms of DCP and PTZ, which gives greater insight into the contrasting photosensitizing potential between DCP and PTZ observed in the patients. © 2017 Wiley Periodicals, Inc.

Rheological and Functional Properties of Catfish Skin Protein Hydrolysates

Science.gov (United States)

Catfish skin is an abundant and underutilized resource that can be used as a unique protein source to make fish skin hydrolysates. The objectives of this study were to: isolating soluble and insoluble proteins from hydrolyzed catfish skin and study the chemical and functional properties of the prote...

Melatonin, mitochondria, and the skin.

Science.gov (United States)

Slominski, Andrzej T; Zmijewski, Michal A; Semak, Igor; Kim, Tae-Kang; Janjetovic, Zorica; Slominski, Radomir M; Zmijewski, Jaroslaw W

2017-11-01

The skin being a protective barrier between external and internal (body) environments has the sensory and adaptive capacity to maintain local and global body homeostasis in response to noxious factors. An important part of the skin response to stress is its ability for melatonin synthesis and subsequent metabolism through the indolic and kynuric pathways. Indeed, melatonin and its metabolites have emerged as indispensable for physiological skin functions and for effective protection of a cutaneous homeostasis from hostile environmental factors. Moreover, they attenuate the pathological processes including carcinogenesis and other hyperproliferative/inflammatory conditions. Interestingly, mitochondria appear to be a central hub of melatonin metabolism in the skin cells. Furthermore, substantial evidence has accumulated on the protective role of the melatonin against ultraviolet radiation and the attendant mitochondrial dysfunction. Melatonin and its metabolites appear to have a modulatory impact on mitochondrion redox and bioenergetic homeostasis, as well as the anti-apoptotic effects. Of note, some metabolites exhibit even greater impact than melatonin alone. Herein, we emphasize that melatonin-mitochondria axis would control integumental functions designed to protect local and perhaps global homeostasis. Given the phylogenetic origin and primordial actions of melatonin, we propose that the melatonin-related mitochondrial functions represent an evolutionary conserved mechanism involved in cellular adaptive response to skin injury and repair.

Biomimetic shark skin: design, fabrication and hydrodynamic function.

Science.gov (United States)

Wen, Li; Weaver, James C; Lauder, George V

2014-05-15

Although the functional properties of shark skin have been of considerable interest to both biologists and engineers because of the complex hydrodynamic effects of surface roughness, no study to date has successfully fabricated a flexible biomimetic shark skin that allows detailed study of hydrodynamic function. We present the first study of the design, fabrication and hydrodynamic testing of a synthetic, flexible, shark skin membrane. A three-dimensional (3D) model of shark skin denticles was constructed using micro-CT imaging of the skin of the shortfin mako (Isurus oxyrinchus). Using 3D printing, thousands of rigid synthetic shark denticles were placed on flexible membranes in a controlled, linear-arrayed pattern. This flexible 3D printed shark skin model was then tested in water using a robotic flapping device that allowed us to either hold the models in a stationary position or move them dynamically at their self-propelled swimming speed. Compared with a smooth control model without denticles, the 3D printed shark skin showed increased swimming speed with reduced energy consumption under certain motion programs. For example, at a heave frequency of 1.5 Hz and an amplitude of ± 1 cm, swimming speed increased by 6.6% and the energy cost-of-transport was reduced by 5.9%. In addition, a leading-edge vortex with greater vorticity than the smooth control was generated by the 3D printed shark skin, which may explain the increased swimming speeds. The ability to fabricate synthetic biomimetic shark skin opens up a wide array of possible manipulations of surface roughness parameters, and the ability to examine the hydrodynamic consequences of diverse skin denticle shapes present in different shark species. © 2014. Published by The Company of Biologists Ltd.

Atopic dermatitis: immune deviation, barrier dysfunction, IgE autoreactivity and new therapies

Directory of Open Access Journals (Sweden)

Masutaka Furue

2017-07-01

Full Text Available Atopic dermatitis (AD is a chronic or chronically relapsing, eczematous, severely pruritic skin disorder mostly associated with IgE elevation and skin barrier dysfunction due to decreased filaggrin expression. The lesional skin of AD exhibits Th2- and Th22-deviated immune reactions that are progressive during disease chronicity. Th2 and Th22 cytokines further deteriorate the skin barrier by inhibiting filaggrin expression. Some IgEs are reactive to self-antigens. The IgE autoreactivity may precipitate the chronicity of AD. Upon activation of the ORAI1 calcium channel, atopic epidermis releases large amounts of thymic stromal lymphopoietin (TSLP, which initiates the Th2 and Th22 immune response. Th2-derived interleukin-31 and TSLP induce an itch sensation. Taken together, TSLP/Th2/Th22 pathway is a promising target for developing new therapeutics for AD. Enhancing filaggrin expression using ligands for the aryl hydrocarbon receptor may also be an adjunctive measure to restore the disrupted barrier function specifically for AD.

Effects of various vehicles on skin hydration in vivo.

Science.gov (United States)

Wiedersberg, S; Leopold, C S; Guy, R H

2009-01-01

The stratum corneum, the outermost layer of the skin, regulates the passive loss of water to the environment. Furthermore, it is well accepted that drug penetration is influenced by skin hydration, which may be manipulated by the application of moisturizing or oleaginous vehicles. Measurements of transepidermal water loss (TEWL), and of skin hydration using a corneometer, were used to assess the effect of different vehicles on stratum corneum barrier function in vivo in human volunteers. A microemulsion significantly increased skin hydration relative to a reference vehicle based on medium chain triglycerides; in contrast, Transcutol(R) lowered skin hydration. TEWL measurements confirmed these observations. Copyright 2009 S. Karger AG, Basel.

Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer

Directory of Open Access Journals (Sweden)

Antoine Berger

2018-01-01

Full Text Available Purpose: As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant for breast cancer. Methods: Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low. Results: Average age was 60 years (range: 34-85. Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031. Positive physician’s opinion on product use was more frequent for high (66.6% versus low (32% users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. Conclusions: These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer.

Science.gov (United States)

Berger, Antoine; Regueiro, Carlos; Hijal, Tarek; Pasquier, David; De La Fuente, Cristina; Le Tinier, Florence; Coche-Dequeant, Bernard; Lartigau, Eric; Moyal, Dominique; Seité, Sophie; Bensadoun, René-Jean

2018-01-01

As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant) for breast cancer. Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation) before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low). Average age was 60 years (range: 34-85). Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031). Positive physician's opinion on product use was more frequent for high (66.6%) versus low (32%) users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

Ceramide 1 and ceramide 3 act synergistically on skin hydration and the transepidermal water loss of sodium lauryl sulfate-irritated skin.

Science.gov (United States)

Huang, Huey-Chun; Chang, Tsong-Min

2008-08-01

Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.

Functional and physiological characteristics of the aging skin.

Science.gov (United States)

Farage, Miranda A; Miller, Kenneth W; Elsner, Peter; Maibach, Howard I

2008-06-01

As life expectancy in the U.S. increases - and with it the proportion of the aged in the population - appropriate care of elderly skin becomes a medical concern of increasing importance. As skin ages, the intrinsic structural changes that are a natural consequence of passing time are inevitably followed by subsequent physiological changes that affect the skin's ability to function as the interface between internal and external environments. The pH of the skin surface increases with age, increasing its susceptibility to infection. Neurosensory perception of superficial pain is diminished both in intensity and speed of perception (increasing the risk of thermal injury); deep tissue pain, however, may be enhanced. A decline in lipid content as the skin ages inhibits the permeability of nonlipophilic compounds, reducing the efficacy of some topical medications. Allergic and irritant reactions are blunted, as is the inflammatory response, compromising the ability of the aged skin to affect wound repair. These functional impairments (although a predictable consequence of intrinsic structural changes) have the potential to cause significant morbidity in the elderly patient and may, as well, be greatly exacerbated by extrinsic factors like photodamage. As numbers of the elderly increase, medical as well as cosmetic dermatological interventions will be necessary to optimize the quality of life for this segment of the population.

Validation of Cyanoacrylate Method for Collection of Stratum Corneum in Human Skin for Lipid Analysis

DEFF Research Database (Denmark)

Jungersted, JM; Hellgren, Lars; Drachmann, Tue

2010-01-01

Background and Objective: Lipids in the stratum corneum (SC) are of major importance for the skin barrier function. Many different methods have been used for the collection of SC for the analysis of SC lipids. The objective of the present study was to validate the cyanoacrylate method for the col......Background and Objective: Lipids in the stratum corneum (SC) are of major importance for the skin barrier function. Many different methods have been used for the collection of SC for the analysis of SC lipids. The objective of the present study was to validate the cyanoacrylate method...

Xenobiotic metabolism in human skin and 3D human skin reconstructs: A review

NARCIS (Netherlands)

Gibbs, S.; Sandt, J.J.M. van de; Merk, H.F.; Lockley, D.J.; Pendlington, R.U.; Pease, C.K.

2007-01-01

In this review, we discuss and compare studies of xenobiotic metabolism in both human skin and 3D human skin reconstructs. In comparison to the liver, the skin is a less studied organ in terms of characterising metabolic capability. While the skin forms the major protective barrier to environmental

Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

Science.gov (United States)

Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

2018-02-01

Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Nanoscale alterations of corneocytes indicate skin disease

DEFF Research Database (Denmark)

Franz, J; Beutel, M; Gevers, K

2016-01-01

BACKGROUND: The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here...... dermatitis, a common inflammatory skin condition. CONCLUSION: The presence of these corneocyte-nanostructures might be used as a diagnostic parameter for skin disorders - even in cases below a clinical threshold....

Skin graft - slideshow

Science.gov (United States)

... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

The intestinal barrier function and its involvement in digestive disease

Directory of Open Access Journals (Sweden)

Eloísa Salvo-Romero

2015-11-01

Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

Cream or foam in pedal skin care: towards the ideal vehicle for urea used against dry skin.

Science.gov (United States)

Borelli, C; Bielfeldt, S; Borelli, S; Schaller, M; Korting, H C

2011-02-01

The aim of this study was to evaluate different urea-containing cosmetic preparations designed for foot care regarding skin occlusion. The primary aim was therefore to screen the short-term transepidermal water loss (TEWL) as a parameter for skin barrier function and skin occlusion and to characterize the relative role of the vehicle, i.e. cream or foam in the context of cosmetics containing urea in the 2-10% range addressing the cosmetic products urea 2% cream (GEHWOL FUSSKRAFT blau), petrolatum containing cream (GEHWOL med Schrundensalbe), urea 10% cream (GEHWOL med Lipidro-Crème), urea 10% foam (Allpresan Fuss Schaum) and vaseline (positive control) compared with an untreated area on the volar forearms of volunteers. Moreover, the short time (24 h) kinetics regarding the moisturizing effect of cream and foam formulations in diabetic patients were compared. The efficacy of a cream on reduction of skin thickness of hyperkeratotic skin in the heel region before and after a period of product application was also evaluated. In some of the trials, healthy individuals and in others, diabetic patients (type I and II) were enrolled. TEWL was determined before product application, as well as at given points of time thereafter. In this study, no excessive occlusion effects comparable with a blockage of the skin's natural water evaporation could be observed for any of the test products. To the extent to be expected, this was found neither for the cream products nor for the foam product. Slightly lowered TEWL values after application of the 10% urea cream can be interpreted as a beneficial effect in terms of an improved barrier function. Regarding skin moisture, the urea-containing cream formulation appeared equal or slightly superior to the foam formulation. The thickness of the horny layer was found reduced after application of 10 % urea-containing cream. At present it looks as if cream vehicles would still be vehicles of choice in general, when it comes to the

A Perspective on the Interplay of Ultraviolet-Radiation, Skin Microbiome and Skin Resident Memory TCRαβ+ Cells

Directory of Open Access Journals (Sweden)

VijayKumar Patra

2018-05-01

Full Text Available The human skin is known to be inhabited by diverse microbes, including bacteria, fungi, viruses, archaea, and mites. This microbiome exerts a protective role against infections by promoting immune development and inhibiting pathogenic microbes to colonize skin. One of the factors having an intense effect on the skin and its resident microbes is ultraviolet-radiation (UV-R. UV-R can promote or inhibit the growth of microbes on the skin and modulate the immune system which can be either favorable or harmful. Among potential UV-R targets, skin resident memory T cells (TRM stand as well positioned immune cells at the forefront within the skin. Both CD4+ or CD8+ αβ TRM cells residing permanently in peripheral tissues have been shown to play prominent roles in providing accelerated and long-lived specific immunity, tissue homeostasis, wound repair. Nevertheless, their response upon UV-R exposure or signals from microbiome are poorly understood compared to resident TCRγδ cells. Skin TRM survive for long periods of time and are exposed to innumerable antigens during lifetime. The interplay of TRM with skin residing microbes may be crucial in pathophysiology of various diseases including psoriasis, atopic dermatitis and polymorphic light eruption. In this article, we share our perspective about how UV-R may directly shape the persistence, phenotype, specificity, and function of skin TRM; and moreover, whether UV-R alters barrier function, leading to microbial-specific skin TRM, disrupting the healthy balance between skin microbiome and skin immune cells, and resulting in chronic inflammation and diseased skin.

Functional analyses of the skin surface of the areola mammae: comparison between healthy adult male and female subjects and between healthy individuals and patients with atopic dermatitis.

Science.gov (United States)

Kikuchi, K; Tagami, H; Akaraphanth, R; Aiba, S

2011-01-01

Although the nipple and areola of the breast constitute a unique and prominent area on the chest, so far no study has been done on the functional properties of their skin surfaces. To study the stratum corneum (SC) covering the areola using noninvasive methods. Eighteen adult healthy subjects comprising nine men and nine women and 18 age- and sex-matched patients with atopic dermatitis (AD), none of whom had visible skin lesions, participated in the study. Transepidermal water loss (TEWL), skin surface hydration and skin surface lipid levels were measured on the areola and adjacent breast skin. The size of the skin surface corneocytes of these skin regions was assessed. All the healthy subjects showed significantly higher TEWL accompanied by smaller sized corneocytes on the areola than on the adjacent breast skin. Only female subjects revealed a significantly higher skin surface hydration state together with significantly increased skin surface lipid levels on the areola than on the adjacent breast skin. These sex differences were observed even in patients with AD. Comparison between healthy individuals and the patients with AD demonstrated higher TEWL, decreased skin surface hydration state and lower skin surface lipid levels associated with smaller sized corneocytes in the areola in the patients with AD, especially in male patients. In adults, the SC barrier function and SC water-binding capacity of the areola were functionally poorer than in the adjacent skin, being covered by smaller sized corneocytes and lower amounts of skin surface lipids, especially in men and in patients with AD. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.

Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

OpenAIRE

Li, Z; Hu, L; Elias, PM; Man, M-Q

2018-01-01

Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Eriko Kage-Nakadai

Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.

Functional barriers: Properties and evaluation

NARCIS (Netherlands)

Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

2005-01-01

Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

Nanoscale alterations of corneocytes indicate skin disease

NARCIS (Netherlands)

Franz, J.; Beutel, M.; Gevers, K.; Kramer, A.; Thyssen, J. P.; Kezic, S.; Riethmüller, C.

2016-01-01

The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here, we extended

Next generation human skin constructs as advanced tools for drug development.

Science.gov (United States)

Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela

2017-11-01

Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various

A new body moisturizer increases skin hydration and improves atopic dermatitis symptoms among children and adults.

Science.gov (United States)

Simpson, Eric; Dutronc, Yves

2011-07-01

Moisturizers result in an increase of skin hydration and restoration of the skin barrier function and play a prominent role in the longterm management of atopic dermatitis (AD). Cetaphil RestoradermTM Moisturizer (CRM) contains novel ingredients specifically designed for AD, and its effects on skin hydration, skin barrier function and signs of AD were assessed in four studies, three of which were evaluator-blinded, randomized and intra-individual comparison trials. A single application of CRM induced significantly greater hydration than the untreated control for at least 24 hours (P is less than 0.001). After the skin was disrupted with 0.5% sodium dodecyl sulfate (SDS), applications of CRM led to a more rapid restoration of skin barrier function and maintained significantly greater skin hydration compared to the untreated control (both P is less than 0.05). After four weeks of twice-daily CRM application among subjects with a history of AD, a significant decrease of itching/stinging scores compared to baseline was reported, as well as an improvement in the quality-of- life and a high level of satisfaction regarding the product. When CRM was used as an adjunctive treatment with topical steroid for four weeks among subjects with mild-to-moderate AD, a more rapid decrease of overall disease severity was observed on days 7, 14 and 21 by the blinded investigator (P is less than 0.05), compared to steroid treatment alone. In summary, CRM is suitable for the specific needs of patients with AD and can be used either alone for long-term management or in adjunction with traditional treatment for both short and long-term disease control.

Dietary Cerebroside from Sea Cucumber (Stichopus japonicus): Absorption and Effects on Skin Barrier and Cecal Short-Chain Fatty Acids.

Science.gov (United States)

Duan, Jingjing; Ishida, Marina; Aida, Kazuhiko; Tsuduki, Tsuyoshi; Zhang, Jin; Manabe, Yuki; Hirata, Takashi; Sugawara, Tatsuya

2016-09-21

Sphingolipids from marine sources have attracted more attention recently because of their distinctive structures and expected functions. In this study, the content and components of cerebroside from sea cucumber Stichopus japonicus were analyzed. The absorption of cerebroside from S. japonicus was investigated with an in vivo lipid absorption assay. The result revealed that S. japonicus is a rich source of cerebroside that contained considerable amounts of odd carbon chain sphingoid bases. The cumulative recoveries of d17:1- and d19:2-containing cerebrosides were 0.31 ± 0.16 and 0.32 ± 0.10%, respectively, for 24 h after administration. To the best of the authors' knowledge, this is the first work that shows sphingolipids from a marine source could be absorbed in vivo and incorporated into ceramides. In addition, dietary supplementation with sea cucumber cerebroside to hairless mouse improved the skin barrier function and increased short-chain fatty acids in cecal contents, which have shown beneficial effects on the host.

DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.

Science.gov (United States)

Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim

2017-12-01

In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.

The integumentary system: anatomy, physiology and function of skin.

Science.gov (United States)

McLafferty, Ella; Hendry, Charles; Alistair, Farley

This article, which forms part of the life sciences series, examines the anatomy and physiology of skin, also termed the integumentary system. Skin is composed of two main layers, the epidermis and dermis. The structure of the epidermis and dermis are described and their functions are discussed. Accessory structures, such as nails and hair are also considered. Although many diseases of the skin exist, two common conditions--psoriasis and decubitus ulcers--are described in this article.

Percutaneous penetration through slightly damaged skin

DEFF Research Database (Denmark)

Nielsen, Jesper B

2005-01-01

with human skin. A slight damage to the barrier integrity was induced by pre-treatment of the skin with sodium lauryl sulphate (SLS) before pesticide exposure. The experimental model with 3 h pre-treatment with SLS (0.1% or 0.3%) assured a significant but controlled damage to the barrier integrity, a damage...

Excellent Aesthetic and Functional Outcome After Fractionated Carbon Dioxide Laser Skin Graft Revision Surgery: Case Report and Review of Laser Skin Graft Revision Techniques.

Science.gov (United States)

Ho, Derek; Jagdeo, Jared

2015-11-01

Skin grafts are utilized in dermatology to reconstruct a defect secondary to surgery or trauma of the skin. Common indications for skin grafts include surgical removal of cutaneous malignancies, replacement of tissue after burns or lacerations, and hair transplantation in alopecia. Skin grafts may be cosmetically displeasing, functionally limiting, and significantly impact patient's quality-of-life. There is limited published data regarding skin graft revision to enhance aesthetics and function. Here, we present a case demonstrating excellent aesthetic and functional outcome after fractionated carbon dioxide (CO2) laser skin graft revision surgery and review of the medical literature on laser skin graft revision techniques.

Selenoproteins are essential for proper keratinocyte function and skin development.

Directory of Open Access Journals (Sweden)

Aniruddha Sengupta

2010-08-01

Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

International Nuclear Information System (INIS)

Svenson, Ola

2000-02-01

The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses

Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

Energy Technology Data Exchange (ETDEWEB)

Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

2000-02-01

The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

p120-catenin mediates inflammatory responses in the skin

DEFF Research Database (Denmark)

Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

2006-01-01

but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

Directory of Open Access Journals (Sweden)

Dirk Breitkreutz

2013-01-01

Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

Sensitive skin at menopause; dew point and electrometric properties of the stratum corneum.

Science.gov (United States)

Paquet, F; Piérard-Franchimont, C; Fumal, I; Goffin, V; Paye, M; Piérard, G E

1998-01-12

A number of menopausal women experience skin sensitive to various environmental threats. Two panels of 15 menopausal women on or without HRT were compared. We studied the response of their stratum corneum to variations in environmental humidity, either in air or in response to an emollient. Environment dew point and electrometric measurements on the skin were recorded to search for correlations. Data show that the baseline stratum corneum hydration is influenced by the dew point. HRT improves the barrier function of the skin. The use of emollient further extends the improvement in the functional properties of skin in menopausal women. Both HRT and an emollient can counteract in part some of the deleterious effects of cold and dry weather.

Skin absorption through atopic dermatitis skin

DEFF Research Database (Denmark)

Halling-Overgaard, A-S; Kezic, S; Jakasa, I

2017-01-01

Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

International guidelines for the in vivo assessment of skin properties in non-clinical settings

DEFF Research Database (Denmark)

du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz

2013-01-01

There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, repre......, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings....

Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

Science.gov (United States)

Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

2018-01-21

Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Skin-associated lymphoid tissues (SALT): origins and functions

International Nuclear Information System (INIS)

Streilein, J.W.

1983-01-01

The skin has an unusual set of immunologic requirements. It is confronted by a specialized set of pathogenic organisms and environmental chemicals that represent a distinctive spectrum of antigenic specificities. Skin is subjected to physicochemical stresses such as irradiation with ultraviolet light that alter dramatically its immunologic properties. It is proposed that nature has provided skin with a unique collection of lymphoid cells, reticular cells, and organized lymphoid organs to deal with these special demands. Evidence in favor of the existence of skin-associated lymphoid tissues (SALT) includes (1) the cutaneous microenvironment is capable on its own of accepting, processing, and presenting nominal antigen; (2) strategically located peripheral lymph nodes are able to accept immunogenic signals derived from skin; (3) subsets of T lymphocytes display differential affinity for skin and its associated peripheral nodes; and (4) acquisition of this affinity by T cells is determined at least in part by differentiation signals received in situ from resident cutaneous cells. Responsibility for the establishment and integration of SALT rests with keratinocytes, Langerhans cells, and immunocompetent lymphocytes, each of which contributes uniquely to the synthesis. Together they provide skin with immune surveillance that effectively prejudices against the development of cutaneous neoplasms and persistent infection with intracellular pathogens. In patients who have been under long-term immunosuppressive therapy, the large majority of nonlymphoid malignancies arise within the skin, rather than other types of tissues. These data suggest that immune surveillance, once thought to be an immune defense operative in all somatic tissues, is a specialized immune function dedicated to the skin and mediated by SALT

Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers

International Nuclear Information System (INIS)

Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang

2006-01-01

The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied

Chimeric autologous/allogeneic constructs for skin regeneration.

Science.gov (United States)

Rasmussen, Cathy Ann; Tam, Joshua; Steiglitz, Barry M; Bauer, Rebecca L; Peters, Noel R; Wang, Ying; Anderson, R Rox; Allen-Hoffmann, B Lynn

2014-08-01

The ideal treatment for severe cutaneous injuries would eliminate the need for autografts and promote fully functional, aesthetically pleasing autologous skin regeneration. NIKS progenitor cell-based skin tissues have been developed to promote healing by providing barrier function and delivering wound healing factors. Independently, a device has recently been created to "copy" skin by harvesting full-thickness microscopic tissue columns (MTCs) in lieu of autografts traditionally harvested as sheets. We evaluated the feasibility of combining these two technologies by embedding MTCs in NIKS-based skin tissues to generate chimeric autologous/allogeneic constructs. Chimeric constructs have the potential to provide immediate wound coverage, eliminate painful donor site wounds, and promote restoration of a pigmented skin tissue possessing hair follicles, sweat glands, and sebaceous glands. After MTC insertion, chimeric constructs and controls were reintroduced into air-interface culture and maintained in vitro for several weeks. Tissue viability, proliferative capacity, and morphology were evaluated after long-term culture. Our results confirmed successful MTC insertion and integration, and demonstrated the feasibility of generating chimeric autologous/allogeneic constructs that preserved the viability, proliferative capacity, and structure of autologous pigmented skin. These feasibility studies established the proof-of-principle necessary to further develop chimeric autologous/allogeneic constructs for the treatment of complex skin defects. Reprint & Copyright © 2014 Association of Military Surgeons of the U.S.

Liquid Crystal Gel Reduces Age Spots by Promoting Skin Turnover

Directory of Open Access Journals (Sweden)

Mina Musashi

2014-07-01

Full Text Available Studies have shown that liquid crystals structurally resembling the intercellular lipids in the stratum corneum can beneficially affect the skin when applied topically by stimulating the skin’s natural regenerative functions and accelerating epidermal turnover. In the present study, the effects of applying low concentrations of a liquid crystal gel of our own creation were evaluated using epidermal thickening in mouse skin as an assay for effective stimulation of epidermal turnover. A liquid crystal gel was also applied topically to human facial skin, and analysis was conducted using before-and-after photographs of age spots, measurements of L* values that reflect degree of skin pigmentation, single-layer samples of the stratum corneum obtained via tape-stripping, and measurements of trans-epidermal water loss that reflect the status of the skin’s barrier function. The results suggested that cost-effective creams containing as low as 5% liquid crystal gel might be effective and safely sold as skin care products targeting age spots and other problems relating to uneven skin pigmentation.

Contribution to the penetration of radionuclides across the skin

International Nuclear Information System (INIS)

Koprda, V.; Harangozo, M.; Kassai, Z.

2000-01-01

hours. The permeation resistance of the skin is proportional to the thickness of the horny layer, the principal barrier mostly restricting the flux of ions. The results showed that the more is the skin stripped, the more enhanced is the penetration of ions. This certifies the fact that stratum corneum represents the most important barrier function of the whole skin (at least in the case of young rats). The results of Co 2+ -ion penetration at different concentrations across the animal models of human skin showed that the permeated amounts of Co 2+ -ions are proportional to its concentration in donor solutions, whereby permeated fractions are higher at lower concentrations. Comparing amounts of penetrated ions through the skin without hairs (5DR) and through the skin with hairs, it was found that the additional (shunt) diffusion through the channels along hair's follicles can be important also in case of human skin where hair density is many times lower than in case of the used animal model. (author)

Permanent isolation surface barrier: Functional performance

International Nuclear Information System (INIS)

Wing, N.R.

1993-10-01

This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release

Nuclear microprobe investigation of the penetration of ultrafine zinc oxide into human skin affected by atopic dermatitis

Science.gov (United States)

Szikszai, Z.; Kertész, Zs.; Bodnár, E.; Borbíró, I.; Angyal, A.; Csedreki, L.; Furu, E.; Szoboszlai, Z.; Kiss, Á. Z.; Hunyadi, J.

2011-10-01

Skin penetration is one of the potential routes for nanoparticles to gain access into the human body. Ultrafine metal oxides, such as titanium dioxide and zinc oxide are widely used in cosmetic and health products like sunscreens. These oxides are potent UV filters and the particle size smaller than 200 nm makes the product more transparent compared to formulations containing coarser particles. The present study continues the work carried out in the frame of the NANODERM: “Quality of skin as a barrier to ultrafine particles” European project and complements our previous investigations on human skin with compromised barrier function. Atopic dermatitis (a type of eczema) is an inflammatory, chronically relapsing, non-contagious skin disease. It is very common in children but may occur at any age. The exact cause of atopic dermatitis is unknown, but is likely due to a combination of impaired barrier function together with a malfunction in the body's immune system. In this study, skin samples were obtained from two patients suffering from atopic dermatitis. Our results indicate that the ultrafine zinc oxide particles, in a hydrophobic basis gel with an application time of 2 days or 2 weeks, have penetrated deeply into the stratum corneum in these patients. On the other hand, penetration into the stratum spinosum was not observed even in the case of the longer application time.

From microscopic to macroscopic dynamics in mean-field theory: effect of neutron skin on fusion barrier and dissipation

Energy Technology Data Exchange (ETDEWEB)

Lacroix, D

2001-07-01

In this work, we introduce a method to reduce the microscopic mean-field theory to a classical macroscopic dynamics at the initial stage of fusion reaction. We show that TDHF (Time-dependent Hartree-Fock) could be a useful tool to infer information on the fusion barrier as well as on one-body dissipation effect. We apply the reduction of information to the case of head-on reaction between a {sup 16}O and {sup 16,22,24,28}O in order to quantify the effect of neutron skin on fusion. We show that the precise determination of fusion barrier requires, in addition to the relative distance between center of mass, the introduction of an additional collective coordinate that explicitly breaks the neutron-proton symmetry. With this additional collective variable, we obtain a rather precise determination of the barrier position, height and diffuseness as well as one-body friction. (author)

Occlusive gloves and skin conditions: is there a problem? Results of a cross-sectional study in a semiconductor company.

Science.gov (United States)

Weistenhöfer, W; Wacker, M; Bernet, F; Uter, W; Drexler, H

2015-04-01

Although there is poor scientific evidence that working with occlusive gloves is as damaging as wet work, prolonged glove occlusion is considered to be a risk factor for developing hand eczema similar to wet work. To assess the effects of wearing occlusive gloves during the whole working day, without exposure to any additional hazardous substances, on skin condition and skin barrier function. We investigated 323 employees of a semiconductor production company in Germany: 177 clean-room workers wearing occlusive gloves during the whole shift (exposed group) and 146 employees working in administration (control group). A standardized interview was performed, the skin condition of both hands was studied using the quantitative skin score HEROS, and transepidermal water loss (TEWL) and stratum corneum hydration were measured. There was no significant difference in skin condition between the two subgroups. Values for TEWL and corneometry were significantly higher in exposed participants (P gloves at least 30 min before the measurement. Hence, the effect of occlusion on skin barrier function seems to be transient. Prolonged wearing of occlusive gloves with clean hands and without exposure to additional hazardous substances does not seem to affect the skin negatively. © 2014 British Association of Dermatologists.

Uniting Control Lyapunov and Control Barrier Functions

NARCIS (Netherlands)

Romdlony, Zakiyullah; Jayawardhana, Bayu

2014-01-01

In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on

Development of a stratum corneum substitute for in vitro percutaneous penetration studies : a skin barrier model comprising synthetic stratum corneum lipids

NARCIS (Netherlands)

Jager, Miranda Wilhelmina de

2006-01-01

The research outlined in this thesis was focused on the development of a skin barrier model, which can substitute for stratum corneum in diffusion studies. This so-called stratum corneum substitute (SCS) was prepared with reconstituted SC lipids (cholesterol, free fatty acids and ceramides) on a

A fermented barley and soybean formula enhances skin hydration.

Science.gov (United States)

Lee, Sein; Kim, Jong-Eun; Suk, Sujin; Kwon, Oh Wook; Park, Gaeun; Lim, Tae-Gyu; Seo, Sang Gwon; Kim, Jong Rhan; Kim, Dae Eung; Lee, Miyeong; Chung, Dae Kyun; Jeon, Jong Eun; Cho, Dong Woon; Hurh, Byung Serk; Kim, Sun Yeou; Lee, Ki Won

2015-09-01

Skin hydration is one of the primary aims of beauty and anti-aging treatments. Barley (Hordeum vulgare) and soybean (Glycine max) are major food crops, but can also be used as ingredients for the maintenance of skin health. We developed a natural product-based skin treatment using a barley and soybean formula (BS) incorporating yeast fermentation, and evaluated its skin hydration effects as a dietary supplement in a clinical study. Participants ingested a placebo- (n = 33) or BS- (3 g/day) containing drink (n = 32) for 8 weeks. A significant increase in hydration in the BS group as compared to the placebo group was observed on the faces of subjects after 4 and 8 weeks, and on the forearm after 4 weeks. Decreases in stratum corneum (SC) thickness were also observed on the face and forearm. BS enhanced hyaluronan (HA) and skin barrier function in vitro and reduced Hyal2 expression in human dermal fibroblasts (HDF). BS also recovered ultraviolet (UV) B-induced downregulation of HA in HaCaT cells. These results suggest that BS has promising potential for development as a health functional food to enhance skin health.

The effectiveness of using a bath oil to reduce signs of dry skin: A randomized controlled pragmatic study.

Science.gov (United States)

Kottner, Jan; Kanti, Varvara; Dobos, Gabor; Hahnel, Elisabeth; Lichterfeld-Kottner, Andrea; Richter, Claudia; Hillmann, Kathrin; Vogt, Annika; Blume-Peytavi, Ulrike

2017-01-01

Dry skin (xerosis cutis) is increasingly recognized as a relevant health problem in daily life and in health and nursing care. The use of bath additives such as oils is common to reduce dry skin, but empirical evidence supporting this practice is limited. The aim of this study was to investigate the effectiveness of using a bath oil additive in improving skin barrier function and ameliorating dry skin in comparison to non-oil containing skin cleansers for bathing or showering. Single centre randomized observer blind pragmatic parallel group trial. Outpatient/community care. Volunteers showing clinically mild to moderate dry skin recruited from the city of Berlin. Healthy children and adults were randomly assigned to use either a commercially available bath oil or to continue using their regular non-oil containing skin cleansers every other day over a study period of 28days. Skin barrier parameters and the severity of dry skin were assessed at baseline and at two follow-up visits at the study centre. Transepidermal water loss was the primary outcome. All sixty participants randomized completed the trial. Median age was 32.5 (IQR 8.3 to 69) years. At the end of study the mean transepidermal water loss in the intervention group was statistically significant lower compared to the control group (mean difference -1.9 (95% CI -3.1 to -0.8) g/m 2 /h). Stratum corneum hydration was statistically significantly higher in the intervention group at the end of the study. Skin surface pH and roughness were comparable in both groups and remained unchanged, while both groups showed a trend to improvement in dry skin symptoms CONCLUSIONS: This pragmatic trial provides empirical evidence that the regular use of the investigated bath oil is effective in improving the skin barrier function in children and adults with mild dry skin when used in routine skin care and supports its use as a basic element for the management of a broad spectrum of dry skin conditions. Clinical

Effects of water activity and low molecular weight humectants on skin permeability and hydration dynamics - a double-blind, randomized and controlled study.

Science.gov (United States)

Albèr, C; Buraczewska-Norin, I; Kocherbitov, V; Saleem, S; Lodén, M; Engblom, J

2014-10-01

The mammalian skin is a barrier that effectively separates the water-rich interior of the body from the normally dryer exterior. Changes in the external conditions, for example ambient humidity, have been shown to affect the skin barrier properties. The prime objective of this study was to evaluate the effect of water activity of a topical formulation on skin hydration and permeability. A second objective was to gain more understanding on how two commonly used humectants, urea and glycerol, affect skin barrier function in vivo. Simple aqueous formulations were applied under occlusion to the volar forearm of healthy volunteers. Following 4-h exposure, skin water loss (by transepidermal water loss measurements), skin hydration (by Corneometry) and skin permeability (by time to vasodilation due to benzyl nicotinate exposure) were monitored. The results demonstrate that a relatively small change in the water activity of a topical formulation is sufficient to induce considerable effects on stratum corneum hydration and permeability to exogenous substances. Exposing the skin to high water activity leads to increased skin hydration and also increased permeability. Furthermore, urea and glycerol promote skin hydration and permeability even at reduced water activity of the applied formulation. These results highlight the importance of considering the water activity in topically applied formulations and the potential benefit of using humectants. The results may impact formulation optimization in how to facilitate skin hydration and to modify skin permeability by temporarily open and close the skin barrier. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Functional restoration of penis with partial defect by scrotal skin flap.

Science.gov (United States)

Zhao, Yue-Qiang; Zhang, Jie; Yu, Mo-Sheng; Long, Dao-Chou

2009-11-01

We investigated a reconstructive method with better sensory and erectile function for partial penile defects and report our long-term results of surgical correction using scrotal skin flaps. We retrospectively analyzed the records of 18 patients with penile defects referred to us between 1992 and 2007. All cases were treated with a scrotal skin flap initially to repair the secondary defect after penile elongation. Of the 18 cases treated during the 15-year period the mechanism of primary injury was circumcision in 3, animal bite in 9 and penile tumor dissection in 6. Penile elongation, division of the suspensory ligament and scrotal skin flaps achieved penile augmentation and enhancement. Six cases were treated with a bilateral scrotal skin flap supplied by the anterior scrotal artery and 12 were repaired with a total anterior scrotal skin flap supplied by the anterior and posterior scrotal arteries. Penile length in the flaccid and erectile states was obviously increased postoperatively (p <0.05). All patients were followed 1 to 9 years (mean 2.3) postoperatively. Deep and superficial sensation recovered and erectile function was retained. Of the 18 patients 15 reported satisfied sexual intercourse during the 0.5 to 5-year followup. The method of correcting partial penile defect using scrotal skin flaps is effective and simple according to our long-term experience. This method achieves reasonable cosmesis and penile length in most cases with better sensory and erectile function.

Epidermal Growth Factor and Intestinal Barrier Function

Directory of Open Access Journals (Sweden)

Xiaopeng Tang

2016-01-01

Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

Stratum corneum damage and ex vivo porcine skin water absorption - a pilot study

DEFF Research Database (Denmark)

Duch Lynggaard, C; Bang Knudsen, D; Jemec, G B E

2009-01-01

A simple ex vivo screening technique would be of interest for mass screening of substances for potential barrier disruptive qualities. Ex vivo water absorption as a marker of skin barrier integrity was studied on pig ear skin. Skin water absorption was quantified by weighing and weight changes were...... found to reflect prehydration barrier damage. It is suggested that this simple model may be elaborated to provide a rapid, economical screening tool for potential skin irritants....

No Sting Barrier Film to Protect Skin in Adult Patients: Findings From a Scoping Review With Implications for Evidence-Based Practice.

Science.gov (United States)

Micheli, Chiara; Palese, Alvisa; Canzan, Federica; Ambrosi, Elisa

2017-10-01

In the industrialized world, approximately 1-1.5% of the population has received treatments for skin lesions. In the 1990s, a polymeric barrier film called the No Sting Barrier Film (NSBF) was developed as an alternative to petrolatum-based ointments and zinc oxide formulas. To date, few studies have explored the effectiveness of NSBF in protecting skin integrity. To map the methods, fields and outcomes used to produce evidence on NSBF effectiveness. A scoping review was performed in 2015. A search strategy for identifying relevant studies was designed and performed. Systematic reviews, meta-analyses, randomized controlled trials, controlled clinical trials, and comparative studies for all types of interventions were included; research conducted in any clinical context was eligible for inclusion. Studies were selected by two reviewers; data extraction and analysis also was performed by two reviewers and disagreements were discussed. Six studies were included. NSBF's potential as a skin protector was investigated with respect to (a) chronic wounds (pressure ulcers or vascular leg ulcers); (b) urinary or fecal incontinence; and (c) post-mastectomy irradiation. The principal clinical outcomes investigated were, respectively: (a) wound healing, wound exudates and erythema control; (b) incidence of incontinence-associated dermatitis and skin reactions; and (c) intensity of pruritus and skin reactions. Pain and comfort were measured in all clinical applications. The main process outcomes investigated were: (a) ease of application, (b) application and removal time, and (c) costs. Zinc oxide and petroleum formulations were the most common comparison interventions in research on chronic ulcers and incontinence; sorbolene cream and topical corticosteroids were the most frequent comparisons in the context of post-mastectomy irradiation. NBSF may be used for peri-wound skin protection in patients with chronic wounds, with urinary or fecal incontinence and for women undergoing

Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin.

Science.gov (United States)

Pellerin, Laurence; Henry, Julie; Hsu, Chiung-Yueh; Balica, Stéfana; Jean-Decoster, Catherine; Méchin, Marie-Claire; Hansmann, Britta; Rodriguez, Elke; Weindinger, Stefan; Schmitt, Anne-Marie; Serre, Guy; Paul, Carle; Simon, Michel

2013-04-01

Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by a disturbed epidermal barrier. In a subset of patients, this is explained by nonsense mutations in the gene encoding filaggrin (FLG). We sought to evaluate the respective role of FLG mutations and proinflammatory cytokines and to assess the expression of FLG, hornerin (HRNR), and FLG2, 2 FLG-like proteins, which are involved in epidermal barrier functions, in normal skin and both lesional and nonlesional skin of patients with AD. An FLG-genotyped cohort of 73 adults with AD and 73 aged-matched control subjects was analyzed by using immunohistochemistry and immunoblotting. Normal primary human keratinocytes were differentiated in either the absence or presence of IL-4, IL-13, and IL-25. Compared with control subjects, FLG, HRNR, and FLG2 were detected at significantly lower levels in the skin of patients with AD, irrespective of their FLG genotype. The reduction was greater in lesional compared with nonlesional skin. In addition, the proFLG/FLG ratio was found to be higher in the skin of wild-type patients than in control subjects. Cytokine treatment of keratinocytes induced a dramatic reduction in FLG, FLG2, and HRNR expression both at the mRNA and protein levels. The stratum corneum of lesional but also clinically unaffected skin of adults with AD is abnormal, with reduced expression of FLG and FLG-like proteins. In addition to nonsense mutations, proinflammatory cytokines and some defects in the proFLG processing can contribute to the FLG downregulation. Our study suggests that skin inflammation reduces the expression of FLG-like proteins, contributing to the AD-related epidermal barrier dysfunction. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Erbium-yttrium-aluminum-garnet laser irradiation ameliorates skin permeation and follicular delivery of antialopecia drugs.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Aljuffali, Ibrahim A; Li, Yi-Ching; Fang, Jia-You

2014-11-01

Alopecia usually cannot be cured because of the available drug therapy being unsatisfactory. To improve the efficiency of treatment, erbium-yttrium-aluminum-garnet (Er-YAG) laser treatment was conducted to facilitate skin permeation of antialopecia drugs such as minoxidil (MXD), diphencyprone (DPCP), and peptide. In vitro and in vivo percutaneous absorption experiments were carried out by using nude mouse skin and porcine skin as permeation barriers. Fluorescence and confocal microscopies were used to visualize distribution of permeants within the skin. Laser ablation at a depth of 6 and 10 μm enhanced MXD skin accumulation twofold to ninefold depending on the skin barriers selected. DPCP absorption showed less enhancement by laser irradiation as compared with MXD. An ablation depth of 10 μm could increase the peptide flux from zero to 4.99 and 0.33 μg cm(-2) h(-1) for nude mouse skin and porcine skin, respectively. The laser treatment also promoted drug uptake in the hair follicles, with DPCP demonstrating the greatest enhancement (sixfold compared with the control). The imaging of skin examined by microscopies provided evidence of follicular and intercellular delivery assisted by the Er-YAG laser. Besides the ablative effect of removing the stratum corneum, the laser may interact with sebum to break up the barrier function, increasing the skin delivery of antialopecia drugs. The minimally invasive, well-controlled approach of laser-mediated drug permeation offers a potential way to treat alopecia. This study's findings provide the basis for the first report on laser-assisted delivery of antialopecia drugs. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Active agents in common skin care products.

Science.gov (United States)

Draelos, Zoe Diana

2010-02-01

Skin care products are numerous and perplexing, yet the majority fall into the moisturizer category. Moisturizers are substances designed to improve and maintain the skin barrier. They serve as a vehicle for the delivery of active ingredients that minimize facial lines of dehydration, deliver photoprotection, and provide antioxidant properties. Moisturizers are based on occlusive substances, such as petrolatum and dimethicone, and humectant substances, such as glycerin, with a variety of sunscreens and botanicals for added functionality and marketing impact. This article reviews these common active agents. The plethora of over-the-counter skin care products available for patient purchase is overwhelming, yet there is certain commonality among 80 percent of the formulations. The majority of the products are moisturizers with added ingredients to support marketing claims. Whether the product is a facial foundation, an antiaging night cream, a sunscreen, a topical antioxidant, or a skin-lightening serum, the formulation is basically a moisturizer. Sunscreen is the most biologically active antiaging ingredient in skin care products, but the antiinflammatory and antioxidant effects of botanicals possess tremendous marketing appeal.

Anomalous Skin Effect for Anisotropic Electron Velocity Distribution Function

International Nuclear Information System (INIS)

Igor Kaganovich; Edward Startsev; Gennady Shvets

2004-01-01

The anomalous skin effect in a plasma with a highly anisotropic electron velocity distribution function (EVDF) is very different from skin effect in a plasma with the isotropic EVDF. An analytical solution was derived for the electric field penetrated into plasma with the EVDF described as a Maxwellian with two temperatures Tx >> Tz, where x is the direction along the plasma boundary and z is the direction perpendicular to the plasma boundary. The skin layer was found to consist of two distinctive regions of width of order nTx/w and nTz/w, where nTx,z/w = (Tx,z/m)1/2 is the thermal electron velocity and w is the incident wave frequency

Lipid functions in skin: differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model

OpenAIRE

Kendall, Alexandra; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke; Harwood, John L.; Nicolaou, Anna

2017-01-01

Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, deri...

Ambient humidity and the skin: the impact of air humidity in healthy and diseased states.

Science.gov (United States)

Goad, N; Gawkrodger, D J

2016-08-01

Humidity, along with other climatic factors such as temperature and ultraviolet radiation, can have an important impact on the skin. Limited data suggest that external humidity influences the water content of the stratum corneum. An online literature search was conducted through Pub-Med using combinations of the following keywords: skin, skin disease, humidity, dermatoses, dermatitis, eczema, and mist. Publications included in this review were limited to (i) studies in humans or animals, (ii) publications showing relevance to the field of dermatology, (iii) studies published in English and (iv) publications discussing humidity as an independent influence on skin function. Studies examining environmental factors as composite influences on skin health are only included where the impact of humidity on the skin is also explored in isolation of other environmental factors. A formal systematic review was not feasible for this topic due to the heterogeneity of the available research. Epidemiological studies indicated an increase in eczema with low internal (indoors) humidity and an increase in eczema with external high humidity. Other studies suggest that symptoms of dry skin appear with low humidity internal air-conditioned environments. Murine studies determined that low humidity caused a number of changes in the skin, including the impairment of the desquamation process. Studies in humans demonstrated a reduction in transepidermal water loss (TEWL) (a measure of the integrity of the skin's barrier function) with low humidity, alterations in the water content in the stratum corneum, decreased skin elasticity and increased roughness. Intervention with a humidifying mist increased the water content of the stratum corneum. Conversely, there is some evidence that low humidity conditions can actually improve the barrier function of the skin. Ambient relative humidity has an impact on a range of parameters involved in skin health but the literature is inconclusive. Further

Skin barrier disruption by sodium lauryl sulfate-exposure alters the expressions of involucrin, transglutaminase 1, profilaggrin, and kallikreins during the repair phase in human skin in vivo.

Science.gov (United States)

Törmä, Hans; Lindberg, Magnus; Berne, Berit

2008-05-01

Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.

Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

Directory of Open Access Journals (Sweden)

Harmit S. Ranhotra

2016-07-01

Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

Connexins and pannexins in the integumentary system: the skin and appendages.

Science.gov (United States)

Faniku, Chrysovalantou; Wright, Catherine S; Martin, Patricia E

2015-08-01

The integumentary system comprises the skin and its appendages, which includes hair, nails, feathers, sebaceous and eccrine glands. In this review, we focus on the expression profile of connexins and pannexins throughout the integumentary system in mammals, birds and fish. We provide a picture of the complexity of the connexin/pannexin network illustrating functional importance of these proteins in maintaining the integrity of the epidermal barrier. The differential regulation and expression of connexins and pannexins during skin renewal, together with a number of epidermal, hair and nail abnormalities associated with mutations in connexins, emphasize that the correct balance of connexin and pannexin expression is critical for maintenance of the skin and its appendages with both channel and non-channel functions playing profound roles. Changes in connexin expression during both hair and feather regeneration provide suggestions of specialized communication compartments. Finally, we discuss the potential use of zebrafish as a model for connexin skin biology, where evidence mounts that differential connexin expression is involved in skin patterning and pigmentation.

A novel continuous colour mapping approach for visualization of facial skin hydration and transepidermal water loss for four ethnic groups.

Science.gov (United States)

Voegeli, R; Rawlings, A V; Seroul, P; Summers, B

2015-12-01

The aim of this exploratory study was to develop a novel colour mapping approach to visualize and interpret the complexity of facial skin hydration and barrier properties of four ethnic groups (Caucasians, Indians, Chinese and Black Africans) living in Pretoria, South Africa. We measured transepidermal water loss (TEWL) and skin capacitance on 30 pre-defined sites on the forehead, cheek, jaw and eye areas of sixteen women (four per ethnic group) and took digital images of their faces. Continuous colour maps were generated by interpolating between each measured value and superimposing the values on the digital images. The complexity of facial skin hydration and skin barrier properties is revealed by these measurements and visualized by the continuous colour maps of the digital images. Overall, the Caucasian subjects had the better barrier properties followed by the Black African subjects, Chinese subjects and Indian subjects. Nevertheless, the two more darkly pigmented ethnic groups had superior skin hydration properties. Subtle differences were seen when examining the different facial sites. There exists remarkable skin capacitance and TEWL gradients within short distances on selected areas of the face. These gradients are distinctive in the different ethnic groups. In contrast to other reports, we found that darkly pigmented skin does not always have a superior barrier function and differences in skin hydration values are complex on the different parts of the face among the different ethnic groups. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Efficacy and Tolerability of a Facial Serum for Fine Lines, Wrinkles, and Photodamaged Skin

OpenAIRE

Mccall-Perez, Fred; Stephens, Thomas J.; Herndon, James H.

2011-01-01

Background: Dermatology visits for the prevention and treatment of aging skin are rapidly increasing. The clinical sequelae including wrinkling, pigmentary changes, roughness, laxity, and telangiectasia can all result in the appearance of aging skin, impacting quality of life. A facial serum was developed with ingredients associated with an improvement in the appearance of fine lines and wrinkles and increase in stratum corneum barrier function. Patients were instructed to use a gentle wash b...

Imaging mass spectrometry visualizes ceramides and the pathogenesis of dorfman-chanarin syndrome due to ceramide metabolic abnormality in the skin.

Directory of Open Access Journals (Sweden)

Naoko Goto-Inoue

Full Text Available Imaging mass spectrometry (IMS is a useful cutting edge technology used to investigate the distribution of biomolecules such as drugs and metabolites, as well as to identify molecular species in tissues and cells without labeling. To protect against excess water loss that is essential for survival in a terrestrial environment, mammalian skin possesses a competent permeability barrier in the stratum corneum (SC, the outermost layer of the epidermis. The key lipids constituting this barrier in the SC are the ceramides (Cers comprising of a heterogeneous molecular species. Alterations in Cer composition have been reported in several skin diseases that display abnormalities in the epidermal permeability barrier function. Not only the amounts of different Cers, but also their localizations are critical for the barrier function. We have employed our new imaging system, capable of high-lateral-resolution IMS with an atmospheric-pressure ionization source, to directly visualize the distribution of Cers. Moreover, we show an ichthyotic disease pathogenesis due to abnormal Cer metabolism in Dorfman-Chanarin syndrome, a neutral lipid storage disorder with ichthyosis in human skin, demonstrating that IMS is a novel diagnostic approach for assessing lipid abnormalities in clinical setting, as well as for investigating physiological roles of lipids in cells/tissues.

BP180 dysfunction triggers spontaneous skin inflammation in mice.

Science.gov (United States)

Zhang, Yang; Hwang, Bin-Jin; Liu, Zhen; Li, Ning; Lough, Kendall; Williams, Scott E; Chen, Jinbo; Burette, Susan W; Diaz, Luis A; Su, Maureen A; Xiao, Shengxiang; Liu, Zhi

2018-06-04

BP180, also known as collagen XVII, is a hemidesmosomal component and plays a key role in maintaining skin dermal/epidermal adhesion. Dysfunction of BP180, either through genetic mutations in junctional epidermolysis bullosa (JEB) or autoantibody insult in bullous pemphigoid (BP), leads to subepidermal blistering accompanied by skin inflammation. However, whether BP180 is involved in skin inflammation remains unknown. To address this question, we generated a BP180-dysfunctional mouse strain and found that mice lacking functional BP180 (termed Δ NC16A ) developed spontaneous skin inflammatory disease, characterized by severe itch, defective skin barrier, infiltrating immune cells, elevated serum IgE levels, and increased expression of thymic stromal lymphopoietin (TSLP). Severe itch is independent of adaptive immunity and histamine, but dependent on increased expression of TSLP by keratinocytes. In addition, a high TSLP expression is detected in BP patients. Our data provide direct evidence showing that BP180 regulates skin inflammation independently of adaptive immunity, and BP180 dysfunction leads to a TSLP-mediated itch. The newly developed mouse strain could be a model for elucidation of disease mechanisms and development of novel therapeutic strategies for skin inflammation and BP180-related skin conditions.

Direct 3D cell-printing of human skin with functional transwell system.

Science.gov (United States)

Kim, Byoung Soo; Lee, Jung-Seob; Gao, Ge; Cho, Dong-Woo

2017-06-06

Three-dimensional (3D) cell-printing has been emerging as a promising technology with which to build up human skin models by enabling rapid and versatile design. Despite the technological advances, challenges remain in the development of fully functional models that recapitulate complexities in the native tissue. Moreover, although several approaches have been explored for the development of biomimetic human skin models, the present skin models based on multistep fabrication methods using polydimethylsiloxane chips and commercial transwell inserts could be tackled by leveraging 3D cell-printing technology. In this paper, we present a new 3D cell-printing strategy for engineering a 3D human skin model with a functional transwell system in a single-step process. A hybrid 3D cell-printing system was developed, allowing for the use of extrusion and inkjet modules at the same time. We began by revealing the significance of each module in engineering human skin models; by using the extrusion-dispensing module, we engineered a collagen-based construct with polycaprolactone (PCL) mesh that prevented the contraction of collagen during tissue maturation; the inkjet-based dispensing module was used to uniformly distribute keratinocytes. Taking these features together, we engineered a human skin model with a functional transwell system; the transwell system and fibroblast-populated dermis were consecutively fabricated by using the extrusion modules. Following this process, keratinocytes were uniformly distributed onto the engineered dermis by the inkjet module. Our transwell system indicates a supportive 3D construct composed of PCL, enabling the maturation of a skin model without the aid of commercial transwell inserts. This skin model revealed favorable biological characteristics that included a stabilized fibroblast-stretched dermis and stratified epidermis layers after 14 days. It was also observed that a 50 times reduction in cost was achieved and 10 times less medium was

Crossing safety barriers: influence of children's morphological and functional variables.

Science.gov (United States)

Cordovil, Rita; Vieira, Filomena; Barreiros, João

2012-05-01

Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Protecting the radiation-damaged skin from friction: a mini review

International Nuclear Information System (INIS)

Herst, Patries M

2014-01-01

Radiation-induced skin reactions are an unavoidable side effect of external beam radiation therapy, particularly in areas prone to friction and excess moisture such as the axilla, head and neck region, perineum and skin folds. Clinical studies investigating interventions for preventing or managing these reactions have largely focussed on formulations with moisturising, anti-inflammatory, anti-microbial and wound healing properties. However, none of these interventions has emerged as a consistent candidate for best practice. Much less emphasis has been placed on evaluating ways to protect the radiation-damaged skin from friction and excess moisture. This mini review analyses the clinical evidence for barrier products that form a protective layer by adhering very closely to the skin folds and do not cause further trauma to the radiation-damaged skin upon removal. A database search identified only two types of barrier products that fitted these criteria and these were tested in two case series and six controlled clinical trials. Friction protection was most effective when the interventions were used from the start of treatment and continued for several weeks after completion of treatment. Soft silicone dressings (Mepilex Lite and Mepitel Film) and Cavilon No Sting Barrier Film, but not Cavilon Moisturizing Barrier Cream, decreased skin reaction severity, most likely due to differences in formulation and skin build-up properties. It seems that prophylactic use of friction protection of areas at risk could be a worthwhile addition to routine care of radiation-damaged skin

Formation of a protection film on the human skin by microparticles

International Nuclear Information System (INIS)

Lademann, J; Schanzer, S; Richter, H; Knorr, F; Sterry, W; Patzelt, A; Antoniou, C

2008-01-01

Laser scanning microscopy and tape stripping, in combination with optical methods, were used to analyze the distribution and penetration of a barrier cream into the horny layer (stratum corneum) of the human skin under in vivo conditions. The barrier cream contained microparticles of 10 – 100 μm loaded with antioxidant substances. The cream was designed for protection of the skin surface against the destructive action of free radicals, produced by systemically applied chemotherapeutic agents reaching the skin surface via the sweat. Both methods were able to demonstrate that the barrier cream was distributed homogeneously on the skin surface forming a protection film. A penetration into deeper parts of the stratum corneum (SC) was not observed

The 500 Dalton rule for the skin penetration of chemical compounds and drugs

NARCIS (Netherlands)

Bos, J. D.; Meinardi, M. M.

2000-01-01

Human skin has unique properties of which functioning as a physicochemical barrier is one of the most apparent. The human integument is able to resist the penetration of many molecules. However, especially smaller molecules can surpass transcutaneously. They are able to go by the corneal layer,

Shining Light on Skin Pigmentation: The Darker and the Brighter Side of Effects of UV Radiation†

Science.gov (United States)

Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi

2012-01-01

The term barrier function as applied to human skin often connotes the physical properties of this organ that provide protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on a) the mechanisms of involved in selective effects of subcomponents of UV radiation on human skin pigmentation and b) the interactive influences between keratinocytes and melanocytes, acting as ‘epidermal melanin unit’, that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the non-ionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. PMID:22404235

Rheological and sensory properties of hydrophilic skin protection gels based on polyacrylates.

Science.gov (United States)

Kulawik-Pióro, Agnieszka; Kurpiewska, Joanna; Kułaszka, Agnieszka

2018-03-01

With the current increases in occupational skin diseases, literature data attesting the decreasing efficiency of barrier creams with respect to the manufacturer's declarations and legal regulations granting skin protection gels for employees, research is required to analyse and evaluate the recipes used for hydrophilic skin protection gels based on polyacrylates. This study investigated the rheological properties, pH and sensory perception of hydrophilic barrier gels based on polyacrylates. The acrylic acid derivatives used were good thickeners, and helped to form transparent gels of adequate durability. They could be used to create hydrophilic films on the surface of the skin to protect it against hydrophobic substances. A correlation was shown between the results of the rheological properties and the barrier properties of the gels. This confirms the possibility of monitoring the quality of the gels at the stage of recipe development. Polyacrylates are viable for use in industry to produce hydrophilic barrier creams suitable for skin protection.

Dirt-binding particles consisting of hydrogenated castor oil beads constitute a nonirritating alternative for abrasive cleaning of recalcitrant oily skin contamination in a three-step programme of occupational skin protection.

Science.gov (United States)

Mahler, V; Erfurt-Berge, C; Schiemann, S; Michael, S; Egloffstein, A; Kuss, O

2010-04-01

In occupational fields with exposure to grease, oil, metal particles, coal, black lead or soot, cleansing formulations containing abrasive bodies (e.g. refined walnut shell, corn, wood, plastic or pumice) are used. These may constitute an irritant per se. As an alternative, hydrogenated castor oil (also known as castor wax) beads have been developed as dirt-binding particles. A polar surface contributes to their mechanical cleaning effects in removal of oily grime. Standardized examination of the in vivo effects upon the skin barrier of castor wax beads in comparison with abrasive bodies and pure detergent. Three cleansing preparations - (i) detergent, (ii) detergent containing castor wax beads, (iii) detergent containing walnut shell powder - were each repetitively applied in vivo (four times daily for 3 weeks), mimicking workplace conditions, in 30 healthy volunteers (15 with and 15 without an atopic skin diathesis) and compared vs. (iv) no treatment. The treatment effects upon the skin barrier were monitored by repeated measurements of functional parameters [transepidermal water loss (TEWL), redness] and surface topography. After a 3-week treatment, a significant global treatment effect (P dirt and use of skin protection and skin care measures under real workplace conditions, this component may now be used and examined further in different occupations.

Erbium:YAG laser resurfacing increases skin permeability and the risk of excessive absorption of antibiotics and sunscreens: the influence of skin recovery on drug absorption.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Al-Suwayeh, Saleh A; Li, Yi-Ching; Fang, Jia-You

2012-06-01

While laser skin resurfacing is expected to result in reduced barrier function and increased risk of drug absorption, the extent of the increment has not yet been systematically investigated. We aimed to establish the skin permeation profiles of tetracycline and sunscreens after exposure to the erbium:yttrium-aluminum-garnet (Er:YAG) laser during postoperative periods. Physiological and histopathological examinations were carried out for 5 days after laser treatment on nude mice. Percutaneous absorption of the permeants was determined by an in vitro Franz cell. Ablation depths varied in reaching the stratum corneum (10 μm, 2.5 J/cm²) to approach the epidermis (25 μm, 6.25 J/cm²) and upper dermis (40 μm, 10 J/cm²). Reepithelialization evaluated by transepidermal water loss was complete within 2-4 days and depended on the ablation depth. Epidermal hyperplasia was observed in the 40-μm-treated group. The laser was sufficient to disrupt the skin barrier and allow the transport of the permeants into and across the skin. The laser fluence was found to play an important role in modulating skin absorption. A 25-μm ablation depth increased tetracycline flux 84-fold. A much smaller enhancement (3.3-fold) was detected for tetracycline accumulation within the skin. The laser with different fluences produced enhancement of oxybenzone skin deposition of 3.4-6.4-fold relative to the untreated group. No penetration across the skin was shown regardless of whether titanium dioxide was applied to intact or laser-treated skin. However, laser resurfacing increased the skin deposition of titanium dioxide from 46 to 109-188 ng/g. Tetracycline absorption had recovered to the level of intact skin after 5 days, while more time was required for oxybenzone absorption. The in vivo skin accumulation and plasma concentration revealed that the laser could increase tetracycline absorption 2-3-fold. The experimental results indicated that clinicians should be cautious when determining the

Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics

OpenAIRE

Henrique Silva; Sara Aguiar Silva; Hugo Ferreira; L. Monteiro Rodrigues

2015-01-01

Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu). The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young ad...

A search for parameters of universal sub-barrier fusion excitation function

Energy Technology Data Exchange (ETDEWEB)

Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

2016-11-15

Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

Tumor Suppressor Function of CYLD in Nonmelanoma Skin Cancer

Directory of Open Access Journals (Sweden)

K. C. Masoumi

2011-01-01

Full Text Available Ubiquitin and ubiquitin-related proteins posttranslationally modify substrates, and thereby alter the functions of their targets. The ubiquitination process is involved in various physiological responses, and dysregulation of components of the ubiquitin system has been linked to many diseases including skin cancer. The ubiquitin pathways activated among skin cancers are highly diverse and may reflect the various characteristics of the cancer type. Basal cell carcinoma and squamous cell carcinoma, the most common types of human skin cancer, are instances where the involvement of the deubiquitination enzyme CYLD has been recently highlighted. In basal cell carcinoma, the tumor suppressor protein CYLD is repressed at the transcriptional levels through hedgehog signaling pathway. Downregulation of CYLD in basal cell carcinoma was also shown to interfere with TrkC expression and signaling, thereby promoting cancer progression. By contrast, the level of CYLD is unchanged in squamous cell carcinoma, instead, catalytic inactivation of CYLD in the skin has been linked to the development of squamous cell carcinoma. This paper will focus on the current knowledge that links CYLD to nonmelanoma skin cancers and will explore recent insights regarding CYLD regulation of NF-κB and hedgehog signaling during the development and progression of these types of human tumors.

The Drosophila blood-brain barrier: Development and function of a glial endothelium

Directory of Open Access Journals (Sweden)

Stefanie eLimmer

2014-11-01

Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

The Drosophila blood-brain barrier: development and function of a glial endothelium.

Science.gov (United States)

Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian

2014-01-01

The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

Facial skin care products and cosmetics.

Science.gov (United States)

Draelos, Zoe Diana

2014-01-01

Facial skin care products and cosmetics can both aid or incite facial dermatoses. Properly selected skin care can create an environment for barrier repair aiding in the re-establishment of a healing biofilm and diminution of facial redness; however, skin care products that aggressively remove intercellular lipids or cause irritation must be eliminated before the red face will resolve. Cosmetics are an additive variable either aiding or challenging facial skin health. Copyright © 2014 Elsevier Inc. All rights reserved.

A nuclide transfer model for barriers of the seabed repository using response function

International Nuclear Information System (INIS)

Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo

1996-01-01

A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)

Friends or Foes? Host defense (antimicrobial) peptides and proteins in human skin diseases.

Science.gov (United States)

Niyonsaba, François; Kiatsurayanon, Chanisa; Chieosilapatham, Panjit; Ogawa, Hideoki

2017-11-01

Host defense peptides/proteins (HDPs), also known as antimicrobial peptides/proteins (AMPs), are key molecules in the cutaneous innate immune system. AMPs/HDPs historically exhibit broad-spectrum killing activity against bacteria, enveloped viruses, fungi and several parasites. Recently, AMPs/HDPs were shown to have important biological functions, including inducing cell proliferation, migration and differentiation; regulating inflammatory responses; controlling the production of various cytokines/chemokines; promoting wound healing; and improving skin barrier function. Despite the fact that AMPs/HDPs protect our body, several studies have hypothesized that these molecules actively contribute to the pathogenesis of various skin diseases. For example, AMPs/HDPs play crucial roles in the pathological processes of psoriasis, atopic dermatitis, rosacea, acne vulgaris, systemic lupus erythematosus and systemic sclerosis. Thus, AMPs/HDPs may be a double-edged sword, promoting cutaneous immunity while simultaneously initiating the pathogenesis of some skin disorders. This review will describe the most common skin-derived AMPs/HDPs (defensins, cathelicidins, S100 proteins, ribonucleases and dermcidin) and discuss the biology and both the positive and negative aspects of these AMPs/HDPs in skin inflammatory/infectious diseases. Understanding the regulation, functions and mechanisms of AMPs/HDPs may offer new therapeutic opportunities in the treatment of various skin disorders. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Loss of Corneodesmosin Leads to Severe Skin Barrier Defect, Pruritus, and Atopy: Unraveling the Peeling Skin Disease

OpenAIRE

Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

2010-01-01

Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disea...

Managing Occupational Irritant Contact Dermatitis Using a Two-Step Skincare Regimen Designed to Prevent Skin Damage and Support Skin Recovery.

Science.gov (United States)

von Grote, Erika C; Palaniswarmy, Kiruthi; Meckfessel, Matthew H

2016-12-01

Occupational irritant contact dermatitis (ICD) affecting the hands is a common and difficult-to-manage condition. Occupations that necessitate contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing elevate the risk of ICD. Management strategies that do not adequately prevent accumulated damage and repair skin, can develop into chronic dermatoses which negatively impact work productivity and quality of life. A 2-step skin-care regimen (Excipial Daily Protection Hand Cream (EP) and Excipial Rapid Repair Hand Cream (ER), Galderma Laboratories, L.P.) has been developed as a daily-use management strategy to protect and repair vulnerable hands. The protective barrier cream is formulated with aluminum chlorohydrate and designed for pre-exposure application to enhance the skin's natural protective barrier and minimize excessive moisture while wearing protective gloves. The repair cream, a lipid-rich formulation, is intended for post-exposure application to rehydrate and facilitate the skin's natural healing process. The results of 3 clinical studies highlighted in this review demonstrate how the use of a 2-step skin-care regimen offers a greater protective effect against ICD than the use of barrier cream alone, and also how the formulation of the barrier cream used in these studies helps minimize the occlusion effect caused by gloves and does not interfere with the antibacterial efficacy of an alcohol-based hand sanitizer. This 2-step skin-care regimen is effectively designed to manage and minimize the risk of ICD development in a variety of patients and provides clinicians an additional tool for helping patients manage ICD. J Drugs Dermatol. 2016;15(12):1504-1510.

Stabilization with guaranteed safety using Control Lyapunov–Barrier Function

NARCIS (Netherlands)

Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu

2016-01-01

We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control

Crossing the entropy barrier of dynamical zeta functions

International Nuclear Information System (INIS)

Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.

1992-01-01

Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)

Crossing the entropy barrier of dynamical zeta functions

Energy Technology Data Exchange (ETDEWEB)

Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

1992-01-01

Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

Association between loss-of-function mutations in the filaggrin gene and self-reported food allergy and alcohol sensitivity

DEFF Research Database (Denmark)

Linneberg, Allan René; Fenger, Runa V; Husemoen, Lise Lotte Nystrup

2013-01-01

Loss-of-function mutations of the filaggrin (FLG) gene cause an impaired skin barrier and increase the risk of atopic dermatitis. Interestingly, FLG mutations have also been found to be associated with a high risk of peanut allergy.......Loss-of-function mutations of the filaggrin (FLG) gene cause an impaired skin barrier and increase the risk of atopic dermatitis. Interestingly, FLG mutations have also been found to be associated with a high risk of peanut allergy....

Radiation dosages absorbed by the skin during videofluorographic examination of velopharyngeal function

International Nuclear Information System (INIS)

Ohara, Hirotoshi; Ogata, Hisao; Nakajima, Tatsuo; Sone, Kiyoaki

2008-01-01

Radiographic assessment has become essential in examining the function of the soft palate and pharyngeal walls in patients with velopharyngeal insufficiency. However, in our search of the literature, there was no report on the exposure dose during videofluorographic examination of velopharyngeal function in Japan. Radiation dosages from videofluorography were measured by attaching a glass dosimeter to the submental skin in 17 patients undergoing examination of velopharyngeal function. Sixteen patients underwent a complete videofluorographic examination. For these 16 patients, the mean time of examination was 96.4 sec; the mean radiation dosage absorbed by the skin was 14.4 mGy, equivalent to approximately 7 standard skull x-rays and lower than that during other fluoroscopic procedures. This dose was also lower than the threshold dose at which the skin damage occurs. In light of increasing concern among the general public over radiation exposure, we consider that these data should provide useful information to patients being asked to give informed consent for this examination. (author)

Quality of life and female sexual function after skinning vulvectomy with split-thickness skin graft in women with vulvar intraepithelial neoplasia or vulvar Paget disease.

Science.gov (United States)

Lavoué, V; Lemarrec, A; Bertheuil, N; Henno, S; Mesbah, H; Watier, E; Levêque, J; Morcel, K

2013-12-01

Vulvar intraepithelial neoplasia (VIN) and vulvar Paget disease are managed with either vulvectomy, destructive treatments (laser, antimitotic drugs) or immunostimulants. All these options are associated with functional complications. The purpose of this study was to evaluate the surgical technique consisting of skinning vulvectomy with split-thickness skin graft, and its effect on overall quality of life and sexual function. A retrospective study was conducted on thirteen patients who underwent skinning vulvectomy with split-thickness skin graft between 1999 and 2009. Overall quality of life and sexual function were assessed with the Medical Outcome Study Short Form 36 (MOS SF-36) and Female Sexual Function Index (FSFI), respectively. The median age of patients was 54 (range: 33-77) years. Three patients had Paget disease and 10 patients had VIN lesions. The excision margins were clear in 46% of cases. The incidence of occult cancer was 31%. The mean follow-up period was 77 (±35) months. Four patients experienced a relapse of their intraepithelial disease. The mean disease-free survival was 58 (±44) months. There was no significant difference in MOS SF-36 scores between the study population and the general population. The patients assessed with the FSFI regained normal sexual function after the surgical procedure. Skinning vulvectomy with split-thickness skin graft is a feasible technique yielding good results in terms of quality of life and sexual function. It enables occult cancer to be diagnosed in patients with VIN or Paget disease. Copyright © 2013 Elsevier Ltd. All rights reserved.

Skin healing and scale regeneration in fed and unfed sea bream, Sparus auratus

Directory of Open Access Journals (Sweden)

Canario Adelino VM

2011-10-01

Full Text Available Abstract Background Fish scales are an important reservoir of calcium and phosphorus and together with the skin function as an integrated barrier against environmental changes and external aggressors. Histological studies have revealed that the skin and scales regenerate rapidly in fish when they are lost or damaged. In the present manuscript the histological and molecular changes underlying skin and scale regeneration in fed and fasted sea bream (Sparus auratus were studied using a microarray 3 and 7 days after scale removal to provide a comprehensive molecular understanding of the early stages of these processes. Results Histological analysis of skin/scales revealed 3 days after scale removal re-epithelisation and formation of the scale pocket had occurred and 53 and 109 genes showed significant up or down-regulation, respectively. Genes significantly up-regulated were involved in cell cycle regulation, cell proliferation and adhesion, immune response and antioxidant activities. 7 days after scale removal a thin regenerated scale was visible and only minor changes in gene expression occurred. In animals that were fasted to deplete mineral availability the expression profiles centred on maintaining energy homeostasis. The utilisation of fasting as a treatment emphasised the competing whole animal physiological requirements with regard to barrier repair, infection control and energy homeostasis. Conclusions The identification of numerous genes involved in the mitotic checkpoint and cell proliferation indicate that the experimental procedure may be useful for understanding cell proliferation and control in vertebrates within the context of the whole animal physiology. In response to skin damage genes of immune surveillance were up-regulated along with others involved in tissue regeneration required to rapidly re-establish barrier function. Additionally, candidate fish genes were identified that may be involved in cytoskeletal re

Daily intake of Jeju groundwater improves the skin condition of the model mouse for human atopic dermatitis.

Science.gov (United States)

Tanaka, Akane; Jung, Kyungsook; Matsuda, Akira; Jang, Hyosun; Kajiwara, Naoki; Amagai, Yosuke; Oida, Kumiko; Ahn, Ginnae; Ohmori, Keitaro; Kang, Kyung-goo; Matsuda, Hiroshi

2013-03-01

Drinking water is an important nutrient for human health. The mineral ingredients included in drinking water may affect the physical condition of people. Various kinds of natural water are in circulation as bottled water in developed countries; however, its influence on clinical conditions of patients with certain diseases has not been fully evaluated. In this study, effects of the natural groundwater from Jeju Island on clinical symptoms and skin barrier function in atopic dermatitis (AD) were evaluated. NC/Tnd mice, a model for human AD, with moderate to severe dermatitis were used. Mice were given different natural groundwater or tap water for 8 weeks from 4 weeks of age. Clinical skin severity scores were recorded every week. Scratching analysis and measurement of transepidermal water loss were performed every other week. The pathological condition of the dorsal skin was evaluated histologically. Real-time polymerase chain reaction analysis was performed for cytokine expression in the affected skin. The epidermal hyperplasia and allergic inflammation were reduced in atopic mice supplied with Jeju groundwater when compared to those supplied with tap water or other kinds of natural groundwater. The increase in scratching behavior with the aggravation of clinical severity of dermatitis was favorably controlled. Moreover, transepidermal water loss that reflects skin barrier function was recovered. The early inflammation and hypersensitivity in the atopic skin was alleviated in mice supplied with Jeju groundwater, suggesting its profitable potential on the daily care of patients with skin troubles including AD. © 2013 Japanese Dermatological Association.

The skin function: a factor of anti-metabolic syndrome

Directory of Open Access Journals (Sweden)

Zhou Shi-Sheng

2012-04-01

Full Text Available Abstract The body’s total antioxidant capacity represents a sum of the antioxidant capacity of various tissues/organs. A decrease in the body’s antioxidant capacity may induce oxidative stress and subsequent metabolic syndrome, a clustering of risk factors for type 2 diabetes and cardiovascular disease. The skin, the largest organ of the body, is one of the major components of the body’s total antioxidant defense system, primarily through its xenobiotic/drug biotransformation system, reactive oxygen species-scavenging system, and sweat glands- and sebaceous glands-mediated excretion system. Notably, unlike other contributors, the skin contribution is variable, depending on lifestyles and ambient temperature or seasonal variations. Emerging evidence suggests that decreased skin’s antioxidant and excretory functions (e.g., due to sedentary lifestyles and low ambient temperature may increase the risk for metabolic syndrome. This review focuses on the relationship between the variability of skin-mediated detoxification and elimination of exogenous and endogenous toxic substances and the development of metabolic syndrome. The potential role of sebum secretion in lipid and cholesterol homeostasis and its impact on metabolic syndrome, and the association between skin disorders (acanthosis nigricans, acne, and burn and metabolic syndrome are also discussed.

Fatty acids are required for epidermal permeability barrier function.

Science.gov (United States)

Mao-Qiang, M; Elias, P M; Feingold, K R

1993-08-01

The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

Shining light on skin pigmentation: the darker and the brighter side of effects of UV radiation.

Science.gov (United States)

Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi

2012-01-01

The term barrier function as applied to human skin often connotes the physical properties of this organ that provides protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing in the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on (1) the mechanisms involved in selective effects of subcomponents of UV radiation on human skin pigmentation and (2) the interactive influences between keratinocytes and melanocytes, acting as "epidermal melanin unit," that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the nonionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.

Drug Delivery Through the Skin: Molecular Simulations of Barrier Lipids to Design more Effective Noninvasive Dermal and Transdermal Delivery Systems for Small Molecules Biologics and Cosmetics

Energy Technology Data Exchange (ETDEWEB)

J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari

2011-12-31

The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.

The role of innate lymphoid cells in healthy and inflamed skin

DEFF Research Database (Denmark)

Bonefeld, Charlotte M.; Geisler, Carsten

2016-01-01

system. During the last years, it has become clear that innate lymphoid cells play a role in homeostasis and inflammation of the skin in humans and mice. In this review, we will discuss the role of innate lymphoid cells in healthy and inflamed skin with special focus on their role in atopic dermatitis.......The skin constitutes the interface between the organism and the environment, and it protects the body from harmful substances in the environment via physical, chemical and immunological barriers. The immunological barrier of the skin comprises both cells from the innate and the adaptive immune...

Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

Science.gov (United States)

Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

2016-01-01

Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.

The skin microbiota: composition and function in health and disease

DEFF Research Database (Denmark)

Brüggemann, Holger

2016-01-01

protective function or its immunomodulatory properties. The skin microbiota of the face and upper back is dominated by species of the genera Staphylococcus and Propionibacterium. In particular, the species Propionibacterium acnes (P. acnes) predominately colonizes sebaceous areas. This species has several...... conflicting properties, some of which are mutualistic with potential beneficial effects for skin health while others are potentially harmful for the host, such as P. acnes’ pro-inflammatory activity. Analysis of the population structure of P. acnes highlighted its multiphyletic composition; together...... with comparative genomics data that revealed phylotype-specific differences, the hypothesis arose that certain lineages of P. acnes are health-beneficial while others are drivers of disease. This talk will introduce properties and host-interacting activities of P. acnes and other skin microbes. The talk...

Xanes and SR-XRF Study of Skin as a Barrier to Ultra-Fine Nanocrystals of TiO2

International Nuclear Information System (INIS)

Kwiatek, W.M.; Lekki, J.; Stachura, Z.; Hanson, A.; Ablett, J.

2007-01-01

Nanocrystalline TiO 2 is commonly used in cosmetic industry as a photoprotective agent. With recent advances in nanomaterial processing, the size of TiO 2 crystals decreased into the nanometre regime. There is no satisfactory evidence that crystals of such small size are harmless to the human population. An EU project NANODERM has been launched where several techniques have been applied to investigate the possibility of particle penetration through the protective horny layer into vital skin regions. Skin biopsies of the animal and human skin have been collected after exposition to formulations containing TiO 2 nanocrystals. The Ti depth distributions were measured by electron and ion microscopy. The microscopy studies did not detect penetration into vital tissue of healthy skin what does not exclude a possibility that TiO 2 could penetrate pathological skin with lowered barrier efficiency. Due to literature the physical effect of the UV irradiation of the TiO 2 nanoparticle is the shift from 4 th to 3 rd oxidation state of the Ti. Titanium at 3 rd oxidation state interact with environment producing free radicals and Reactive Oxygen Species. In order to quantify the oxidation state shift, XANES experiments were carried out with commercially available TiO 2 nanocrystals (6 - 100 nm size), both in anatase and rutile phase. The samples were irradiated with X-rays with, and without accompanying UV illumination at the NSLS X27A beam line. The corresponding XANES spectra were registered and the absorption edge was compared in UV - illuminated and not illuminated spectra. A shift of about 1 eV in the absorption edge position of the rutile sample exposed to UVA light (365 nm, 20 mW/cm 2 ) has been measured and attributed to the changed electron configuration. However, the direction of the shift detected in measured samples was opposite to the expected. (author)

Fire barrier problems-part 3

International Nuclear Information System (INIS)

Verna, B.J.

1993-01-01

This article deals with problems associated with a thermal barrier material called Thermo-Lag 330. Typically in nuclear applications this material is used to provide either 1 hour (1/2 inch thick) or 3 hour (1 inch thick) barriers to prevent the spread of fires between redundant safety systems, and to protect cable trays and conduit. The article reviews concerns within the nuclear industry as to the proper handling of the material, how to interpret the data available on the material, the apparant conflicting assessments of the material when tested by different groups, etc. Research is ongoing on the suitability of the material, but the article points out that the manufacturer feels it should be installed by properly trained installers, the joints sealed with a grouting material, properly bundled to maintain its integrity, have a complete stress skin, and not be walked on after installation in order to function properly

A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin

Directory of Open Access Journals (Sweden)

Nisma Mujahid

2017-06-01

Full Text Available The presence of dark melanin (eumelanin within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in “redhaired” Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk.

A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin.

Science.gov (United States)

Mujahid, Nisma; Liang, Yanke; Murakami, Ryo; Choi, Hwan Geun; Dobry, Allison S; Wang, Jinhua; Suita, Yusuke; Weng, Qing Yu; Allouche, Jennifer; Kemeny, Lajos V; Hermann, Andrea L; Roider, Elisabeth M; Gray, Nathanael S; Fisher, David E

2017-06-13

The presence of dark melanin (eumelanin) within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in "redhaired" Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK) has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Barrier functions for Pucci-Heisenberg operators and applications

OpenAIRE

Cutri , Alessandra; Tchou , Nicoletta

2007-01-01

International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...

Elevated vacuum suspension preserves residual-limb skin health in people with lower-limb amputation: Randomized clinical trial.

Science.gov (United States)

Rink, Cameron; Wernke, Matthew M; Powell, Heather M; Gynawali, Surya; Schroeder, Ryan M; Kim, Jayne Y; Denune, Jeffrey A; Gordillo, Gayle M; Colvin, James M; Sen, Chandan K

2016-01-01

A growing number of clinical trials and case reports support qualitative claims that use of an elevated vacuum suspension (EVS) prosthesis improves residual-limb health on the basis of self-reported questionnaires, clinical outcomes scales, and wound closure studies. Here, we report first efforts to quantitatively assess residual-limb circulation in response to EVS. Residual-limb skin health and perfusion of people with lower-limb amputation (N = 10) were assessed during a randomized crossover study comparing EVS with nonelevated vacuum suspension (control) over a 32 wk period using noninvasive probes (transepidermal water loss, laser speckle imaging, transcutaneous oxygen measurement) and functional hyperspectral imaging approaches. Regardless of the suspension system, prosthesis donning decreased perfusion in the residual limb under resting conditions. After 16 wk of use, EVS improved residual-limb oxygenation during treadmill walking. Likewise, prosthesis-induced reactive hyperemia was attenuated with EVS following 16 wk of use. Skin barrier function was preserved with EVS but disrupted after control socket use. Taken together, outcomes suggest chronic EVS use improves perfusion and preserves skin barrier function in people with lower-limb amputation. ClinicalTrials.gov; "Evaluation of limb health associated with a prosthetic vacuum socket system": NCT01839123; https://clinicaltrials.gov/ct2/show/NCT01839123?term=NCT01839123&rank=1.

Tumor Suppressor Function of CYLD in Non melanoma Skin Cancer

International Nuclear Information System (INIS)

Masoumi, K. C.; Hallgren, G. S.; Massoumi, R.

2011-01-01

Ubiquitin and ubiquitin-related proteins post translationally modify substrates, and thereby alter the functions of their targets. The ubiquitination process is involved in various physiological responses, and dysregulation of components of the ubiquitin system has been linked to many diseases including skin cancer. The ubiquitin pathways activated among skin cancers are highly diverse and may reflect the various characteristics of the cancer type. Basal cell carcinoma and squamous cell carcinoma, the most common types of human skin cancer, are instances where the involvement of the deubiquitination enzyme CYLD has been recently highlighted. In basal cell carcinoma, the tumor suppressor protein CYLD is repressed at the transcriptional levels through hedgehog signaling pathway. Downregulation of CYLD in basal cell carcinoma was also shown to interfere with TrkC expression and signaling, thereby promoting cancer progression. By contrast, the level of CYLD is unchanged in squamous cell carcinoma, instead, catalytic inactivation of CYLD in the skin has been linked to the development of squamous cell carcinoma. This paper will focus on the current knowledge that links CYLD to non melanoma skin cancers and will explore recent insights regarding CYLD regulation of NF-κB and hedgehog signaling during the development and progression of these types of human tumors.

Lactobacillus frumenti Facilitates Intestinal Epithelial Barrier Function Maintenance in Early-Weaned Piglets

Science.gov (United States)

Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua

2018-01-01

Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance

Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

Science.gov (United States)

Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

2018-01-01

The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Confocal laser scanning microscopy to estimate nanoparticles' human skin penetration in vitro.

Science.gov (United States)

Zou, Ying; Celli, Anna; Zhu, Hanjiang; Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard

2017-01-01

With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human "viable" epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested.

Structure and Function of Skin: The Application of THz Radiation in Dermatology

Science.gov (United States)

Jo, Seong Jin; Kwon, Oh Sang

Skin, the largest organ of human being, is a soft membrane covering the exterior of the body. It protects the host from mechanical injuries, toxic materials, pathogenic organisms, and so on. Although its basic function is protection from the environment like this, it is not a simple and static shield but a complex and dynamic organ which performs important roles in maintaining the homeostasis of the body. Skin controls evaporation to prevent massive water loss, and regulates body temperature by controlling the blood flow of skin and perspiration [1]. It is responsible for the synthesis of vitamin D and a storage center for lipid and water. In addition, skin contains nerve endings and provides sensation for temperature, touch, pressure, and vibration.

Hydrogen sulfide metabolism regulates endothelial solute barrier function

Directory of Open Access Journals (Sweden)

Shuai Yuan

2016-10-01

Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

Cutaneous penetration of soft nanoparticles via photodamaged skin: Lipid-based and polymer-based nanocarriers for drug delivery.

Science.gov (United States)

Hung, Chi-Feng; Chen, Wei-Yu; Hsu, Ching-Yun; Aljuffali, Ibrahim A; Shih, Hui-Chi; Fang, Jia-You

2015-08-01

Photoaging is recognized as the factor damaging skin-barrier function. The aim of this study was to examine the impact of ultraviolet (UV) irradiation on the cutaneous penetration of soft nanoparticles, including nanostructured lipid carriers (NLCs) and poly(lactic-co-glycolic acid) polymer nanoparticles (PNs). In vitro cutaneous permeation of retinoic acid (RA) carried by nanoparticles was evaluated. In vivo nude mouse skin distribution of topically applied nanoparticles was observed by fluorescence and confocal microscopies. The association of nanoparticles with cultured keratinocytes was measured by flow cytometry and fluorescence microscopy. The average diameter and surface charge were 236nm and -32mV for NLCs, and 207nm and -12mV for PNs. The ultrastructural images of skin demonstrated that the application of UV produced a loss of Odland bodies and desmosomes, the organelles regulating skin-barrier function. UVA exposure increased skin deposition of RA regardless of nanoparticle formulation. UVB did not alter RA deposition from nanoparticles as compared to the non-treated group. Exposure to UVA promoted RA delivery into hair follicles from NLCs and PNs by 4.2- and 4.9-fold, respectively. The in vivo skin distribution also showed a large accumulation of Nile red-loaded nanoparticles in follicles after UVA treatment. The soft nanoparticles were observed deep in the dermis. PNs with higher lipophilicity showed a greater association with keratinocytes compared to NLCs. The cell association of PNs was increased by UVA application, whereas the association between NLCs and keratinocytes was reduced two times by UVA. It was concluded that both follicles and intercellular spaces were the main pathways for nanoparticle diffusion into photodamaged skin. Copyright © 2015 Elsevier B.V. All rights reserved.

Experimental skin carcinoma by UVB application

Directory of Open Access Journals (Sweden)

Andrada Iftode

2016-12-01

Full Text Available OBJECTIVES AND BACKGROUND The aim of this research study was to evaluate the harmful effects at skin level induced by concomitant and repeated exposure to three toxic agents: UVB radiation, DMBA and TPA. MATERIALS AND METHODS Experimental mice were divided in thw following groups (n=5 mice/group: group 1 – healthy mice, group 2 – mice exposed to UVB – radiation and topical administration of acetone and group 3 – mice exposed to UVB – radiation and topical application of DMBA and TPA solutions (phase I - double tumor initiation and phase II - tumor promotion. RESULTS Application of these compounds led to the development of skin papilloma and to significant changes in skin parameters. CONCLUSIONS The barrier function of the skin was degraded in UVB exposed mice. DMBA and TPA depended on carcinogens schedule and corelated with skin carcinoma. Graphical abstract: Schematic protocol of experimental skin carcinoma REFERENCES 1. Lee Ja, Ko Jh, Jung Bg, Kim Th, Hong Ji, Park Ys, Lee Bj. Fermented Prunus mume with Probiotics Inhibits 7,12- Dimethylbenz[a]anthracene and 12-OTetradecanoyl phorbol-13-acetate Induced Skin Carcinogenesis through Alleviation of Oxidative Stress. Asian Pac J Cancer Prev. 2013;14:2973-2978. 2. Firooz A, Sadr B, Babakoohi S, Sarraf-Yazdy M, Fanian F, Kazerouni-Timsar A, NassiriKashani M, Naghizadeh MM, Dowlati Y. Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region. Scientific World Journal. 2012; doi.org/10.1100/2012/386936 3. Gheorgheosu (Coricovac D, Borcan F, Balasz NI, Soica C, Simu G, Kemeny L, Dehelean CA. Evaluation of skin parameters in C57BL/6J mice exposed to chemical and environmental factors using non-invasive methods. J Agroalim Proc Technol. 2014;20:14-20.

Age-related changes in expression and function of Toll-like receptors in human skin

Science.gov (United States)

Iram, Nousheen; Mildner, Michael; Prior, Marion; Petzelbauer, Peter; Fiala, Christian; Hacker, Stefan; Schöppl, Alice; Tschachler, Erwin; Elbe-Bürger, Adelheid

2012-01-01

Toll-like receptors (TLRs) initiate innate immune responses and direct subsequent adaptive immunity. They play a major role in cutaneous host defense against micro-organisms and in the pathophysiology of several inflammatory skin diseases. To understand the role of TLRs in the acquisition of immunological competence, we conducted a comprehensive study to evaluate TLR expression and function in the developing human skin before and after birth and compared it with adults. We found that prenatal skin already expresses the same spectrum of TLRs as adult skin. Strikingly, many TLRs were significantly higher expressed in prenatal (TLRs 1-5) and infant and child (TLRs 1 and 3) skin than in adult skin. Surprisingly, neither dendritic cell precursors in prenatal skin nor epidermal Langerhans cells and dermal dendritic cells in adult skin expressed TLRs 3 and 6, whereas the staining pattern and intensity of both TLRs in fetal basal keratinocytes was almost comparable to those of adults. Stimulation of primary human keratinocytes from fetal, neonatal and adult donors with selected TLR agonists revealed that the synthetic TLR3 ligand poly (I:C) specifically, mimicking viral double-stranded RNA, induced a significantly enhanced secretion of CXCL8/IL8, CXCL10/IP-10 and TNFα in fetal and neonatal keratinocytes compared with adult keratinocytes. This study demonstrates quantitative age-specific modifications in TLR expression and innate skin immune reactivity in response to TLR activation. Thus, antiviral innate immunity already in prenatal skin may contribute to protect the developing human body from viral infections in utero in a scenario where the adaptive immune system is not yet fully functional. PMID:23034637

Safety barriers and safety functions a comparison of different applications

International Nuclear Information System (INIS)

Harms-Ringdahl, L.

1998-01-01

A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)

Circadian rhythms on skin function of hairless rats: light and thermic influences.

Science.gov (United States)

Flo, Ana; Díez-Noguera, Antoni; Calpena, Ana C; Cambras, Trinitat

2014-03-01

Circadian rhythms are present in most functions of living beings. We have demonstrated the presence of circadian rhythms in skin variables (transepidermal water loss, TEWL; stratum corneum hydration, SCH; and skin temperature) in hairless rats under different environmental conditions of light and temperature. Circadian rhythms in TEWL and SCH showed mean amplitudes of about 20% and 14% around the mean, respectively, and appeared under light-dark cycles as well as under constant darkness. Environmental temperature was able to override TEWL, but not SCH rhythm, evidencing the dependency of TEWL on the temperature. Mean daily values of TEWL and SCH, and also the amplitude of TEWL rhythm, increased with the age of the animal. Under constant light, situation that induces arrhythmicity in rats, SCH and TEWL were inversely correlated. The results suggest the importance to take into account the functional skin rhythms in research in dermatological sciences. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Assessing the Impact of Mechanical Damage on Full-Thickness Porcine and Human Skin Using an In Vitro Approach

Directory of Open Access Journals (Sweden)

Hinda Dabboue

2015-01-01

Full Text Available For most xenobiotics, the rates of percutaneous absorption are limited by diffusion through the horny layer of skin. However, percutaneous absorption of chemicals may seriously increase when the skin is damaged. The aim of this work was to develop an in vitro representative model of mechanically damaged skins. The epidermal barrier was examined following exposure to a razor, a rotating brush, and a microneedle system in comparison to tape-stripping which acted as a reference. Excised full-thickness skins were mounted on a diffusion chamber in order to evaluate the effect of injuries and to mimic physiological conditions. The transepidermal water loss (TEWL was greatly increased when the barrier function was compromised. Measurements were made for all the damaged biopsies and observed histologically by microscopy. On human and porcine skins, the tape-stripping application (0 to 40 times showed a proportional increase in TEWL which highlights the destruction of the stratum corneum. Similar results were obtained for all cosmetic instruments. This is reflected in our study by the nonsignificant difference of the mean TEWL scores between 30 strips and mechanical damage. For a specific appreciation, damaged skins were then selected to qualitatively evaluate the absorption of a chlorogenic acid solution using fluorescence microscopy.

Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

Science.gov (United States)

Crawford, Melissa; Dagnino, Lina

2017-10-02

The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

Human age and skin physiology shape diversity and abundance of Archaea on skin.

Science.gov (United States)

Moissl-Eichinger, Christine; Probst, Alexander J; Birarda, Giovanni; Auerbach, Anna; Koskinen, Kaisa; Wolf, Peter; Holman, Hoi-Ying N

2017-06-22

The human skin microbiome acts as an important barrier protecting our body from pathogens and other environmental influences. Recent investigations have provided evidence that Archaea are a constant but highly variable component of the human skin microbiome, yet factors that determine their abundance changes are unknown. Here, we tested the hypothesis that the abundance of archaea on human skin is influenced by human age and skin physiology by quantitative PCR of 51 different skin samples taken from human subjects of various age. Our results reveal that archaea are more abundant in human subjects either older than 60 years or younger than 12 years as compared to middle-aged human subjects. These results, together with results obtained from spectroscopy analysis, allowed us gain first insights into a potential link of lower sebum levels and lipid content and thus reduced skin moisture with an increase in archaeal signatures. Amplicon sequencing of selected samples revealed the prevalence of specific eury- and mainly thaumarchaeal taxa, represented by a core archaeome of the human skin.

A first vascularized skin equivalent as an alternative to animal experimentation.

Science.gov (United States)

Groeber, Florian; Engelhardt, Lisa; Lange, Julia; Kurdyn, Szymon; Schmid, Freia F; Rücker, Christoph; Mielke, Stephan; Walles, Heike; Hansmann, Jan

2016-01-01

Tissue-engineered skin equivalents mimic key aspects of the human skin, and can thus be employed as wound coverage for large skin defects or as in vitro test systems as an alternative to animal models. However, current skin equivalents lack a functional vasculature limiting clinical and research applications. This study demonstrates the generation of a vascularized skin equivalent with a perfused vascular network by combining a biological vascularized scaffold (BioVaSc) based on a decellularized segment of a porcine jejunum and a tailored bioreactor system. Briefly, the BioVaSc was seeded with human fibroblasts, keratinocytes, and human microvascular endothelial cells. After 14 days at the air-liquid interface, hematoxylin & eosin and immunohistological staining revealed a specific histological architecture representative of the human dermis and epidermis including a papillary-like architecture at the dermal-epidermal-junction. The formation of the skin barrier was measured non-destructively using impedance spectroscopy. Additionally, endothelial cells lined the walls of the formed vessels that could be perfused with a physiological volume flow. Due to the presence of a complex in-vivo-like vasculature, the here shown skin equivalent has the potential for skin grafting and represents a sophisticated in vitro model for dermatological research.

Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

Science.gov (United States)

Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

2015-01-01

Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

Directory of Open Access Journals (Sweden)

Hee Soon Shin

2015-01-01

Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

Tests of potential functional barriers for laminated multilayer food packages. Part I: Low molecular weight permeants.

Science.gov (United States)

Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R

2000-08-01

The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.

3D bioprinting of functional human skin: production and in vivo analysis.

Science.gov (United States)

Cubo, Nieves; Garcia, Marta; Del Cañizo, Juan F; Velasco, Diego; Jorcano, Jose L

2016-12-05

Significant progress has been made over the past 25 years in the development of in vitro-engineered substitutes that mimic human skin, either to be used as grafts for the replacement of lost skin, or for the establishment of in vitro human skin models. In this sense, laboratory-grown skin substitutes containing dermal and epidermal components offer a promising approach to skin engineering. In particular, a human plasma-based bilayered skin generated by our group, has been applied successfully to treat burns as well as traumatic and surgical wounds in a large number of patients in Spain. There are some aspects requiring improvements in the production process of this skin; for example, the relatively long time (three weeks) needed to produce the surface required to cover an extensive burn or a large wound, and the necessity to automatize and standardize a process currently performed manually. 3D bioprinting has emerged as a flexible tool in regenerative medicine and it provides a platform to address these challenges. In the present study, we have used this technique to print a human bilayered skin using bioinks containing human plasma as well as primary human fibroblasts and keratinocytes that were obtained from skin biopsies. We were able to generate 100 cm 2 , a standard P100 tissue culture plate, of printed skin in less than 35 min (including the 30 min required for fibrin gelation). We have analysed the structure and function of the printed skin using histological and immunohistochemical methods, both in 3D in vitro cultures and after long-term transplantation to immunodeficient mice. In both cases, the generated skin was very similar to human skin and, furthermore, it was indistinguishable from bilayered dermo-epidermal equivalents, handmade in our laboratories. These results demonstrate that 3D bioprinting is a suitable technology to generate bioengineered skin for therapeutical and industrial applications in an automatized manner.

Application of Protease Technology in Dermatology: Rationale for Incorporation into Skin Care with Initial Observations on Formulations Designed for Skin Cleansing, Maintenance of Hydration, and Restoration of the Epidermal Permeability Barrier

OpenAIRE

Del Rosso, James Q.

2013-01-01

This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also ...

Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro

Science.gov (United States)

Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard

2017-01-01

Objective With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Methods Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. Results NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Conclusion Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. PMID:29184403

Barrier and system performances within a safety case: their functioning and evolution with time

International Nuclear Information System (INIS)

Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.

2002-01-01

The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

Effects of in Utero Exposure of C57BL/6J Mice to 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Epidermal Permeability Barrier Development and Function

Science.gov (United States)

Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.

2014-01-01

Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982

Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

Directory of Open Access Journals (Sweden)

David eBueno

2014-10-01

Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

Energy Technology Data Exchange (ETDEWEB)

Graham, Peter H., E-mail: peter.graham@sesiahs.health.nsw.gov.au [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Plant, Natalie; Graham, Jennifer L.; Browne, Lois [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Borg, Martin [Department of Radiation Oncology, Royal Adelaide Hospital (Australia); Capp, Anne [Department of Radiation Oncology, Mater Hospital, Newcastle, New South Wales (Australia); Delaney, Geoff P. [Cancer Care Centre, Liverpool Hospital, Liverpool, New South Wales (Australia); Harvey, Jennifer [Mater Hospital, South Brisbane, Queensland (Australia); Kenny, Lisbeth [Royal Brisbane Hospital, Herston, Queensland (Australia); Francis, Michael [Andrew Love Cancer Centre, Geelong (Australia); Zissiadis, Yvonne [Department of Radiation Oncology, Royal Perth Hospital, Perth (Australia)

2013-05-01

Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.

A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

International Nuclear Information System (INIS)

Graham, Peter H.; Plant, Natalie; Graham, Jennifer L.; Browne, Lois; Borg, Martin; Capp, Anne; Delaney, Geoff P.; Harvey, Jennifer; Kenny, Lisbeth; Francis, Michael; Zissiadis, Yvonne

2013-01-01

Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies

Ethyl cellulose nanocarriers and nanocrystals differentially deliver dexamethasone into intact, tape-stripped or sodium lauryl sulfate-exposed ex vivo human skin - assessment by intradermal microdialysis and extraction from the different skin layers.

Science.gov (United States)

Döge, Nadine; Hönzke, Stefan; Schumacher, Fabian; Balzus, Benjamin; Colombo, Miriam; Hadam, Sabrina; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Schäfer-Korting, Monika; Schindler, Anke; Rühl, Eckart; Skov, Per Stahl; Church, Martin K; Hedtrich, Sarah; Kleuser, Burkhard; Bodmeier, Roland; Vogt, Annika

2016-11-28

Understanding penetration not only in intact, but also in lesional skin with impaired skin barrier function is important, in order to explore the surplus value of nanoparticle-based drug delivery for anti-inflammatory dermatotherapy. Herein, short-term ex vivo cultures of (i) intact human skin, (ii) skin pretreated with tape-strippings and (iii) skin pre-exposed to sodium lauryl sulfate (SLS) were used to assess the penetration of dexamethasone (Dex). Intradermal microdialysis was utilized for up to 24h after drug application as commercial cream, nanocrystals or ethyl cellulose nanocarriers applied at the therapeutic concentration of 0.05%, respectively. In addition, Dex was assessed in culture media and extracts from stratum corneum, epidermis and dermis after 24h, and the results were compared to those in heat-separated split skin from studies in Franz diffusion cells. Providing fast drug release, nanocrystals significantly accelerated the penetration of Dex. In contrast to the application of cream and ethyl cellulose nanocarriers, Dex was already detectable in eluates after 6h when applying nanocrystals on intact skin. Disruption of the skin barrier further accelerated and enhanced the penetration. Encapsulation in ethyl cellulose nanocarriers delayed Dex penetration. Interestingly, for all formulations highly increased concentrations in the dialysate were observed in tape-stripped skin, whereas the extent of enhancement was less in SLS-exposed skin. The results were confirmed in tissue extracts and were in line with the predictions made by in vitro release studies and ex vivo Franz diffusion cell experiments. The use of 45kDa probes further enabled the collection of inflammatory cytokines. However, the estimation of glucocorticoid efficacy by Interleukin (IL)-6 and IL-8 analysis was limited due to the trauma induced by the probe insertion. Ex vivo intradermal microdialysis combined with culture media analysis provides an effective, skin-sparing method for

Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

Science.gov (United States)

Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

2012-04-01

For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

Application of protease technology in dermatology: rationale for incorporation into skin care with initial observations on formulations designed for skin cleansing, maintenance of hydration, and restoration of the epidermal permeability barrier.

Science.gov (United States)

Del Rosso, James Q

2013-06-01

This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article.

Modulatory effects of the fruits of Tribulus terrestris L. on the function of atopic dermatitis-related calcium channels, Orai1 and TRPV3

Directory of Open Access Journals (Sweden)

Joo Hyun Nam

2016-07-01

Conclusions: Our results suggest that T. terrestris extract may have a therapeutic potential for recovery of abnormal skin barrier pathologies in atopic dermatitis through modulating the activities of calcium ion channels, Orai1 and TRPV3. This is the first study to report the modulatory effect of a medicinal plant on the function of ion channels in skin barrier.

Biophysical evaluation of fractional laser skin resurfacing with an Er:YSGG laser device in Japanese skin.

Science.gov (United States)

Kimura, Utako; Kinoshita, Ayako; Osawa, Aki; Negi, Osamu; Haruna, Kunitaka; Mizuno, Yuki; Suga, Yasushi

2012-05-01

Ablative fractional laser skin resurfacing (FLSR) has recently been used for the amelioration of acne scars, and previous studies have shown clinical effectiveness. Despite its extensive use, few studies have focused on the associated changes in biophysical properties of the epidermis. Herein, we evaluate transepidermal water loss, sebum levels, skin hydration, and skin elasticity, following FLSR treatments with an Er:YSGG laser device (Pearl FractionalTM, Cutera Inc., Brisbane, CA), employing non-invasive measurements. Five Japanese patients with facial acne scars underwent one FLSR session. Some acne scars appeared to become less obvious as a consequence of the treatment. All patients were aware of a feeling of skin tightness in treated areas. Objective measurements on the lower lateral angle of the eye and on the inner cheeks were evaluated at baseline and at 3 days, 1 week, and 4 weeks after FLSR. Transepidermal water loss showed a significant two-fold (100%) increase at day 3, but had returned to almost the baseline level at week 4 in both areas. Sebum secretion showed a 50% increase at day 3, but had returned to the baseline level after day 7. Skin hydration showed a significant decrease at day 3, but had returned to the baseline level by day 7, and showed significant improvement at the end of the study. Skin elasticity (R2) was still at baseline on day 3, but showed some improvement--an increase of at least 30%--at the end of the study. Based on our findings, we believe that FLSR should be performed no more than once a month to allow sufficient time for the damaged skin to recover its barrier function in most areas of the face.

Market trends in baby skin care products and implications for clinical practice.

Science.gov (United States)

Gao, Xiang; Simpson, Eric L

2014-01-01

Although the U.S. pediatric skin care market is a $1.7 billion industry, little is known regarding the usage pattern of skin care products in very young children. We have begun to recognize that common over-the-counter skin care products may have positive or negative effects on skin barrier function. Thus, knowing what and how skin care products are used early in life is important. The goal of the current study was to better understand skin care product use in the United States using market research data. We found that the prevalence of use was greater than 50% for all skin care product categories and age groups. Premoistened cleansing wipes and cloths were the most frequently used product, followed by baby oil and lotion and body and baby powder. Baby bath and shampoo products were used at least five times per week per household, and caregivers generally preferred products that were fragrance-free and made for sensitive skin. Lower-income households reported a higher frequency of product use and were less likely to purchase fragrance-free products or ones that were made for sensitive skin. Our findings suggest that the prevalence of pediatric skin care product use is high and conflicts with current recommended skin care guidelines. Product use and preferences may also vary according to race and ethnicity and household income level. © 2014 Wiley Periodicals, Inc.

Immune responses at brain barriers and implications for brain development and neurological function in later life

Directory of Open Access Journals (Sweden)

Helen B. Stolp

2013-08-01

Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

The biological mechanisms and behavioral functions of opsin-based light detection by the skin

Directory of Open Access Journals (Sweden)

Jennifer L Kelley

2016-08-01

Full Text Available Light detection not only forms the basis of vision (via visual retinal photoreceptors, but can also occur in other parts of the body, including many non-rod/non-cone ocular cells, the pineal complex, the deep brain, and the skin. Indeed, many of the photopigments (an opsin linked to a light-sensitive 11-cis retinal chromophore that mediate color vision in the eyes of vertebrates are also present in the skin of animals such as reptiles, amphibians, crustaceans and fishes (with related photoreceptive molecules present in cephalopods, providing a localized mechanism for light detection across the surface of the body. This form of non-visual photosensitivity may be particularly important for animals that can change their coloration by altering the dispersion of pigments within the chromatophores (pigment containing cells of the skin. Thus, skin coloration may be directly color matched or tuned to both the luminance and spectral properties of the local background environment, thereby facilitating behavioral functions such as camouflage, thermoregulation, and social signaling. This review examines the diversity and sensitivity of opsin-based photopigments present in the skin and considers their putative functional roles in mediating animal behavior. Furthermore, it discusses the potential underlying biochemical and molecular pathways that link shifts in environmental light to both photopigment expression and chromatophore photoresponses. Although photoreception that occurs independently of image formation remains poorly understood, this review highlights the important role of non-visual light detection in facilitating the multiple functions of animal coloration.

Sodium lauryl sulfate enhances nickel penetration through guinea-pig skin. Studies with energy dispersive X-ray microanalysis

International Nuclear Information System (INIS)

Lindberg, M.; Sagstroem, S.R.; Roomans, G.M.; Forslind, B.

1989-01-01

The effect of sodium lauryl sulphate (SLS), a common ingredient of detergents, on the penetration of nickel through the stratum corneum in the guinea-pig skin model was studied with energy dispersive X-ray microanalysis (EDX) to evaluate the barrier-damaging properties of this common detergent. The EDX technique allows a simultaneous determination of physiologically important elements, e.g., Na, Mg, P, Cl, K, Ca and S in addition to Ni at each point of measurement in epidermal cell strata. Our results show that SLS reduces the barrier function to Ni-ion penetration of the stratum corneum. In addition we have shown that EDX allows analysis of the influence of different factors involved in nickel penetration through the skin by giving data on the physiological effects on the epidermal cells caused by the applied substances

Aloe sterol supplementation improves skin elasticity in Japanese men with sunlight-exposed skin: a 12-week double-blind, randomized controlled trial

Directory of Open Access Journals (Sweden)

Tanaka M

2016-11-01

Full Text Available Miyuki Tanaka,1 Yuki Yamamoto,2 Eriko Misawa,1 Kazumi Nabeshima,1 Marie Saito,1 Koji Yamauchi,1 Fumiaki Abe,1 Fukumi Furukawa2 1Functional Food Ingredients Department, Food Ingredients & Technology Institute, Morinaga Milk Industry Co., Ltd., Zama, Kanagawa, 2Department of Dermatology, Wakayama Medical University, Kimiidera, Wakayama, Japan Background/objective: Recently, it was confirmed that the daily oral intake of plant sterols of Aloe vera gel (Aloe sterol significantly increases the skin barrier function, moisture, and elasticity in photoprotected skin. This study aimed to investigate whether Aloe sterol intake affected skin conditions following sunlight exposure in Japanese men. Methods: We performed a 12-week, randomized, double-blind, placebo-controlled study to evaluate the effects of oral Aloe sterol supplementation on skin conditions in 48 apparently healthy men (age range: 30–59 years; average: 45 years. The subjects were instructed to expose the measurement position of the arms to the sunlight outdoors every day for 12 weeks. The skin parameters were measured at 0 (baseline, 4, 8, and 12 weeks. Results: Depending on the time for the revelation of the sunlight, the b* value and melanin index increased and the skin moisture decreased. After taking an Aloe sterol tablet daily for 12 weeks, the skin elasticity index (R2, R5, and R7 levels were significantly higher than the baseline value. There were no differences between the groups in these skin elasticity values. In the subgroup analysis of subjects aged <46 years, the change in the R5 and R7 was significantly higher in the Aloe group than in the placebo group at 8 weeks (P=0.0412 and P=0.0410, respectively. There was a difference in the quantity of sun exposure between each subject, and an additional clinical study that standardizes the amount of ultraviolet rays is warranted. No Aloe sterol intake-dependent harmful phenomenon was observed during the intake period

Evaluation of the correlation between Scoring Feline Allergic Dermatitis and Feline Extent and Severity Index and skin hydration in atopic cats.

Science.gov (United States)

Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Łukasz R; Zając, Marcin; Gołyński, Marcin; Sitkowski, Wiesław; Taszkun, Iwona

2018-02-01

Evaluation of the severity of clinical signs of cats with allergic skin diseases has used two scoring systems: Scoring Feline Allergic Dermatitis (SCORFAD) and the Feline Extent and Severity Index (FeDESI). The integrity of the cutaneous barrier can also be evaluated by measuring skin hydration. A correlation between the clinical score and skin hydration has been observed in humans and dogs with atopic dermatitis (AD). To demonstrate a correlation between the clinical score and skin hydration of cats affected with presumed AD. European short hair cats (n = 18): 11 females and seven males with a confirmed diagnosis of AD. SCORFAD and FeDESI scores were calculated and the measurements of skin hydration were assessed from seven body sites using corneometry. The correlation between the SCORFAD and FeDESI systems and skin hydration of each site, and the average skin hydration was calculated. There was a positive correlation between the SCORFAD score and skin hydration for the axilla, thorax and forelimb; for FeDESI and axilla and lumbar sites. There was a negative correlation between the FeDESI and skin hydration for the pinna (r = -0.47). Measurements of skin hydration could be a useful tool for the evaluation of allergic cats. There is limited evidence of any useful correlation between clinical scoring systems and measurements of hydration. The pinna may be a suitable region for the assessment of skin barrier function in normal and allergic cats. © 2017 ESVD and ACVD.

Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

Science.gov (United States)

Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

2016-08-01

OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Epidermal transglutaminase (TGase 3 is required for proper hair development, but not the formation of the epidermal barrier.

Directory of Open Access Journals (Sweden)

Susan John

Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.

Skin Redox Balance Maintenance: The Need for an Nrf2-Activator Delivery System

Directory of Open Access Journals (Sweden)

Maya Ben-Yehuda Greenwald

2016-01-01

Full Text Available The skin, being the largest organ of the body, functions as a barrier between our body and the environment. It is consistently exposed to various exogenous and endogenous stressors (e.g., air pollutants, ionizing and non-ionizing irradiation, toxins, mitochondrial metabolism, enzyme activity, inflammatory process, etc. producing reactive oxygen species (ROS and physical damage (e.g., wounds, sunburns also resulting in reactive oxygen species production. Although skin is equipped with an array of defense mechanisms to counteract reactive oxygen species, augmented exposure and continued reactive oxygen species might result in excessive oxidative stress leading to many skin disorders including inflammatory diseases, pigmenting disorders and some types of cutaneous malignancy. The nuclear factor erythroid 2-related factor 2 (Nrf2 is an emerging regulator of cellular resistance and of defensive enzymes such as the phase II enzymes. Induction of the Keap1–Nrf2 pathway may have a beneficial effect in the treatment of a large number of skin disorders by stimulating an endogenous defense mechanism. However, prolonged and enhanced activation of this pathway is detrimental and, thus, limits the therapeutic potential of Keap1–Nrf2 modulators. Here, we review the consequences of oxidative stress to the skin, and the defense mechanisms that skin is equipped with. We describe the challenges of maintaining skin redox balance and its impact on skin status and function. Finally, we suggest a novel strategy for maintenance of skin redox homeostasis by modulating the Keap1–Nrf2 pathway using nanotechnology-based delivery systems.

[Advances in the research of function of Merkel cells in tactile formation of skin].

Science.gov (United States)

You, X; Wei, Z R

2018-01-20

Skin is the largest sense organ of human, with many mechanoreceptor cells under epidermis or dermis of skin and Merkel cell is one of them. It has been confirmed that Merkel cells play an important role in the process of mechanical transmission of mammalian soft tactile stimulation. Researches showed that Merkel cells had close relation to tactile formation and functioned by Merkel cell-neurite complexes and ion channels Piezo2. This article reviews Merkel cells and the function, problem and prospect of Merkel cells in tactile formation.

3D cell printing of in vitro stabilized skin model and in vivo pre-vascularized skin patch using tissue-specific extracellular matrix bioink: A step towards advanced skin tissue engineering.

Science.gov (United States)

Kim, Byoung Soo; Kwon, Yang Woo; Kong, Jeong-Sik; Park, Gyu Tae; Gao, Ge; Han, Wonil; Kim, Moon-Bum; Lee, Hyungseok; Kim, Jae Ho; Cho, Dong-Woo

2018-06-01

3D cell-printing technique has been under spotlight as an appealing biofabrication platform due to its ability to precisely pattern living cells in pre-defined spatial locations. In skin tissue engineering, a major remaining challenge is to seek for a suitable source of bioink capable of supporting and stimulating printed cells for tissue development. However, current bioinks for skin printing rely on homogeneous biomaterials, which has several shortcomings such as insufficient mechanical properties and recapitulation of microenvironment. In this study, we investigated the capability of skin-derived extracellular matrix (S-dECM) bioink for 3D cell printing-based skin tissue engineering. S-dECM was for the first time formulated as a printable material and retained the major ECM compositions of skin as well as favorable growth factors and cytokines. This bioink was used to print a full thickness 3D human skin model. The matured 3D cell-printed skin tissue using S-dECM bioink was stabilized with minimal shrinkage, whereas the collagen-based skin tissue was significantly contracted during in vitro tissue culture. This physical stabilization and the tissue-specific microenvironment from our bioink improved epidermal organization, dermal ECM secretion, and barrier function. We further used this bioink to print 3D pre-vascularized skin patch able to promote in vivo wound healing. In vivo results revealed that endothelial progenitor cells (EPCs)-laden 3D-printed skin patch together with adipose-derived stem cells (ASCs) accelerates wound closure, re-epithelization, and neovascularization as well as blood flow. We envision that the results of this paper can provide an insightful step towards the next generation source for bioink manufacturing. Copyright © 2018 Elsevier Ltd. All rights reserved.

Skin innate immune system

Directory of Open Access Journals (Sweden)

Berna Aksoy

2013-06-01

Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

Randomized Clinical Trial of the Innovative Bilayered Wound Dressing Made of Silk and Gelatin: Safety and Efficacy Tests Using a Split-Thickness Skin Graft Model

Science.gov (United States)

Hasatsri, Sukhontha; Angspatt, Apichai

2015-01-01

We developed the novel silk fibroin-based bilayered wound dressing for the treatment of partial thickness wounds. And it showed relevant characteristics and accelerated the healing of full-thickness wounds in a rat model. This study is the clinical evaluation of the bilayered wound dressing to confirm its safety and efficacy for the treatment of split-thickness skin donor sites. The safety test was performed using a patch model and no evidence of marked and severe cutaneous reactions was found. The efficacy test of the bilayered wound dressing was conducted on 23 patients with 30 split-thickness skin graft donor sites to evaluate healing time, pain score, skin barrier function, and systemic reaction in comparison to Bactigras. We found that the healing time of donor site wounds treated with the bilayered wound dressing (11 ± 6 days) was significantly faster than those treated with Bactigras (14 ± 6 days) (p = 10−6). The wound sites treated with the bilayered wound dressing showed significantly less pain and more rapid skin functional barrier recovery than those treated with Bactigras (p = 10−5). Therefore, these results confirmed the clinical safety and efficacy of the bilayered wound dressing for the treatment of split-thickness skin graft donor sites. PMID:26221170

Recent Advances in Skin Penetration Enhancers for Transdermal Gene and Drug Delivery.

Science.gov (United States)

Amjadi, Morteza; Mostaghaci, Babak; Sitti, Metin

2017-01-01

There is a growing interest in transdermal delivery systems because of their noninvasive, targeted, and on-demand delivery of gene and drugs. However, efficient penetration of therapeutic compounds into the skin is still challenging largely due to the impermeability of the outermost layer of the skin, known as stratum corneum. Recently, there have been major research activities to enhance the skin penetration depth of pharmacological agents. This article reviews recent advances in the development of various strategies for skin penetration enhancement. We show that approaches such as ultrasound waves, laser, and microneedle patches have successfully been employed to physically disrupt the stratum corneum structure for enhanced transdermal delivery. Rather than physical approaches, several non-physical route have also been utilized for efficient transdermal delivery across the skin barrier. Finally, we discuss some clinical applications of transdermal delivery systems for gene and drug delivery. This paper shows that transdermal delivery devices can potentially function for diverse healthcare and medical applications while further investigations are still necessary for more efficient skin penetration of gene and drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Genetic Algorithm for Opto-thermal Skin Hydration Depth Profiling Measurements

Science.gov (United States)

Cui, Y.; Xiao, Perry; Imhof, R. E.

2013-09-01

Stratum corneum is the outermost skin layer, and the water content in stratum corneum plays a key role in skin cosmetic properties as well as skin barrier functions. However, to measure the water content, especially the water concentration depth profile, within stratum corneum is very difficult. Opto-thermal emission radiometry, or OTTER, is a promising technique that can be used for such measurements. In this paper, a study on stratum corneum hydration depth profiling by using a genetic algorithm (GA) is presented. The pros and cons of a GA compared against other inverse algorithms such as neural networks, maximum entropy, conjugate gradient, and singular value decomposition will be discussed first. Then, it will be shown how to use existing knowledge to optimize a GA for analyzing the opto-thermal signals. Finally, these latest GA results on hydration depth profiling of stratum corneum under different conditions, as well as on the penetration profiles of externally applied solvents, will be shown.

Biohydrogels for the In Vitro Re-construction and In Situ Regeneration of Human Skin

Science.gov (United States)

Korkina, Liudmila; Kostyuk, Vladimir; Guerra, Liliana

Natural and synthetic biohydrogels are of great interest for the development of innovative medicinal and cosmetic products feasible for the treatment of numerous skin diseases and age-related changes in skin structure and function. Here, the characteristics of bio-resorbable hydrogels as scaffolds for the in vitro re-construction of temporary skin substitutes or full skin equivalents for further transplantation are reviewed. Another fast developing area of regenerative medicine is the in situ regeneration of human skin. The approach is mainly applicable to activate and facilitate the skin regeneration process and angiogenesis in chronic wounds with impaired healing. In this case, extracellular matrix resembling polymers are used to stimulate cell growth, adhesion, and movement. Better results could be achieved by activation of biocompatible hydrogels either with proteins (growth factors, adhesion molecules or/and cytokines) or with allogenic skin cells producing and releasing these molecules. Hydrogels are widely applied as carriers of low molecular weight substances with antioxidant, anti-inflammatory, anti-ageing, and wound healing action. Incorporation of these substances into hydrogels enhances their penetration through the skin barrier and prevents their destruction by oxidation. Potential roles of hydrogel-based products for modern dermatology and cosmetology are also discussed.

Plastic occlusion stress test as a model to investigate the effects of skin delipidization on the stratum corneum water holding capacity in vivo.

Science.gov (United States)

Berardesca, E; Herbst, R; Maibach, H

1993-01-01

The purpose of the study was to develop an in vivo model to study the effects of lipid removal on skin barrier. 16 subjects (age 41 +/- 8) were delipidized in vivo on the volar forearm using respectively ether/acetone (EA; 1:1) and chloroform/methanol (CM; 2:1). A third site served as control. Water holding capacity (WHC) was measured according to the plastic occlusion stress test (POST) procedure: the water desorption curve after removal of the occlusion was recorded in terms of skin surface water loss (SSWL) using an evaporimeter for 30 min. In the central part of the evaporation curve (bound water) the CM-treated site is significantly different from control and EA-treated sites (p rate of water from SC are higher in the CM-treated site (p evaporation of free water. We conclude that polar lipids have a key role in modulating barrier function and WHC of the stratum corneum. The POST can represent a useful in vivo model to study the effects of lipid extraction on skin function.

Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

Science.gov (United States)

Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

2016-05-01

Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

Fisetin Regulates Nrf2 Expression and the Inflammation-Related Signaling Pathway to Prevent UVB-Induced Skin Damage in Hairless Mice

Directory of Open Access Journals (Sweden)

Po-Yuan Wu

2017-10-01

Full Text Available Chronic ultraviolet (UV exposure may cause skin damage, disrupt skin barrier function, and promote wrinkle formation. UV induces oxidative stress and inflammation, which results in extracellular matrix degradation in the dermis and epidermal hyperplasia. Our previous study demonstrated that fisetin exerts photoprotective activity by inhibiting mitogen-activated protein kinase/activator protein-1/matrix metalloproteinases (MMPs activation. In this study, fisetin was applied topically to investigate its antiphotodamage effects in hairless mice. The erythema index (a* values and transepidermal water loss were evaluated to assess skin damage, and immunohistochemical staining was conducted to elucidate the photoprotective mechanism of fisetin. The results revealed that the topical application of fisetin reduced UVB-induced increase in the a* value and wrinkle formation. In addition, fisetin inhibited epidermal hyperplasia and increased the collagen content in the dermis. Fisetin exerted photoprotective activity by inhibiting the expression of MMP-1, MMP-2, and cyclooxygenase-2 and increasing the expression of nuclear factor erythroid 2-related factor. Furthermore, fisetin increased the expression of filaggrin to prevent UVB-induced barrier function disruption. Altogether, the present results provide evidence of the effects and mechanisms of fisetin’s antiphotodamage and antiphotoinflammation activities.

Fisetin Regulates Nrf2 Expression and the Inflammation-Related Signaling Pathway to Prevent UVB-Induced Skin Damage in Hairless Mice.

Science.gov (United States)

Wu, Po-Yuan; Lyu, Jia-Ling; Liu, Yi-Jung; Chien, Ting-Yi; Hsu, Hao-Cheng; Wen, Kuo-Ching; Chiang, Hsiu-Mei

2017-10-10

Chronic ultraviolet (UV) exposure may cause skin damage, disrupt skin barrier function, and promote wrinkle formation. UV induces oxidative stress and inflammation, which results in extracellular matrix degradation in the dermis and epidermal hyperplasia. Our previous study demonstrated that fisetin exerts photoprotective activity by inhibiting mitogen-activated protein kinase/activator protein-1/matrix metalloproteinases (MMPs) activation. In this study, fisetin was applied topically to investigate its antiphotodamage effects in hairless mice. The erythema index (a* values) and transepidermal water loss were evaluated to assess skin damage, and immunohistochemical staining was conducted to elucidate the photoprotective mechanism of fisetin. The results revealed that the topical application of fisetin reduced UVB-induced increase in the a* value and wrinkle formation. In addition, fisetin inhibited epidermal hyperplasia and increased the collagen content in the dermis. Fisetin exerted photoprotective activity by inhibiting the expression of MMP-1, MMP-2, and cyclooxygenase-2 and increasing the expression of nuclear factor erythroid 2-related factor. Furthermore, fisetin increased the expression of filaggrin to prevent UVB-induced barrier function disruption. Altogether, the present results provide evidence of the effects and mechanisms of fisetin's antiphotodamage and antiphotoinflammation activities.

Progress and Future Prospectives in Skin-on-Chip Development with Emphasis on the use of Different Cell Types and Technical Challenges.

Science.gov (United States)

van den Broek, Lenie J; Bergers, Lambert I J C; Reijnders, Christianne M A; Gibbs, Susan

2017-06-01

Understanding the healthy and diseased state of skin is important in many areas of basic and applied research. Although the field of skin tissue engineering has advanced greatly over the last years, current in vitro skin models still do not mimic the complexity of the human skin. Skin-on-chip and induced pluripotent stem cells (iPSC) might be key technologies to improve in vitro skin models. This review summarizes the state of the art of in vitro skin models with regard to cell sources (primary, cell line, iPSC) and microfluidic devices. It can be concluded that iPSC have the potential to be differentiated into many kinds of immunologically matched cells and skin-on-chip technology might lead to more physiologically relevant skin models due to the controlled environment, possible exchange of immune cells, and an increased barrier function. Therefore the combination of iPSC and skin-on-chip is expected to lead to superior healthy and diseased in vitro skin models.

Characterizing Facial Skin Ageing in Humans: Disentangling Extrinsic from Intrinsic Biological Phenomena

Science.gov (United States)

Trojahn, Carina; Dobos, Gabor; Lichterfeld, Andrea; Blume-Peytavi, Ulrike; Kottner, Jan

2015-01-01

Facial skin ageing is caused by intrinsic and extrinsic mechanisms. Intrinsic ageing is highly related to chronological age. Age related skin changes can be measured using clinical and biophysical methods. The aim of this study was to evaluate whether and how clinical characteristics and biophysical parameters are associated with each other with and without adjustment for chronological age. Twenty-four female subjects of three age groups were enrolled. Clinical assessments (global facial skin ageing, wrinkling, and sagging), and biophysical measurements (roughness, colour, skin elasticity, and barrier function) were conducted at both upper cheeks. Pearson's correlations and linear regression models adjusted for age were calculated. Most of the measured parameters were correlated with chronological age (e.g., association with wrinkle score, r = 0.901) and with each other (e.g., residual skin deformation and wrinkle score, r = 0.606). After statistical adjustment for age, only few associations remained (e.g., mean roughness (R z) and luminance (L *),  β = −0.507, R 2 = 0.377). Chronological age as surrogate marker for intrinsic ageing has the most important influence on most facial skin ageing signs. Changes in skin elasticity, wrinkling, sagging, and yellowness seem to be caused by additional extrinsic ageing. PMID:25767806

Characterizing Facial Skin Ageing in Humans: Disentangling Extrinsic from Intrinsic Biological Phenomena

Directory of Open Access Journals (Sweden)

Carina Trojahn

2015-01-01

Full Text Available Facial skin ageing is caused by intrinsic and extrinsic mechanisms. Intrinsic ageing is highly related to chronological age. Age related skin changes can be measured using clinical and biophysical methods. The aim of this study was to evaluate whether and how clinical characteristics and biophysical parameters are associated with each other with and without adjustment for chronological age. Twenty-four female subjects of three age groups were enrolled. Clinical assessments (global facial skin ageing, wrinkling, and sagging, and biophysical measurements (roughness, colour, skin elasticity, and barrier function were conducted at both upper cheeks. Pearson’s correlations and linear regression models adjusted for age were calculated. Most of the measured parameters were correlated with chronological age (e.g., association with wrinkle score, r=0.901 and with each other (e.g., residual skin deformation and wrinkle score, r=0.606. After statistical adjustment for age, only few associations remained (e.g., mean roughness (Rz and luminance (L*,  β=-0.507, R2=0.377. Chronological age as surrogate marker for intrinsic ageing has the most important influence on most facial skin ageing signs. Changes in skin elasticity, wrinkling, sagging, and yellowness seem to be caused by additional extrinsic ageing.

Innate lymphoid cells and the skin

OpenAIRE

Salimi, Maryam; Ogg, Graham

2014-01-01

Innate lymphoid cells are an emerging family of effector cells that contribute to lymphoid organogenesis, metabolism, tissue remodelling and protection against infections. They maintain homeostatic immunity at barrier surfaces such as lung, skin and gut (Nature 464:1367?1371, 2010, Nat Rev Immunol 13: 145?149, 2013). Several human and mouse studies suggest a role for innate lymphoid cells in inflammatory skin conditions including atopic eczema and psoriasis. Here we review the innate lymphoid...

Chemotactic Activity of Cyclophilin A in the Skin Mucus of Yellow Catfish (Pelteobagrus fulvidraco) and Its Active Site for Chemotaxis

Science.gov (United States)

Dawar, Farman Ullah; Tu, Jiagang; Xiong, Yang; Lan, Jiangfeng; Dong, Xing Xing; Liu, Xiaoling; Khattak, Muhammad Nasir Khan; Mei, Jie; Lin, Li

2016-01-01

Fish skin mucus is a dynamic barrier for invading pathogens with a variety of anti-microbial enzymes, including cyclophilin A (CypA), a multi-functional protein with peptidyl-prolyl cis/trans isomerase (PPIase) activity. Beside various other immunological functions, CypA induces leucocytes migration in vitro in teleost. In the current study, we have discovered several novel immune-relevant proteins in yellow catfish skin mucus by mass spectrometry (MS). The CypA present among them was further detected by Western blot. Moreover, the CypA present in the skin mucus displayed strong chemotactic activity for yellow catfish leucocytes. Interestingly, asparagine (like arginine in mammals) at position 69 was the critical site in yellow catfish CypA involved in leucocyte attraction. These novel efforts do not only highlight the enzymatic texture of skin mucus, but signify CypA to be targeted for anti-inflammatory therapeutics. PMID:27589721

Chemotactic Activity of Cyclophilin A in the Skin Mucus of Yellow Catfish (Pelteobagrus fulvidraco and Its Active Site for Chemotaxis

Directory of Open Access Journals (Sweden)

Farman Ullah Dawar

2016-08-01

Full Text Available Fish skin mucus is a dynamic barrier for invading pathogens with a variety of anti-microbial enzymes, including cyclophilin A (CypA, a multi-functional protein with peptidyl-prolyl cis/trans isomerase (PPIase activity. Beside various other immunological functions, CypA induces leucocytes migration in vitro in teleost. In the current study, we have discovered several novel immune-relevant proteins in yellow catfish skin mucus by mass spectrometry (MS. The CypA present among them was further detected by Western blot. Moreover, the CypA present in the skin mucus displayed strong chemotactic activity for yellow catfish leucocytes. Interestingly, asparagine (like arginine in mammals at position 69 was the critical site in yellow catfish CypA involved in leucocyte attraction. These novel efforts do not only highlight the enzymatic texture of skin mucus, but signify CypA to be targeted for anti-inflammatory therapeutics.

Alterations in Factors Involved in Differentiation and Barrier Function in the Epithelium in Oral and Genital Lichen Planus.

Science.gov (United States)

Danielsson, Karin; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin

2017-02-08

Lichen planus is a chronic recurrent inflammatory disease affecting both skin and mucosa, mainly in oral and/or genital regions. Keratinocytes go through a well-regulated process of proliferation and differentiation, alterations in which may result in defects in the protective epithelial barrier. Long-term barrier impairment might lead to chronic inflammation. In order to broaden our understanding of the differentiation process in mucosal lichen planus, we mapped the expression of 4 factors known to be involved in differentiation. Biopsies were collected from oral and genital lichen planus lesions and normal controls. Altered expression of all 4 factors in epithelium from lichen planus lesions was found, clearly indicating disturbed epithelial differentiation in lichen planus lesions.

International guidelines for the in vivo assessment of skin properties in non-clinical settings: Part 2. transepidermal water loss and skin hydration

Science.gov (United States)

du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz; John, Swen; Agner, Tove; Chou, Tzu-Chieh; Nixon, Rosemary; Steiner, Markus; Franken, Anja; Kudla, Irena; Holness, Linn

2015-01-01

Background There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings. Methods An expert working group convened a workshop as part of the 5th International Conference on Occupational and Environmental Exposure of Skin to Chemicals (OEESC) to develop basic guidelines and best practices (based on existing clinical guidelines, published data, and own experiences) for the in vivo measurement of transepidermal water loss (TEWL) and skin hydration in non-clinical settings with specific reference to the workplace as a worst-case scenario. Results Key elements of these guidelines are: (i) to minimize or recognize, to the extent feasible, the influences of relevant endogenous-, exogenous-, environmental- and measurement/instrumentation-related factors; (ii) to measure TEWL with a closed-chamber type instrument; (iii) report results as a difference or percent change (rather than absolute values); and (iv) accurately report any notable deviations from this guidelines. Conclusion It is anticipated that these guidelines will promote consistent data reporting, which will facilitate inter-comparison of study results. PMID:23331328

Evaluation of Barrier Skin Cream Effectiveness Against JP-8 Jet Fuel Absorption and Irritation

Science.gov (United States)

2009-04-01

quantify the colorimeter measurements. This system uses spectral chromaticity coordinates and corresponding color- matching functions based on...in the caudal thigh or lumbar muscles and the rabbit was monitored throughout the procedure. Once anesthetized, a baseline visual and colorimeter ...Visual Scoring Technique All barrier creams were scored in 3 ways; by visual scoring described in the Draize method, by colorimeter , and by

Epidemiology of "fragile skin": results from a survey of different skin types

Directory of Open Access Journals (Sweden)

Haftek M

2013-12-01

findings need to be confirmed through objective evaluation, the current survey demonstrated that "fragile skin" is perceived to occur in a substantial proportion of individuals from any given country, particularly in the age range of 15–34 years, regardless of skin type. Keywords: fragile skin, prevalence, skin barrier, skin type, survey

Skin and scales of teleost fish: Simple structure but high performance and multiple functions

Science.gov (United States)

Vernerey, Franck J.; Barthelat, Francois

2014-08-01

Natural and man-made structural materials perform similar functions such as structural support or protection. Therefore they rely on the same types of properties: strength, robustness, lightweight. Nature can therefore provide a significant source of inspiration for new and alternative engineering designs. We report here some results regarding a very common, yet largely unknown, type of biological material: fish skin. Within a thin, flexible and lightweight layer, fish skins display a variety of strain stiffening and stabilizing mechanisms which promote multiple functions such as protection, robustness and swimming efficiency. We particularly discuss four important features pertaining to scaled skins: (a) a strongly elastic tensile behavior that is independent from the presence of rigid scales, (b) a compressive response that prevents buckling and wrinkling instabilities, which are usually predominant for thin membranes, (c) a bending response that displays nonlinear stiffening mechanisms arising from geometric constraints between neighboring scales and (d) a robust structure that preserves the above characteristics upon the loss or damage of structural elements. These important properties make fish skin an attractive model for the development of very thin and flexible armors and protective layers, especially when combined with the high penetration resistance of individual scales. Scaled structures inspired by fish skin could find applications in ultra-light and flexible armor systems, flexible electronics or the design of smart and adaptive morphing structures for aerospace vehicles.

Langerhans cell precursors acquire RANK/CD265 in prenatal human skin.

Science.gov (United States)

Schöppl, Alice; Botta, Albert; Prior, Marion; Akgün, Johnnie; Schuster, Christopher; Elbe-Bürger, Adelheid

2015-01-01

The skin is the first barrier against foreign pathogens and the prenatal formation of a strong network of various innate and adaptive cells is required to protect the newborn from perinatal infections. While many studies about the immune system in healthy and diseased adult human skin exist, our knowledge about the cutaneous prenatal/developing immune system and especially about the phenotype and function of antigen-presenting cells such as epidermal Langerhans cells (LCs) in human skin is still scarce. It has been shown previously that LCs in healthy adult human skin express receptor activator of NF-κB (RANK), an important molecule prolonging their survival. In this study, we investigated at which developmental stage LCs acquire this important molecule. Immunofluorescence double-labeling of cryostat sections revealed that LC precursors in prenatal human skin either do not yet [10-11 weeks of estimated gestational age (EGA)] or only faintly (13-15 weeks EGA) express RANK. LCs express RANK at levels comparable to adult LCs by the end of the second trimester. Comparable with adult skin, dermal antigen-presenting cells at no gestational age express this marker. These findings indicate that epidermal leukocytes gradually acquire RANK during gestation - a phenomenon previously observed also for other markers on LCs in prenatal human skin. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro

Directory of Open Access Journals (Sweden)

Zou Y

2017-10-01

Full Text Available Ying Zou,1,2,* Anna Celli,2,3,* Hanjiang Zhu,2,* Akram Elmahdy,2 Yachao Cao,2 Xiaoying Hui,2 Howard Maibach2 1Skin & Cosmetic Research Department, Shanghai Skin Disease Hospital, Shanghai, People’s Republic of China; 2Department of Dermatology, School of Medicine, University of California San Francisco, San Francisco, CA, USA; 3San Francisco Veterans Medical Center, San Francisco, CA, USA *These authors contributed equally to this work Objective: With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration.Methods: Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy.Results: NPs were localized in the stratum corneum (SC and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not.Conclusion: Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. Keywords: nanoparticles, skin penetration, stratum corneum, confocal laser scanning microscopy, tape stripping

Frog skin function revisited

DEFF Research Database (Denmark)

Hviid Larsen, Erik; Ramløv, Hans

2013-01-01

of the epidermis. These mechanisms have evolved pari passu with life alternating between aquatic and terrestrial habitats associated with permeabilities of the skin controlled by external ion- and osmotic concentrations (loc. cit.). This allows for fast switching of the cutaneous uptake of chloride between active...

Complex rheological behaviors of loach (Misgurnus anguillicaudatus) skin mucus

International Nuclear Information System (INIS)

Wang, Xiang; Su, Heng; Lv, Weiyang; Du, Miao; Song, Yihu; Zheng, Qiang

2015-01-01

The functions and structures of biological mucus are closely linked to rheology. In this article, the skin mucus of loach (Misgurnus anguillicaudatus) was proved to be a weak hydrogel susceptible to shear rate, time, and history, exhibiting: (i) Two-region breakdown of its gel structure during oscillatory strain sweep; (ii) rate-dependent thickening followed by three-region thinning with increased shear rate, and straight thinning with decreased shear rate; and (iii) time-dependent rheopexy at low shear rates, and thixotropy at high shear rates. An interesting correlation between the shear rate- and time-dependent rheological behaviors was also revealed, i.e., the rheopexy-thixotropy transition coincided with the first-second shear thinning region transition. Apart from rheology, a structure of colloidal network was observed in loach skin mucus using transmission electron microscopy. The complex rheology was speculated to result from inter- and intracolloid structural alterations. The unique rheology associated with the colloidal network structure, which has never been previously reported in vertebrate mucus, may play a key role in the functions (e.g., flow, reannealing, lubrication, and barrier) of the mucus