WorldWideScience

Sample records for single-stranded regions gaps

  1. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  2. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  3. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  4. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  5. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  6. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  7. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  8. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  9. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  12. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  13. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  14. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  15. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  16. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  17. Region 9 Tribal Environmental GAP Funding

    Science.gov (United States)

    EPA Region 9 invites Indian Environmental General Assistance Program (GAP) grant proposals from federally recognized tribal governments and eligible intertribal consortia for FY2019 work plan program development activities.

  18. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  19. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  20. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  1. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  2. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  3. Is There a Gap in the Gap? Regional Differences in the Gender Pay Gap

    OpenAIRE

    Hirsch, Boris; König, Marion; Möller, Joachim

    2009-01-01

    In this paper, we investigate regional differences in the gender pay gap both theoretically and empirically. Within a spatial oligopsony model, we show that more densely populated labour markets are more competitive and constrain employers' ability to discriminate against women. Utilising a large administrative data set for western Germany and a flexible semi-parametric propensity score matching approach, we find that the unexplained gender pay gap for young workers is substantially lower in ...

  4. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  5. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  6. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  7. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  8. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  9. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  10. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  11. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  13. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  14. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  15. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  16. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  17. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  18. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  19. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  20. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  1. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  2. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  3. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  4. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  5. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  6. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  7. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  8. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  9. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  10. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  11. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  12. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  13. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  14. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  15. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  16. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  17. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  18. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  19. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  20. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  1. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  2. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  3. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  4. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  5. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  6. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  7. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  8. Mind the gap: financial London and the regional class pay gap.

    Science.gov (United States)

    Friedman, Sam; Laurison, Daniel

    2017-09-01

    The hidden barriers, or 'gender pay gap', preventing women from earning equivalent incomes to men is well documented. Yet recent research has uncovered that, in Britain, there is also a comparable class-origin pay gap in higher professional and managerial occupations. So far this analysis has only been conducted at the national level and it is not known whether there are regional differences within the UK. This paper uses pooled data from the 2014 and 2015 Labour Force Survey (N = 7,534) to stage a more spatially sensitive analysis that examines regional variation in the class pay gap. We find that this 'class ceiling' is not evenly spatially distributed. Instead it is particularly marked in Central London, where those in high-status occupations who are from working-class backgrounds earn, on average, £10,660 less per year than those whose parents were in higher professional and managerial employment. Finally, we inspect the Capital further to reveal that the class pay gap is largest within Central London's banking and finance sector. Challenging policy conceptions of London as the 'engine room' of social mobility, these findings suggest that class disadvantage within high-status occupations is particularly acute in the Capital. The findings also underline the value of investigating regional differences in social mobility, and demonstrate how such analysis can unravel important and previously unrecognized spatial dimensions of class inequality. © London School of Economics and Political Science 2017.

  9. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  10. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  13. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  14. Size and frequency of gaps in newly synthesized DNA of xeroderma pigmentosum human cells irradiated with ultraviolet light

    International Nuclear Information System (INIS)

    Meneghini, R.; Cordeiro-Stone, M.; Schumacher, R.I.

    1981-01-01

    Native newly synthesized DNA from human cells (xeroderma pigmentosum type) irradiated with ultraviolet light releases short pieces of DNA (L-DNA) when incubated with the single-strand specific S 1 nuclease. This is not observed in the case of unirradiated cells. Previous experiments had shown that the L-DNA resulted from the action of S 1 nuclease upon gaps, i.e., single-stranded DNA discontinuities in larger pieces of double-stranded DNA. We verified that the duplex L-DNA, that arises from the inter-gap regions upon S 1 nuclease treatment, has a size which approximates the distance between two pyrimidine dimers on the same strand. A method was devised to measure the size of the gaps. These parameters have been considered in the proposition of a model for DNA synthesis on a template containing pyrimidine dimers

  15. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  16. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  17. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  18. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  19. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  20. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  1. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  2. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  3. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  4. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  5. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  6. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  7. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  8. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  9. Biosafety initiatives in BMENA region: identification of gaps and advances

    Directory of Open Access Journals (Sweden)

    Erum eKhan

    2016-03-01

    Full Text Available AbstractIntroduction: The objectives of this study were to identify and assess the impact of capacity-building biosafety initiatives and programs that have taken place in the broader Middle East and north Africa (BMENA region between 2001-13, to highlight gaps that require further development, and to suggest sustainable ways to build cooperative regional biosafety opportunities. Methods: A cross sectional study was conducted with two aspects 1 thorough desktop review of literature for all biosafety / biosecurity related activities in the study countries such as seminars, conferences, workshops, policy documents, technology transfer, sustained scientific endeavours between countries etc.; and 2 an online survey of scientists in countries in the region to get first-hand information about biosafety and biosecurity initiatives and gaps in their country. Results: A total of 1832 initiatives of biosafety / biosecurity were recorded from 97 web-links,70.68% (n=1295 initiatives were focused on raising general awareness among the scientific community about biosafety/biosecurity/biocontainment. The most frequent areas of interest were biorisk management in biomedical and biotechnology laboratories 13% (n=239, followed by Living Modified Organisms (LMO’s 9.17% (n=168. Hands-on training accounted for 2.67% (n=49 of initiatives. On line survey results confirmed desktop review findings, however the response rate was 11%.

  10. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  11. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  12. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  13. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  14. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  15. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  16. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  17. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  20. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  1. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  2. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  3. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  4. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  5. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  7. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  8. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  9. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  10. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  11. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  12. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  13. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  14. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  16. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  17. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  18. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  19. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  20. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  1. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  2. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  3. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  4. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

    Science.gov (United States)

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

    2018-03-27

    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  5. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  6. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  7. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  8. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  9. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  10. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  11. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  12. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  13. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Gender-specific spatial interactions on Dutch regional labour markets and the gender employment gap

    NARCIS (Netherlands)

    Noback, Inge; Broersma, Lourens; Van Dijk, Jouke

    2013-01-01

    Gender-specific spatial interactions on Dutch regional labour markets and the gender employment gap, Regional Studies. This paper analyses gender-specific employment rates and the gender employment gap in Dutch municipalities for 2002. The novelty of this analysis is that it takes into account the

  15. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  16. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  17. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  18. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  19. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  20. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  2. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  3. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  4. Final report : Occupational gap analysis, volume 2 Wood Buffalo region

    International Nuclear Information System (INIS)

    2002-06-01

    The general economy of the Wood Buffalo region of Alberta has improved in recent years due to the expansion of the oil sand industry. Many of the oil sands projects are situated in the southern part of the region and are serviced out of Lac LaBiche. This paper examines the implications of this economic growth for the regional supply and demand of workers in key occupational categories. In particular, it projects employment opportunities that are directly attributed to the regional economic expansion, and assesses whether there will be an adequate supply of workers to meet the demand for new and replacement employees. The report includes: an overview of the regional economy; a population forecast for the region and the demand for workers in selected occupations; an analysis of whether or not the new labour force entrants will choose the selected occupations; and, a supply and demand analysis. 7 tabs., 2 figs., 5 appendices

  5. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  6. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  7. Marine mammal strandings in the New Caledonia region, Southwest Pacific.

    Science.gov (United States)

    Borsa, Philippe

    2006-04-01

    Four hundred twenty three marine mammals, in 72 stranding events, were recorded between 1877 and 2005 in New Caledonia, the Loyalty Islands, and Vanuatu in the southwest Pacific. Sixteen species were represented in this count, including: minke whale, Balaenoptera acutorostrata (1 single stranding), sei whale, B. borealis (1 single stranding), blue whale, B. musculus (1 single stranding), humpback whale, Megaptera novaeangliae (2 single strandings), giant sperm whale, Physeter macrocephalus (18 single strandings, 2 pair strandings), pygmy sperm whale, Kogia breviceps (5 single strandings), dwarf sperm whale, K. sima (2 single strandings, 1 triple stranding), Blainville's beaked whale, Mesoplodon densirostris (2 single strandings), short-finned pilot whale, Globicephala macrorhynchus (4 strandings, 56 individuals), melon-headed whale, Peponocephala electra (1 single stranding and 2 mass strandings totalling 231 individuals), common dolphin, Delphinus delphis (1 single stranding), spinner dolphin, Stenella longirostris (1 pair stranding and 2 mass strandings of groups of approximately 30 individuals each), Indian Ocean bottlenose dolphin, Tursiops aduncus (2 single strandings), dugong, Dugong dugon (14 single strandings), and New Zealand fur seal, Arctocephalus forsteri (3 single strandings). A stranded rorqual identified as an Antarctic minke whale (B. bonaerensis), with coloration patterns that did not match known descriptions, was also reported. Sei whale was recorded for the first time in the tropical Southwest Pacific region and Antarctic minke whale, melon-headed whale, and Indian Ocean bottlenose dolphin were recorded for the first time in New Caledonia. Strandings of sperm whales were most frequent in the spring, but also occurred in autumn months, suggesting a seasonal pattern of occurrence possibly related to seasonal migration. One stranded humpback whale bore the scars of a killer whale's attack and one dugong was injured by a shark. Scars left by

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  10. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  11. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  12. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  13. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  14. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  15. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  16. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  17. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  18. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  19. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  20. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  1. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  2. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  3. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  4. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  5. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  6. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  8. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  9. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  10. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  11. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  12. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  13. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  14. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  16. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  17. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  19. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  20. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  1. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  2. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  3. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  4. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  5. TB and HIV in the Central African region: current knowledge and knowledge gaps

    NARCIS (Netherlands)

    Janssen, S.; Huson, M. A. M.; Bélard, S.; Stolp, S.; Kapata, N.; Bates, M.; van Vugt, M.; Grobusch, M. P.

    2014-01-01

    Reliable and comprehensive data on the HIV/AIDS and TB co-pandemics from Central Africa remain scarce. This systematic review provides a comprehensive overview on current and past research activities in the region and provides a basis for future research work to close knowledge gaps. The scientific

  6. Engineering Graduates' Skill Sets in the MENA Region: A Gap Analysis of Industry Expectations and Satisfaction

    Science.gov (United States)

    Ramadi, Eric; Ramadi, Serge; Nasr, Karim

    2016-01-01

    This study explored gaps between industry expectations and perceptions of engineering graduates' skill sets in the Middle East and North Africa (MENA) region. This study measured the importance that managers of engineers placed on 36 skills relevant to engineers. Also measured was managers' satisfaction with engineering graduates' skill sets.…

  7. New approach for regional crop yield gap analysis in the Borujen ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... This study was performed to analyze the regional crop yield gap for potential and water-limited production situations in the cold-semiarid climate at Borujen basin, Iran. Experimental data were used for model calibration and evaluation of WOFOST as a crop growth simulation model. WOFOST divides.

  8. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  9. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  11. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  12. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  13. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  14. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  15. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  16. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Present state of the perception gap of nuclear energy between Japanese nuclear energy supplying region and an energy consuming region

    International Nuclear Information System (INIS)

    Ohnishi, Teruaki

    2002-01-01

    Public opinion surveys have been carried out since 1998 on what phase and on what extent of the perception of nuclear energy differs between Japanese dwelling in energy supplying region and an energy-consuming region. Southern Fukui rural district where 15 nuclear reactors are now installed and Osaka urban region of about 100 km apart from Fukui were selected as the respective targets for the energy supplying and consuming regions. Analyses of the data of about 3000 samples have revealed the followings. (1) The public in the nuclear energy supplying region are very friendly to nuclear energy so that only about 20 and 39 of the public are resistive to the general promotion of nuclear energy in Japan and to the construction of another nuclear reactor in their dwelling region, respectively. (2) On the other hand, in the energy-consuming region those respective fractions are 41 and 70 implying strong resistance to nuclear energy in the urban region. (3) Both the degree of interest in and the degree of knowledge on nuclear energy are very low, whereas the extent of fear to nuclear is high for the urban public. (4) Not only the fraction of the public who are satisfied with their present life, but the public fraction who is eagerly support the thought of return-to-nature are very high in the urban region. (5) On the other hand, in the energy supplying region, many peoples eagerly want their life to become more convenient than it is now, and 6) all those trends (I)-(5) are revealed more pronouncedly in the woman than the man. The perception gap of nuclear energy thus became clear between Japanese dwelling in rural and urban regions. On the basis of this knowledge, discussions on the nature of the so-called NIMBY will be made from the socio-psychological viewpoint and propositions will also be made on the methods to dissolve the perception gap of that soft. (author)

  18. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  20. Migration and gender wage gap in the southern region of Brazil

    Directory of Open Access Journals (Sweden)

    Karla Cristina Tyskowski Teodoro Rodrigues

    2016-07-01

    Full Text Available This paper analyzes the wage gap according to migration status and gender of the labor force of the southern states of Brazil (Paraná, Santa Catarina and Rio Grande do Sul. We used data from the National Household Sample Survey – 2013, Mincer equations, Heckman procedure for sample selection bias and the Oaxaca-Blinder decomposition analysis. The results show that the state of Paraná has greater relative share of migrants from the South, followed by Santa Catarina and Rio Grande do Sul. The region has a higher salary for migrants, both for men and for women, consistent with the results already seen in the literature. Men have a higher salary, and the largest wage gap by gender occurs in the migrant population. By decomposing wage gap we detected discrimination by sex, which is higher among migrants. We also found the migration effect on wages, i.e. a wage gap caused by migration even after controlling by workers endowments: among women, about 15% of the pay gap comes from the migration status (favorable to migrants, and among men a difference of approximately 38% (favorable migrants.

  1. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  2. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  3. The Tokar Gap Jet: Regional Circulation, Diurnal Variability, and Moisture Transport Based on Numerical Simulations

    KAUST Repository

    Davis, Shannon R.

    2015-05-14

    The structure, variability, and regional connectivity of the Tokar Gap jet (TGJ) are described using WRF Model analyses and supporting atmospheric datasets from the East African–Red Sea–Arabian Peninsula (EARSAP) region during summer 2008. Sources of the TGJ’s unique quasi-diurnal nature and association with atypically high atmospheric moisture transport are traced back to larger-scale atmospheric dynamics influencing its forcing. These include seasonal shifts in the intertropical convergence zone (ITCZ), variability of the monsoon and North African wind regimes, and ties to other orographic flow patterns. Strong modulation of the TGJ by regional processes such as the desert heating cycle, wind convergence at the ITCZ surface front, and the local land–sea breeze cycle are described. Two case studies present the interplay of these influences in detail. The first of these was an “extreme” gap wind event on 12 July, in which horizontal velocities in the Tokar Gap exceeded 26 m s−1 and the flow from the jet extended the full width of the Red Sea basin. This event coincided with development of a large mesoscale convective complex (MCC) and precipitation at the entrance of the Tokar Gap as well as smaller gaps downstream along the Arabian Peninsula. More typical behavior of the TGJ during the 2008 summer is discussed using a second case study on 19 July. Downwind impact of the TGJ is evaluated using Lagrangian model trajectories and analysis of the lateral moisture fluxes (LMFs) during jet events. These results suggest means by which TGJ contributes to large LMFs and has potential bearing upon Sahelian rainfall and MCC development.

  4. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  5. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  6. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  7. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  8. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  9. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  10. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  11. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  12. A regional implementation of WOFOST for calculating yield gaps of winter wheat across the European Union

    OpenAIRE

    Boogaard, H.; Wolf, J.; Supit, I.; Niemeyer, S.; Ittersum, van, M.K.

    2013-01-01

    Wheat is Europe’s dominant crop in terms of land use in the European Union (EU25). Most of this wheat area is sown in autumn, i.e., winter wheat in all EU25 countries, apart from southern Italy, southern Spain and most of Portugal, where spring wheat varieties are sown in late autumn. We evaluated the strengths and limitations of a regional implementation of the crop growth model WOFOST implemented in the Crop Growth Monitoring System (CGMS) for calculating yield gaps of autumn-sown wheat acr...

  13. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  14. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  15. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  16. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  17. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  18. REGIONAL AIR-SEA INTERACTION (RASI) GAP WIND AND COASTAL UPWELLING EVENTS CLIMATOLOGY GULF OF PANAMA, PANAMA V1

    Data.gov (United States)

    National Aeronautics and Space Administration — The Regional Air-Sea Interactions (RASI) Gap Wind and Coastal Upwelling Events Climatology datasets were created using an automated intelligent algorithm which...

  19. REGIONAL AIR-SEA INTERACTION (RASI) GAP WIND AND COASTAL UPWELLING EVENTS CLIMATOLOGY GULF OF TEHUANTEPEC, MEXICO V1

    Data.gov (United States)

    National Aeronautics and Space Administration — The Regional Air-Sea Interactions (RASI) Gap Wind and Coastal Upwelling Events Climatology datasets were created using an automated intelligent algorithm which...

  20. REGIONAL AIR-SEA INTERACTION (RASI) GAP WIND AND COASTAL UPWELLING EVENTS CLIMATOLOGY GULF OF PAPAGAYO, COSTA RICA V1

    Data.gov (United States)

    National Aeronautics and Space Administration — The Regional Air-Sea Interactions (RASI) Gap Wind and Coastal Upwelling Events Climatology datasets were created using an automated intelligent algorithm which...

  1. REGIONAL AIR-SEA INTERACTION (RASI) GAP WIND AND COASTAL UPWELLING EVENTS CLIMATOLOGY GULF OF PAPAGAYO, COSTA RICA V1

    Data.gov (United States)

    National Aeronautics and Space Administration — The Regional Air-Sea Interactions (RASI) Gap Wind and Coastal Upwelling Events Climatology Gulf of Papagayo, Costa Rica dataset was created using an automated...

  2. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2013-01-01

    Roč. 61, Oct (2013), s. 448-452 ISSN 0141-8130 R&D Projects: GA ČR GAP208/10/0559 Institutional support: RVO:61388963 Keywords : metal ions * polyA * metal lized form * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  3. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.

    2016-01-01

    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/ 1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  4. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  5. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  6. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  7. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  8. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  9. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  10. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  11. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  12. Full-scale regional exercises: closing the gaps in disaster preparedness.

    Science.gov (United States)

    Klima, David A; Seiler, Sarah H; Peterson, Jeff B; Christmas, A Britton; Green, John M; Fleming, Greg; Thomason, Michael H; Sing, Ronald F

    2012-09-01

    Man-made (9/11) and natural (Hurricane Katrina) disasters have enlightened the medical community regarding the importance of disaster preparedness. In response to Joint Commission requirements, medical centers should have established protocols in place to respond to such events. We examined a full-scale regional exercise (FSRE) to identify gaps in logistics and operations during a simulated mass casualty incident. A multiagency, multijurisdictional, multidisciplinary exercise (FSRE) included 16 area hospitals and one American College of Surgeons-verified Level I trauma center (TC). The scenario simulated a train derailment and chemical spill 20 miles from the TC using 281 moulaged volunteers. Third-party contracted evaluators assessed each hospital in five areas: communications, command structure, decontamination, staffing, and patient tracking. Further analysis examined logistic and operational deficiencies. None of the 16 hospitals were compliant in all five areas. Mean hospital compliance was 1.9 (± 0.9 SD) areas. One hospital, unable to participate because of an air conditioner outage, was deemed 0% compliant. The most common deficiency was communications (15 of 16 hospitals [94%]; State Medical Asset Resource Tracking Tool system deficiencies, lack of working knowledge of Voice Interoperability Plan for Emergency Responders radio system) followed by deficient decontamination in 12 (75%). Other deficiencies included inadequate staffing based on predetermined protocols in 10 hospitals (63%), suboptimal command structure in 9 (56%), and patient tracking deficiencies in 5 (31%). An additional 11 operational and 5 logistic failures were identified. The TC showed an appropriate command structure but was deficient in four of five categories, with understaffing and a decontamination leak into the emergency department, which required diversion of 70 patients. Communication remains a significant gap in the mass casualty scenario 10 years after 9/11. Our findings

  13. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  14. Interaction of Zn2+ Ions with Single-Stranded PolyU and PolyC in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Usenko, E. L.; Valeev, V. A.; Berezniak, E. G.; Andrushchenko, Valery

    2015-01-01

    Roč. 119, č. 12 (2015), s. 4409-4416 ISSN 1520-6106 R&D Projects: GA ČR GAP208/11/0105; GA ČR GA15-09072S Institutional support: RVO:61388963 Keywords : metal ions * polyU * polyC * metallized DNA * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.187, year: 2015

  15. Neuroinflammation leads to region-dependent alterations in astrocyte gap junction communication and hemichannel activity.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Fritz, Teresa; Angle, Amanda; Kielian, Tammy

    2011-01-12

    Inflammation attenuates gap junction (GJ) communication in cultured astrocytes. Here we used a well-characterized model of experimental brain abscess as a tool to query effects of the CNS inflammatory milieu on astrocyte GJ communication and electrophysiological properties. Whole-cell patch-clamp recordings were performed on green fluorescent protein (GFP)-positive astrocytes in acute brain slices from glial fibrillary acidic protein-GFP mice at 3 or 7 d after Staphylococcus aureus infection in the striatum. Astrocyte GJ communication was significantly attenuated in regions immediately surrounding the abscess margins and progressively increased to levels typical of uninfected brain with increasing distance from the abscess proper. Conversely, astrocytes bordering the abscess demonstrated hemichannel activity as evident by enhanced ethidium bromide (EtBr) uptake that could be blocked by several pharmacological inhibitors, including the connexin 43 (Cx43) mimetic peptide Gap26, carbenoxolone, the pannexin1 (Panx1) mimetic peptide (10)Panx1, and probenecid. However, hemichannel opening was transient with astrocytic EtBr uptake observed near the abscess at day 3 but not day 7 after infection. The region-dependent pattern of hemichannel activity at day 3 directly correlated with increases in Cx43, Cx30, Panx1, and glutamate transporter expression (glial L-glutamate transporter and L-glutamate/L-aspartate transporter) along the abscess margins. Changes in astrocyte resting membrane potential and input conductance correlated with the observed changes in GJ communication and hemichannel activity. Collectively, these findings indicate that astrocyte coupling and electrical properties are most dramatically affected near the primary inflammatory site and reveal an opposing relationship between the open states of GJ channels versus hemichannels during acute infection. This relationship may extend to other CNS diseases typified with an inflammatory component.

  16. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  17. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  18. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  19. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  20. Novel wind measurement techniques for the middle-atmospheric gap region

    Science.gov (United States)

    Rüfenacht, R.; Hildebrand, J.; Baumgarten, G.; Kaempfer, N.; Luebken, F. J.

    2016-12-01

    Stratospheric and mesospheric dynamics are known to substantially influence the tropospheric weather and climate patterns. Therefore, in recent years many numerical weather prediction and climate models have extended their lids towards higher middle-atmospheric alitudes. However, wind observations between 35 and 70 km altitude are extremely scarce. Neither can balloon-borne in-situ sensors reach these altitudes nor are there enough backscatterers for radar measurements. Until recently only occasional rocket-based measurements allowed to obtain a few snapshots of measured wind information in this altitude range. In the last years efforts were made to bridge this gap for example by the limb sounding radiometer SMILES which was measurning horizontal winds between 35 and 70 km during 7 months aboard the International Space Station. We present a combination of two novel independent observation techniques capable of providing middle-atmospheric wind profiles. They are based on passive Doppler microwave radiometry offering good temporal coverage and active Doppler lidar providing high vertical resolution observations, respectively. The radiometer is a single sideband low noise heterodyne receiver with high frequency resolution whereas the lidar is a twin Rayleigh system using single-edge iodine absorption spectroscopy. The two ground-based instruments used in this study are currently the unique operational representatives of their measurement approach with the ability to cover the entire gap region from 35 to 70 km. In the framework of the project ARISE2 intending to promote the development of research infrastructure to assess the dynamics of the middle atmosphere, both instruments are run in co-location at ALOMAR observatory (69.3°N, 16.0°E) since April 2016. Results of the improved wind retrievals will be presented along with cross-validations of both instruments. The combination of both instruments will be used for assessing the representation of the middle

  1. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  2. A regional implementation of WOFOST for calculating yield gaps of autumn-sown wheat across the European Union

    OpenAIRE

    Boogaard, Hendrik; Wolf, Joost; Supit, Iwan; Niemeyer, Stefan; van Ittersum, Martin

    2013-01-01

    The Crop Growth Monitoring System (CGMS) is regularly applied for regional monitoring of growing conditions, for simulating growth and yields of the main arable crops, and for producing regional yield forecasts over Europe. These crop growth simulations are done with CGMS-WOFOST to calculate the potential and water limited yields for the main crop types over Europe, of which we analyze here the results for winter wheat. The yield gaps for winter wheat in regions over Europe are subsequently d...

  3. Coverage gap in maternal and child health services in India: assessing trends and regional deprivation during 1992-2006.

    Science.gov (United States)

    Kumar, Chandan; Singh, Prashant Kumar; Rai, Rajesh Kumar

    2013-12-01

    Increasing the coverage of key maternal, newborn and child health interventions is essential, if India has to attain Millennium Development Goals 4 and 5. This study assesses the coverage gap in maternal and child health services across states in India during 1992-2006 emphasizing the rural-urban disparities. Additionally, association between the coverage gap and under-5 mortality rate across states are illustrated. The three waves of National Family Health Survey (NFHS) conducted during 1992-1993 (NFHS-1), 1998-1999 (NFHS-2) and 2005-2006 (NFHS-3) were used to construct a composite index of coverage gap in four areas of health-care interventions: family planning, maternal and newborn care, immunization and treatment of sick children. The central, eastern and northeastern regions of India reported a higher coverage gap in maternal and child health care services during 1992-2006, while the rural-urban difference in the coverage gap has increased in Gujarat, Haryana, Rajasthan and Kerala over the period. The analysis also shows a significant positive relationship between the coverage gap index and under-five mortality rate across states. Region or area-specific focus in order to increase the coverage of maternal and child health care services in India should be the priority of the policy-makers and programme executors.

  4. Bridging the Information Gap: Remote Sensing and Micro Hydropower Feasibility in Data-Scarce Regions

    Science.gov (United States)

    Muller, Marc Francois

    Access to electricity remains an impediment to development in many parts of the world, particularly in rural areas with low population densities and prohibitive grid extension costs. In that context, community-scale run-of-river hydropower---micro-hydropower---is an attractive local power generation option, particularly in mountainous regions, where appropriate slope and runoff conditions occur. Despite their promise, micro hydropower programs have generally failed to have a significant impact on rural electrification in developing nations. In Nepal, despite very favorable conditions and approximately 50 years of experience, the technology supplies only 4% of the 10 million households that do not have access to the central electricity grid. These poor results point towards a major information gap between technical experts, who may lack the incentives or local knowledge needed to design appropriate systems for rural villages, and local users, who have excellent knowledge of the community but lack technical expertise to design and manage infrastructure. Both groups suffer from a limited basis for evidence-based decision making due to sparse environmental data available to support the technical components of infrastructure design. This dissertation draws on recent advances in remote sensing data, stochastic modeling techniques and open source platforms to bridge that information gap. Streamflow is a key environmental driver of hydropower production that is particularly challenging to model due to its stochastic nature and the complexity of the underlying natural processes. The first part of the dissertation addresses the general challenge of Predicting streamflow in Ungauged Basins (PUB). It first develops an algorithm to optimize the use of rain gauge observations to improve the accuracy of remote sensing precipitation measures. It then derives and validates a process-based model to estimate streamflow distribution in seasonally dry climates using the stochastic

  5. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  6. FDI technology spillover and threshold effect of the technology gap: regional differences in the Chinese industrial sector.

    Science.gov (United States)

    Wang, Hui; Liu, Huifang; Cao, Zhiyong; Wang, Bowen

    2016-01-01

    This paper presents a new perspective that there is a double-threshold effect in terms of the technology gap existing in the foreign direct investment (FDI) technology spillover process in different regional Chinese industrial sectors. In this paper, a double-threshold regression model was established to examine the relation between the threshold effect of the technology gap and technology spillover. Based on the provincial panel data of Chinese industrial sectors from 2000 to 2011, the empirical results reveal that there are two threshold values, which are 1.254 and 2.163, in terms of the technology gap in the industrial sector in eastern China. There are also two threshold values in both the central and western industrial sector, which are 1.516, 2.694 and 1.635, 2.714, respectively. The technology spillover is a decreasing function of the technology gap in both the eastern and western industrial sectors, but a concave curve function of the technology gap is in the central industrial sectors. Furthermore, the FDI technology spillover has increased gradually in recent years. Based on the empirical results, suggestions were proposed to elucidate the introduction of the FDI and the improvement in the industrial added value in different regions of China.

  7. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  8. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  9. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  10. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  11. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  12. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  13. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  14. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  15. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  16. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  17. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  18. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  19. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  20. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  1. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  3. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  4. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  5. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  6. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  7. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  8. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  9. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  10. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  11. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Toward closing rice telomere gaps: mapping and sequence characterization of rice subtelomere regions.

    NARCIS (Netherlands)

    Yang, T.J.; Yu, Y.; Chang, S.B.; Jong, de J.H.S.G.M.; Oh, C.S.; Ahn, S.N.; Fang, E.; Wing, R.A.

    2005-01-01

    Despite the collective efforts of the international community to sequence the complete rice genome, telomeric regions of most chromosome arms remain uncharacterized. In this report we present sequence data from subtelomere regions obtained by analyzing telomeric clones from two 8.8 × genome

  14. Advancing Environmental Mainstreaming in the Caribbean Region: The Role of Regional Institutions for Overcoming Barriers and Capacity Gaps

    Directory of Open Access Journals (Sweden)

    Livia Bizikova

    2015-10-01

    Full Text Available Environmental mainstreaming (EM is a policy instrument to integrate environmental risks and opportunities into planning and implementation. A body of knowledge exists on identifying barriers for EM at the national level. This paper identifies contributions of regional institutions for improving capacities for EM at the national level, using the Caribbean region as a case study. The methodology adopted combines in-depth interviews with senior policy-makers and participatory workshops for medium- and junior-level staff of government agencies. Four barriers for EM are analyzed with specific roles for regional agencies, including weak leadership, insufficient science–policy linkages, deficits in quantity and quality of human resources, and institutional aspects. Research findings identify regional leadership as crucial to supporting the science–policy interface, to share data and knowledge across countries facing similar challenges, to provide assistance with national policy development for EM involving transboundary issues, and to ensure cross-sectoral perspectives in regional initiatives, especially those on economic development.

  15. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  16. Gap Resolution

    Energy Technology Data Exchange (ETDEWEB)

    2017-04-25

    Gap Resolution is a software package that was developed to improve Newbler genome assemblies by automating the closure of sequence gaps caused by repetitive regions in the DNA. This is done by performing the follow steps:1) Identify and distribute the data for each gap in sub-projects. 2) Assemble the data associated with each sub-project using a secondary assembler, such as Newbler or PGA. 3) Determine if any gaps are closed after reassembly, and either design fakes (consensus of closed gap) for those that closed or lab experiments for those that require additional data. The software requires as input a genome assembly produce by the Newbler assembler provided by Roche and 454 data containing paired-end reads.

  17. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  18. New approach for regional crop yield gap analysis in the Borujen ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... Finally, the results of quantitative analysis (yield estimation in different wheat cropping systems) performed on four ... Yield forecasting, or determining yield in advance of harvest, has been used in many .... a simulation model to problems on regional scale, two methods can be used: simulate first and then ...

  19. New approach for regional crop yield gap analysis in the Borujen ...

    African Journals Online (AJOL)

    Borujen Basin has semiarid climatic conditions with cold winter and winter precipitation. For the sake of it, temperature was a decisive factor during rainfall seasons, limiting the crop growth period. This study demonstrates that WOFOST model can be used to analyze cropping systems and accurately simulate regional wheat ...

  20. Faculty Study: New Mexico Higher Education Institutions Compared with Regional Peers. Gap Analysis

    Science.gov (United States)

    McClure, Beverlee J.

    2006-01-01

    This study addresses concerns regarding compensation disparities between New Mexico institutions and their peers. A recommended adjustment schedule with fiscal requirements is included, but not specific recommendations for faculty at individual institutions. The average salaries for New Mexico institutions were compared with regional peers to…

  1. Filling the Gap : Relationship Between the Serotonin-Transporter-Linked Polymorphic Region and Amygdala Activation

    NARCIS (Netherlands)

    Bastiaansen, Jojanneke A.; Servaas, Michelle N.; Marsman, Jan-Bernard; Ormel, Johan; Nolte, Ilja M.; Riese, Harriette; Aleman, Andre

    2014-01-01

    The alleged association between the serotonin-transporter-linked polymorphic region (5-HTTLPR) and amygdala activation forms a cornerstone of the common view that carrying the short allele of this polymorphism is a potential risk factor for affective disorders. The authors of a recent meta-analysis

  2. Observing Crustal Magnetic Anomalies in Remote Ocean Regions: Filling in the Gaps

    Science.gov (United States)

    Claus, B.; Kinsey, J. C.; Tominaga, M.; Tivey, M.

    2016-12-01

    The use of long duration ocean observing platforms is necessary for filling in broad gaps in the observational record of magnetic anomaly measurements in the ocean basins -- observations that are necessary for understanding a variety of geophysical processes. Such an instrument would need to gather 1000s of kilometers of magnetic data untended, requiring in-situ calibration methods and minimization of energy usage. In this work an autonomous underwater glider (AUG) has been equipped with a low power flux-gate magnetic sensor. Sensor integration was tested locally in shallow water followed by deep water trials to verify the calibration procedure in June of 2016. During this cruise a 160 kilometer magnetic tow was also collected across the East Coast Shelf Anomaly to the South-East of Cape Cod. Following these tests, the AUG was deployed such that it followed the trajectory of the towed magnetic survey to provide a baseline comparison against a known methodology. For these deployments an in-situ calibration procedure was used whereby the vehicle was commanded to perform descending and ascending spirals with its actuators at various discrete locations. When combined with a temperature model for the sensor the calibrated measurements were found to be in agreement with the towed data to within several 10's of nT. These comparative measurements demonstrate the utility of using directed long duration autonomous ocean observing platforms to gather medium wavelength crustal magnetic anomaly features. This ability is especially desirable for collecting measurements in remote ocean basins, such as the Southern Ocean, where presently only a few ship tracks exist and are likely to never be sampled by conventional research vessels surveys.

  3. The role of place branding in local and regional economic development: bridging the gap between policy and practicality

    Directory of Open Access Journals (Sweden)

    Evan Cleave

    2016-01-01

    Full Text Available Place branding has become an increasingly integral part of local and regional economic development strategies in the global competition for business investment. Professional and academic understanding remains limited, however, regarding whether place branding can be classified as a ‘high-road’ policy with substantive and effective merits or a ‘low-road’ policy that is generally inefficient and ineffective at fostering sustainable economic growth. Through the context of business attraction, this study examines whether place branding represents ‘high-road’ policy by comparing what economic development practitioners are doing to create and support their brands against the needs and desires of businesses considering relocation. The research goal is achieved through a series of in-depth interviews with economic development practitioners (n = 25 and private-sector site selectors (n = 10 in the province of Ontario, Canada. Gaps between policy and practicality are identified by comparing the responses of the two groups. Results demonstrate that place branding has the potential to be ‘high-road’ policy given its utility in business attraction. In its current implementation, however, place branding remains better described as a ‘low-road’ policy, as it is not being used efficiently. Several gaps in place-branding policy are identified, including an overreliance on visual identities and narratives, poor communication of the brand information, and overemphasis on presenting quality of life and affordability. These gaps present possible areas of ineffectiveness that can limit the ability of a place brand to attract investment, but provide areas of future policy improvements, thus enabling place branding to shift from ‘low road’ to ‘high road’.

  4. Experimental and Numerical Study of Windage Losses in the Narrow Gap Region of a High-Speed Electric Motor

    Directory of Open Access Journals (Sweden)

    Kevin R. Anderson

    2018-03-01

    Full Text Available Windage (drag losses have been found to be a key design factor for high power density and high-speed electric motor development. Inducing axial flow between rotor and stator is a common method in cooling the rotor. Hence, it is necessary to understand the effect on windage while forced axial airflow is in present in the air gap. The current paper presents results from experimental testing and modeling of a high-speed motor designed to operate at 30,000 revolutions per minute (RPM and utilize axial air cooling of 200 Liters per minute (LPM to cool the motor. Details of the experimental apparatus and computational fluid dynamics (CFD modeling of the small gap narrow region of the stator/rotor are outlined in the paper. The experimental results are used to calibrate the CFD model. Results for windage losses, flow rate of cooling air, power and torque of the motor versus mass flow rate are given in the paper. Trade studies of CFD on the effect of inlet cooling flow rate, and parasitic heat transfer losses on the Taylor–Couette flow coherent flow structure breakdown are presented. Windage losses on the order of 20 W are found to be present in the configuration tested and simulated.

  5. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  6. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  7. Bridging the Gap between Policy-Driven Land Use Changes and Regional Climate Projections

    Science.gov (United States)

    Berckmans, J.; Hamdi, R.; Dendoncker, N.; Ceulemans, R.

    2017-12-01

    Land use land cover changes (LULCC) can impact the regional climate by two mechanisms: biogeochemical and biogeophysical. The biogeochemical mechanism of the LULCC alters the chemical composition of the atmosphere by greenhouse gas emissions. The biogeophysical mechanism forces changes in the heat and moisture transfer between the land and the atmosphere. The different representations of the future LULCC under influence of the biogeochemical mechanism are included in the IPCC Radiative Concentration Pathways (RCPs). In contrast, the RCPs do not incorporate the biogeophysical effects. Although considerable research has been devoted to the biogeophysical effects of LULCC on climate, less attention has been paid to assessing the full (both biogeochemical and biogeophysical) LULCC impact on the regional climate in modeling studies. Due to the large variety of small changes in the landscape of Western Europe, the small scale climate impact by the LULCC has been achieved using high-resolution scenarios. The "ALARM" project that was governed by the European Commission generated LULCC data on a resolution of 250x250 m for three time steps: 2020, 2050 and 2080. The CNRM-CM5.1 global climate model has been downscaled to perform simulations with ALARO-SURFEX for the near-term future. Both climate changes and land cover changes have been assessed based on RCP and ALARM scenarios. The use of the land surface model SURFEX with its tiling approach allowed us to accurately represent the small scale changes in the landscape. The largest landscape changes contain the abandonment of agricultural land and the increase in forestry and urban areas. Our results show that the conversions from rural areas to urban areas and arable land to forest in Western Europe considerable affect the near-surface temperature and to a lesser extent the precipitation. These results are related to modifications demonstrated in the surface energy budget. The LULCC have a significant impact compared to the

  8. Mapping moderate-scale land-cover over very large geographic areas within a collaborative framework: A case study of the Southwest Regional Gap Analysis Project (SWReGAP)

    Science.gov (United States)

    Lowry, J.; Ramsey, R.D.; Thomas, K.; Schrupp, D.; Sajwaj, T.; Kirby, J.; Waller, E.; Schrader, S.; Falzarano, S.; Langs, L.; Manis, G.; Wallace, C.; Schulz, K.; Comer, P.; Pohs, K.; Rieth, W.; Velasquez, C.; Wolk, B.; Kepner, W.; Boykin, K.; O'Brien, L.; Bradford, D.; Thompson, B.; Prior-Magee, J.

    2007-01-01

    Land-cover mapping efforts within the USGS Gap Analysis Program have traditionally been state-centered; each state having the responsibility of implementing a project design for the geographic area within their state boundaries. The Southwest Regional Gap Analysis Project (SWReGAP) was the first formal GAP project designed at a regional, multi-state scale. The project area comprises the southwestern states of Arizona, Colorado, Nevada, New Mexico, and Utah. The land-cover map/dataset was generated using regionally consistent geospatial data (Landsat ETM+ imagery (1999-2001) and DEM derivatives), similar field data collection protocols, a standardized land-cover legend, and a common modeling approach (decision tree classifier). Partitioning of mapping responsibilities amongst the five collaborating states was organized around ecoregion-based "mapping zones". Over the course of 21/2 field seasons approximately 93,000 reference samples were collected directly, or obtained from other contemporary projects, for the land-cover modeling effort. The final map was made public in 2004 and contains 125 land-cover classes. An internal validation of 85 of the classes, representing 91% of the land area was performed. Agreement between withheld samples and the validated dataset was 61% (KHAT = .60, n = 17,030). This paper presents an overview of the methodologies used to create the regional land-cover dataset and highlights issues associated with large-area mapping within a coordinated, multi-institutional management framework. ?? 2006 Elsevier Inc. All rights reserved.

  9. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  10. Methodological challenges to bridge the gap between regional climate and hydrology models

    Science.gov (United States)

    Bozhinova, Denica; José Gómez-Navarro, Juan; Raible, Christoph; Felder, Guido

    2017-04-01

    The frequency and severity of floods worldwide, together with their impacts, are expected to increase under climate change scenarios. It is therefore very important to gain insight into the physical mechanisms responsible for such events in order to constrain the associated uncertainties. Model simulations of the climate and hydrological processes are important tools that can provide insight in the underlying physical processes and thus enable an accurate assessment of the risks. Coupled together, they can provide a physically consistent picture that allows to assess the phenomenon in a comprehensive way. However, climate and hydrological models work at different temporal and spatial scales, so there are a number of methodological challenges that need to be carefully addressed. An important issue pertains the presence of biases in the simulation of precipitation. Climate models in general, and Regional Climate models (RCMs) in particular, are affected by a number of systematic biases that limit their reliability. In many studies, prominently the assessment of changes due to climate change, such biases are minimised by applying the so-called delta approach, which focuses on changes disregarding absolute values that are more affected by biases. However, this approach is not suitable in this scenario, as the absolute value of precipitation, rather than the change, is fed into the hydrological model. Therefore, bias has to be previously removed, being this a complex matter where various methodologies have been proposed. In this study, we apply and discuss the advantages and caveats of two different methodologies that correct the simulated precipitation to minimise differences with respect an observational dataset: a linear fit (FIT) of the accumulated distributions and Quantile Mapping (QM). The target region is Switzerland, and therefore the observational dataset is provided by MeteoSwiss. The RCM is the Weather Research and Forecasting model (WRF), driven at the

  11. Improving the Gap between Model Predictions and Observations of Formaldehyde over the Remote Marine Regions

    Science.gov (United States)

    Trueblood, J.; Meskhidze, N.

    2013-05-01

    Formaldehyde (HCHO) is a ubiquitous oxidation product that exists in polluted rural and urban areas, as well as remote background sites where it is an important photochemical intermediate. HCHO levels of up to six times above what is typically predicted by photochemical models have been reported over the Marine Boundary Layer (MBL). As proposed mechanisms for HCHO production remain to be insufficient to explain such large discrepancies between model predictions and measured values, the role of marine regions in the creation of HCHO continues to be one of the largest sources of uncertainty in current global chemistry-transport models. Here we examine the viability of a proposed mechanism for the photochemical production of formaldehyde involving aerosols enriched with biologically produced organic matter. In this study, the phytoplankton Emiliania Huxleyi was incubated in autoclaved seawater contained within a 9 liter Pyrex glass bottle. Quantitative analysis of the enrichment of transparent exopolymer particles (TEP) and other biologically produced organic matter (dissolved and particulate) in the surface microlayer was carried out by employing Alldredge's alcian blue staining technique. To produce organic aerosols, enriched seawater was bubbled with hydrocarbon free air using a sintered glass filter placed 5 cm below the surface. Utilizing a mixed flow reaction scheme, produced aerosols were then pushed through stainless steel flow tubes into a separate 9-liter Pyrex glass container acting as a residence chamber. The container was surrounded with six Ushio 9W Midrange UVB lights to allow for the irradiation of aerosols at 306 nm. A flow rate of approximately 0.1 l/min allowed for an average aerosol residence time of 90 minutes inside the residence chamber. All air from the chamber was then passed through a 5" long Pyrex desorber tube packed with 60/80 Tenax that had been soaked in the derivatizing agent pentafluorophenyl hydrazine (PFPH). Subsequent thermal

  12. Bridging scale gaps between regional maps of forest aboveground biomass and field sampling plots using TanDEM-X data

    Science.gov (United States)

    Ni, W.; Zhang, Z.; Sun, G.

    2017-12-01

    Several large-scale maps of forest AGB have been released [1] [2] [3]. However, these existing global or regional datasets were only approximations based on combining land cover type and representative values instead of measurements of actual forest aboveground biomass or forest heights [4]. Rodríguez-Veiga et al[5] reported obvious discrepancies of existing forest biomass stock maps with in-situ observations in Mexico. One of the biggest challenges to the credibility of these maps comes from the scale gaps between the size of field sampling plots used to develop(or validate) estimation models and the pixel size of these maps and the availability of field sampling plots with sufficient size for the verification of these products [6]. It is time-consuming and labor-intensive to collect sufficient number of field sampling data over the plot size of the same as resolutions of regional maps. The smaller field sampling plots cannot fully represent the spatial heterogeneity of forest stands as shown in Figure 1. Forest AGB is directly determined by forest heights, diameter at breast height (DBH) of each tree, forest density and tree species. What measured in the field sampling are the geometrical characteristics of forest stands including the DBH, tree heights and forest densities. The LiDAR data is considered as the best dataset for the estimation of forest AGB. The main reason is that LiDAR can directly capture geometrical features of forest stands by its range detection capabilities.The remotely sensed dataset, which is capable of direct measurements of forest spatial structures, may serve as a ladder to bridge the scale gaps between the pixel size of regional maps of forest AGB and field sampling plots. Several researches report that TanDEM-X data can be used to characterize the forest spatial structures [7, 8]. In this study, the forest AGB map of northeast China were produced using ALOS/PALSAR data taking TanDEM-X data as a bridges. The TanDEM-X InSAR data used in

  13. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  14. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  15. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  16. Regional assessment of pan-Pacific urban environments over 25 years using annual gap free Landsat data

    Science.gov (United States)

    Lu, Yuhao; Coops, Nicholas C.; Hermosilla, Txomin

    2016-08-01

    Urbanization and the associated change in land cover has been intensifying across the globe in recent decades. Regional studies on the rate and amount of urban expansion are critical for understanding how patterns of change differ within and among cities with varying structure and development characteristics. Yet spatially consistent and timely information on urban development is difficult to access particularly across international jurisdictions. Remote sensing based technologies offer a unique perspective on urban land cover with the data offering significant potential to urban studies due to its consistent and ubiquitous nature. In this research we applied a pixel-based image composite technique to generate annual gap-free surface reflectance Landsat composites from 1984 to 2012 for 25 urban environments across 12 countries in the Pacific Rim. Using time series composites, spectral indices were calculated and compared using a hexagonal grid ring model to assess changes in vegetative and urban patterns. Trajectories were then clustered to further investigate the spatio-temporal dynamics and relationships among the 25 cities. Performance of the clustering analyses varied depended on the temporal and spatial metrics however overall clustering results indicated relatively strong spatio-temporal similarities among a number of key cities. Three pairs of cities-Melbourne and Sydney; Tianjin and Manila; and Singapore City and Kuala Lumpur were found to be highly similar in their urban and vegetation dynamics temporally and spatially. In contrast Vancouver and Las Vegas had no similar analogous. This work demonstrates the value of utilising annual Landsat time series composites for assessing urban vegetation and urban dynamics at regional scales and potential use in sustainable urban planning, resources allocation, and policy making.

  17. Replication of the plasmid pBR322 under the control of a cloned replication origin from the single-stranded DNA phage M13.

    OpenAIRE

    Cleary, J M; Ray, D S

    1980-01-01

    The replication origins of viral and complementary strands of bacteriophage M13 DNA are contained within a 507-nucleotide intergenic region of the viral genome. Chimeric plasmids have been constructed by inserting restriction endonuclease fragments of the M13 intergenic region into the plasmid pBR322. Replication of these hybrid plasmids, under conditions not permissive for the plasmid replicon, depends on specific segments of the M13 origin region and on the presence of M13 helper virus. Thu...

  18. [Supply and demand of medical specialists in the health facilities of the Ministry of Health: national, regional and by type of specialty gaps].

    Science.gov (United States)

    Zevallos, Leslie; Pastor, Reyna; Moscoso, Betsy

    2011-06-01

    To characterize the supply, demand and the gap of medical specialists in facilities of the Ministry of Health of Peru (MINSA) at the national, regional and specialty type levels. Observational, descriptive study through which we calculated the supply of medical specialists using secondary sources of MINSA. The analysis of the demand for medical specialists was based on two methodologies: the need for specialists according to the guidelines of classification of the health facilities and according to the epidemiological and demographic profile. The arithmetic difference between the estimated demand and the supply was the procedure used to calculate the gap of medical specialists. The Ministry of Health has a total supply at the national level of 6,074 medical specialists of which 61.5% belong to the clinical specialties, 33.2% to the surgical specialties, 4.9% specialities related to aid to diagnosis and treatment and 0.4% to public health specialties. According to the categorization guideline there is a total demand of 11,176 medical specialists and according to the epidemiological and demographic profile of 11,738. The national estimated gaps found are similar in both methods, although they differ widely across regions and by type of specialty. At the regional level, the gaps are greater in Loreto, Piura, Puno and Madre de Dios when estimating the defficit in relation to the supply. Regarding the speciality, the gap is greater in the four basic specialties: gynecology and obstetrics, pediatrics, internal medicine and general surgery. There is a waid gap between supply and demand of medical specialists at the national and regional levels, as a whole representing approximately 45% of the current offer, regardless of the estimation method.

  19. Effect of Global-GAP Policy on Climate Change Perceptions of Smallholder French Beans Farmers in Central and Eastern Regions, Kenya

    Directory of Open Access Journals (Sweden)

    Peter Shimon Otieno

    2017-03-01

    Full Text Available The risks posed by climate change to Sub Saharan Africa’s (SSA smallholder fresh export fruit and vegetables production are amplifying the significance of farmers’ climate change perceptions in enhancing adoption of suitable adaptation strategies. Production of fresh export fruit and vegetables in Kenya has increasingly been done under the Global-GAP standard scheme by smallholder farmers to improve both environmental conservation and market access. The objective of this study was to determine the effect of Global-GAP policy on climate change perceptions of smallholder French beans farmers. The analysis was based on data collected from a random sample of 616 households interviewed in the Central and Eastern regions of Kenya. The study used principal component analysis (PCA to extract farmers’ key prevailing climate change perceptions and logit regression model to examine the effect of Global-GAP policy on climate change perceptions among other socio-economic factors. The PCA analysis extracted three components proxying for ‘droughts’, ‘delay in rainy seasons’, ‘diseases and pests’ and three proxying for ‘hot days’, ‘floods’, and ‘diseases and pests’ as summarizing maximum variance in the perceptions in the Central and Eastern region respectively. The common, study area-wide climate change perception was identified as incidence of diseases and pest. Logit regression analysis found that Global-GAP policy significantly influenced and improved farmers’ probability of perceiving climate change. Other factors found to influence farmers’ probability of having the identified climate change perceptions included regional specificity, access to agricultural extension service, access to credit, plot size, and soil fertility. The policy implication of this study is that the government and service providers should mainstream factors like Global-GAP compliance and regional considerations found to improve probability of

  20. Regional disparities in botulinum toxin A (BoNT-A) therapy for spasticity in Sweden: budgetary consequences of closing the estimated treatment gap.

    Science.gov (United States)

    Ertzgaard, P; Anhammer, M; Forsmark, A

    2017-03-01

    As no national treatment guidelines for spasticity have been issued in Sweden, different regional treatment practices may potentially occur. This study examines botulinum toxin A (BoNT-A) treatment for spasticity on a regional level in Sweden and presents budgetary consequences of closing the estimated treatment gap. Prevalence of spasticity in Sweden was estimated from published data. Regional sales data for BoNT-A were acquired from IMS Health. A set proportion of hospital BoNT-A use was assumed to represent treatment of spasticity. Total intervention cost of BoNT-A treatment was gathered from healthcare regional tariffs, while costs associated with spasticity were derived from publications on multiple sclerosis and stroke. Results show that the regional variation in treatment of spasticity with BoNT-A is large, with approximately every fourth patient being treated in Southern healthcare region compared to every tenth in the Stockholm-Gotland or Western healthcare regions. The incremental cost of filling the reported treatment gap was also assessed and was estimated at around 9.4 million EUR. However, for the incremental cost to be offset by savings in spasticity-related costs, only a small proportion of treatment responders (defined as patients transitioning to a lower severity grade of spasticity) was required (12%). The study revealed apparent regional disparities of BoNT-A treatment for spasticity in Sweden. The results further suggest that the incremental cost of eliminating the treatment gap has a high probability of being offset by savings in direct costs, even at a low proportion of the patients reaching clinical improvement. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Frequent Loss of Genome Gap Region in 4p16.3 Subtelomere in Early-Onset Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Hirohito Kudo

    2011-01-01

    Full Text Available A small portion of Type 2 diabetes mellitus (T2DM is familial, but the majority occurs as sporadic disease. Although causative genes are found in some rare forms, the genetic basis for sporadic T2DM is largely unknown. We searched for a copy number abnormality in 100 early-onset Japanese T2DM patients (onset age <35 years by whole-genome screening with a copy number variation BeadChip. Within the 1.3-Mb subtelomeric region on chromosome 4p16.3, we found copy number losses in early-onset T2DM (13 of 100 T2DM versus one of 100 controls. This region surrounds a genome gap, which is rich in multiple low copy repeats. Subsequent region-targeted high-density custom-made oligonucleotide microarray experiments verified the copy number losses and delineated structural changes in the 1.3-Mb region. The results suggested that copy number losses of the genes in the deleted region around the genome gap in 4p16.3 may play significant roles in the etiology of T2DM.

  2. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block.

    Science.gov (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P

    2010-02-15

    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  3. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  4. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  5. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  6. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  7. InAs/InP quantum dots emitting in the 1.55 μm wavelength region by inserting submonolayer GaP interlayers

    International Nuclear Information System (INIS)

    Gong, Q.; Noetzel, R.; Veldhoven, P.J. van; Eijkemans, T.J.; Wolter, J.H.

    2004-01-01

    We report on the growth of InAs quantum dots (QDs) in GaInAsP on InP (100) substrates by chemical-beam epitaxy, with emission wavelength in the 1.55 μm region. Submonolayer coverage of GaP on the GaInAsP buffer before deposition of the InAs QDs results in most efficient suppression of As/P exchange during InAs growth and subsequent growth interruption under arsenic flux. Continuous wavelength tuning from above 1.6 to below 1.5 μm is thus achieved by varying the coverage of the GaP interlayer within the submonolayer range. Temperature dependent photoluminescence reveals distinct zero-dimensional carrier confinement and indicates that the InAs QDs are free of defects and dislocations

  8. 45S rDNA regions are chromosome fragile sites expressed as gaps in vitro on metaphase chromosomes of root-tip meristematic cells in Lolium spp.

    Directory of Open Access Journals (Sweden)

    Jing Huang

    Full Text Available BACKGROUND: In humans, chromosome fragile sites are regions that are especially prone to forming non-staining gaps, constrictions or breaks in one or both of the chromatids on metaphase chromosomes either spontaneously or following partial inhibition of DNA synthesis and have been well identified. So far, no plant chromosome fragile sites similar to those in human chromosomes have been reported. METHODS AND RESULTS: During the course of cytological mapping of rDNA on ryegrass chromosomes, we found that the number of chromosomes plus chromosome fragments was often more than the expected 14 in most cells for Lolium perenne L. cv. Player by close cytological examination using a routine chromosome preparation procedure. Further fluorescent in situ hybridization (FISH using 45S rDNA as a probe indicated that the root-tip cells having more than a 14-chromosome plus chromosome fragment count were a result of chromosome breakage or gap formation in vitro (referred to as chromosome lesions at 45S rDNA sites, and 86% of the cells exhibited chromosome breaks or gaps and all occurred at the sites of 45S rDNA in Lolium perenne L. cv. Player, as well as in L. multiflorum Lam. cv. Top One. Chromatin depletion or decondensation occurred at various locations within the 45S rDNA regions, suggesting heterogeneity of lesions of 45S rDNA sites with respect to their position within the rDNA region. CONCLUSIONS: The chromosome lesions observed in this study are very similar cytologically to that of fragile sites observed in human chromosomes, and thus we conclude that the high frequency of chromosome lesions in vitro in Lolium species is the result of the expression of 45S rDNA fragile sites. Possible causes for the spontaneous expression of fragile sites and their potential biological significance are discussed.

  9. Infant mortality gap in the Baltic region - Latvia, Estonia, and Lithuania - in relation to macroeconomic factors in 1996-2010.

    Science.gov (United States)

    Ebela, Inguna; Zile, Irisa; Ebela, Danute Razuka; Rozenfelde, Ingrida Rumba

    2013-01-01

    BACKGROUND AND OBJECTIVE. A constant gap has appeared in infant mortality among the 3 Baltic States - Latvia, Estonia, and Lithuania - since the restoration of independence in 1991. The aim of the study was to compare infant mortality rates in all the 3 Baltic countries and examine some of the macro- and socioeconomic factors associated with infant mortality. MATERIAL AND METHODS. The data were obtained from international databases, such as World Health Organization and EUROSTAT, and the national statistical databases of the Baltic States. The time series data sets (1996-2010) were used in the regression and correlation analysis. RESULTS. In all the 3 Baltic States, a strong and significant correlation was found: Latvia (r=-0.81, PLatvia (r=-0.81, PLatvia (r=0.87, PLatvia are apparently explained by less successful adaptation to a new political and economic situation and limited skills in adjusting the healthcare system to the reality of life.

  10. Identifying and closing gaps in environmental monitoring by means of metadata, ecological regionalization and geostatistics using the UNESCO biosphere reserve Rhoen (Germany) as an example.

    Science.gov (United States)

    Schröder, Winfried; Pesch, Roland; Schmidt, Gunther

    2006-03-01

    In Germany, environmental monitoring is intended to provide a holistic view of the environmental condition. To this end the monitoring operated by the federal states must use harmonized, resp., standardized methods. In addition, the monitoring sites should cover the ecoregions without any geographical gaps, the monitoring design should have no gaps in terms of ecologically relevant measurement parameters, and the sample data should be spatially without any gaps. This article outlines the extent to which the Rhoen Biosphere Reserve, occupying a part of the German federal states of Bavaria, Hesse and Thuringia, fulfills the listed requirements. The investigation considered collection, data banking and analysis of monitoring data and metadata, ecological regionalization and geostatistics. Metadata on the monitoring networks were collected by questionnaires and provided a complete inventory and description of the monitoring activities in the reserve and its surroundings. The analysis of these metadata reveals that most of the monitoring methods are harmonized across the boundaries of the three federal states the Rhoen is part of. The monitoring networks that measure precipitation, surface water levels, and groundwater quality are particularly overrepresented in the central ecoregions of the biosphere reserve. Soil monitoring sites are more equally distributed within the ecoregions of the Rhoen. The number of sites for the monitoring of air pollutants is not sufficient to draw spatially valid conclusions. To fill these spatial gaps, additional data on the annual average values of the concentrations of air pollutants from monitoring sites outside of the biosphere reserve had therefore been subject to geostatistical analysis and estimation. This yields valid information on the spatial patterns and temporal trends of air quality. The approach illustrated is applicable to similar cases, as, for example, the harmonization of international monitoring networks.

  11. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  12. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  13. upstream region of the myostatin gene in four chicken breeds and its

    African Journals Online (AJOL)

    user

    2012-05-17

    May 17, 2012 ... polymorphisms (SNPs) of the 5'-upstream region of the myostatin gene were detected by single- stranded conformation polymorphism (SSCP) and DNA sequencing in the Bian, Jinghai, Youxi and. Arbor Acre chickens. Four novel mutations (G673A, G985C, G1085A, and A1278T) were detected. Only.

  14. Delivering Economic Development in the Context of Financial Crisis: A Workforce Gap Analysis of the Sacramento Regional Economy

    Science.gov (United States)

    Taghavian, Alexander H.

    2013-01-01

    Workforce development represents a central priority in a comprehensive effort to create wealth, industry thickening, and broad-based prosperity. From the onset of the Great Recession in 2007, the Sacramento Region experienced anemic economic growth and remained behind the nation in job creation. Contextualized in the aftermath of the economic…

  15. Regional energy efficiency, carbon emission performance and technology gaps in China: A meta-frontier non-radial directional distance function analysis

    International Nuclear Information System (INIS)

    Yao, Xin; Zhou, Hongchen; Zhang, Aizhen; Li, Aijun

    2015-01-01

    At present, China is the largest primary energy consumer and carbon emitter in the world. Meantime, China is a large transitional economy with significant regional gaps. Against such backgrounds, the calculated results of energy and carbon performance indicators may be biased, without considering heterogeneity across regions. To this end, after incorporating region-heterogeneity, this paper provides detailed information, regarding energy efficiency, carbon emission performance and the potential of carbon emission reductions from regional perspectives, which may be important and useful for policy makers. Our main findings are as follows. Firstly, there is significant group-heterogeneity across regions in China, in terms of energy efficiency and carbon emission performance. Secondly, there are no considerable differences between total-factor and single-factor performance indices, since there is limited substitutability between energy inputs and other production inputs. Finally, significant carbon emission reductions can be made by “catching up” for regions with low energy efficiency and carbon emission performance. Looking ahead, the Chinese government should adopt measures to promote improvements in terms of energy efficiency and carbon emission performance in the short term. -- Highlights: •We adopt a meta-frontier non-radial directional distance function analysis. •We provide detailed information regarding energy and carbon emission performance. •We find that there is significant region-heterogeneity in China. •There are no large differences between total- and single-factor performance indices. •It can make great contributions to carbon emission reductions by “catching up”

  16. Knowledge Gaps

    DEFF Research Database (Denmark)

    Lyles, Marjorie; Pedersen, Torben; Petersen, Bent

    2003-01-01

    , assimilating, and utilizing knowledge - are crucial determinants ofknowledge gap elimination. In contrast, the two factors deemed essential in traditionalinternationalization process theory - elapsed time of operations and experientiallearning - are found to have no or limited effect.Key words......: Internationalization, knowledge gap, absorptive capacity, learning box....

  17. Gap junctions.

    Science.gov (United States)

    Goodenough, Daniel A; Paul, David L

    2009-07-01

    Gap junctions are aggregates of intercellular channels that permit direct cell-cell transfer of ions and small molecules. Initially described as low-resistance ion pathways joining excitable cells (nerve and muscle), gap junctions are found joining virtually all cells in solid tissues. Their long evolutionary history has permitted adaptation of gap-junctional intercellular communication to a variety of functions, with multiple regulatory mechanisms. Gap-junctional channels are composed of hexamers of medium-sized families of integral proteins: connexins in chordates and innexins in precordates. The functions of gap junctions have been explored by studying mutations in flies, worms, and humans, and targeted gene disruption in mice. These studies have revealed a wide diversity of function in tissue and organ biology.

  18. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes...

  19. Assessing coastal wetland vulnerability to sea-level rise along the northern Gulf of Mexico coast: Gaps and opportunities for developing a coordinated regional sampling network

    Science.gov (United States)

    Osland, Michael J.; Griffith, Kereen T.; Larriviere, Jack C.; Feher, Laura C.; Cahoon, Donald R.; Enwright, Nicholas M.; Oster, David A.; Tirpak, John M.; Woodrey, Mark S.; Collini, Renee C.; Baustian, Joseph J.; Breithaupt, Joshua L.; Cherry, Julia A; Conrad, Jeremy R.; Cormier, Nicole; Coronado-Molina, Carlos A.; Donoghue, Joseph F.; Graham, Sean A.; Harper, Jennifer W.; Hester, Mark W.; Howard, Rebecca J.; Krauss, Ken W.; Kroes, Daniel; Lane, Robert R.; Mckee, Karen L.; Mendelssohn, Irving A.; Middleton, Beth A.; Moon, Jena A.; Piazza, Sarai; Rankin, Nicole M.; Sklar, Fred H.; Steyer, Gregory D.; Swanson, Kathleen M.; Swarzenski, Christopher M.; Vervaeke, William; Willis, Jonathan M; Van Wilson, K.

    2017-01-01

    Coastal wetland responses to sea-level rise are greatly influenced by biogeomorphic processes that affect wetland surface elevation. Small changes in elevation relative to sea level can lead to comparatively large changes in ecosystem structure, function, and stability. The surface elevation table-marker horizon (SET-MH) approach is being used globally to quantify the relative contributions of processes affecting wetland elevation change. Historically, SET-MH measurements have been obtained at local scales to address site-specific research questions. However, in the face of accelerated sea-level rise, there is an increasing need for elevation change network data that can be incorporated into regional ecological models and vulnerability assessments. In particular, there is a need for long-term, high-temporal resolution data that are strategically distributed across ecologically-relevant abiotic gradients. Here, we quantify the distribution of SET-MH stations along the northern Gulf of Mexico coast (USA) across political boundaries (states), wetland habitats, and ecologically-relevant abiotic gradients (i.e., gradients in temperature, precipitation, elevation, and relative sea-level rise). Our analyses identify areas with high SET-MH station densities as well as areas with notable gaps. Salt marshes, intermediate elevations, and colder areas with high rainfall have a high number of stations, while salt flat ecosystems, certain elevation zones, the mangrove-marsh ecotone, and hypersaline coastal areas with low rainfall have fewer stations. Due to rapid rates of wetland loss and relative sea-level rise, the state of Louisiana has the most extensive SET-MH station network in the region, and we provide several recent examples where data from Louisiana’s network have been used to assess and compare wetland vulnerability to sea-level rise. Our findings represent the first attempt to examine spatial gaps in SET-MH coverage across abiotic gradients. Our analyses can be

  20. Assessing coastal wetland vulnerability to sea-level rise along the northern Gulf of Mexico coast: Gaps and opportunities for developing a coordinated regional sampling network.

    Science.gov (United States)

    Osland, Michael J; Griffith, Kereen T; Larriviere, Jack C; Feher, Laura C; Cahoon, Donald R; Enwright, Nicholas M; Oster, David A; Tirpak, John M; Woodrey, Mark S; Collini, Renee C; Baustian, Joseph J; Breithaupt, Joshua L; Cherry, Julia A; Conrad, Jeremy R; Cormier, Nicole; Coronado-Molina, Carlos A; Donoghue, Joseph F; Graham, Sean A; Harper, Jennifer W; Hester, Mark W; Howard, Rebecca J; Krauss, Ken W; Kroes, Daniel E; Lane, Robert R; McKee, Karen L; Mendelssohn, Irving A; Middleton, Beth A; Moon, Jena A; Piazza, Sarai C; Rankin, Nicole M; Sklar, Fred H; Steyer, Greg D; Swanson, Kathleen M; Swarzenski, Christopher M; Vervaeke, William C; Willis, Jonathan M; Wilson, K Van

    2017-01-01

    Coastal wetland responses to sea-level rise are greatly influenced by biogeomorphic processes that affect wetland surface elevation. Small changes in elevation relative to sea level can lead to comparatively large changes in ecosystem structure, function, and stability. The surface elevation table-marker horizon (SET-MH) approach is being used globally to quantify the relative contributions of processes affecting wetland elevation change. Historically, SET-MH measurements have been obtained at local scales to address site-specific research questions. However, in the face of accelerated sea-level rise, there is an increasing need for elevation change network data that can be incorporated into regional ecological models and vulnerability assessments. In particular, there is a need for long-term, high-temporal resolution data that are strategically distributed across ecologically-relevant abiotic gradients. Here, we quantify the distribution of SET-MH stations along the northern Gulf of Mexico coast (USA) across political boundaries (states), wetland habitats, and ecologically-relevant abiotic gradients (i.e., gradients in temperature, precipitation, elevation, and relative sea-level rise). Our analyses identify areas with high SET-MH station densities as well as areas with notable gaps. Salt marshes, intermediate elevations, and colder areas with high rainfall have a high number of stations, while salt flat ecosystems, certain elevation zones, the mangrove-marsh ecotone, and hypersaline coastal areas with low rainfall have fewer stations. Due to rapid rates of wetland loss and relative sea-level rise, the state of Louisiana has the most extensive SET-MH station network in the region, and we provide several recent examples where data from Louisiana's network have been used to assess and compare wetland vulnerability to sea-level rise. Our findings represent the first attempt to examine spatial gaps in SET-MH coverage across abiotic gradients. Our analyses can be used

  1. Assessing coastal wetland vulnerability to sea-level rise along the northern Gulf of Mexico coast: Gaps and opportunities for developing a coordinated regional sampling network.

    Directory of Open Access Journals (Sweden)

    Michael J Osland

    Full Text Available Coastal wetland responses to sea-level rise are greatly influenced by biogeomorphic processes that affect wetland surface elevation. Small changes in elevation relative to sea level can lead to comparatively large changes in ecosystem structure, function, and stability. The surface elevation table-marker horizon (SET-MH approach is being used globally to quantify the relative contributions of processes affecting wetland elevation change. Historically, SET-MH measurements have been obtained at local scales to address site-specific research questions. However, in the face of accelerated sea-level rise, there is an increasing need for elevation change network data that can be incorporated into regional ecological models and vulnerability assessments. In particular, there is a need for long-term, high-temporal resolution data that are strategically distributed across ecologically-relevant abiotic gradients. Here, we quantify the distribution of SET-MH stations along the northern Gulf of Mexico coast (USA across political boundaries (states, wetland habitats, and ecologically-relevant abiotic gradients (i.e., gradients in temperature, precipitation, elevation, and relative sea-level rise. Our analyses identify areas with high SET-MH station densities as well as areas with notable gaps. Salt marshes, intermediate elevations, and colder areas with high rainfall have a high number of stations, while salt flat ecosystems, certain elevation zones, the mangrove-marsh ecotone, and hypersaline coastal areas with low rainfall have fewer stations. Due to rapid rates of wetland loss and relative sea-level rise, the state of Louisiana has the most extensive SET-MH station network in the region, and we provide several recent examples where data from Louisiana's network have been used to assess and compare wetland vulnerability to sea-level rise. Our findings represent the first attempt to examine spatial gaps in SET-MH coverage across abiotic gradients. Our

  2. Human resources for health planning and management in the Eastern Mediterranean region: facts, gaps and forward thinking for research and policy

    Directory of Open Access Journals (Sweden)

    Abdallah Ahmad

    2007-03-01

    Full Text Available Abstract Background The early decades of the 21st century are considered to be the era of human resources for health (HRH. The World Health Report (WHR 2006 launched the Health Workforce Decade (2006–2015, with high priority given for countries to develop effective workforce policies and strategies. In many countries in the Eastern Mediterranean Region (EMR, particularly those classified as Low and Low-Middle Income Countries (LMICs, the limited knowledge about the nature, scope, composition and needs of HRH is hindering health sector reform. This highlights an urgent need to understand the current reality of HRH in several EMR countries. The objectives of this paper are to: (1 lay out the facts on what we know about the HRH for EMR countries; (2 generate and interpret evidence on the relationship between HRH and health status indicators for LMICs and middle and high income countries (MHICs in the context of EMR; (3 identify and analyze the information gaps (i.e. what we do not know and (4 provide forward thinking by identifying priorities for research and policy. Methods The variables used in the analysis were: nurse and physician density, gross national income, poverty, female literacy, health expenditure, Infant Mortality Rate (IMR, Under 5 Mortality Rate (U5MR, Maternal Mortality Rate (MMR and Life Expectancy (LE. Univariate (charts, bivariate (Pearson correlation and multivariate analysis (linear regression was conducted using SPSS 14.0, besides a synthesis of HRH literature. Results Results demonstrate the significant disparities in physician and nurse densities within the EMR, particularly between LMICs and MHICs. Besides this, significant differences exist in health status indicators within the EMR. Results of the Pearson correlation revealed that physician and nurse density, as well as female literacy in EMR countries were significantly correlated with lower mortality rates and higher life expectancy. Results of the regression

  3. Closing the gap? Top-down versus bottom-up projections of China's regional energy use and CO2 emissions

    DEFF Research Database (Denmark)

    Dai, Hancheng; Mischke, Peggy; Xie, Xuxuan

    2016-01-01

    and demographic trends as well as a carbon tax pathway, we explore how both models respond to these identical exogenous inputs. Then a soft-linking methodology is applied to "narrow the gap" between the results computed by these models. We find for example that without soft-linking, China's baseline CO2 emissions...... might range from 15-20Gt in 2050, while soft-linking models results in 17Gt. Reasons for the results gap between the models are discussed subsequently, such as model structure and statistical inputs. At a sectoral level, the gap can be mainly traced to China's future coal use in electricity production...

  4. Double-Gap Soft Diffraction Results from CDF

    International Nuclear Information System (INIS)

    Goulianos, K.

    2002-01-01

    We present a study of (anti)pp collisions with a leading antiproton and a rapidity gap in addition to that associated with the antiproton. The second gap is either within the region available to the proton dissociation products, (anti)p + p → ((anti)p + gap) + X + gap + Y, or adjacent to the outgoing proton (anti)p + p → ((anti)p + gap) + X + (gap + p ). Results are reported for two-gap to one-gap event ratios and compared with one-gap to no-gap ratios and with theoretical expectations. (author)

  5. Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

    Science.gov (United States)

    Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

    2015-01-01

    The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction

  6. Lambda red mediated gap repair utilizes a novel replicative intermediate in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Thimma R Reddy

    Full Text Available The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion. SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single

  7. The Gap Within the Gap

    Directory of Open Access Journals (Sweden)

    Katherine Michelmore

    2017-02-01

    Full Text Available Gaps in educational achievement between high- and low-income children are growing. Administrative data sets maintained by states and districts lack information about income but do indicate whether a student is eligible for subsidized school meals. We leverage the longitudinal structure of these data sets to develop a new measure of economic disadvantage. Half of eighth graders in Michigan are eligible for a subsidized meal, but just 14% have been eligible for subsidized meals in every grade since kindergarten. These children score 0.94 standard deviations below those who are never eligible for meal subsidies and 0.23 below those who are occasionally eligible. There is a negative, linear relationship between grades spent in economic disadvantage and eighth-grade test scores. This is not an exposure effect; the relationship is almost identical in third-grade, before children have been exposed to varying years of economic disadvantage. Survey data show that the number of years that a child will spend eligible for subsidized lunch is negatively correlated with her or his current household income. Years eligible for subsidized meals can therefore be used as a reasonable proxy for income. Our proposed measure can be used to estimate heterogeneous effects in program evaluations, to improve value-added calculations, and to better target resources.

  8. Crimea and the quest for energy and military hegemony in the Black Sea region: governance gap in a contested geostrategic zone

    NARCIS (Netherlands)

    Blockmans, S.

    2015-01-01

    Russia’s annexation of Crimea and its destabilization of Eastern Ukraine have radically altered the European security order, with the Black Sea region becoming an acutely contested geostrategic zone. Russia’s strategic interests in the Black Sea region, especially in terms of energy and military

  9. Timespace matters - Exploring the gap between knowing about activity patterns of people and knowing how to design and plan urban areas and regions

    NARCIS (Netherlands)

    Van Schaick, J.

    2011-01-01

    It is important to know about peoples’ temporospatial activity patterns when making urban and regional designs and plans. Despite wide acknowledgment of this idea, knowledge about people’s activity patterns does not get full attention in day-to-day practice of urban and regional design and planning.

  10. Recombinant Production of the Amino Terminal Cytoplasmic Region of Dengue Virus Non-Structural Protein 4A for Structural Studies

    OpenAIRE

    Hung, Yu-Fu; Valdau, Olga; Schünke, Sven; Stern, Omer; Koenig, Bernd W.; Willbold, Dieter; Hoffmann, Silke

    2014-01-01

    BACKGROUND: Dengue virus (DENV) is a mosquito-transmitted positive single strand RNA virus belonging to the Flaviviridae family. DENV causes dengue fever, currently the world's fastest-spreading tropical disease. Severe forms of the disease like dengue hemorrhagic fever and dengue shock syndrome are life-threatening. There is no specific treatment and no anti-DENV vaccines. Our recent data suggests that the amino terminal cytoplasmic region of the dengue virus non-structural protein 4A (NS4A)...

  11. New Very Low Noise Multilayer And Graded-Gap Avalanche Photodiodes For The 0.8 To 1 .8 μm Wavelength Region

    Science.gov (United States)

    Capasso, F.; Tsang, W. T.; Williams, G. F.

    1982-12-01

    Recent experimental and theoretical results on a new class of low noise avalanche photo-diodes are reviewed. A large enhancement of the impact ionization rates ratio (a/(3=10) has been demonstrated in AlGaAs/GaAs superlattices and graded band gap detector structures. In addition two novel photodiodes ("staircase" and "channeling" APDs) where only electrons multiply, have been proposed. The staircase APD is the solid state analog of the photo-multiplier with discrete dynodes. It has a low operating voltage (5-20 volts) and a lower excess noise factor, in the ideal case, than that of an ideal conventional APD The channeling APD is instead the solid state analog of a channeltron photomultiplier and has the unique feature of an ultrahigh a/β, ratio (≍∞) compatible with high gain (>100).

  12. Mechanism of gap-filling during postreplication repair of ultraviolet damage in Haemophilus influenzae

    International Nuclear Information System (INIS)

    Small, G.D.

    1975-01-01

    Deoxyribonucleic acid (DNA), pulse labeled after ultraviolet irradiation of excision-defective mutants of Haemophilus influenzae, is of lower single strand molecular weight than that of unirradiated cells but approaches the size of DNA from unirradiated cells upon further incubation in growth medium. This gap-filling process is controlled by the rec-1 gene. Gap-filling occurs normally in a temperature-sensitive DNA synthesis mutant at the restrictive temperature showing that normal semiconservative DNA synthesis is not necessary for gap-filling. To test for recombinational events after irradiation, the DNA synthesized after irradiation was radioactively labeled for a short time in medium containing 5-bromodeoxyuridine followed by incubation for various times in nonradioactive, 5-bromodeoxyuridine-containing medium. The DNA was denatured and analyzed isopycnically. The labeled DNA was initially ''heavy'', but later shifted toward lighter densities. This shift occurred in the temperature-sensitive DNA synthesis mutant at the restrictive temperature and in the recombination-defective mutant rec-2, but was not seen in the rec-1 mutant. The density shift can be interpreted as evidence that rather extensive exchanges occurred between parental DNA and the DNA made after irradiation. These results suggest that such exchanges are important for gap-filling in H. influenzae. (auth)

  13. Gap Task Force

    CERN Multimedia

    Lissuaer, D

    One of the more congested areas in the ATLAS detector is the GAP region (the area between the Barrel Calorimeter and the End Cap calorimeter) where Inner Detector services, LAr Services and some Tile services all must co-habitat in a very limited area. It has been clear for some time that the space in the GAP region is not sufficient to accommodate all that is needed. In the last few month additional problems of routing all the services to Z=0 have been encountered due to the very limited space between the Tile Calorimeter and the first layer of Muon chambers. The Technical Management Board (TMB) and the Executive Board (EB) decided in the middle of March to establish a Task Force to look at this problem and come up with a solution within well-specified guidelines. The task force consisted of experts from the ID, Muon, Liquid Argon and Tile systems in addition to experts from the Technical Coordination team and the Physics coordinator. The task force held many meetings and in general there were some very l...

  14. Opportunity Knocks: Closing the Gaps between Leaders and the Public on Math, Science, & Technology Education--A Qualitative Research Report on the Kansas City Region

    Science.gov (United States)

    Kadlec, Alison; Friedman, Will

    2010-01-01

    The Kansas City region is in many ways representative of the larger national economy. As with many cities of its size, the largest area of employment, other than in government, is in the healthcare sector. While biomedical research is a major growth area across the nation, Kansas City is also the national leader in the animal healthcare industry,…

  15. Project LOCAL - Bridging The Gap

    Science.gov (United States)

    Haven, Robert N.

    1975-01-01

    Project LOCAL, a not-for-profit regional consortium, offers a broad spectrum of in-service training courses tailored to meet the needs of educators in various disciplines and levels of experience. The purpose of these offerings is to bridge the communication gap between innovative centers in computer-oriented education and staff members in Boston…

  16. Mutational analysis of the GAP-related domain of the neurofibromatosis type 1 gene in Brazilian NF1 patients

    Directory of Open Access Journals (Sweden)

    Alessandra B. Trovó

    2004-01-01

    Full Text Available Neurofibromatosis type 1 (NF1 is a common autosomal dominant disorder caused by mutations in the NF1 gene. In the present study, a total of 55 unrelated NF1 patients were screened for mutations in the GAP-related domain/GRD (exons 20-27a by single-strand conformation polymorphism (SSCP. Four different mutations were identified and, taken together, they comprise one nonsense substitution (Q1189X, one deletion (3525-3526delAA, one missense substitution (E1356G and one mutation in the splice acceptor site (c.4111-1G>A. One novel polymorphism (c.4514+11C>G and other three putative polymorphisms were also found (c.3315-27G>A, V1146I and V1317A. Genotype-phenotype correlations were investigated, but no particular association was detected.

  17. A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene's 5'-Flanking Region is Associated with Essential Hypertension among Japanese Females

    OpenAIRE

    Kosuge, Kotoko; Soma, Masayoshi; Nakayama, Tomohiro; Aoi, Noriko; Sato, Mikano; Izumi, Yoichi; Matsumoto, Koichi

    2007-01-01

    Background: Brain natriuretic peptide (BNP) acts primarily as a cardiac hormone; it is produced by the ventricle and has both vasodilatory and natriuretic actions. Therefore, the BNP gene is thought to be a candidate gene for essential hypertension (EH). The present study identified variants in the 5'-flanking region of natriuretic peptide precursor B (NPPB) gene and assessed the relationship between gene variants and EH. Methods: The polymerase chain reaction-single strand conformation polym...

  18. Gaps in the prevention of perinatal transmission of hepatitis B virus between recommendations and routine practices in a highly endemic region: a provincial population-based study in China

    Directory of Open Access Journals (Sweden)

    Hu Yali

    2012-09-01

    Full Text Available Abstract Background Hepatitis B virus (HBV infection is endemic in China; perinatal transmission is the main source of chronic HBV infection. Simultaneous administration of hepatitis B immune globulin (HBIG and hepatitis B vaccine is highly effective to prevent perinatal transmission of HBV; however, the effectiveness also depends on full adherence to the recommended protocols in daily practice. In the present investigation, we aimed to identify gaps in immunoprophylaxis of perinatal transmission of HBV between recommendations and routine practices in Jiangsu Province, China. Methods Totally 626 children from 6 cities and 8 rural areas across Jiangsu Province, China, born from February 2003 to December 2004, were enrolled; 298 were born to mothers with positive hepatitis B surface antigen (HBsAg and 328 were born to HBsAg-negative mothers. Immunoprophylactic measures against hepatitis B were retrospectively reviewed for about half of the children by checking medical records or vaccination cards and the vaccine status was validated for most of children. Results Of 298 children born to HBV carrier mothers, 11 (3.7% were HBsAg positive, while none of 328 children born to non-carrier mothers was HBsAg positive (P  Conclusions There are substantial gaps in the prevention of perinatal HBV infection between the recommendations and routine practices in China, which highlights the importance of full adherence to the recommendations to eliminate perinatal HBV infection in the endemic regions.

  19. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  20. Charting service quality gaps

    OpenAIRE

    Cândido, Carlos; Morris, D. S.

    2000-01-01

    Some of the most influential models in the service management literature (Parasuraman et al., 1985; Grönroos, 1990) focus on the concept of service quality gap (SQG). Parasuraman et al. (1985) define a pioneering model with five SQGs, the concepts of which are amplified in Brogowicz et al.’s (1990) model. The latter has five types of encompassing gaps: information and feedback-related gaps; design-related gaps; implementation-related gaps; communication-related gaps; and customers’ perception...

  1. Behind the Pay Gap

    Science.gov (United States)

    Dey, Judy Goldberg; Hill, Catherine

    2007-01-01

    Women have made remarkable gains in education during the past three decades, yet these achievements have resulted in only modest improvements in pay equity. The gender pay gap has become a fixture of the U.S. workplace and is so ubiquitous that many simply view it as normal. "Behind the Pay Gap" examines the gender pay gap for college graduates.…

  2. Bridging the terahertz gap

    International Nuclear Information System (INIS)

    Davies, Giles; Linfield, Edmund

    2004-01-01

    Over the last century or so, physicists and engineers have progressively explored and conquered the electromagnetic spectrum. Starting with visible light, we have encroached outwards, developing techniques for generating and detecting radiation at both higher and lower frequencies. And as each successive region of the spectrum has been colonized, we have developed technology to exploit the radiation found there. X-rays, for example, are routinely used to image hidden objects. Near-infrared radiation is used in fibre-optic communications and in compact-disc players, while microwaves are used to transmit signals from your mobile phone. But there is one part of the electromagnetic spectrum that has steadfastly resisted our advances. This is the terahertz region, which ranges from frequencies of about 300 GHz to 10 THz (10 x 10 sup 1 sup 2 Hz). This corresponds to wavelengths of between about 1 and 0.03 mm, and lies between the microwave and infrared regions of the spectrum. However, the difficulties involved in making suitably compact terahertz sources and detectors has meant that this region of the spectrum has only begun to be explored thoroughly over the last decade. A particularly intriguing feature of terahertz radiation is that the semiconductor devices that generate radiation at frequencies above and below this range operate in completely different ways. At lower frequencies, microwaves and millimetre- waves can be generated by 'electronic' devices such as those found in mobile phones. At higher frequencies, near-infrared and visible light are generated by 'optical' devices such as semiconductor laser diodes, in which electrons emit light when they jump across the semiconductor band gap. Unfortunately, neither electronic nor optical devices can conveniently be made to work in the terahertz region because the terahertz frequency range sits between the electronic and optical regions of the electromagnetic spectrum. Developing a terahertz source is therefore a

  3. Bridging the Gap

    DEFF Research Database (Denmark)

    Kramer Overgaard, Majken; Broeng, Jes; Jensen, Monika Luniewska

    Bridging the Gap (BtG) is a 2-year project funded by The Danish Industry Foundation. The goal of Bridging the Gap has been to create a new innovation model which will increase the rate at which Danish universities can spinout new technology ventures.......Bridging the Gap (BtG) is a 2-year project funded by The Danish Industry Foundation. The goal of Bridging the Gap has been to create a new innovation model which will increase the rate at which Danish universities can spinout new technology ventures....

  4. Bridging a Cultural Gap

    Science.gov (United States)

    Leviatan, Talma

    2008-01-01

    There has been a broad wave of change in tertiary calculus courses in the past decade. However, the much-needed change in tertiary pre-calculus programmes--aimed at bridging the gap between high-school mathematics and tertiary mathematics--is happening at a far slower pace. Following a discussion on the nature of the gap and the objectives of a…

  5. Theory of hard diffraction and rapidity gaps

    International Nuclear Information System (INIS)

    Del Duca, V.

    1995-06-01

    In this talk we review the models describing the hard diffractive production of jets or more generally high-mass states in presence of rapidity gaps in hadron-hadron and lepton-hadron collisions. By rapidity gaps we mean regions on the lego plot in (pseudo)-rapidity and azimuthal angle where no hadrons are produced, between the jet(s) and an elastically scattered hadron (single hard diffraction) or between two jets (double hard diffraction). (orig.)

  6. Wide-Gap Chalcopyrites

    CERN Document Server

    Siebentritt, Susanne

    2006-01-01

    Chalcopyrites, in particular those with a wide band gap, are fascinating materials in terms of their technological potential in the next generation of thin-film solar cells and in terms of their basic material properties. They exhibit uniquely low defect formation energies, leading to unusual doping and phase behavior and to extremely benign grain boundaries. This book collects articles on a number of those basic material properties of wide-gap chalcopyrites, comparing them to their low-gap cousins. They explore the doping of the materials, the electronic structure and the transport through interfaces and grain boundaries, the formation of the electric field in a solar cell, the mechanisms and suppression of recombination, the role of inhomogeneities, and the technological role of wide-gap chalcopyrites.

  7. Narrow gap electronegative capacitive discharges

    Energy Technology Data Exchange (ETDEWEB)

    Kawamura, E.; Lieberman, M. A.; Lichtenberg, A. J. [Department of Electrical Engineering and Computer Sciences, University of California, Berkeley, California 94720 (United States)

    2013-10-15

    Narrow gap electronegative (EN) capacitive discharges are widely used in industry and have unique features not found in conventional discharges. In this paper, plasma parameters are determined over a range of decreasing gap length L from values for which an electropositive (EP) edge exists (2-region case) to smaller L-values for which the EN region connects directly to the sheath (1-region case). Parametric studies are performed at applied voltage V{sub rf}=500 V for pressures of 10, 25, 50, and 100 mTorr, and additionally at 50 mTorr for 1000 and 2000 V. Numerical results are given for a parallel plate oxygen discharge using a planar 1D3v (1 spatial dimension, 3 velocity components) particle-in-cell (PIC) code. New interesting phenomena are found for the case in which an EP edge does not exist. This 1-region case has not previously been investigated in detail, either numerically or analytically. In particular, attachment in the sheaths is important, and the central electron density n{sub e0} is depressed below the density n{sub esh} at the sheath edge. The sheath oscillations also extend into the EN core, creating an edge region lying within the sheath and not characterized by the standard diffusion in an EN plasma. An analytical model is developed using minimal inputs from the PIC results, and compared to the PIC results for a base case at V{sub rf}=500 V and 50 mTorr, showing good agreement. Selected comparisons are made at the other voltages and pressures. A self-consistent model is also developed and compared to the PIC results, giving reasonable agreement.

  8. Gap length distributions by PEPR

    International Nuclear Information System (INIS)

    Warszawer, T.N.

    1980-01-01

    Conditions guaranteeing exponential gap length distributions are formulated and discussed. Exponential gap length distributions of bubble chamber tracks first obtained on a CRT device are presented. Distributions of resulting average gap lengths and their velocity dependence are discussed. (orig.)

  9. Semantic Gaps Are Dangerous

    DEFF Research Database (Denmark)

    Ejstrup, Michael; le Fevre Jakobsen, Bjarne

    Semantic gaps are dangerous Language adapts to the environment where it serves as a tool to communication. Language is a social agreement, and we all have to stick to both grammaticalized and non-grammaticalized rules in order to pass information about the world around us. As such language develops...... unpolite language and tend to create dangerous relations where specialy language creates problems and trouble that could be avoided if we had better language tools at hand. But we have not these tools of communication, and we are in a situation today where media and specially digital and social media......, supported by new possibilities of migration, create dangerous situations. How can we avoid these accidental gaps in language and specially the gaps in semantic and metaphoric tools. Do we have to keep silent and stop discusing certain isues, or do we have other ways to get acces to sufficient language tools...

  10. Where are the Gaps?

    Science.gov (United States)

    Stoneham, Marshall

    Reading a Handbook like this gives a vivid picture of the enormous vigour and power of materials modelling. One is tempted to believe that we can answer all the questions materials technology might pose. Even if that were partly true, we should be identifying just what we do not know how to do. Some gaps will be depend on new hardware and software, especially when modelling quantum systems. Some gaps will be recognised only after some social or technological change has brought them into focus. Among the developments likely to stimulate innovation could be novel nanoelectronics, or the fields where physics meets biology. Still further gaps exist because we have been slaves to fashion, and have been drawn away from unpopular (roughly translating as "too difficult") fields; examples might include excited state spectroscopy, or electrical breakdown.

  11. The longevity gender gap

    DEFF Research Database (Denmark)

    Aviv, Abraham; Shay, Jerry; Christensen, Kaare

    2005-01-01

    In this Perspective, we focus on the greater longevity of women as compared with men. We propose that, like aging itself, the longevity gender gap is exceedingly complex and argue that it may arise from sex-related hormonal differences and from somatic cell selection that favors cells more...... resistant to the ravages of time. We discuss the interplay of these factors with telomere biology and oxidative stress and suggest that an explanation for the longevity gender gap may arise from a better understanding of the differences in telomere dynamics between men and women....

  12. Bridge the Gap

    DEFF Research Database (Denmark)

    Marselis, Randi

    2017-01-01

    This article focuses on photo projects organised for teenage refugees by the Society for Humanistic Photography (Berlin, Germany). These projects, named Bridge the Gap I (2015), and Bridge the Gap II (2016), were carried out in Berlin and brought together teenagers with refugee and German-majorit...... was produced – and sometimes not produced - within the projects. The importance of memory work in the context of refugee resettlement is often overlooked, but is particularly relevant when cultural encounters are organised in museums and exhibition galleries....

  13. Missing the gap

    DEFF Research Database (Denmark)

    Tanggaard, Lene; Glaveanu, Vlad Petre

    by the premise that difference and gaps are places where creative learning is intensified (Glaveanu & Gillespie, 2015). The public discourse around education is often concerned with minding or avoiding the gap by making education more relevant for or similar to the labour market, but what if facilitating...... creative learning at the borders need not minimize differences, but handle and learn from them? If not, schools and educational institutions risk becoming bad copies of the labour marked instead of enabling students to enter the market with something new, something radically dissimilar from what...

  14. Development of Multidimensional Gap Conductance model using Virtual Link Gap Element

    International Nuclear Information System (INIS)

    Kim, Hyo Chan; Yang, Yong Sik; Kim, Dae Ho; Bang, Je Geon; Kim, Sun Ki; Koo, Yang Hyun

    2013-01-01

    The gap conductance that determines temperature gradient between pellet and cladding can be quite sensitive to gap thickness. For instance, once the gap size increases up to several micrometers in certain region, difference of pellet surface temperatures increases up to 100 Kelvin. Therefore, iterative thermo-mechanical coupled analysis is required to solve temperature distribution throughout pellet and cladding. Recently, multidimensional fuel performance codes have been being developed in the advanced countries to evaluate thermal behavior of fuel for off normal conditions and DBA(design based accident) conditions using the Finite Element Method (FEM). FRAPCON-FRAPTRAN code system, which is well known as the verified and reliable code, incorporates 1D thermal module and multidimensional mechanical module. In this code, multidimensional gap conductance model is not applied. ALCYONE developed by CEA introduces equivalent heat convection coefficient that represents multidimensional gap conductance as a function of gap thickness. BISON, which is multidimensional fuel performance code developed by INL, owns multidimensional gap conductance model using projected thermal contact. In general, thermal contact algorithm is nonlinear calculation which is expensive approach numerically. The gap conductance model for multi-dimension is difficult issue in terms of convergence and nonlinearity because gap conductance is function of gap thickness which depends on mechanical analysis at each iteration step. In this paper, virtual link gap (VLG) element has been proposed to resolve convergence issue and nonlinear characteristic of multidimensional gap conductance. In terms of calculation accuracy and convergence efficiency, the proposed VLG model was evaluated. LWR fuel performance codes should incorporate thermo-mechanical loop to solve gap conductance problem, iteratively. However, gap conductance in multidimensional model is difficult issue owing to its nonlinearity and

  15. Estimating Gender Wage Gaps

    Science.gov (United States)

    McDonald, Judith A.; Thornton, Robert J.

    2011-01-01

    Course research projects that use easy-to-access real-world data and that generate findings with which undergraduate students can readily identify are hard to find. The authors describe a project that requires students to estimate the current female-male earnings gap for new college graduates. The project also enables students to see to what…

  16. 'Mind the Gap!'

    DEFF Research Database (Denmark)

    Persson, Karl Gunnar

    This paper challenges the widely held view that sharply falling real transport costs closed the transatlantic gap in grain prices in the second half of the 19th century. Several new results emerge from an analysis of a new data set of weekly wheat prices and freight costs from New York to UK mark...

  17. Regeneration in canopy gaps of tierra-firme forest in the Peruvian Amazon

    DEFF Research Database (Denmark)

    Karsten, Rune Juelsborg; Jovanovic, Milos; Meilby, Henrik

    2013-01-01

    the regeneration dynamics of logging gaps with naturally occuring canopy gaps. In the concession of Consorcio Forestal Amazonico in the region of Ucayali in the Peruvian Amazon, a total of 210 circular sample plots were established in 35 gaps in unmanaged natural forest and 35 canopy gaps in forest managed...

  18. THE PAL 5 STAR STREAM GAPS

    International Nuclear Information System (INIS)

    Carlberg, R. G.; Hetherington, Nathan; Grillmair, C. J.

    2012-01-01

    Pal 5 is a low-mass, low-velocity-dispersion, globular cluster with spectacular tidal tails. We use the Sloan Digital Sky Survey Data Release 8 data to extend the density measurements of the trailing star stream to 23 deg distance from the cluster, at which point the stream runs off the edge of the available sky coverage. The size and the number of gaps in the stream are measured using a filter which approximates the structure of the gaps found in stream simulations. We find 5 gaps that are at least 99% confidence detections with about a dozen gaps at 90% confidence. The statistical significance of a gap is estimated using bootstrap resampling of the control regions on either side of the stream. The density minimum closest to the cluster is likely the result of the epicyclic orbits of the tidal outflow and has been discounted. To create the number of 99% confidence gaps per unit length at the mean age of the stream requires a halo population of nearly a thousand dark matter sub-halos with peak circular velocities above 1 km s –1 within 30 kpc of the galactic center. These numbers are a factor of about three below cold stream simulation at this sub-halo mass or velocity but, given the uncertainties in both measurement and more realistic warm stream modeling, are in substantial agreement with the LCDM prediction.

  19. Water limits to closing yield gaps

    Science.gov (United States)

    Davis, Kyle Frankel; Rulli, Maria Cristina; Garrassino, Francesco; Chiarelli, Davide; Seveso, Antonio; D'Odorico, Paolo

    2017-01-01

    Agricultural intensification is often seen as a suitable approach to meet the growing demand for agricultural products and improve food security. It typically entails the use of fertilizers, new cultivars, irrigation, and other modern technology. In regions of the world affected by seasonal or chronic water scarcity, yield gap closure is strongly dependent on irrigation (blue water). Global yield gap assessments have often ignored whether the water required to close the yield gap is locally available. Here we perform a gridded global analysis (10 km resolution) of the blue water consumption that is needed annually to close the yield gap worldwide and evaluate the associated pressure on renewable freshwater resources. We find that, to close the yield gap, human appropriation of freshwater resources for irrigation would have to increase at least by 146%. Most study countries would experience at least a doubling in blue water requirement, with 71% of the additional blue water being required by only four crops - maize, rice, soybeans, and wheat. Further, in some countries (e.g., Algeria, Morocco, Syria, Tunisia, and Yemen) the total volume of blue water required for yield gap closure would exceed sustainable levels of freshwater consumption (i.e., 40% of total renewable surface and groundwater resources).

  20. Large gaps between primes

    OpenAIRE

    Maynard, James

    2014-01-01

    We show that there exists pairs of consecutive primes less than $x$ whose difference is larger than $t(1+o(1))(\\log{x})(\\log\\log{x})(\\log\\log\\log\\log{x})(\\log\\log\\log{x})^{-2}$ for any fixed $t$. Our proof works by incorporating recent progress in sieve methods related to small gaps between primes into the Erdos-Rankin construction. This answers a well-known question of Erdos.

  1. Minding the Gap

    Energy Technology Data Exchange (ETDEWEB)

    Firestone, Millicent Anne [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-02-23

    Neutron & X-ray scattering provides nano- to meso-scale details of complex fluid structure; 1D electronic density maps dervied from SAXS yield molecular level insights; Neutron reflectivity provides substructure details of substrate supported complex fluids; Complex fluids composition can be optimized to support a wide variety of both soluble and membrane proteins; The water gap dimensions can be finely tuned through polymer component.

  2. Mind the Gap

    Science.gov (United States)

    Fairbanks, Terry; Savage, Erica; Adams, Katie; Wittie, Michael; Boone, Edna; Hayden, Andrew; Barnes, Janey; Hettinger, Zach; Gettinger, Andrew

    2016-01-01

    Summary Objective Decisions made during electronic health record (EHR) implementations profoundly affect usability and safety. This study aims to identify gaps between the current literature and key stakeholders’ perceptions of usability and safety practices and the challenges encountered during the implementation of EHRs. Materials and Methods Two approaches were used: a literature review and interviews with key stakeholders. We performed a systematic review of the literature to identify usability and safety challenges and best practices during implementation. A total of 55 articles were reviewed through searches of PubMed, Web of Science and Scopus. We used a qualitative approach to identify key stakeholders’ perceptions; semi-structured interviews were conducted with a diverse set of health IT stakeholders to understand their current practices and challenges related to usability during implementation. We used a grounded theory approach: data were coded, sorted, and emerging themes were identified. Conclusions from both sources of data were compared to identify areas of misalignment. Results We identified six emerging themes from the literature and stakeholder interviews: cost and resources, risk assessment, governance and consensus building, customization, clinical work-flow and usability testing, and training. Across these themes, there were misalignments between the literature and stakeholder perspectives, indicating major gaps. Discussion Major gaps identified from each of six emerging themes are discussed as critical areas for future research, opportunities for new stakeholder initiatives, and opportunities to better disseminate resources to improve the implementation of EHRs. Conclusion Our analysis identified practices and challenges across six different emerging themes, illustrated important gaps, and results suggest critical areas for future research and dissemination to improve EHR implementation. PMID:27847961

  3. MV controlled spark gap

    International Nuclear Information System (INIS)

    Evdokimovich, V.M.; Evlampiev, S.B.; Korshunov, G.S.; Nikolaev, V.A.; Sviridov, Yu.F.; Khmyrov, V.V.

    1980-01-01

    A megavolt gas-filled trigatron gap with a sectional gas-discharge chamber having a more than three-fold range of operating voltages is described. The discharge chamber consists of ten sections, each 70 mm thick, made of organic glass. The sections are separated one from another by aluminium gradient rings to which ohmic voltage divider is connected. Insulational sections and gradient rings are braced between themselves by means of metal flanges through gaskets made of oil-resistant rubber with the help of fiberglass-laminate pins. The gap has two electrodes 110 mm in diameter. The trigatron ignition assembly uses a dielectric bushing projecting over the main electrode plane. Use has been made of a gas mixture containing 10% of SF 6 and 90% of air making possible to ensure stable gap operation without readjusting in the voltage range from 0.4 to 1.35 MV. The operation time lag in this range is equal to 10 μs at a spread of [ru

  4. SUBORDINATE GAPS IN MANDARIN CHINESE

    Directory of Open Access Journals (Sweden)

    Ting-Chi Wei

    2011-06-01

    Full Text Available The existence of subordinate gaps in Mandarin Chinese casts doubt on analyses built on canonical coordinate gapping. We observe that the minimality of contrastive focus and the type of subordinate clause determine the acceptability of a missing gap in subordinate structure. Along this vein, we propose that a semantic-based deletion account can be used to interpret gapping in Mandarin. Such account relies on two violable constraints, AvoidF and Focus condition on gapping (Schwarzchild 1999, Merchant 2001 to compute the acceptability of a gap.

  5. GapBlaster-A Graphical Gap Filler for Prokaryote Genomes.

    Science.gov (United States)

    de Sá, Pablo H C G; Miranda, Fábio; Veras, Adonney; de Melo, Diego Magalhães; Soares, Siomar; Pinheiro, Kenny; Guimarães, Luis; Azevedo, Vasco; Silva, Artur; Ramos, Rommel T J

    2016-01-01

    The advent of NGS (Next Generation Sequencing) technologies has resulted in an exponential increase in the number of complete genomes available in biological databases. This advance has allowed the development of several computational tools enabling analyses of large amounts of data in each of the various steps, from processing and quality filtering to gap filling and manual curation. The tools developed for gap closure are very useful as they result in more complete genomes, which will influence downstream analyses of genomic plasticity and comparative genomics. However, the gap filling step remains a challenge for genome assembly, often requiring manual intervention. Here, we present GapBlaster, a graphical application to evaluate and close gaps. GapBlaster was developed via Java programming language. The software uses contigs obtained in the assembly of the genome to perform an alignment against a draft of the genome/scaffold, using BLAST or Mummer to close gaps. Then, all identified alignments of contigs that extend through the gaps in the draft sequence are presented to the user for further evaluation via the GapBlaster graphical interface. GapBlaster presents significant results compared to other similar software and has the advantage of offering a graphical interface for manual curation of the gaps. GapBlaster program, the user guide and the test datasets are freely available at https://sourceforge.net/projects/gapblaster2015/. It requires Sun JDK 8 and Blast or Mummer.

  6. GapBlaster-A Graphical Gap Filler for Prokaryote Genomes.

    Directory of Open Access Journals (Sweden)

    Pablo H C G de Sá

    Full Text Available The advent of NGS (Next Generation Sequencing technologies has resulted in an exponential increase in the number of complete genomes available in biological databases. This advance has allowed the development of several computational tools enabling analyses of large amounts of data in each of the various steps, from processing and quality filtering to gap filling and manual curation. The tools developed for gap closure are very useful as they result in more complete genomes, which will influence downstream analyses of genomic plasticity and comparative genomics. However, the gap filling step remains a challenge for genome assembly, often requiring manual intervention. Here, we present GapBlaster, a graphical application to evaluate and close gaps. GapBlaster was developed via Java programming language. The software uses contigs obtained in the assembly of the genome to perform an alignment against a draft of the genome/scaffold, using BLAST or Mummer to close gaps. Then, all identified alignments of contigs that extend through the gaps in the draft sequence are presented to the user for further evaluation via the GapBlaster graphical interface. GapBlaster presents significant results compared to other similar software and has the advantage of offering a graphical interface for manual curation of the gaps. GapBlaster program, the user guide and the test datasets are freely available at https://sourceforge.net/projects/gapblaster2015/. It requires Sun JDK 8 and Blast or Mummer.

  7. Closing the stop gap

    International Nuclear Information System (INIS)

    Czakon, Michal; Mitov, Alexander; Papucci, Michele; California Univ., Berkeley, CA; Ruderman, Joshua T.; California Univ., Berkeley, CA; New York Univ., NY; Weiler, Andreas; CERN - European Organization for Nuclear Research, Geneva

    2014-07-01

    Light stops are a hallmark of the most natural realizations of weak-scale supersymmetry. While stops have been extensively searched for, there remain open gaps around and below the top mass, due to similarities of stop and top signals with current statistics. We propose a new fast-track avenue to improve light stop searches for R-parity conserving supersymmetry, by comparing top cross section measurements to the theoretical prediction. Stop masses below ∝180 GeV can now be ruled out for a light neutralino. The possibility of a stop signal contaminating the top mass measurement is also briefly addressed.

  8. Photonic band gap materials

    Science.gov (United States)

    Cassagne, D.

    Photonic band gap materials Photonic band gap materials are periodic dielectric structures that control the propagation of electromagnetic waves. We describe the plane wave method, which allows to calculate the band structures of photonic crystals. By symmetry analysis and a perturbative approach, we predict the appearance of the low energy photonic band gaps of hexagonal structures. We propose new two-dimensional structures called graphite and boron nitride. Using a transfer matrix method, we calculate the transmission of the graphite structure and we show the crucial role of the coupling with external modes. We study the appearance of allowed modes in the photonic band gap by the introduction of localized defects in the periodicity. Finally, we discuss the properties of opals formed by self-organized silica microspheres, which are very promising for the fabrication of three-dimensional photonic crystals. Les matériaux à bandes interdites photoniques sont des structures diélectriques périodiques qui contrôlent la propagation des ondes électromagnétiques. Nous décrivons la méthode des ondes planes qui permet de calculer les structures de bandes des cristaux photoniques. Par une analyse de la symétrie et une approche perturbative, nous précisons les conditions d'existence des bandes interdites de basse énergie. Nous proposons de nouvelles structures bidimensionnelles appelées graphite et nitrure de bore. Grâce à une méthode de matrices de transfert, nous calculons la transmission de la structure graphite et nous mettons en évidence le rôle fondamental du couplage avec les modes extérieurs. Nous étudions l'apparition de modes permis dans la bande interdite grâce à l'introduction de défauts dans la périodicité. Enfin, nous discutons les propriétés des opales constituées de micro-billes de silice auto-organisées, qui sont très prometteuses pour la fabrication de cristaux photoniques tridimensionnels.

  9. gap: Genetic Analysis Package

    Directory of Open Access Journals (Sweden)

    Jing Hua Zhao

    2007-06-01

    Full Text Available A preliminary attempt at collecting tools and utilities for genetic data as an R package called gap is described. Genomewide association is then described as a specific example, linking the work of Risch and Merikangas (1996, Long and Langley (1997 for family-based and population-based studies, and the counterpart for case-cohort design established by Cai and Zeng (2004. Analysis of staged design as outlined by Skol et al. (2006 and associate methods are discussed. The package is flexible, customizable, and should prove useful to researchers especially in its application to genomewide association studies.

  10. Gaps in nonsymmetric numerical semigroups

    International Nuclear Information System (INIS)

    Fel, Leonid G.; Aicardi, Francesca

    2006-12-01

    There exist two different types of gaps in the nonsymmetric numerical semigroups S(d 1 , . . . , d m ) finitely generated by a minimal set of positive integers {d 1 , . . . , d m }. We give the generating functions for the corresponding sets of gaps. Detailed description of both gap types is given for the 1st nontrivial case m = 3. (author)

  11. Sequence and expression analysis of gaps in human chromosome 20

    DEFF Research Database (Denmark)

    Minocherhomji, Sheroy; Seemann, Stefan; Mang, Yuan

    2012-01-01

    /or overlap disease-associated loci, including the DLGAP4 locus. In this study, we sequenced ~99% of all three unfinished gaps on human chr 20, determined their complete genomic sizes and assessed epigenetic profiles using a combination of Sanger sequencing, mate pair paired-end high-throughput sequencing......The finished human genome-assemblies comprise several hundred un-sequenced euchromatic gaps, which may be rich in long polypurine/polypyrimidine stretches. Human chromosome 20 (chr 20) currently has three unfinished gaps remaining on its q-arm. All three gaps are within gene-dense regions and...

  12. GAP-REACH

    Science.gov (United States)

    Lewis-Fernández, Roberto; Raggio, Greer A.; Gorritz, Magdaliz; Duan, Naihua; Marcus, Sue; Cabassa, Leopoldo J.; Humensky, Jennifer; Becker, Anne E.; Alarcón, Renato D.; Oquendo, María A.; Hansen, Helena; Like, Robert C.; Weiss, Mitchell; Desai, Prakash N.; Jacobsen, Frederick M.; Foulks, Edward F.; Primm, Annelle; Lu, Francis; Kopelowicz, Alex; Hinton, Ladson; Hinton, Devon E.

    2015-01-01

    Growing awareness of health and health care disparities highlights the importance of including information about race, ethnicity, and culture (REC) in health research. Reporting of REC factors in research publications, however, is notoriously imprecise and unsystematic. This article describes the development of a checklist to assess the comprehensiveness and the applicability of REC factor reporting in psychiatric research publications. The 16-itemGAP-REACH© checklist was developed through a rigorous process of expert consensus, empirical content analysis in a sample of publications (N = 1205), and interrater reliability (IRR) assessment (N = 30). The items assess each section in the conventional structure of a health research article. Data from the assessment may be considered on an item-by-item basis or as a total score ranging from 0% to 100%. The final checklist has excellent IRR (κ = 0.91). The GAP-REACH may be used by multiple research stakeholders to assess the scope of REC reporting in a research article. PMID:24080673

  13. Closing the value gap

    International Nuclear Information System (INIS)

    Snyder, A.V.

    1992-01-01

    It's a predicament. For the most part, investor-owned electric utilities trade at a deep discount to the actual (that is, replacement-cost) value to their assets. That's because most utilities fail to earn real returns large enough to justify raising and investing capital. The result is a value gap, where overall market value is significantly lower than the replacement costs of the assets. This gap is wider for utilities than for virtually any other industry in our economy. In addition to providing education and awareness, senior management must determine which businesses and activities create value and which diminish it. Then, management must allocate capital and human resources appropriately, holding down investments in value-diminishing areas until they can improve their profitability, and aggressively investing in value-enhancing businesses while preserving their profitability. But value management must not stop with resource-allocation decisions. To create a lasting transition to a value management philosophy, the utility's compensation system must also change: executives will have motivation to create value when compensation stems from this goal, not from such misleading accounting measures as earnings-per-share growth or ROE. That requires clear value-creation goals, and the organization must continuously evaluate top management's performance in light of the progress made toward those goals

  14. High-Power Fiber Lasers Using Photonic Band Gap Materials

    Science.gov (United States)

    DiDomenico, Leo; Dowling, Jonathan

    2005-01-01

    High-power fiber lasers (HPFLs) would be made from photonic band gap (PBG) materials, according to the proposal. Such lasers would be scalable in the sense that a large number of fiber lasers could be arranged in an array or bundle and then operated in phase-locked condition to generate a superposition and highly directed high-power laser beam. It has been estimated that an average power level as high as 1,000 W per fiber could be achieved in such an array. Examples of potential applications for the proposed single-fiber lasers include welding and laser surgery. Additionally, the bundled fibers have applications in beaming power through free space for autonomous vehicles, laser weapons, free-space communications, and inducing photochemical reactions in large-scale industrial processes. The proposal has been inspired in part by recent improvements in the capabilities of single-mode fiber amplifiers and lasers to produce continuous high-power radiation. In particular, it has been found that the average output power of a single strand of a fiber laser can be increased by suitably changing the doping profile of active ions in its gain medium to optimize the spatial overlap of the electromagnetic field with the distribution of active ions. Such optimization minimizes pump power losses and increases the gain in the fiber laser system. The proposal would expand the basic concept of this type of optimization to incorporate exploitation of the properties (including, in some cases, nonlinearities) of PBG materials to obtain power levels and efficiencies higher than are now possible. Another element of the proposal is to enable pumping by concentrated sunlight. Somewhat more specifically, the proposal calls for exploitation of the properties of PBG materials to overcome a number of stubborn adverse phenomena that have impeded prior efforts to perfect HPFLs. The most relevant of those phenomena is amplified spontaneous emission (ASE), which causes saturation of gain and power

  15. The Adaptation Finance Gap Report

    DEFF Research Database (Denmark)

    UNEP’s Adaptation Gap Report series focuses on Finance, Technology and Knowledge gaps in climate change adaptation. It compliments the Emissions Gap Report series, and explores the implications of failing to close the emissions gap. The report builds on a 2014 assessment by the United Nations...... Environment Programme (UNEP), which laid out the concept of ‘adaptation gaps’ and outlined three such gaps: technology, finance and knowledge. The 2016 Adaptation Gap Report assesses the difference between the financial costs of adapting to climate change in developing countries and the amount of money...... and highlights challenges associated with measuring progress towards fulfilling the adaptation finance gap, while informing national and international efforts to advance adaptation. It analyses the ‘adaptation finance gap’ against the background of the provisions laid out in the Paris Agreement, and benefits...

  16. Minding the gap

    Directory of Open Access Journals (Sweden)

    Mia Carlberg

    2013-12-01

    Full Text Available The plan for the Round table session was to focus on organizational and social/cultural differences between librarians and faculty with the aim to increase our awareness of the differences when we try to find ways to cooperate within the academy or school. This may help us to sort things out, experience acceptance and take adequate actions, saving energy and perhaps be less frustrated.  The questions that the workshop addressed were: What is in the gap between librarians and faculty when dealing with information literacy? How can we fill the gap? Participants discussed this in detail with the aim of together finding ways to understand it better and make it possible to find ways to fill this gap. By defining it and thereby making it easier to work out a strategy for future action to improve the teaching of information literacy, including listing possible, impossible or nearly impossible ways. The springboard to the discussion was extracted from some projects that the workshop leader has been engaged in since 2009. The first example is a research circle where Uppsala University Library used action research to observe and understand the process when we had the opportunity to implement information literacy classes with progression in an undergraduate program. What worked well? What did not? Why? This work was described together with other examples from Uppsala University to an international panel working with quality issues. What did they think of our work? May this change the ways we are working? How? Another example is an ongoing joint project where librarians and faculty members are trying to define ways to increase the cooperation between the library and faculty and make this cooperation sustainable. Recent experience from this was brought to the discussion.   There are an overwhelming number of papers written in this field. A few papers have inspired these ideas. One article in particular: Christiansen, L., Stombler, M. & Thaxton, L. (2004. A

  17. Integración regional, necesidades de salud de la población y dotación de recursos humanos en sistemas y servicios de salud: aproximación al concepto de estimación de brecha Regional integration, population health needs, and human resources for health systems and services: an approach to the concept of health care gap

    Directory of Open Access Journals (Sweden)

    Arturo Luis Francisco Schweiger

    2007-01-01

    Full Text Available La existencia de brechas asistenciales entre las necesidades de salud de la población y los recursos humanos disponibles para responder a ellas, así como las limitaciones de los métodos que permitirían estimar dichas necesidades, constituyen un factor clave a trabajar para el desarrollo e integración de los sistemas de salud de los países de la región. El objetivo de este trabajo es iniciar un primer examen bibliográfico de las herramientas y procedimientos, presentes en la literatura, empleados para estimar y programar la dotación de recursos humanos en salud y, a partir de la revisión realizada, identificar las ventajas, limitaciones y complementariedades de dichas herramientas, planteando la necesidad de profundizar estudios referentes a su aplicabilidad en el diseño de políticas sanitarias regionales. Desde esa perspectiva se presenta el concepto de Bienes Públicos Globales en Salud, cuya generación y aprovechamiento resulta una alternativa estratégica para la mejora e integración de los sistemas de salud de la región y la población a la que asisten.The existence of gaps between the population's health needs and the human resources available for meeting them, as well as limitations in the methods to estimate such needs, constitute key factors to be tackled in the development and integration of health systems in Latin America. This aim of this study was to conduct an initial literature review on the tools and procedures used to estimate and plan human resources allocation in health and to use this review as the basis for identifying the advantages, limitations, and complementary characteristics of these tools, subsequently proposing the need for more in-depth studies on their applicability for designing regional health policies. The article then presents the concept of global public health goods, the generation and use of which results in a strategic alternative for improving both health systems integration in the region and

  18. Bridging the Evaluation Gap

    Directory of Open Access Journals (Sweden)

    Paul Wouters

    2017-02-01

    Full Text Available Paul Wouters’ essay is concerned with bridging the gap between what we value in our academic work and how we are assessed in formal evaluation exercises. He reflects on the recent evaluation of his own center, and reminds us that it is productive to see evaluations not as the (obviously impossible attempt to produce a true representation of past work, but rather as the exploration and performance of “who one wants to be.” Reflecting on why STS should do more than just play along to survive in the indicator game, he suggests that our field should contribute to changing its very rules. In this endeavor, the attitude and sensibilities developed in our field may be more important than any specific theoretical concepts or methodologies.

  19. Finding the gaps

    Science.gov (United States)

    Stoneham, A. M.

    Much of the pioneering work on radiation damage was based on very simple potentials. Potentials are now much more sophisticated and accurate. Self-consistent molecular dynamics is routine for adiabatic energy surfaces, at least for modest numbers of atoms and modest timescales. This means that non-equilibrium nuclear processes can be followed dynamically. It might also give the illusion that any damage process can be modelled with success. Sadly, this is not yet so. This paper discusses where the gaps lie, and specifically three groups of challenges. The first challenge concerns electronic excited states. The second challenge concerns timescales, from femtoseconds to tens of years. The third challenge concerns length scales, and the link between microscopic (atomistic) and mesoscopic (microstructural) scales. The context of these challenges is materials modification by excitation: the removal of material, the modification of bulk or surface material, the altering of rates of processes or changing of branching ratios, and damage, good or bad.

  20. Measuring the Gap

    Directory of Open Access Journals (Sweden)

    Xinshu She MD, MPH

    2016-02-01

    Full Text Available China is a large country where rapid development is accompanied by growing inequalities. How economic inequalities translate to health inequalities is unknown. Baseline health assessment is lacking among rural Chinese children. We aimed at assessing baseline student health of rural Chinese children and comparing them with those of urban children of similar ages. A cross-sectional study was conducted using the 2003 Global School-Based Student Health Survey among 100 students Grade 4 to 6 from rural Guizhou, China. Results were summarized and compared with public data from urban Beijing using multivariate logistic regression models. Rural children are more likely to not wash their hands before a meal (odds ratio [OR] = 5.71, P .05. Rural parents are more likely to not know their children’s whereabouts (OR = 1.81, P < .05. Rural children are more than 4 times likely to have serious injuries (OR = 4.64, P < .01 and to be bullied (OR = 4.01, P < .01. In conclusion, school-age rural Chinese children exhibit more health risk behaviors and fewer protective factors at baseline compared to their urban counterparts. Any intervention aimed at improving child health should take this distributive gap into consideration.

  1. Radiating gap filler

    International Nuclear Information System (INIS)

    2009-01-01

    Full text: In May, corrosion on the outside wall of the over 50 year old Canadian Chalk River reactor vessel caused a heavy water leak and the reactor was shut down triggering worldwide a nuclear medicine shortage. The reactor is also a major supplier of the isotope molybdenum-99 (Mo-99), a precursor of the medically widely used technetium-99 m . To fill the gap in demand, the Australian Nuclear Science and Technology Organisation has now arranged with US company Lantheus Medical Imaging, Inc., a world leader in medical imaging, to supply Mo-99. Subject to pending Australian regulatory processes, the deal is expected to assist in alleviating the world's current nuclear medicine shortage. As ANSTO is currently also the only global commercial supplier that produces Mo-99 from low enriched uranium (LEU) targets, Lantheus will be the first company bringing LEU derived Tc-99 m to the US market. To date, over 95% of Mo-99 is derived from highly enriched uranium (HEU) targets. However, there are concerns regarding proliferation risks associated with HEU targets and for commercial uses production from LEU targets would be desirable. ANSTO says that global Mo-99 supply chain is fragile and limited and it is working closely with nuclear safety and healthy regulators, both domestically and overseas, to expedite all necessary approvals to allow long-term production and export of medical isotopes.

  2. Gap Winds and Wakes: SAR Observations and Numerical Simulations.

    Science.gov (United States)

    Pan, Feifei; Smith, Ronald B.

    1999-04-01

    The nature of terrain-induced gap winds and wakes in the atmosphere is examined using surface wind data from synthetic aperture radar (SAR) and the shallow water equations. The shallow water model is used to predict the types of wake-jet wind patterns that might occur behind an idealized pair of bell-shaped hills with a gap between them. A regime diagram is constructed based on the width of the gap and the upstream Froude number. Specific predictions of the model are found to compare moderately well with SAR data from four examples of airflow near Unimak Island in the Aleutian Chain. The model predicts the observed wakes and jets, including jets that exceed the upstream speed. Theoretical analysis considers the relative importance of rising terrain and narrowing valley walls in the acceleration of gap winds. Wind speeds in the wake region are controlled by the Bernoulli function and regional pressure. Gap winds therefore are streams of air that have avoided Bernoulli loss over the terrain by passing through gaps. The speed of gap winds can exceed the upstream speed only in ridgelike situations when the regional leeside pressure is lower than the upstream pressure.

  3. Bridging the Gap

    DEFF Research Database (Denmark)

    Dahlberg, Rasmus

    2016-01-01

    Tunnel, approximately 25,000 of them critical to the regional work market. Even though the risk analysis states that the likelihood of a long-term closure (100C days) is very low Danish and Swedish transport authorities have demanded that the infrastructure operator conducts a survey of the preparedness...

  4. Gap solitons in Rabi lattices.

    Science.gov (United States)

    Chen, Zhaopin; Malomed, Boris A

    2017-03-01

    We introduce a two-component one-dimensional system, which is based on two nonlinear Schrödinger or Gross-Pitaevskii equations (GPEs) with spatially periodic modulation of linear coupling ("Rabi lattice") and self-repulsive nonlinearity. The system may be realized in a binary Bose-Einstein condensate, whose components are resonantly coupled by a standing optical wave, as well as in terms of the bimodal light propagation in periodically twisted waveguides. The system supports various types of gap solitons (GSs), which are constructed, and their stability is investigated, in the first two finite bandgaps of the underlying spectrum. These include on- and off-site-centered solitons (the GSs of the off-site type are additionally categorized as spatially even and odd ones), which may be symmetric or antisymmetric, with respect to the coupled components. The GSs are chiefly stable in the first finite bandgap and unstable in the second one. In addition to that, there are narrow regions near the right edge of the first bandgap, and in the second one, which feature intricate alternation of stability and instability. Unstable solitons evolve into robust breathers or spatially confined turbulent modes. On-site-centered GSs are also considered in a version of the system that is made asymmetric by the Zeeman effect, or by birefringence of the optical waveguide. A region of alternate stability is found in the latter case too. In the limit of strong asymmetry, GSs are obtained in a semianalytical approximation, which reduces two coupled GPEs to a single one with an effective lattice potential.

  5. Gap solitons in Rabi lattices

    Science.gov (United States)

    Chen, Zhaopin; Malomed, Boris A.

    2017-03-01

    We introduce a two-component one-dimensional system, which is based on two nonlinear Schrödinger or Gross-Pitaevskii equations (GPEs) with spatially periodic modulation of linear coupling ("Rabi lattice") and self-repulsive nonlinearity. The system may be realized in a binary Bose-Einstein condensate, whose components are resonantly coupled by a standing optical wave, as well as in terms of the bimodal light propagation in periodically twisted waveguides. The system supports various types of gap solitons (GSs), which are constructed, and their stability is investigated, in the first two finite bandgaps of the underlying spectrum. These include on- and off-site-centered solitons (the GSs of the off-site type are additionally categorized as spatially even and odd ones), which may be symmetric or antisymmetric, with respect to the coupled components. The GSs are chiefly stable in the first finite bandgap and unstable in the second one. In addition to that, there are narrow regions near the right edge of the first bandgap, and in the second one, which feature intricate alternation of stability and instability. Unstable solitons evolve into robust breathers or spatially confined turbulent modes. On-site-centered GSs are also considered in a version of the system that is made asymmetric by the Zeeman effect, or by birefringence of the optical waveguide. A region of alternate stability is found in the latter case too. In the limit of strong asymmetry, GSs are obtained in a semianalytical approximation, which reduces two coupled GPEs to a single one with an effective lattice potential.

  6. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    regions and regions of importance for translation, as well as coding sequences of the two genes, were studied using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The genetic analyses were performed in subgroups of 52 Caucasian NIDDM patients and 25 age-matched healthy......To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  7. Yield trends and yield gap analysis of major crops in the world

    NARCIS (Netherlands)

    Hengsdijk, H.; Langeveld, J.W.A.

    2009-01-01

    This study aims to quantify the gap between current and potential yields of major crops in the world, and the production constraints that contribute to this yield gap. Using an expert-based evaluation of yield gaps and the literature, global and regional yields and yield trends of major crops are

  8. PhoneGap for enterprise

    CERN Document Server

    Shotts, Kerri

    2014-01-01

    This book is intended for developers who wish to use PhoneGap to develop useful, rich, secure mobile applications for their enterprise environment. The book assumes you have working knowledge of PhoneGap, HTML5, CSS3, and JavaScript, and a reasonable understanding of networking and n-tier architectures.

  9. LiGAPS-Beef 2018

    NARCIS (Netherlands)

    Linden, van der A.; Ven, van de G.W.J.; Oosting, S.J.; Ittersum, van M.K.; Boer, de I.J.M.

    2018-01-01

    LiGAPS-Beef is a mechanistic model to assess potential and feed-limited beef production in different beef production systems across the world. The model is one of the first using concepts of production ecology to simulate livestock production. LiGAPS-Beef consists of a thermoregulation sub-model, a

  10. LiGAPS-Beef 2017

    NARCIS (Netherlands)

    Linden, van der A.; Ven, van de G.W.J.; Oosting, S.J.; Ittersum, van M.K.; Boer, de I.J.M.

    2017-01-01

    LiGAPS-Beef is a mechanistic model to assess potential and feed-limited beef production in different beef production systems across the world. The model is one of the first using concepts of production ecology to simulate livestock production. LiGAPS-Beef consists of a thermoregulation sub-model, a

  11. False air-bone gap.

    Science.gov (United States)

    Rudmin, F

    1983-01-01

    A single case is reported of a severely hearing-impaired child with a finding of a large air-bone gap on pure-tone audiometry on multiple tests. Exploratory surgery found normal middle ear function. Subsequent audiometry indicated the presence of a false air-bone gap resulting from vibrotactile responses. Test procedures for identifying vibrotactile responses are discussed.

  12. Microstrip microwave band gap structures

    Indian Academy of Sciences (India)

    Microwave band gap structures exhibit certain stop band characteristics based on the periodicity, impedance contrast and effective refractive index contrast. These structures though formed in one-, two- and three-dimensional periodicity, are huge in size. In this paper, microstrip-based microwave band gap structures are ...

  13. The Emissions Gap Report 2014

    DEFF Research Database (Denmark)

    Farrell, Timothy Clifford

    This fifth Emissions Gap report has a different focus from previous years. While it updates the 2020 emissions gap analysis, it gives particular attention to the implications of the global carbon dioxide emissions budget for staying within the 2 °C limit beyond 2020. It does so because countries ...

  14. The fluctuating gap model

    International Nuclear Information System (INIS)

    Cao, Xiaobin

    2011-01-01

    The quasi-one-dimensional systems exhibit some unusual phenomenon, such as the Peierls instability, the pseudogap phenomena and the absence of a Fermi-Dirac distribution function line shape in the photoemission spectroscopy. Ever since the discovery of materials with highly anisotropic properties, it has been recognized that fluctuations play an important role above the three-dimensional phase transition. This regime where the precursor fluctuations are presented can be described by the so called fluctuating gap model (FGM) which was derived from the Froehlich Hamiltonian to study the low energy physics of the one-dimensional electron-phonon system. Not only is the FGM of great interest in the context of quasi-one-dimensional materials, liquid metal and spin waves above T c in ferromagnets, but also in the semiclassical approximation of superconductivity, it is possible to replace the original three-dimensional problem by a directional average over effectively one-dimensional problem which in the weak coupling limit is described by the FGM. In this work, we investigate the FGM in a wide temperature range with different statistics of the order parameter fluctuations. We derive a formally exact solution to this problem and calculate the density of states, the spectral function and the optical conductivity. In our calculation, we show that a Dyson singularity appears in the low energy density of states for Gaussian fluctuations in the commensurate case. In the incommensurate case, there is no such kind of singularity, and the zero frequency density of states varies differently as a function of the correlation lengths for different statistics of the order parameter fluctuations. Using the density of states we calculated with non-Gaussian order parameter fluctuations, we are able to calculate the static spin susceptibility which agrees with the experimental data very well. In the calculation of the spectral functions, we show that as the correlation increases, the quasi

  15. The fluctuating gap model

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Xiaobin

    2011-01-15

    The quasi-one-dimensional systems exhibit some unusual phenomenon, such as the Peierls instability, the pseudogap phenomena and the absence of a Fermi-Dirac distribution function line shape in the photoemission spectroscopy. Ever since the discovery of materials with highly anisotropic properties, it has been recognized that fluctuations play an important role above the three-dimensional phase transition. This regime where the precursor fluctuations are presented can be described by the so called fluctuating gap model (FGM) which was derived from the Froehlich Hamiltonian to study the low energy physics of the one-dimensional electron-phonon system. Not only is the FGM of great interest in the context of quasi-one-dimensional materials, liquid metal and spin waves above T{sub c} in ferromagnets, but also in the semiclassical approximation of superconductivity, it is possible to replace the original three-dimensional problem by a directional average over effectively one-dimensional problem which in the weak coupling limit is described by the FGM. In this work, we investigate the FGM in a wide temperature range with different statistics of the order parameter fluctuations. We derive a formally exact solution to this problem and calculate the density of states, the spectral function and the optical conductivity. In our calculation, we show that a Dyson singularity appears in the low energy density of states for Gaussian fluctuations in the commensurate case. In the incommensurate case, there is no such kind of singularity, and the zero frequency density of states varies differently as a function of the correlation lengths for different statistics of the order parameter fluctuations. Using the density of states we calculated with non-Gaussian order parameter fluctuations, we are able to calculate the static spin susceptibility which agrees with the experimental data very well. In the calculation of the spectral functions, we show that as the correlation increases, the

  16. Kinetic calculation of plasma deposition in castellated tile gaps

    International Nuclear Information System (INIS)

    Dejarnac, R.; Gunn, J.P.

    2007-01-01

    Plasma-facing divertors and limiters are armoured with castellated tiles to withstand intense heat fluxes. Recent experimental studies show that a non-negligible amount of deuterium is deposited in the gaps between tiles. We present here a numerical study of plasma deposition in this critical region. For this purpose we have developed a particle-in-cell code with realistic boundary conditions determined from kinetic calculations. We find a strong asymmetry of plasma deposition into the gaps. A significant fraction of the plasma influx is expelled from the gap to be deposited on the leading edge of the downstream tile

  17. Predicting sequence and structural specificities of RNA binding regions recognized by splicing factor SRSF1

    Directory of Open Access Journals (Sweden)

    Wang Xin

    2011-12-01

    Full Text Available Abstract Background RNA-binding proteins (RBPs play diverse roles in eukaryotic RNA processing. Despite their pervasive functions in coding and noncoding RNA biogenesis and regulation, elucidating the sequence specificities that define protein-RNA interactions remains a major challenge. Recently, CLIP-seq (Cross-linking immunoprecipitation followed by high-throughput sequencing has been successfully implemented to study the transcriptome-wide binding patterns of SRSF1, PTBP1, NOVA and fox2 proteins. These studies either adopted traditional methods like Multiple EM for Motif Elicitation (MEME to discover the sequence consensus of RBP's binding sites or used Z-score statistics to search for the overrepresented nucleotides of a certain size. We argue that most of these methods are not well-suited for RNA motif identification, as they are unable to incorporate the RNA structural context of protein-RNA interactions, which may affect to binding specificity. Here, we describe a novel model-based approach--RNAMotifModeler to identify the consensus of protein-RNA binding regions by integrating sequence features and RNA secondary structures. Results As an example, we implemented RNAMotifModeler on SRSF1 (SF2/ASF CLIP-seq data. The sequence-structural consensus we identified is a purine-rich octamer 'AGAAGAAG' in a highly single-stranded RNA context. The unpaired probabilities, the probabilities of not forming pairs, are significantly higher than negative controls and the flanking sequence surrounding the binding site, indicating that SRSF1 proteins tend to bind on single-stranded RNA. Further statistical evaluations revealed that the second and fifth bases of SRSF1octamer motif have much stronger sequence specificities, but weaker single-strandedness, while the third, fourth, sixth and seventh bases are far more likely to be single-stranded, but have more degenerate sequence specificities. Therefore, we hypothesize that nucleotide specificity and

  18. Sobrevivência de espécies arbóreas plantadas em clareiras causadas pela colheita de madeira em uma floresta de terra firme no município de Paragominas na Amazônia brasileira Survival of seedlings planted in gaps after harvesting in a terra firme rain forest in Paragominas region in the Brazilian Amazonia

    Directory of Open Access Journals (Sweden)

    Jaqueline Macêdo Gomes

    2010-03-01

    Full Text Available Analisou-se a sobrevivência de mudas plantadas em 400 clareiras causadas por exploração florestal de impacto reduzido, em floresta de terra firme na Amazônia Oriental. Foram plantadas 3.818 mudas de 17 espécies, das quais apenas Schizolobium amazonicum não ocorre na área de estudo. A distância entre as mudas plantadas foi de aproximadamente 5m. As avaliações ocorreram em 2005 e 2006. Com base na sobrevivência das mudas aos 11 meses após o plantio, as espécies indicadas para o enriquecimento de clareiras são: Schizolobium amazonicum, Cedrela odorata, Jacaranda copaia, Manilkara huberi, Astronium gracile, Pouteria bilocularis, Tabebuia impetiginosa,Pseudopiptadenia suaveolens, Cordia goeldiana, Parkia gigantocarpa, Simarouba amara, Sterculia pilosa, Laetia procera, Dinizia excelsa e Schefflera morototoni. Estudos sobre a taxa de crescimento, em períodos mais longos, são necessários para confirmar a utilização dessas espécies em plantios de enriquecimento de clareiras oriundas de exploração florestal, como alternativa para aumentar a produtividade e o valor econômico das florestas naturais manejadas na Amazônia brasileira.Survival of seedlings planted in 400 gaps created by reduced impact logging in a terra firme forest in the Eastern Amazonia was evaluated. 3,818 seedlings from 17 species occurring in the study area, except for Schizolobium amazonicum (paricá, which is rare in natural forests of Paragominas region, were planted in the gaps. Spacing of planted seedlings was 5m. According to survival of seedlings during 11 months after planting, the species Schizolobium amazonicum, Cedrela odorata, Jacaranda copaia, Manilkara huberi, Astronium gracile, Pouteria bilocularis, Tabebuia impetiginosa,Pseudopiptadenia suaveolens, Cordia goeldiana, Parkia gigantocarpa, Simarouba amara, Sterculia pilosa, Laetia procera, Dinizia excelsa and Schefflera morototoni can be suggested for enriching in gaps created by reduced impact logging

  19. Gap Surface Plasmon Waveguide Analysis

    DEFF Research Database (Denmark)

    Nielsen, Michael Grøndahl; Bozhevolnyi, Sergey I.

    2014-01-01

    Plasmonic waveguides supporting gap surface plasmons (GSPs) localized in a dielectric spacer between metal films are investigated numerically and the waveguiding properties at telecommunication wavelengths are presented. Especially, we emphasize that the mode confinement can advantageously be con...

  20. Closing the Cybersecurity Skills Gap

    Directory of Open Access Journals (Sweden)

    Rebecca Vogel

    2016-05-01

    Full Text Available The current consensus is that there is a worldwide gap in skills needed for a competent cybersecurity workforce. This skills gap has implications for the national security sector, both public and private. Although the view is that this will take a concerted effort to rectify, it presents an opportunity for IT professionals, university students, and aspirants to take-up jobs in national security national intelligence as well military and law enforcement intelligence. This paper examines context of the issue, the nature of the cybersecurity skills gap, and some key responses by governments to address the problem. The paper also examines the emerging employment trends, some of the employment challenges, and what these might mean for practice. The paper argues that the imperative is to close the cyber skills gap by taking advantage of the window of opportunity, allowing individuals interested in moving into the cybersecurity field to do so via education and training.

  1. The region of XRCC1 which harbours the three most common nonsynonymous polymorphic variants, is essential for the scaffolding function of XRCC1

    DEFF Research Database (Denmark)

    Hanssen-Bauer, Audun; Solvang-Garten, Karin; Gilljam, Karin Margaretha

    2012-01-01

    for recruitment of XRCC1 to sites of DNA damage and DNA replication. Also, we found that ectopic expression of the region from residue 166-436 partially rescued the methyl methanesulfonate (MMS) hypersensitivity of XRCC1-deficient EM9 cells, suggesting a key role for this region in mediating DNA repair. The three...... most common amino acid variants of XRCC1, Arg194Trp, Arg280His and Arg399Gln, are located within the region comprising the NLS and BRCT1 domains, and these variants may be associated with increased incidence of specific types of cancer. While we could not detect differences in the intra......XRCC1 functions as a non-enzymatic, scaffold protein in single strand break repair (SSBR) and base excision repair (BER). Here, we examine different regions of XRCC1 for their contribution to the scaffolding functions of the protein. We found that the central BRCT1 domain is essential...

  2. Verb gapping: an action-gap compatibility study.

    Science.gov (United States)

    Claus, Berry

    2015-03-01

    This study addresses the processing of verb-gapping sentences, e.g., John closes a juice bottle and Jim [ ] a lemonade bottle. The goal was to explore if there would be an interaction between language comprehension and motor action not only for overt action verbs but also for gapped verbs. Participants read gapping sentences that either described clockwise or counter-clockwise manual rotations (e.g., closes vs. opens a juice bottle). Adopting a paradigm developed by Zwaan and Taylor (2006), sentence presentation was frame-by-frame. Participants proceeded from frame to frame by turning a knob either clockwise or counter clockwise. Analyses of the frame reading-times yielded a significant effect of compatibility between the linguistically conveyed action and the knob turning for the overt-verb (e.g., closes/opens a juice bottle) as well as for the gapped-verb frame (e.g., a lemonade bottle) - with longer reading times in the match condition than in the mismatch condition - but not for any of the other frames (e.g., and Jim). The results are promising in providing novel evidence for the real-time reactivation of gapped verbs and in suggesting that action simulation is not bound to the processing of overt verbs. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. A Quick Reference on Anion Gap and Strong Ion Gap.

    Science.gov (United States)

    Torrente Artero, Carlos

    2017-03-01

    Metabolic acid-base disorders are common in emergency and critically ill patients. Clinicians may have difficulty recognizing their presence when multiple acid-base derangements are present in a single patient simultaneously. The anion gap and the strong ion gap concepts are useful calculations to identify the components of complex metabolic acid-base associated to the presence of unmeasured anions. This article presents their definition, normal values, indications, limitations, and guidelines for interpretation of changes in the clinical setting. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. RPC Gap Production and Performance for CMS RE4 Upgrade

    CERN Document Server

    Park, Sung Keun

    2014-01-01

    The 4th trigger station composed of 144 double-gap Resistive Plate Chambers (RPC) is currently being constructed to enhance muon-trigger efficiency in the Endcap regions of the CMS detector. Korea Detector Laboratory in Korea has produced qualified RPC gaps in accordance with the quality-assurance procedure proposed by the CMS RPC group. The qualified RPC gaps passing the sophisticated quality-control (QC) steps have been delivered to three assembly sites; CERN in Switzerland, BARC in India, and Ghent University in Belgium for the RPC detector assembly. Here, we report the QC procedures for the crucial selection and the performance of the qualified RE4 RPC gaps shown in the high-statistics QC data.

  5. ABORT GAP CLEANING IN RHIC

    International Nuclear Information System (INIS)

    DREES, A.; AHRENS, L.; III FLILLER, R.; GASSNER, D.; MCINTYRE, G.T.; MICHNOFF, R.; TRBOJEVIC, D.

    2002-01-01

    During the RHIC Au-run in 2001 the 200 MHz storage cavity system was used for the first time. The rebucketing procedure caused significant beam debunching in addition to amplifying debunching due to other mechanisms. At the end of a four hour store, debunched beam could account for approximately 30%-40% of the total beam intensity. Some of it will be in the abort gap. In order to minimize the risk of magnet quenching due to uncontrolled beam losses at the time of a beam dump, a combination of a fast transverse kicker and copper collimators were used to clean the abort gap. This report gives an overview of the gap cleaning procedure and the achieved performance

  6. Addressing the military gap in the western Balkans and closing the gap through regional cooperation

    Science.gov (United States)

    2017-06-09

    Membership Action Plan, Security Environment, European Union, NATO, Joint Enabling Capabilities 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT...Explosive Ordinance Device EU European Union GDP Gross Domestic Product MAP Membership Action Plan NATO North Atlantic Treaty Organization...collective defense. The research also addresses the potential capabilities of the A-5 countries, which can be used as a complementary capability for

  7. The Adaptation Gap Report - a Preliminary Assessment

    DEFF Research Database (Denmark)

    Alverson, Keith; Olhoff, Anne; Noble, Ian

    This first Adaptation Gap report provides an equally sobering assessment of the gap between adaptation needs and reality, based on preliminary thinking on how baselines, future goals or targets, and gaps between them might be defined for climate change adaptation. The report focuses on gaps in de...

  8. Gap junctions and motor behavior

    DEFF Research Database (Denmark)

    Kiehn, Ole; Tresch, Matthew C.

    2002-01-01

    The production of any motor behavior requires coordinated activity in motor neurons and premotor networks. In vertebrates, this coordination is often assumed to take place through chemical synapses. Here we review recent data suggesting that electrical gap-junction coupling plays an important role...... to the production of motor behavior in adult mammals....

  9. Globalization and the Gender Gap

    NARCIS (Netherlands)

    Oostendorp, R.H.

    2004-01-01

    There are several theoretical reasons why globalization will have a narrowing as well as a widening effect on the gender wage gap, but little is known about the actual impact, except for some country studies. This study contributes to the literature in three respects. First, it is a large

  10. The Politics of Achievement Gaps

    DEFF Research Database (Denmark)

    Valant, J.; Newark, D. A.

    2016-01-01

    For decades, researchers have documented large differences in average test scores between minority and White students and between poor and wealthy students. These gaps are a focal point of reformers’ and policymakers’ efforts to address educational inequities. However, the U.S. public’s views...

  11. Talent Management: Bridging the Gap

    Science.gov (United States)

    2015-06-12

    culling continues at each grade. By this process, the model proposes to raise the talent distribution and level. Professional sports use this method... TALENT MANAGEMENT: BRIDGING THE GAP A thesis presented to the Faculty of the U.S. Army Command and General Staff College in...

  12. AUDIT EXPECTATION GAP IN THE PUBLIC SECTOR IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Gherai Dana Simona

    2011-12-01

    between level of knowledge of the students regarding the statements in audit and the expectation gap. Also there is a significant difference in perceptions of the role of the public auditor in respect of fraud detection. The research will be extended to other users of accounting information (accountants, executives, managers, bankers to see their understanding of the role of external public auditors, this we consider Originality/value – This paper adds evidence to the important debate about expectation gap from a region that has had little coverage. In Romania are just a few information regarding the importance of education in reducing the audit expectation gap in public area. We try to draw attention in two sectors that are left one side, education and public domain. A correlation between these two, in the context of audit expectation gap will give some answers absolutely necessary.

  13. Using yield gap analysis to give sustainable intensification local meaning

    NARCIS (Netherlands)

    Silva, João Vasco

    2017-01-01

    Yield gap analysis is useful to understand the relative contribution of growth-defining, -limiting and -reducing factors to actual yields. This is traditionally performed at the field level using mechanistic crop growth simulation models, and directly up-scaled to the regional and global levels

  14. How to close the ever widening gap of Africa's agriculture

    NARCIS (Netherlands)

    Bindraban, P.S.; Löffler, H.J.M.; Rabbinge, R.

    2008-01-01

    While global food availability increased by 27% per person over the past four decades, it decreased by 12% in Sub-Saharan Africa (SSA). This paper explores the role of technology use on agricultural development to understand the ever widening gap of SSA with other global regions. It looks into land

  15. Looking for new emperor penguin colonies? Filling the gaps

    Directory of Open Access Journals (Sweden)

    André Ancel

    2017-01-01

    Our analysis highlights a fundamental requirement, that in order to predict how species might respond to regional climate change, we must better understand their biogeography and the factors that lead to their occupation of particular sites. Regarding emperor penguins, remote sensing should target the identified gaps apparently devoid of penguins in order to update the total number of colonies, to re-evaluate both the regional and global population of emperor penguins, and to gain a better understanding of their biogeography.

  16. Hydrogeologic Model for the Gable Gap Area, Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Bjornstad, Bruce N.; Thorne, Paul D.; Williams, Bruce A.; Last, George V.; Thomas, Gregory S.; Thompson, Michael D.; Ludwig, Jami L.; Lanigan, David C.

    2010-09-30

    Gable Gap is a structural and topographic depression between Gable Mountain and Gable Butte within the central Hanford Site. It has a long and complex geologic history, which includes tectonic uplift synchronous with erosional downcutting associated with the ancestral Columbia River during both Ringold and Cold Creek periods, and by the later Ice Age (mostly glacial Lake Missoula) floods. The gap was subsequently buried and partially backfilled by mostly coarse-grained, Ice Age flood deposits (Hanford formation). Erosional remnants of both the Ringold Formation and Cold Creek unit locally underlie the high-energy flood deposits. A large window exists in the gap where confined basalt aquifers are in contact with the unconfined suprabasalt aquifer. Several paleochannels, of both Hanford and Ringold Formation age, were eroded into the basalt bedrock across Gable Gap. Groundwater from the Central Plateau presently moves through Gable Gap via one or more of these shallow paleochannels. As groundwater levels continue to decline in the region, groundwater flow may eventually be cut off through Gable Gap.

  17. Turbine Blade Tip-Gap Flow Physics and Control

    Science.gov (United States)

    Douville, Travis

    2005-11-01

    A linear cascade that is designed to simulate the flow around blades in the low-pressure turbine stage of turbo-jet engines is used to study the physics of the tip-gap flow and vortex. The cascade consists of three Pratt & Whitney ``PakB'' blades. The experiment investigated gap sizes of 0.5 to 5.0 percent of the blade axial chord, and Reynolds numbers from 100K to 500K that correspond to tip relative Mach numbers of 0.04 to 0.21. Static pressure ports at mid and tip spanwise locations recorded blade pressure distributions. Static end wall taps recorded pressures in the gap region. A five-hole Pitot probe that was traversed in the blade wakes was used to determine total pressure loss coefficients and local velocity vectors. Baseline measurements were analyzed across the range of Reynolds numbers and gap sizes to categorize their effects. These were then compared to flow changes produced by a passive flow control device placed at the end of a blade to locally reduce the gap height. Its effect on the tip-gap flow is presented.

  18. Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost.

    Directory of Open Access Journals (Sweden)

    Roger M Benoit

    Full Text Available Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides.

  19. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  20. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  1. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  2. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  3. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  4. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  5. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  6. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  7. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  8. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  9. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  10. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  11. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  12. Source-based nomenclature for single-strand homopolymers and copolymers (IUPAC Recommendations 2016)

    Czech Academy of Sciences Publication Activity Database

    Jones, R. G.; Kitayama, T.; Hellwich, K. H.; Hess, M.; Jenkins, A. D.; Kahovec, Jaroslav; Kratochvíl, Pavel; Mita, I.; Mormann, W.; Ober, C. K.; Penczek, S.; Stepto, R. F. T.; Thurlow, K.; Vohlídal, J.; Wilks, E. S.

    2016-01-01

    Roč. 88, 10-11 (2016), s. 1073-1100 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : apparent monomer * copolymer * end-groups Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.626, year: 2016

  13. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  14. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  15. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  16. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  17. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  18. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  19. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  20. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  1. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  2. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  3. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  4. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  5. GAP junctional communication in brain secondary organizers.

    Science.gov (United States)

    Bosone, Camilla; Andreu, Abraham; Echevarria, Diego

    2016-06-01

    Gap junctions (GJs) are integral membrane proteins that enable the direct cytoplasmic exchange of ions and low molecular weight metabolites between adjacent cells. They are formed by the apposition of two connexons belonging to adjacent cells. Each connexon is formed by six proteins, named connexins (Cxs). Current evidence suggests that gap junctions play an important part in ensuring normal embryo development. Mutations in connexin genes have been linked to a variety of human diseases, although the precise role and the cell biological mechanisms of their action remain almost unknown. Among the big family of Cxs, several are expressed in nervous tissue but just a few are expressed in the anterior neural tube of vertebrates. Many efforts have been made to elucidate the molecular bases of Cxs cell biology and how they influence the morphogenetic signal activity produced by brain signaling centers. These centers, orchestrated by transcription factors and morphogenes determine the axial patterning of the mammalian brain during its specification and regionalization. The present review revisits the findings of GJ composed by Cx43 and Cx36 in neural tube patterning and discuss Cx43 putative enrollment in the control of Fgf8 signal activity coming from the well known secondary organizer, the isthmic organizer. © 2016 The Authors. Development, Growth & Differentiation published by John Wiley & Sons Australia, Ltd on behalf of Japanese Society of Developmental Biologists.

  6. The wide gap resistive plate chamber

    International Nuclear Information System (INIS)

    Crotty, I.; Lamas Valverde, J.; Hatzifotiadou, D.; Williams, M.C.S.; Zichichi, A.

    1995-01-01

    The resistive plate chamber (RPC) has good time and position resolution; these factors (coupled to its simple construction) make it an attractive candidate for muon trigger systems at future colliders. However, operated in spark mode, the RPC has severe rate problems that make it unusable above 10 Hz/cm 2 . We have previously published our results concerning the operation of the RPC in spark and in avalanche mode; we have shown that the rate limit can be increased to 150 Hz/cm 2 if the RPC is operated in avalanche mode. Here, we discuss the performance of chambers with 6 and 8 mm gas gaps (compared to the more usual 2 mm gap). We outline the reasons for this choice, and also discuss anode versus cathode strip readout. We have measured the efficiency versus flux, and also show that an enhanced rate limit can be obtained if only a small region of the chamber is exposed to the beam (spot illumination). Finally we have tested the performance of chambers constructed with other materials for the resistiv e plate and compare it to chambers constructed with our preferred plastic, melamine laminate. (orig.)

  7. Gaps in EU Foreign Policy

    DEFF Research Database (Denmark)

    Larsen, Henrik

    of Capability-Expectations Gap in the study of European foreign policy. Through examples from relevant literature, Larsen not only demonstrates how this concept sets up standards for the EU as a foreign policy actor (that are not met by most other international actors) but also shows how this curtails analysis......This book argues that theories of European foreign policy are performative: they create the objects they analyse. In this text, Larsen outlines the performativity approach to the role of theories based on the work of Derrida and goes on to examine the performative role of Christopher Hill's concept...... of EU foreign policy. The author goes on to discuss how the widespread use of the concept of ‘gap' affects the way in which EU foreign policy has been studied; and that it always produces the same result: the EU is an unfulfilled actor outside the realm of “normal” actors in IR. This volume offers new...

  8. Homolumo Gap and Matrix Model

    CERN Document Server

    Andric, I; Jurman, D; Nielsen, H B

    2007-01-01

    We discuss a dynamical matrix model by which probability distribution is associated with Gaussian ensembles from random matrix theory. We interpret the matrix M as a Hamiltonian representing interaction of a bosonic system with a single fermion. We show that a system of second-quantized fermions influences the ground state of the whole system by producing a gap between the highest occupied eigenvalue and the lowest unoccupied eigenvalue.

  9. Filling in biodiversity threat gaps

    DEFF Research Database (Denmark)

    Joppa, L. N.; O'Connor, Brian; Visconti, Piero

    2016-01-01

    increase to 10,000 times the background rate should species threatened with extinction succumb to pressures they face (4). Reversing these trends is a focus of the Convention on Biological Diversity's 2020 Strategic Plan for Biodiversity and its 20 Aichi Targets and is explicitly incorporated...... into the United Nations' 2030 Agenda for Sustainable Development and its 17 Sustainable Development Goals (SDGs). We identify major gaps in data available for assessing global biodiversity threats and suggest mechanisms for closing them....

  10. Prometheus and the Keeler gap

    Science.gov (United States)

    Tajeddine, Radwan; Nicholson, Phillip D.; Hedman, Matthew M.; French, Richard G.; Tiscareno, Matthew S.; Burns, Joseph A.

    2014-11-01

    Linblad resonances with Saturn’s satellites are located at many radii in the rings. While some cause density or bending waves, others hold gap edges from spreading, like the 2:1 resonance with Mimas located at the B-ring edge, the 7:6 resonance with Janus at the A-ring edge, and the 32:31 resonance with Prometheus at the inner edge of the Keeler gap. The latter is the case of study here.Theoretically, the inner edge of the Keeler gap should have 32 regular sinusoidal lobes, where either the maximum or the minimum radius is expected to be aligned with Prometheus and rotating with its mean motion. We show that such is not the case. Fit of occultation data shows the presence of the 32:31 resonance, however, the fit residuals is as high as the amplitude of the resonance amplitude (about 2 km). Analysis of the ISS data, shows irregularities overlapping the lobes (Tiscareno et al. 2005, DPS), that follow Keplerian motion. These irregularities may be due to clumps of particles with different eccentricities than the rest of the edge particles. This phenomenon may be caused by the resonance, as it has not been observed at other circular edges were no resonance is present at their location. The ISS data also shows that the lobe’s minimum/maximum is not perfectly aligned with the longitude of Prometheus, which may be due to libration about the centre of the resonance.

  11. Gap Junctions and Chagas Disease

    Science.gov (United States)

    Adesse, Daniel; Goldenberg, Regina Coeli; Fortes, Fabio S.; Jasmin; Iacobas, Dumitru A.; Iacobas, Sanda; de Carvalho, Antonio Carlos Campos; de Narareth Meirelles, Maria; Huang, Huan; Soares, Milena B.; Tanowitz, Herbert B.; Garzoni, Luciana Ribeiro; Spray, David C.

    2013-01-01

    Gap junction channels provide intercellular communication between cells. In the heart, these channels coordinate impulse propagation along the conduction system and through the contractile musculature, thereby providing synchronous and optimal cardiac output. As in other arrhythmogenic cardiac diseases, chagasic cardiomyopathy is associated with decreased expression of the gap junction protein connexin43 (Cx43) and its gene. Our studies of cardiac myocytes infected with Trypanosoma cruzi have revealed that synchronous contraction is greatly impaired and gap junction immunoreactivity is lost in infected cells. Such changes are not seen for molecules forming tight junctions, another component of the intercalated disc in cardiac myocytes. Transcriptomic studies of hearts from mouse models of Chagas disease and from acutely infected cardiac myocytes in vitro indicate profound remodelling of gene expression patterns involving heart rhythm determinant genes, suggesting underlying mechanisms of the functional pathology. One curious feature of the altered expression of Cx43 and its gene expression is that it is limited in both extent and location, suggesting that the more global deterioration in cardiac function may result in part from spread of damage signals from more seriously compromised cells to healthier ones. PMID:21884887

  12. Hyper-active gap filling.

    Science.gov (United States)

    Omaki, Akira; Lau, Ellen F; Davidson White, Imogen; Dakan, Myles L; Apple, Aaron; Phillips, Colin

    2015-01-01

    Much work has demonstrated that speakers of verb-final languages are able to construct rich syntactic representations in advance of verb information. This may reflect general architectural properties of the language processor, or it may only reflect a language-specific adaptation to the demands of verb-finality. The present study addresses this issue by examining whether speakers of a verb-medial language (English) wait to consult verb transitivity information before constructing filler-gap dependencies, where internal arguments are fronted and hence precede the verb. This configuration makes it possible to investigate whether the parser actively makes representational commitments on the gap position before verb transitivity information becomes available. A key prediction of the view that rich pre-verbal structure building is a general architectural property is that speakers of verb-medial languages should predictively construct dependencies in advance of verb transitivity information, and therefore that disruption should be observed when the verb has intransitive subcategorization frames that are incompatible with the predicted structure. In three reading experiments (self-paced and eye-tracking) that manipulated verb transitivity, we found evidence for reading disruption when the verb was intransitive, although no such reading difficulty was observed when the critical verb was embedded inside a syntactic island structure, which blocks filler-gap dependency completion. These results are consistent with the hypothesis that in English, as in verb-final languages, information from preverbal noun phrases is sufficient to trigger active dependency completion without having access to verb transitivity information.

  13. Holographic entropy inequalities and gapped phases of matter

    International Nuclear Information System (INIS)

    Bao, Ning; Cao, ChunJun; Walter, Michael; Wang, Zitao

    2015-01-01

    We extend our studies of holographic entropy inequalities to gapped phases of matter. For any number of regions, we determine the linear entropy inequalities satisfied by systems in which the entanglement entropy satisfies an exact area law. In particular, we find that all holographic entropy inequalities are valid in such systems. In gapped systems with topological order, the “cyclic inequalities” derived recently for the holographic entanglement entropy generalize the Kitaev-Preskill formula for the topological entanglement entropy. Finally, we propose a candidate linear inequality for general 4-party quantum states.

  14. Innovation gaps in Scandinavian rural tourism

    DEFF Research Database (Denmark)

    Hjalager, Anne Mette; Kwiatkowski, Grzegorz; Østervig Larsen, Martin

    2018-01-01

    , the study offers a model that identifies the following five innovation gaps in Scandinavian rural tourism: (1) the portfolio gap, (2) the policy departmentalization gap, (3) the knowledge gap, (4) the change motivation gap, and (5) the resource interpretation gap. At the empirical level, the study shows...... that rural tourism has its basis in a dichotomy between authenticity and modernization. New and prospective customer groups, particularly from Germany, demand more diversified and higher quality rural tourism products than current groups, for example, in relation to outdoor opportunities, leisure festivals...

  15. Geographic Variation of District-Level Gender Achievement Gaps within the United States

    Science.gov (United States)

    Reardon, Sean; Fahle, Erin; Kalogrides, Demetra; Podolsky, Anne; Zarate, Rosalia

    2016-01-01

    Gender achievement gaps on national and state assessments have been a popular research topic over the last few decades. Many prior studies examine these gaps in different subjects (e.g., mathematics, reading, and science) and grades (typically kindergarten through eighth grade) for students living in various regions (typically states or countries)…

  16. A study of the influence of forest gaps on fire–atmosphere interactions

    Science.gov (United States)

    Michael T. Kiefer; Warren E. Heilman; Shiyuan Zhong; Joseph J. (Jay) Charney; Xindi (Randy) Bian

    2016-01-01

    Much uncertainty exists regarding the possible role that gaps in forest canopies play in modulating fire–atmosphere interactions in otherwise horizontally homogeneous forests. This study examines the influence of gaps in forest canopies on atmospheric perturbations induced by a low-intensity fire using the ARPS-CANOPY model, a version of the Advanced Regional...

  17. When yield gaps are poverty traps: The paradigm of ecological intensification in African smallholder agriculture

    NARCIS (Netherlands)

    Tittonell, P.A.; Giller, K.E.

    2013-01-01

    Yield gaps are pervasive in African smallholder agriculture, and are large for almost all crops in all regions. There is consensus that poor soil fertility and nutrient availability are the major biophysical limitations to agricultural production in the continent. We identify two major yield gaps:

  18. DNA sequencing with pyrophosphatase

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1996-03-12

    A kit or solution for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule having a second single-stranded region homologous to the first single-stranded region, comprising a first agent able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture, and a second agent able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

  19. Hyper-active gap filling

    Directory of Open Access Journals (Sweden)

    Akira eOmaki

    2015-04-01

    Full Text Available Much work has demonstrated that speakers of verb-final languages are able to construct rich syntactic representations in advance of verb information. This may reflect general architectural properties of the language processor, or it may only reflect a language-specific adaptation to the demands of verb-finality. The present study addresses this issue by examining whether speakers of a verb-medial language (English wait to consult verb transitivity information before constructing filler-gap dependencies, where internal arguments are fronted and hence precede the verb. This configuration makes it possible to investigate whether the parser actively makes representational commitments on the gap position before verb transitivity information becomes available. A key prediction of the view that rich pre-verbal structure-building is a general architectural property is that speakers of verb-medial languages should predictively construct dependencies in advance of verb transitivity information, and therefore that disruption should be observed when the verb has intransitive subcategorization frames that are incompatible with the predicted structure. In three reading experiments (self-paced and eye-tracking that manipulated verb transitivity, we found evidence for reading disruption when the verb was intransitive, although no such reading difficulty was observed when the critical verb was embedded inside a syntactic island structure, which blocks filler-gap dependency completion. These results are consistent with the hypothesis that in English, as in verb-final languages, information from preverbal NPs is sufficient to trigger active dependency completion without having access to verb transitivity information.

  20. Explaining the gender wage gap in Georgia

    OpenAIRE

    Khitarishvili, Tamar

    2009-01-01

    This paper evaluates gender wage differentials in Georgia between 2000 and 2004. Using ordinary least squares, we find that the gender wage gap in Georgia is substantially higher than in other transition countries. Correcting for sample selection bias using the Heckman approach further increases the gender wage gap. The Blinder Oaxaca decomposition results suggest that most of the wage gap remains unexplained. The explained portion of the gap is almost entirely attributed to industrial variab...

  1. Gap Year: Time off, with a Plan

    Science.gov (United States)

    Torpey, Elka Maria

    2009-01-01

    A gap year allows people to step off the usual educational or career path and reassess their future. According to people who have taken a gap year, the time away can be well worth it. This article can help a person decide whether to take a gap year and how to make the most of his time off. It describes what a gap year is, including its pros and…

  2. Gender Wage Gap in Urban China

    OpenAIRE

    Yuan Ni

    2005-01-01

    This paper analyses the gender wage gap and returns to education in urban China using data collected from Fangshan, Beijing. The traditional Oaxaca decomposition shows that the unexplained part seems to dominate the gender wage gap in urban China. The Appleton decomposition, which takes into account sectoral location, shows that the gender gap is mostly within sector and most of the intra-sector wage gap is unexplained. The gender pay differential due to sectoral location is small; in fact, t...

  3. A PHOTONIC BAND GAP FIBRE

    DEFF Research Database (Denmark)

    1999-01-01

    An optical fibre having a periodicidal cladding structure provididing a photonic band gap structure with superior qualities. The periodical structure being one wherein high index areas are defined and wherein these are separated using a number of methods. One such method is the introduction...... of additional low index elements, another method is providing elongated elements deformed in relation to a circular cross section. Also described is a cladding structure comprising elongated elements of a material having an index of refraction higher than that of the material adjacent thereto. Using...

  4. Superconducting gap anomaly in heavy fermion systems

    Indian Academy of Sciences (India)

    of a pseudo-gap due to superconductivity and the signature of a hybridization gap at the. Fermi level. For the choice of the model parameters, the DOS shows that the HFS is a metal and undergoes a transition to the gap-less superconducting state. Keywords. Heavy fermion superconductor; Narrow band system; Valence ...

  5. Closing the gap between research and management

    Science.gov (United States)

    Deborah M. Finch; Marcia Patton-Mallory

    1993-01-01

    In this paper, we evaluate the reasons for gaps in communication between researchers and natural resource managers and identify methods to close these gaps. Gaps originate from differing patterns of language use, disparities in organizational culture and values, generation of knowledge that is too narrowly-focused to solve complex problems, failure by managers to relay...

  6. Forest canopy gap distributions in the southern Peruvian Amazon.

    Directory of Open Access Journals (Sweden)

    Gregory P Asner

    Full Text Available Canopy gaps express the time-integrated effects of tree failure and mortality as well as regrowth and succession in tropical forests. Quantifying the size and spatial distribution of canopy gaps is requisite to modeling forest functional processes ranging from carbon fluxes to species interactions and biological diversity. Using high-resolution airborne Light Detection and Ranging (LiDAR, we mapped and analyzed 5,877,937 static canopy gaps throughout 125,581 ha of lowland Amazonian forest in Peru. Our LiDAR sampling covered a wide range of forest physiognomies across contrasting geologic and topographic conditions, and on depositional floodplain and erosional terra firme substrates. We used the scaling exponent of the Zeta distribution (λ as a metric to quantify and compare the negative relationship between canopy gap frequency and size across sites. Despite variable canopy height and forest type, values of λ were highly conservative (λ mean  = 1.83, s  = 0.09, and little variation was observed regionally among geologic substrates and forest types, or at the landscape level comparing depositional-floodplain and erosional terra firme landscapes. λ-values less than 2.0 indicate that these forests are subjected to large gaps that reset carbon stocks when they occur. Consistency of λ-values strongly suggests similarity in the mechanisms of canopy failure across a diverse array of lowland forests in southwestern Amazonia.

  7. Tunable transport gap in phosphorene.

    Science.gov (United States)

    Das, Saptarshi; Zhang, Wei; Demarteau, Marcel; Hoffmann, Axel; Dubey, Madan; Roelofs, Andreas

    2014-10-08

    In this article, we experimentally demonstrate that the transport gap of phosphorene can be tuned monotonically from ∼0.3 to ∼1.0 eV when the flake thickness is scaled down from bulk to a single layer. As a consequence, the ON current, the OFF current, and the current ON/OFF ratios of phosphorene field effect transistors (FETs) were found to be significantly impacted by the layer thickness. The transport gap was determined from the transfer characteristics of phosphorene FETs using a robust technique that has not been reported before. The detailed mathematical model is also provided. By scaling the thickness of the gate oxide, we were also able to demonstrate enhanced ambipolar conduction in monolayer and few layer phosphorene FETs. The asymmetry of the electron and the hole current was found to be dependent on the layer thickness that can be explained by dynamic changes of the metal Fermi level with the energy band of phosphorene depending on the layer number. We also extracted the Schottky barrier heights for both the electron and the hole injection as a function of the layer thickness. Finally, we discuss the dependence of field effect hole mobility of phosphorene on temperature and carrier concentration.

  8. Using Unmanned Aerial Vehicles (UAV to Quantify Spatial Gap Patterns in Forests

    Directory of Open Access Journals (Sweden)

    Stephan Getzin

    2014-07-01

    Full Text Available Gap distributions in forests reflect the spatial impact of man-made tree harvesting or naturally-induced patterns of tree death being caused by windthrow, inter-tree competition, disease or senescence. Gap sizes can vary from large (>100 m2 to small (<10 m2, and they may have contrasting spatial patterns, such as being aggregated or regularly distributed. However, very small gaps cannot easily be recorded with conventional aerial or satellite images, which calls for new and cost-effective methodologies of forest monitoring. Here, we used an unmanned aerial vehicle (UAV and very high-resolution images to record the gaps in 10 temperate managed and unmanaged forests in two regions of Germany. All gaps were extracted for 1-ha study plots and subsequently analyzed with spatially-explicit statistics, such as the conventional pair correlation function (PCF, the polygon-based PCF and the mark correlation function. Gap-size frequency was dominated by small gaps of an area <5 m2, which were particularly frequent in unmanaged forests. We found that gap distances showed a variety of patterns. However, the polygon-based PCF was a better descriptor of patterns than the conventional PCF, because it showed randomness or aggregation for cases when the conventional PCF showed small-scale regularity; albeit, the latter was only a mathematical artifact. The mark correlation function revealed that gap areas were in half of the cases negatively correlated and in the other half independent. Negative size correlations may likely be the result of single-tree harvesting or of repeated gap formation, which both lead to nearby small gaps. Here, we emphasize the usefulness of UAV to record forest gaps of a very small size. These small gaps may originate from repeated gap-creating disturbances, and their spatial patterns should be monitored with spatially-explicit statistics at recurring intervals in order to further insights into forest dynamics.

  9. Evaluation of the optimum induction gap for the GEM-MIGAS

    International Nuclear Information System (INIS)

    Mir, J.A.; Rhodes, N.J.; Schooneveld, E.M.; Conceicao, A.S.; Maia, J.M.; Veloso, J.F.C.A.; dos Santos, J.M.F.

    2009-01-01

    A gas electron multiplier with a micro-induction gap amplifying structure (GEM-MIGAS) is formed when a conventional GEM is operated with a short induction gap, typically set at 50 μm. The main aims of this study were to examine the charge amplification in the induction gap of the GEM-MIGAS and then to evaluate the optimum induction gap thickness for achieving the maximum charge amplification in the region. For the present study, the GEM-MIGAS was operated in the gas flow mode using He/iso-C 4 H 10 (85/15%). It was also possible to determine the optimum gap thickness, where the dependence of the charge amplification was least sensitive to the small variations of the gap thickness and to the ambient variables, such as pressure and temperature. This was accomplished by setting the voltage across the GEM-holes to a small value as to allow the transfer of electrons from the drift region into the induction region, without incurring multiplication within the holes. Through parametric curve fitting of the charge gain-induction gap voltage characteristics, the optimum induction gap for sustaining highest charge gains was evaluated and compared with trends observed using a conventional Micromegas.

  10. Tudor staphylococcal nuclease is a structure-specific ribonuclease that degrades RNA at unstructured regions during microRNA decay.

    Science.gov (United States)

    Li, Chia-Lung; Yang, Wei-Zen; Shi, Zhonghao; Yuan, Hanna S

    2018-02-13

    Tudor staphylococcal nuclease (TSN) is an evolutionarily conserved ribonuclease in eukaryotes that is composed of five staphylococcal nuclease-like domains (SN1 to SN5) and a Tudor domain. TSN degrades hyper-edited double-stranded RNA, including primary miRNA precursors containing multiple I-U and U-I pairs, and mature miRNA during miRNA decay. However, how TSN binds and degrades its RNA substrates remains unclear. Here, we show that the C. elegans TSN (cTSN) is a monomeric Ca 2+ -dependent ribonuclease, cleaving RNA chains at the 5'-side of the phosphodiester linkage to produce degraded fragments with 5'-hydroxyl and 3'-phosphate ends. cTSN degrades single-stranded RNA and double-stranded RNA containing mismatched base pairs, but is not restricted to those containing multiple I-U and U-I pairs. cTSN has at least two catalytic active sites located in the SN1 and SN3 domains, since mutations of the putative Ca 2+ -binding residues in these two domains strongly impaired its ribonuclease activity. We further show by small-angle X-ray scattering that rice osTSN has a flexible two-lobed structure with open to closed conformations, indicating that TSN may change its conformation upon RNA binding. We conclude that TSN is a structure-specific ribonuclease targeting not only single-stranded RNA, but also unstructured regions of double-stranded RNA. This study provides the molecular basis for how TSN cooperates with RNA editing to eliminate duplex RNA in cell defense, and how TSN selects and degrades RNA during microRNA decay. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Decreased anion gap in polyclonal hypergammaglobulinemia.

    Science.gov (United States)

    Qujeq, Durdi; Mohiti, Javad

    2002-02-01

    The anion gap has proved a valuable tool in the diagnosis of various forms of acid-base disorders, although the importance of slight rises in the anion gap remains unclear. The concept of the anion gap is often misunderstood and misapplied. The relationship between gammaglobulins and the serum anion gap has not received much attention except for reports of a narrowing of the gap associated with certain monoclonal immunoglobulin G gammopathies. We present patients with polyclonal gammopathy, the magnitude of which correlated strongly and negatively with the anion gap. The anion gap can be readily calculated from routine laboratory data, and anion gap was calculated as ([Na] +[K])- ([Cl] + [HCO3]). Serum anion gaps were determined in 206 patients with polyclonal hypergammaglobulinemia and 63 healthy subjects. Serum sodium and potassium ions concentration were determined by flame photometry. Serum bicarbonate level was measured as total carbon dioxide content. Serum chloride level was determined by chlorimetric titration with silver ions. All patients with polyclonal hypergammaglobulinemia had a statistically significant reduction in their mean serum anion gaps (6.4 +/- 1.2 mmol/L) when compared with normal control volunteers (15.3 +/- 2.4 mmol/L), p anion gap and gammaglobulins concentration.

  12. Electronic properties of doped gapped graphene

    Energy Technology Data Exchange (ETDEWEB)

    Mousavi, Hamze, E-mail: hamze.mousavi@gmail.com [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of); Nano Science and Nano Technology Research Center, Razi University, Kermanshah (Iran, Islamic Republic of)

    2013-04-01

    One of the carbon atoms in each Bravais lattice unit cell of pristine graphene plane is substituted by a foreign atom leading to a band gap in the density of states of the system. Then, the gapped graphene is randomly doped by another impurity. The density of states, electronic heat capacity and electrical conductivity of the gapped and doped gapped graphene are investigated within random tight-binding Hamiltonian model and Green's function formalism. The results show that by presence of impurities in the gapped graphene the band gap moves towards lower (higher) values of energy when dopants act as acceptors (donors). The heat capacity decreases (increases) before (after) the Schottky anomaly as well. It is also found that the electrical conductivity of the doped gapped graphene reduces on all ranges of temperature.

  13. Denmark and the gap year

    DEFF Research Database (Denmark)

    Katznelson, Noemi; Juul, Tilde Mette

    2013-01-01

    This paper describes three different educational offers to young people: “The Folk High School”, “The ‘After-school’” and 10th class. All can be considered optional Gap Years. The following diagram shows how the Danish education system is structured. The Folk High School is a training course...... of varying duration (approximately between 12 weeks and 1 year) where one lives at the school. It is primarily located after 12 school year. The ‘After-school’ is a special school structure, were the students also live at the school during their 8th, 9th, or 10th years of primary school. 10th Class...... is a voluntary school year extension of primary school. All three types of schools will be described in more detail in this paper....

  14. Spark gap produced plasma diagnostics

    International Nuclear Information System (INIS)

    Chang, H.Y.

    1990-01-01

    A Spark Gap (Applied voltage : 2-8KV, Capacitor : 4 Micro F. Dia of the tube : 1 inch, Electrode distance : .3 ∼.5 inch) was made to generate a small size dynamic plasma. To measure the plasma density and temperature as a function of time and position, we installed and have been installing four detection systems - Mach-Zehnder type Interferometer for the plasma refractivity, Expansion speed detector using two He-Ne laser beams, Image Processing using Lens and A Optical-Fiber Array for Pointwise Radiation Sensing, Faraday Rotation of a Optical Fiber to measure the azimuthal component of B-field generated by the plasma drift. These systems was used for the wire explosion diagnostics, and can be used for the Laser driven plasma also

  15. Photonic band gap structure simulator

    Science.gov (United States)

    Chen, Chiping; Shapiro, Michael A.; Smirnova, Evgenya I.; Temkin, Richard J.; Sirigiri, Jagadishwar R.

    2006-10-03

    A system and method for designing photonic band gap structures. The system and method provide a user with the capability to produce a model of a two-dimensional array of conductors corresponding to a unit cell. The model involves a linear equation. Boundary conditions representative of conditions at the boundary of the unit cell are applied to a solution of the Helmholtz equation defined for the unit cell. The linear equation can be approximated by a Hermitian matrix. An eigenvalue of the Helmholtz equation is calculated. One computation approach involves calculating finite differences. The model can include a symmetry element, such as a center of inversion, a rotation axis, and a mirror plane. A graphical user interface is provided for the user's convenience. A display is provided to display to a user the calculated eigenvalue, corresponding to a photonic energy level in the Brilloin zone of the unit cell.

  16. Shell gap reduction in neutron-rich N=17 nuclei

    International Nuclear Information System (INIS)

    Obertelli, A.; Gillibert, A.; Alamanos, N.; Alvarez, M.; Auger, F.; Dayras, R.; Drouart, A.; France, G. de; Jurado, B.; Keeley, N.; Lapoux, V.; Mittig, W.; Mougeot, X.; Nalpas, L.; Pakou, A.; Patronis, N.; Pollacco, E.C.; Rejmund, F.; Rejmund, M.; Roussel-Chomaz, P.; Savajols, H.; Skaza, F.; Theisen, Ch.

    2006-01-01

    The spectroscopy of 27 Ne has been investigated through the one-neutron transfer reaction 26 Ne(d,p) 27 Ne in inverse kinematics at 9.7 MeV/nucleon. The results strongly support the existence of a low-lying negative parity state in 27 Ne, which is a signature of a reduced sd-fp shell gap in the N=16 neutron-rich region, at variance with stable nuclei

  17. Computer Simulation of the Solidification Process Including Air Gap Formation

    Directory of Open Access Journals (Sweden)

    Skrzypczak T.

    2017-12-01

    Full Text Available The paper presents an approach of numerical modelling of alloy solidification in permanent mold and transient heat transport between the casting and the mold in two-dimensional space. The gap of time-dependent width called "air gap", filled with heat conducting gaseous medium is included in the model. The coefficient of thermal conductivity of the gas filling the space between the casting and the mold is small enough to introduce significant thermal resistance into the heat transport process. The mathematical model of heat transport is based on the partial differential equation of heat conduction written independently for the solidifying region and the mold. Appropriate solidification model based on the latent heat of solidification is also included in the mathematical description. These equations are supplemented by appropriate initial and boundary conditions. The formation process of air gap depends on the thermal deformations of the mold and the casting. The numerical model is based on the finite element method (FEM with independent spatial discretization of interacting regions. It results in multi-mesh problem because the considered regions are disconnected.

  18. Study of gap conductance model for thermo mechanical fully coupled finite element model

    International Nuclear Information System (INIS)

    Kim, Hyo Cha; Yang, Yong Sik; Kim, Dae Ho; Bang, Je Geon; Kim, Sun Ki; Koo, Yang Hyun

    2012-01-01

    A light water reactor (LWR) fuel rod consists of zirconium alloy cladding and uranium dioxide pellets, with a slight gap between them. Therefore, the mechanical integrity of zirconium alloy cladding is the most critical issue, as it is an important barrier for fission products released into the environment. To evaluate the stress and strain of the cladding during operation, fuel performance codes with a one-dimensional (1D) approach have been reported since the 1970s. However, it is difficult for a 1D model to simulate the stress and strain of the cladding accurately owing to a lack of degree of freedom. A LWR fuel performance code should include thermo-mechanical coupled model owing to the existence of the fuel-cladding gap. Generally, the gap that is filled with helium gas results in temperature drop along radius direction. The gap conductance that determines temperature gradient within the gap is very sensitive to gap thickness. For instance, once the gap size increases up to several microns in certain region, difference of surface temperatures increases up to 100 Kelvin. Therefore, iterative thermo-mechanical coupled analysis is required to solve temperature distribution throughout pellet and cladding. Consequently, the Finite Element (FE) module, which can simulate a higher degree of freedom numerically, is an indispensable requirement to understand the thermomechanical behavior of cladding. FRAPCON-3, which is reliable performance code, has iterative loop for thermo-mechanical coupled calculation to solve 1D gap conductance model. In FEMAXI-III, 1D thermal analysis module and FE module for stress-strain analysis were separated. 1D thermal module includes iterative analysis between them. DIONISIO code focused on thermal contact model as function of surface roughness and contact pressure when the gap is closed. In previous works, gap conductance model has been developed only for 1D model or hybrid model (1D and FE). To simulate temperature, stress and strain

  19. The Adaptation Gap Report. Towards Global Assessment

    DEFF Research Database (Denmark)

    2017-01-01

    of the temperature goal. The 2017 Adaptation Gap Report, which is the third global Adaptation Gap Report by UN Environment – prepared in collaboration with the Global Centre of Excellence on Climate Adaptation – focuses on one of the key questions arising in the wake of the global goal: What are the ways forward...... Change (UNFCCC) to prepare for the implementation of the Paris Agreement. In contrast to previous Adaptation Gap Reports, the 2017 report focuses on issues relating to frameworks, comprising concepts, methodologies and data, rather than on assessing a particular dimension of the adaptation gap. Future...... Adaptation Gap Reports will return to assessments of specific adaptation gaps. An international team of experts, assessing the latest literature and practical experience within the topic area, has prepared the report. The process has been overseen by a steering committee, and all chapters have undergone...

  20. The early career gender wage gap

    OpenAIRE

    Sami Napari

    2006-01-01

    In Finland the gender wage gap increases significantly during the first 10 years after labor market entry accounting most of the life-time increase in the gender wage gap. This paper focuses on the early career gender wage differences among university graduates and considers several explanations for the gender wage gap based on the human capital theory, job mobility and labor market segregation. Gender differences in the accumulation of experience and in the type of education explain about 16...

  1. 30 CFR 56.6603 - Air gap.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Air gap. 56.6603 Section 56.6603 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Extraneous Electricity § 56.6603 Air gap. At least a 15-foot air gap...

  2. PBX 9502 air-gap tests

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, Peter [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Novak, Alan M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Timothy J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Campbell, Christopher Charles [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-06-29

    A small number of simple air-gap tests were performed on 1-inch diameter PBX 9502 cylinders to determine an approximate threshold for detonation failure. The primary diagnostics were streak imaging and dent measurements in a steel witness plate. Relight was found to occur, with negligible excess transit time, for air gaps up to 1 mm. Relight did not occur with a 3-mm air gap.

  3. The gender wage gap in four countries

    OpenAIRE

    Daly, Anne; Kawaguchi, Akira; Meng, Xin; Mumford, Karen

    2006-01-01

    In a series of studies written during the 1980s Bob Gregory and his co-authors compared the gender wage gap in Australia with that found in other countries. They found it was not the difference in human capital endowments that explained different gender wage gaps but rather the rewards for these endowments. They concluded that country-specific factors, especially the institutional environment, were important in explaining the gender wage gap. This study updates Gregory's work by comparing the...

  4. Abrupt onset of a second energy gap at the superconducting transition of underdoped Bi2212

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Zahid; Lee, W.S.; Vishik, I.M.; Tanaka, K.; Lu, D.H.; Sasagawa, T.; Nagaosa, N.; Devereaux, T.P.; Hussain, Z.; Shen, Z.-X.

    2007-05-26

    he superconducting gap--an energy scale tied to the superconducting phenomena--opens on the Fermi surface at the superconducting transition temperature (Tc) in conventional BCS superconductors. In underdoped high-Tc superconducting copper oxides, a pseudogap (whose relation to the superconducting gap remains a mystery) develops well above Tc (refs 1, 2). Whether the pseudogap is a distinct phenomenon or the incoherent continuation of the superconducting gap above Tc is one of the central questions in high-Tc research3, 4, 5, 6, 7, 8. Although some experimental evidence suggests that the two gaps are distinct9, 10, 11, 12, 13, 14, 15, 16, 17, 18, this issue is still under intense debate. A crucial piece of evidence to firmly establish this two-gap picture is still missing: a direct and unambiguous observation of a single-particle gap tied to the superconducting transition as function of temperature. Here we report the discovery of such an energy gap in underdoped Bi2Sr2CaCu2O8+delta in the momentum space region overlooked in previous measurements. Near the diagonal of Cu?O bond direction (nodal direction), we found a gap that opens at Tc and has a canonical (BCS-like) temperature dependence accompanied by the appearance of the so-called Bogoliubov quasi-particles, a classical signature of superconductivity. This is in sharp contrast to the pseudogap near the Cu?O bond direction (antinodal region) measured in earlier experiments19, 20, 21.

  5. Fuel temperature prediction using a variable bypass gap size in the prismatic VHTR

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sung Nam, E-mail: snlee@kaeri.re.kr; Tak, Nam-il; Kim, Min Hwan

    2016-04-15

    Highlights: • The bypass flow of the prismatic very high temperature reactor is analyzed. • The bypass gap sizes are calculated considering the effect of the neutron fluences and thermal expansion. • The fuel hot spot temperature and temperature profiles are calculated using the variable gap size. • The BOC, MOC and EOC condition at the cycle 07 and 14 are applied. - Abstract: The temperature gradient and hot spot temperatures were calculated in the prismatic very high temperature reactor as a function of the variable bypass gap size. Many previous studies have predicted the temperature of the reactor core based on a fixed bypass gap size. The graphite matrix of the assemblies in the reactor core undergoes a dimensional change during the operation due to thermal expansion and neutron fluence. The expansion and shrinkage of the bypass gaps change the coolant flow fractions into the coolant channels, the control rod holes, and the bypass gaps. Therefore, the temperature of the assemblies may differ compared to those for the fixed bypass gap case. The temperature gradient and the hot spot temperatures are important for the design of reactor structures to ensure their safety and efficiency. In the present study, the temperature variation of the PMR200 is studied at the beginning (BOC), middle (MOC), and end (EOC) of cycles 07 and 14. CORONA code which has been developed in KAERI is applied to solve the thermal-hydraulics of the reactor core of the PMR200. CORONA solves a fluid region using a one-dimensional formulation and a solid region using a three-dimensional formulation to enhance the computational speed and still obtain a reasonable accuracy. The maximum temperatures in the fuel assemblies using the variable bypass gaps did not differ much from the corresponding temperatures using the fixed bypass gaps. However, the maximum temperatures in the reflector assemblies using the variable bypass gaps differ significantly from the corresponding temperatures

  6. Fuel temperature prediction using a variable bypass gap size in the prismatic VHTR

    International Nuclear Information System (INIS)

    Lee, Sung Nam; Tak, Nam-il; Kim, Min Hwan

    2016-01-01

    Highlights: • The bypass flow of the prismatic very high temperature reactor is analyzed. • The bypass gap sizes are calculated considering the effect of the neutron fluences and thermal expansion. • The fuel hot spot temperature and temperature profiles are calculated using the variable gap size. • The BOC, MOC and EOC condition at the cycle 07 and 14 are applied. - Abstract: The temperature gradient and hot spot temperatures were calculated in the prismatic very high temperature reactor as a function of the variable bypass gap size. Many previous studies have predicted the temperature of the reactor core based on a fixed bypass gap size. The graphite matrix of the assemblies in the reactor core undergoes a dimensional change during the operation due to thermal expansion and neutron fluence. The expansion and shrinkage of the bypass gaps change the coolant flow fractions into the coolant channels, the control rod holes, and the bypass gaps. Therefore, the temperature of the assemblies may differ compared to those for the fixed bypass gap case. The temperature gradient and the hot spot temperatures are important for the design of reactor structures to ensure their safety and efficiency. In the present study, the temperature variation of the PMR200 is studied at the beginning (BOC), middle (MOC), and end (EOC) of cycles 07 and 14. CORONA code which has been developed in KAERI is applied to solve the thermal-hydraulics of the reactor core of the PMR200. CORONA solves a fluid region using a one-dimensional formulation and a solid region using a three-dimensional formulation to enhance the computational speed and still obtain a reasonable accuracy. The maximum temperatures in the fuel assemblies using the variable bypass gaps did not differ much from the corresponding temperatures using the fixed bypass gaps. However, the maximum temperatures in the reflector assemblies using the variable bypass gaps differ significantly from the corresponding temperatures

  7. Targeted functional imaging of estrogen receptors with 99mTc-GAP-EDL

    International Nuclear Information System (INIS)

    Takahashi, Nobukazu; Yang, David J.; Kohanim, Saady; Oh, Chang-Sok; Yu, Dong-Fang; Azhdarinia, Ali; Kurihara, Hiroaki; Kim, E.E.; Zhang, Xiaochun; Chang, Joe Y.

    2007-01-01

    To evaluate the feasibility of using 99m Tc-glutamate peptide-estradiol in functional imaging of estrogen receptor-positive [ER(+)] diseases. 3-Aminoethyl estradiol (EDL) was conjugated to glutamate peptide (GAP) to yield GAP-EDL. Cellular uptake studies of 99m Tc-GAP-EDL were conducted in ER(+) cell lines (MCF-7, 13762 and T47D). To demonstrate whether GAP-EDL increases MAP kinase activation, Western blot analysis of GAP-EDL was performed in 13762 cells. Biodistribution was conducted in nine rats with 13762 breast tumors at 0.5-4 h. Each rat was administered 99m Tc-GAP-EDL. Two animal models (rats and rabbits) were created to ascertain whether tumor uptake of 99m Tc-GAP-EDL was via an ER-mediated process. In the tumor model, breast tumor-bearing rats were pretreated with diethylstilbestrol (DES) 1 h prior to receiving 99m Tc-GAP-EDL. In the endometriosis model, part of the rabbit uterine tissue was dissected and grafted to the peritoneal wall. The rabbit was administered with 99m Tc-GAP-EDL. There was a 10-40% reduction in uptake of 99m Tc-GAP-EDL in cells treated with DES or tamoxifen compared with untreated cells. Western blot analysis showed an ERK1/2 phosphorylation process with GAP-EDL. Biodistribution studies showed that tumor uptake and tumor-to-muscle count density ratio in 99m Tc-GAP-EDL groups were significantly higher than those in 99m Tc-GAP groups at 4 h. Among 99m Tc-GAP-EDL groups, region of interest analysis of images showed that tumor-to muscle ratios were decreased in blocking groups. In the endometriosis model, the grafted uterine tissue could be visualized by 99m Tc-GAP-EDL. Cellular or tumor uptake of 99m Tc-GAP-EDL occurs via an ER-mediated process. 99m Tc-GAP-EDL is a useful agent for imaging functional ER(+) disease. (orig.)

  8. Targeted functional imaging of estrogen receptors with {sup 99m}Tc-GAP-EDL

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Nobukazu; Yang, David J.; Kohanim, Saady; Oh, Chang-Sok; Yu, Dong-Fang; Azhdarinia, Ali; Kurihara, Hiroaki; Kim, E.E. [The University of Texas M.D. Anderson Cancer Center, Division of Diagnostic Imaging, Houston, TX (United States); Zhang, Xiaochun; Chang, Joe Y. [The University of Texas M.D. Anderson Cancer Center, Division of Radiation Oncology, Houston, TX (United States)

    2007-03-15

    To evaluate the feasibility of using {sup 99m}Tc-glutamate peptide-estradiol in functional imaging of estrogen receptor-positive [ER(+)] diseases. 3-Aminoethyl estradiol (EDL) was conjugated to glutamate peptide (GAP) to yield GAP-EDL. Cellular uptake studies of {sup 99m}Tc-GAP-EDL were conducted in ER(+) cell lines (MCF-7, 13762 and T47D). To demonstrate whether GAP-EDL increases MAP kinase activation, Western blot analysis of GAP-EDL was performed in 13762 cells. Biodistribution was conducted in nine rats with 13762 breast tumors at 0.5-4 h. Each rat was administered {sup 99m}Tc-GAP-EDL. Two animal models (rats and rabbits) were created to ascertain whether tumor uptake of {sup 99m}Tc-GAP-EDL was via an ER-mediated process. In the tumor model, breast tumor-bearing rats were pretreated with diethylstilbestrol (DES) 1 h prior to receiving {sup 99m}Tc-GAP-EDL. In the endometriosis model, part of the rabbit uterine tissue was dissected and grafted to the peritoneal wall. The rabbit was administered with {sup 99m}Tc-GAP-EDL. There was a 10-40% reduction in uptake of {sup 99m}Tc-GAP-EDL in cells treated with DES or tamoxifen compared with untreated cells. Western blot analysis showed an ERK1/2 phosphorylation process with GAP-EDL. Biodistribution studies showed that tumor uptake and tumor-to-muscle count density ratio in {sup 99m}Tc-GAP-EDL groups were significantly higher than those in {sup 99m}Tc-GAP groups at 4 h. Among {sup 99m}Tc-GAP-EDL groups, region of interest analysis of images showed that tumor-to muscle ratios were decreased in blocking groups. In the endometriosis model, the grafted uterine tissue could be visualized by {sup 99m}Tc-GAP-EDL. Cellular or tumor uptake of {sup 99m}Tc-GAP-EDL occurs via an ER-mediated process. {sup 99m}Tc-GAP-EDL is a useful agent for imaging functional ER(+) disease. (orig.)

  9. A stretch of polybasic residues mediates Cdc42 GTPase-activating protein (CdGAP) binding to phosphatidylinositol 3,4,5-trisphosphate and regulates its GAP activity.

    Science.gov (United States)

    Karimzadeh, Fereshteh; Primeau, Martin; Mountassif, Driss; Rouiller, Isabelle; Lamarche-Vane, Nathalie

    2012-06-01

    The Rho family of small GTPases are membrane-associated molecular switches involved in the control of a wide range of cellular activities, including cell migration, adhesion, and proliferation. Cdc42 GTPase-activating protein (CdGAP) is a phosphoprotein showing GAP activity toward Rac1 and Cdc42. CdGAP activity is regulated in an adhesion-dependent manner and more recently, we have identified CdGAP as a novel molecular target in signaling and an essential component in the synergistic interaction between TGFβ and Neu/ErbB-2 signaling pathways in breast cancer cells. In this study, we identified a small polybasic region (PBR) preceding the RhoGAP domain that mediates specific binding to negatively charged phosphatidylinositol 3,4,5-trisphosphate (PI(3,4,5)P3). In vitro reconstitution of membrane vesicles loaded with prenylated Rac1 demonstrates that the PBR is required for full activation of CdGAP in the presence of PI(3,4,5)P3. In fibroblast cells, the expression of CdGAP protein mutants lacking an intact PBR shows a significant reduced ability of the protein mutants to induce cell rounding or to mediate negative effects on cell spreading. Furthermore, an intact PBR is required for CdGAP to inactivate Rac1 signaling into cells, whereas it is not essential in an in vitro context. Altogether, these studies reveal that specific interaction between negatively charged phospholipid PI(3,4,5)P3 and the stretch of polybasic residues preceding the RhoGAP domain regulates CdGAP activity in vivo and is required for its cellular functions.

  10. Addressing the vaccine confidence gap.

    Science.gov (United States)

    Larson, Heidi J; Cooper, Louis Z; Eskola, Juhani; Katz, Samuel L; Ratzan, Scott

    2011-08-06

    Vaccines--often lauded as one of the greatest public health interventions--are losing public confidence. Some vaccine experts have referred to this decline in confidence as a crisis. We discuss some of the characteristics of the changing global environment that are contributing to increased public questioning of vaccines, and outline some of the specific determinants of public trust. Public decision making related to vaccine acceptance is neither driven by scientific nor economic evidence alone, but is also driven by a mix of psychological, sociocultural, and political factors, all of which need to be understood and taken into account by policy and other decision makers. Public trust in vaccines is highly variable and building trust depends on understanding perceptions of vaccines and vaccine risks, historical experiences, religious or political affiliations, and socioeconomic status. Although provision of accurate, scientifically based evidence on the risk-benefit ratios of vaccines is crucial, it is not enough to redress the gap between current levels of public confidence in vaccines and levels of trust needed to ensure adequate and sustained vaccine coverage. We call for more research not just on individual determinants of public trust, but on what mix of factors are most likely to sustain public trust. The vaccine community demands rigorous evidence on vaccine efficacy and safety and technical and operational feasibility when introducing a new vaccine, but has been negligent in demanding equally rigorous research to understand the psychological, social, and political factors that affect public trust in vaccines. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Maximizing band gaps in plate structures

    DEFF Research Database (Denmark)

    Halkjær, Søren; Sigmund, Ole; Jensen, Jakob Søndergaard

    2006-01-01

    Band gaps, i.e., frequency ranges in which waves cannot propagate, can be found in elastic structures for which there is a certain periodic modulation of the material properties or structure. In this paper, we maximize the band gap size for bending waves in a Mindlin plate. We analyze an infinite...

  12. Superconducting gap anomaly in heavy fermion systems

    Indian Academy of Sciences (India)

    Within this approximation the equation for the superconducting gap is derived, which depends on the effective position of the energy level of the -electrons relative to the Fermi level. The latter in turn depends on the occupation probability f of the -electrons. The gap equation is solved self-consistently with the equation ...

  13. The Wage Gap and Administrative Salaries Today.

    Science.gov (United States)

    Beyer, Kirk D.

    1992-01-01

    Analysis of national data on college administrator salaries by gender, minority/nonminority status, years of service, and institution type found that wage gaps related to gender and minority status persisted in 1991-92 but that interaction of length of service with other study variables explained a significant amount of this gap. (MSE)

  14. Public Perceptions of the Pay Gap

    Science.gov (United States)

    Hill, Catherine; Silva, Elena

    2005-01-01

    Women have made gains toward closing the gender pay gap during the past two decades. Much of the progress occurred during the 1980s, with smaller gains in the 1990s (Institute for Women's Policy Research 2004). Women's achievements in higher education are partly responsible for narrowing the pay gap in the 1980s and 1990s. As more women earned…

  15. Closing the Gender Gap: Act Now

    Science.gov (United States)

    OECD Publishing (NJ3), 2012

    2012-01-01

    Gender gaps are pervasive in all walks of economic life and imply large losses in terms of foregone productivity and living standards to the individuals concerned and the economy. This new OECD report focuses on how best to close these gender gaps under four broad headings: (1) Gender equality, social norms and public policies; and gender equality…

  16. Estimating Gender Wage Gaps: A Data Update

    Science.gov (United States)

    McDonald, Judith A.; Thornton, Robert J.

    2016-01-01

    In the authors' 2011 "JEE" article, "Estimating Gender Wage Gaps," they described an interesting class project that allowed students to estimate the current gender earnings gap for recent college graduates using data from the National Association of Colleges and Employers (NACE). Unfortunately, since 2012, NACE no longer…

  17. Delaying the Academy: A Gap Year Education

    Science.gov (United States)

    O'Shea, Joseph

    2011-01-01

    This investigation serves as one of the first empirical analyses to examine the international volunteering gap year from an educational perspective, concluding an in-depth case study of a prominent gap year organisation in the UK. Contrary to widespread industry promotion of international development, the findings suggest that the experience can…

  18. 30 CFR 57.6603 - Air gap.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Air gap. 57.6603 Section 57.6603 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives Extraneous Electricity-Surface and Underground § 57.6603 Air gap. At...

  19. Optical response and excitons in gapped graphene

    DEFF Research Database (Denmark)

    Pedersen, Thomas Garm; Jauho, Antti-Pekka; Pedersen, K.

    2009-01-01

    Graphene can be rendered semiconducting via energy gaps introduced in a variety of ways, e.g., coupling to substrates, electrical biasing, or nanostructuring. To describe and compare different realizations of gapped graphene we propose a simple two-band model in which a "mass" term is responsible...

  20. Spectral Gaps in Graphene Antidot Lattices

    DEFF Research Database (Denmark)

    Barbaroux, Jean-Marie; Cornean, Decebal Horia; Stockmeyer, Edgardo

    2017-01-01

    We consider the gap creation problem in an antidot graphene lattice, i.e. a sheet of graphene with periodically distributed obstacles. We prove several spectral results concerning the size of the gap and its dependence on different natural parameters related to the antidot lattice....